PDF Manual
Contents
1. Please highlight sequence s and click Submit 005 866 937 NoV WT RNA1 _L4G1M0C1 00Centered 006 938 1037 NoV WT RNA1_L4G1M0C100Centered 007 1192 1294JNoV WT RNA1_L4G1M0C100Centered 008 1351 1450 NoV WT RNA1_L4G1M0C100Centered 009 1501 1600 NoV WT RNA1_L4G1MOC100Centered Figure 9 RG and UNAFold selected for the three sequences RNASSA 2 0 Manual P 6 of 11 Next check the appropriate check boxes for the different prediction algorithms Finally hit the Submit button to connect to the RNAVLab server and get the prediction results Please note that any submissions of the same sequence name and algorithm will be replaced by the last submission received from the server The right hand side of this table gives the sequence name algorithm used start time and status of being processed with the time ticking It may take a few seconds to display after clicking the Submit button Once the prediction is done the status is changed to Completed with the finish time and predicted structures will be available for viewing in the next tab Bia RNA Secondary Structure Analysis RNASSA File RNA Web Sequences CF bl a Input Sequence Selection Algorithm Selection Visualization Comparison i 4 Mas 4 at Sequence Name 4 Algorithm Start HH MM SS Status 4 Active List WRG WI UNAFoId Submit 006 938 1037 NoV WT RNA1_L4G1M0 RG 15 182. Structure 1 006 938 1037 NoV WT RNA1 L4G1M C1eeCentered RG Structure 2 06 938 1037 NOV WT RNA1_L4G1M C10eCentered UNAFold Structure 1 ii C rii DPE Cs ss EVENS ESE EER OIS AYI e Structure 2 SEK P ibeta ie esa aa NN C s issss rii it Ce Se Erleri TETIT Meler Peel eee PE eee Pipe EEE epi e 1037 Figure 15 Output for predicted structure alignment Additional Functions In addition to the different tabs there are also some additional features within RNASSA from the drop down menus and toolbar icons This includes saving loading options along with the ability to add new or edit records These are located in the menu bar at the top left hand corner of the GUI Under the File menu the Open Ctrl O option 1s to be used with files that are created by RNASSA and not FASTA files see Tab One for importing FASTA files The save and load features allow you to save the predicted secondary structures and reload them into RNASSA after exiting the program There is the option to Save Ctrl S the current work allowing the user to save all sequences in the current Active List along with the information related to the sequences including sequence names and any predictions that were finished by the time of the save Please note that any predictions that are still in process will not be added to the file The Save As Ctrl A option works the same as Save op
3. EF bed as Input Sequence Selection Algorithm Selection Visualization Comparison 7 Select Algorithm Starting at Select Algorithm v Starting at q pre m Figure 11 Visualization Tab with a pair of PseudoViewer windows RNASSA 2 0 Manual P 7 of 11 Once the image is received it will automatically be displayed in the PseudoViewer Two additional buttons become available the first is to save the original image to a PNG file The image displayed has been modified to fit within the viewing area while the saved image 1s in the original size File RNA Web Sequences Er 006 938 1037 NOV WT RNA1_L4G1M0C100Centered ac Cpe a gt n a a Oo 5 o o Mea 5 MN ty so a a gt gt a o Figure 12 Predicted RNA structures displayed The second button Display displays the information Mame mesane WE EEE regarding the sequence 1 e sequence name sequence etc ree eee eco meraya octoacenteree in a new window This information can also be saved in a fecscence text file by clicking on the Save button in the new 1st User Defined Prediction null window 2nd User Defined Prediction null Comments null Comparison Tab On this tab you can compare either sequences or structures and the GOPR Seleleri Rigor n eaa an o o OOO O o agreement percentage along with a list Select Options an
