Home

Prime Elite v2.0

image

Contents

1. e DO NOT place any liquid directly into the instrument OPERATOR SAFETY All operators of Techne equipment must have available the relevant literature needed to ensure their safety It is Important that only suitably trained personnel operate this equipment in accordance with the instructions contained in this manual and with general safety standards and procedures If the equipment is used in a manner not specified by Bibby Scientific Ltd the protection provided by the equipment to the operator may be impaired All Techne instruments are designed to conform to international safety requirements and are fitted with an over temperature cut out If a safety problem should be encountered switch off the unit at the mains socket and remove the plug from the electricity supply INSTALLATION The instrument should be carried using both hands Never move or carry the instrument when in use or connected to the mains electricity supply 1 All Techne instruments are supplied with a power cable this may be integral or plug in 2 7 Before connecting the instrument to the mains electricity supply check the voltage j against the rating plate located on the back of the unit Please note that the unit must be earthed to ensure proper electrical safety Connect the mains cable to a suitable plug according to the table below 220 240V 50 60Hz 110V 120V 50 60Hz 3 UK ONLY The fused plug supplied with the mains cable is fitted with a 1
2. Asia Bibby Scientific Singapore Prudential Tower Level 26 30 Cecil Street Singapore 049712 Tel 65 6631 2976 Fax 44 0 1785 810405 e mail info bibby scientific com www bibby scientific com 15 PRIME ELITE SPECIFICATION TEMPERATURE Block temperature range 4 C or 20 C below ambient to 100 C Block uniformity lt 0 3 C Temperature accuracy lt 0 2 C Gradient availability Maximum gradient 10 C to 100 C 30 C 16 C with the 384 well block Minimum gradient 1 C Column uniformity with a 10 C gradient lt 0 3 C Pre run sample cooling Yes 4 C Temperature set point adjustment 0 1 C HEATING COOLING RATE Maximum heating rate 5 0 C s Minimum heating rate 0 1 C s Maximum cooling rate 3 0 C s Minimum cooling rate 0 1 C s HEATED LID selectable heated lid temperature 35 to 115 C or off Pre heat lid Yes Warm up time from ambient lt 2 min Over temperature cut out Yes Regulated heated lid pressure Automatic The heated lid is only operational if the block temperature is set above 35 C PROGRAMMING Program interface 5 7 colour VGA LCD touch screen Maximum number of programs stored 1000 Maximum number of stages per program 99 Maximum number of steps per stage 99 Maximum number of cycles per stage 99 Programmable ramp rate Yes 0 1 C s steps Maximum