4. N 100 Tue Dec 11 15 0 n4oraane navi lann Tua Mae 44 AFN Figure 6 Sequences added to the Active List RNASSA 2 0 Manual P 5 of 11 i C Users mleung la Documents Caprice BriefCase RNASSA20 a For the Assemble button at least two chunks must be added to the Active List along with their parent sequence tem nas lisli If the parent sequence 1s missing the assembled sequence Mees ae 7 3 ae inverslist No records will end with the last base position of the last chunk Each Cf inverstist_Pavt Nov Minus assembled rnassa chunk is required to be named in a special format with a rere oe 3 are inverslist_SJV1 prefix containing a leading 3 digit chunk number CA imersiist SJV2 followed by its cut point coordinates in interval notation e g 003 a b denotes Chunk 3 starting from a to b oars ma il en inclusive By clicking the Assemble button to perform sequence assembly for a set of chunks a dialog box for saving a RNASSA file will pop up with RNASSA20 as Figure 7 Assembled sequence saved in RNASSA file the default directory The assembled sequence will be written in the file indicated and listed in the Sort List on the left By adding the assembled sequence to the Active List you can view the assembled sequence or its chunks by hitting the Manual Cut Edit button For viewing both the assembled sequence and all the prefixes as sh
5. after a carriage return Clicking the Insert Sequence button will enter the typed text into the Inputted Sequences area above 4 Full List This shows the name of each sequence entered and or loaded into RNASSA The Load FASTA File button will open a dialog box for loading files in the RNASSA20 directory If the FASTA file contains a single sequence the file name will also show up in the RNA Segmentation file box The Sort and Remove Duplicates button will sort the Full List by the sequence names entered and remove any duplicated entries The Clear Highlighted Sequences button will clear the highlighted sequences in the Full List only without deleting them in the file RNASSA 2 0 Manual P 4 of 11 There are two ways to enter sequences to be analyzed The first is typing a name and sequence into the nsert New Sequence area see Figure 4 below and then pressing the Insert Seguence button on the top right hand corner of this area This should be used for entering single sequences or groups of sequences pulled from GenBank The second 1s to load a file of RNA sequences stored in FASTA format similar to loading a document by Word Example of FASTA Format gt Test ACUGUAGCUGAUGCUAGUCGUGCUGAUGAUGUAGCUGAUGUAGUCGAUCGA Insert New Sequence in FASTA format Insert Sequence Note After inserting sequences into the program you Fresi ACUGUAGCUGAUGCUAGUCGUGCUGAUGAUGUAGCUGAUGUAGUCGAUCGA can
6. number and cut point coordinates as described earlier in the Sequence Selection Tab where the same dialog box can be invoked by a similar button on the top of the Active List During manual cutting there are various suggested default values for coordinates according to maximum chunk size provided by the user If one or more chunks are present in the Active List the sequence without prefix is assumed to be the parent sequence By highlighting the parent sequence in the RNA Segmentation dialog box see Figure 22 above the prefixes of all the chunks present in the Active List will be shown in the fields on top of the display pane for the parent sequence see Figure 23 below By default long gaps in assembled sequences will be shortened to simplify the display but can be overridden by selecting the radio button Show Gaps in Full View or Cut RNA Manually Chunk 001 10 109 002 161 260 003 590 689 004 737 836 005 866 937 006 938 1037 007 1192 1291 008 1351 1450 009 1501 1600 010 1647 1746 011 1852 1951 012 1998 2097 013 2516 2615 014 2706 2805 015 2851 2950 016 2951 3000 017 3077 3176 eguence RNA123Seq NoV RNA1 id 0 GUAUUGAAUCCAAAACUCAAAAUGCUGAACUACGAGACAAUCAUCAACGGCGCAUCGAGCGCUCUGAACAUCGUUUCGCGUGCGUUAGGAUACCGCGUGC Figure 23 Display of chunk prefixes and their parent sequence By clicking a particular prefix its original coordinates will show up in appropriate entry fields on top for inputtin
7. read only UNAFold Prediction Bracket View ready only 1st User Defined Prediction Bracket View 2nd User Defined Prediction Bracket View ee ee een KR swwonsrastanie cameo Figure 19 Data entries for a new RNA sequence Please note that changing the name or adding just a new prediction does not affect the stored predicted structures but editing the sequence does cause the predictions to be erased Thus if you do not want to keep the original information press the Create New button otherwise use the Replace Old button to replace the old predictions with the new ones To save all information in rnassa file press Done recorded Edit RNA Sequence Sequence Name 001 10 109 NoV WT RNA1_L4G1M0C100Centered Sequence CCAAAACUCAAAAUGCUGAACUACGAGACAAUCAUCAACGGCGCAUCGAGCGCUCUGAACAUCGUU UCGCGUGCGUUAGGAUACCGCGUGCCACUAGCCA Copy Paste Select All UNAFold Prediction Bracket View ready only RG Prediction Bracket View read only ist User Defined Prediction Bracket View 2nd User Defined Prediction Bracket View YK a Figure 21 Editing the RNA seguence data and select Save Ctrl S under the File menu Those seguences stored on the RNAVLab server retain only the sequence names and the sequences while the predictions are not In addition press the right button of the mouse and the Copy and Paste box will pop up anywhere inside a text
8. sort the names of the sequences by pressing the Sort and Remove Duplicates button This sorts all of the sequences by name capital letters and then lower case letters Figure 4 Insert New Sequence area Sequence Selection Tab This tab is divided into two areas The left side of the tab is the Sorted List of all available sequences along with information about each sequence in the varying columns The right side of the tab is the Active List an active playlist of sequences with sequence names only File RNA Web Sequences 20E Active List Add to Active Title Length Date o _RG Prediction UNAFoldPredicti 1st User Defined 2nd User Defined Manual Cut Edit Remove Assemble 001 10 109 NovV 100 Tue Dec 11 15 0 0021161 260JNoV T100 Tue Dec 11 15 0 Selected Sequences for Manual Cut Prediction Assembly or Comparison 003 590 689 NoV 100 Tue Dec 11 15 0 Tue Dec 11 15 0 ue Dec 11 15 0 007 1192 1291 N 100 TueDec11158 o 00811351 1450 N 1100 TueDec11150 100 Tue Dec 11 15 0 010 1647 1746 N 1100 Tue Dec 11 15 0 01111852 19511N 100 Tue Dec 11 15 0 Figure 5 Five sequences selected To add sequences to the Active List highlight one or more sequences in the Sorted List and hit the A
9. 02 Completed 15 18 03 007 1192 1291 NoV WT RNA1_L4G1M RG 15 18 04 Completed 15 18 04 ME NN REESE SCENES AES roe Le 008 1351 1450 NoV WT RNA1_L4G1M RG 15 18 06 Completed 15 18 06 ee ae EE ae Be BM aL utun E 006 938 1037 NoV WT RNA1_L4G1M0 UNAFold 15 18 08 Completed 15 18 08 006 938 1037 NoV WT RNA1_L4G1M0C100Centered 00711 192 1291JNoV WT RNA1_L4G1M t _ UNAFold 15 18 10 o Completed 15 18 10 007 1192 1291 NoV WT RNA1_L4G1M0C100Centered 008 1351 1450 NoV WT RNA1_L4G1M UNAFold comeet 15 18 12 15 18 12 008 1351 1450 NoV WT RNA1_L4G1M0C100Centered Figure 10 Prediction jobs completed Visualization Tab This tab allows for you to view the predicted fold using Pseudo Viewer This tab 1s broken into two identical parts Within each part a large viewing area is available below a drop down list of the different algorithms Upon choosing the desired algorithm in which you have a predicted sequence you can select the sequence by name by looking at the second drop down list After selecting the algorithm an input field following Starting at will pop up allowing you to use any starting number instead of the default value Next press the Submit button to send the request for the PseudoViewer image of the predicted secondary structure of the sequence Bi RNA Secondary Structure Analysis RNASSA Versic File RNA Web Sequences
10. 13 2007 National Institutes of Health Grants SO6GM08012 35 5G12RR008124 11 and 3T 34GM008048 20S1 and National Science Foundation Grant DMS0800272 The original Java codes of RNASSA GUI and user manual were developed and written by Jon Mohl while prediction algorithm modules on the RNAVLab server were implemented by Abel Licon and Leo Saldivar We also thank Reeder and Giegerich 2004 of pknotsRG bibiserv techfak uni bielefeld de pknotsrg and Markham and Zuker 2008 of UNAFold mfold rna albany edu g DINAMelt software for their source codes as well as Byun and Han 2009 of PseudoViewer pseudoviewer inha ac kr for the access Please visit our RNAVLab rnavlab utep edu for more details and updated information
11. RNA Secondary Structure Analysis RNASSA User Manual By RNAV Lab Bioinformatics Program The University of Texas at El Paso Updated December 12 2012 RNASSA 2 0 Manual P 2 of 11 RNASSA 2 0 Overview RNASSA allows users to input RNA sequences either by loading a file in FASTA format or by direct keyboard entries with options to select two prediction algorithms RG and UNAFold Prediction results can then be visualized using PseudoViewer pseudoviewer inha ac kr and compared to other RNA structures The RNASSA Graphical User Interface GUI 1s organized in tabs with different functions with drop down menus and toolbar icons In this major upgrade RNA Segmentation and Sequence Assembly are the two powerful functions added 1n the first two tabs 1 Input Tab is used for loading a FASTA file containing single or multiple RNA sequences For automatic RNA segmentation only one file containing a single sequence is accepted 2 Sequence Selection Tab is for creating a smaller Active List with a selected number of sequences added from the Full List of sequences stored in the software All the sequences in the Active List are used for chunk editing or sequence assembly 3 Algorithm Selection Tab is for submitting selected sequences from the Active List by highlighting them along with the desired algorithm s for RG and or UNAFold predictions at the RNAVLab Ribonucleic Acid Virtual Laboratory A table lists the sequences sent and the
12. area throughout the program Highlight the text you want to copy and select Copy in the box Then move the cursor to the destination highlight the text to be replaced then right click and select Paste You may choose to save the edited sequence in FASTA by clicking the Save As FASTA File button and a file saving dialog box will pop up RNASSA 2 0 Manual P 10 of 11 Using Manual Cut Edit Ctrl M option under the RNA Menu you can perform automatic or manual segmentation For automatic segmentation click the Run Standalone button to launch EANA Se men ames Segmenta 2 0 inside its frame Automatic segmentation is also hoose a Sequence from the Active List available in the Input Tab as an integrated GUI within the Run RNA1Z3SeqiNOV RNA Hc Segmentation area The standalone version however is more Vee Run Yenilen erene seomentaton emi L powerful in directory handling if the R installation on your Run Standalone computer 1s not standard as the default is R2 14 2 for both 32 and 64 bit For manual segmentatlon you may add a single seguence to the Note Automatic segmentation is also avatabie in heeii Ta Active List and click Manual Cut Edit to create chunks based PEN ee YA on user defined cut points Each chunk will be named after the 7 given sequence name with the addition of a unique prefix Manual Cut Edit Figure 22 Create or edit chunks denoting its chunk
13. current status of the process 4 Visualization Tab allows for visualization of the prediction results with options to save the image as a PNG file or to save the details in a text file 5 Comparison Tab is used to compare two structures or sequences in the Active List Users may use RNASSA either by an anonymous login or an account with RNAVLab For more information please visit www rnavlab utep edu In addition RNASSA requires Java version 6 or later running on Windows XP or later Menus and Tabs Upon opening the RNASSA GUL a login pop up will appear This login asks for the RNASSA user name and password these are the registered user name and password from the webpage Upon entering the correct information press Submit and the program will bring you to the first tab Pressing Cancel will bring you into the program without logging in the GUI will ask you to provide user credentials at any point that a sequence is submitted or sequences are requested by the user To use RNASSA anonymously click the checkbox before Check to login as guest and then the Submit button but data will be lost after ma Submit Cancel closing the program Guest login analysis is for 1 time processing whereas the account allows for retrieval of sequences and predictions Lo after logging off Off campus connections to UTEP still require a guest VPN account from UTEP for RNASSA t
14. d Click Submit Comparison Results of comparison statistics To start select Il osences whether you will either compare two 00 1038 os7imov wr rwa1_tacimoctoocentered RG z sequences or two structures Then select the sequences that you would like to compare File RNA Web Sequences Il Sequence Comparison Structure Comparison Comparison Output Display 4 Ill gt Figure 14 Option panel of Alignments Tab RNASSA 2 0 Manual P 8 of 11 Once you hit Submit button the program will align and display the two selected structures as Sequence and Sequence 2 in the panel below with the comparison results in the right panel You can continue analyzing different sequences by selecting the appropriate ones and hitting Submit again Bu RNA Secondary Structure Analysis RNASSA Vers File RNA Web Seguences EF Input Sequence Selection Algorithm Selection Visualization Comparison Select Options and Click Submit Comparison Results 00 Agreement Between S1 and S2 Unpaired Bases in Common Base Pairs in Common Base Pairs in S1 Base Pairs in S2 71 Base Pairs in S1 Also Found in S2 Seguence 1 006 938 1037 NoV WT RNA1_L4G1M0C100Centered RG Sequence 2 006 938 1037 NoV WT RNA1_L4G1M0C100Centered UNAFold 96 Base Pairs in S2 Also Found in S1 Sequence Comparison Structure Comparison Comparison Output Display
15. dd to Active button on top of the Active List Multiple selections can be done by holding down the Ctrl key while clicking one item at a time or the Shift key for a block To remove sequences from the Active List highlight them in the list and hit the Remove button Ea RNA Secondary Structure Analysis RNASSA Ver File RNA Web Sequences EF bed e Seguence Selection Algorithm Selection Visualization Comparison Active List Title de Length Date L RG Prediction UNAFold Predicti 1st User Defined 2nd User Defined Add to Active Manual Cut Edit Remove 001 10 109JNoV 100 Tue Dec 11 15 0 002 161 260 Nov 100 Tue Dec 11 15 0 o OO Selected Sequences for Manual Cut Prediction Assembly or Comparison 003 590 689 NovV 100 Tue Dec 11 15 0 005 866 937JNoV AWT RNA1 L4G1M0C100Centered 0041737 836JNoV 1100 Tue Dec 11 15 0 a 006 938 1037 NoV WT RNA1 L4G1M0C100Centered 005 866 937 NoV 72 Tue Dec 11 15 0 007 1192 1291 NoV WT RNA1_L4G1MO0C100Centered 006 938 1037 No 400 Tue Dec 11150 1 008 1351 1450 NoV WT RNA1_L4G1M0C100Centered 007 1192 1291 N 100 Tue Dec 11 15 0 009 1501 1600 NoV WT RNA1_L4G1M0C100Centered _ 00811351 1450 N 100 Tue Dec 11150 1009 1501 1600 N 100 Tue Dec 11 15 0 010 1647 1746 N 100 Tue Dec 11 15 0 011 1852 1951
16. g cut points and the prefix being edited is shown in red During prefix editing you can always override the suggested default values RNASSA 2 0 Manual P 11 of 11 Using the four buttons at the top right hand corner you can add save insert or delete For cases with over 20 prefixes another set of four buttons will become functional for forward and backward navigation By hitting the Save button a dialog box m 1 mama will appear with options to update only the Full and Active Lists Figure 24 Update lists and save chunks or to save also ina FASTA file see Figure 24 r Confirm saving chunks In addition manual segmentation can also be used for cutting a very long sequence into regions by clicking the radio button for Region on the top of the frame see Figure 23 To distinguish regions from chunks the region number in the prefix begins with the letter R e g RO2 denotes region 2 Future Features in Development The program is being further developed to benefit the user and make more of the RNAVLab functionality available Things that are in process are the ability to identify the type of pseudoknots and to extract sequences and structures from different databases This is not an exhaustive list and suggestions to help make the program easier to use would be greatly appreciated Acknowledgements RNAVLab is supported by the Texas Advanced Research Program Grant 003661 0008 2006 and 003661 00
17. ighted Sequences RNA Find GU pairing _ Report overlaps Find Inversions Inserted and or Loaded Sequences in FASTA and RNASSA Files RNA123Seg NoV RNA1lid 0 _ Min Stem Length 4 to 6 Maximum Gap 0 to 5 Max Stem Length 4 602 Max Mismatches 0 _ to 4 lt Output File NoV WT RNA1_output txt View Parameter File View Output File Maximum Chunk Size C 100 Run Segmentation Inputted Sequences CCATTCCCGCGAAAAGCCGTATTGGTTGACTGTTGGAGGCGCTTGGCCCCAAGATGTCAAGGACGTTGATCTTATGTTCCA TGTGCGGCCGCACGTACCGGAGTAGACCTCGAGACACT TCGGTCTCTGGATCAGCGTCTAGGAGAAATCACTGACGTCT iGGCGGATATTACCATCAACCGGGATAAT GAACCAAACCCCTACAAGGATACACTGGACTT GGAGGGCCCGGCTGATGGC CGGGTGGACGATCGTGTATTTCAGAATGACAAACATGTCAT GCGCT TACGAGCTAATCAAGTCACTTCCAGCCAAGCTGGA GCAGCTGGCTCAGGAGACGCAAGCAACGATCCAAACGCTCATGAT CGCGGAT CCCAACGT CAACAAGGAT CT GCGAGCGT TTCTGCGAGTTCCTGACCGT GCAGCACCAGCGGGCGTATCGAGCGACGAACAGCCTGCTCATCAAACCGCGAGTCGCAGC AGCGCTTCGCGGGGAGGAGCTGGACCT GGGCGAGGCGGACGTCGCCGCCCGGGTCCGCCAGCTAAAACAACAGCTGG ICGGAGCTCGAGATGGAAATCAAGCCAGGGCACCAACAAGT GGCCCAAGTAAGCGGCAGGCGGAAGGCCGCAGCCGCAG CTCCCGTGGCCCAGCTGGGTCGCGTGGGCGTGGTAAATGAGTGATTCATCGTCCCATCTGACGAAACCCGAACTAGGCT TATGCCAGTGGT E Insert New Sequence in FASTA format Insert Sequence Figure 3 Input Tab for loading FASTA files and RNA Segmentation I RNA Segmentation This box is developed from Segmenta Version 2 0 121208 with four buttons fo
18. o access RNAV Lab servers Figure 1 Login dialog box Drop Down Menus and Toolbar Icons Three menus File RNA and Web Sequences and Bis File RNA Web Sequences three icons Load Save and Export are located on the top left hand corner of the main GUI The File pa semen S z m atgonthm s ze Visuaizaton Comparson menu allows users to load or save RNASSA file with U an rnassa file extension while the RNA menu Figure 2 Drop down menus and icons provides alternative ways to enter new edit or delete RNA sequence data with short cuts Ctrl N Ctrl E and Ctrl D respectively The Manual Cut Edit Ctrl M is a manual segmentation utility with powerful editing features to enter user defined cut points for creating or modifying chunks The Web Sequences menu is a powerful feature being developed to load RNA sequences RNASSA 2 0 Manual P 3 of 11 directly from RNAVLab either by Choose One Ctrl C or Get Al Ctrl G The Login Ctrl L option allows you to login in if you have not done so ap Tab a i 1S ee into four areas File RNA Web PEET EF bel a Input Sequence Selection Algorithm Selection Visualization Comparison RNA Segmentation Full List NoV WT RNA1 fasta single sequence only Load FASTA File Sort and Remove Duplicates Clear Highl
19. own in Figure 7 below the assembled sequence must be highlighted in sequence selector of the Run Segmentation dialog box invoked by clicking the Manual Cut Edit button or simply by Ctrl M 5 View or Cut RNA Manually 006 938 1037 007 1192 1291 008 1351 1450 Sequence A 6 938 145 NoV WT RNA1_L4G1MeC1eeCentered UUCGGCGUGUGCGUUAUCAGGACACGUCCCGGCCCGGUUGGAAUUCCAUCGUCUCGACCGGGU Pe a a a a s ee ed 3201 3204 Figure 8 Pop up box showing the assembled sequence and its chunks in the Active List For an assembled sequence gaps are likely to exist but will be skipped 1f their lengths are over 100 to simplify the display Such a long gap is indicated by a tilde in front of the base position number at the beginning of the next line e g 901 at the start and 3201 following 1500 Algorithm Selection Tab This tab is also divided into two areas with the Active List on the left Sequences from the Active List and the desired algorithm s are chosen and then submitted to the RNAVLab server for prediction To select the desired sequence click on it or multiple sequences by holding down the Ctrl or Shift key Bia RNA Secondary Structure Analysis RNA File RNA Web Sequences le Input Seguence Selection Algorithm Selection Visualization Comparison 2 z Sequence Name Algorithm Start HH MM SS Status Active List WRG JUNAFold Submit
20. r automatic segmentation of one long RNA sequence The first input field shows the name of one single sequence FASTA file loaded into RNASSA see 4 below for loading a FASTA file while unsaved inputted sequences and loaded FASTA file with multiple sequences are not accepted A standalone Segmenta 2 0 is also available under Manual Cut Edit of the RNA menu or by pressing Ctrl M After entering necessary parameters inversions can be found by clicking Find Inversions button and user can view the parameter file or the output file by hitting View Parameter File or View Output File respectively Then click Run Segmentation for the GUI version of R to load where you select Source R Code under the File menu Highlight Segmenta20 R with all methods or Segmenta21 R without using Optimized Method for shorter running time and click the file to run the program Output text FASTA and PDF Rplot files will be placed in subdirectory inverslist The FASTA files for chunks after segmentation can be loaded directly back to RNASSA 2 0 for prediction 2 Inputted Sequences This shows the names and sequences either in the loaded FASTA file or of the ones entered in the Insert New Sequence area below it 3 Insert New Sequence in FASTA format This allows for the entry of one or more RNA sequences The correct format requires a gt placed before the name of the sequence followed by the RNA sequence on the next line
21. tion ron A bpseg JJAUACUCUGGUUUCU UU except it allows to place the alm O in a new location with a new file name The L4 De Exit Ctrl X menu option will terminate the program but all unsaved material Figure 16 File menu will be lost Under the RNA menu there are options related to adding a new sequence or ai anaseconday editing a current sequence The New Ctrl N option allows for the creation of 5 e MA Web sequences a new sequence within the program including the addition of predicted structures This is helpful when a structure has been predicted already and you need to enter it into the system Sol Manual Cut Edit Ciri h Delete 004110 109JNoV 100 0021164 260 NoV J100 003 590 689 NoV 100 Figure 17 RNA menu Using the Edit Ctrl E option under the RNA drop down menu allows modification of the name sequence or addition of a prediction to the instance of the RNA First choose the desired RNA and press Submit then edit the information Edit RNA Sequence select the sequence you wish to edit Figure 18 Choose RNA RNASSA 2 0 Manual P 9 of 11 Sequence Name 001 10 109 NoV WT RNA1_L4G1M0C100Centered Sequence CCAAAACUCAAAAUGCUGAACUACGAGACAAU CAUCAACGGCGCAUCGAGCGCUCUGAACAUCGUU UCGCGUGCGUUAGGAUACCGCGUGCCACUAGCCA RG Prediction Bracket View
Download Pdf Manuals
Related Search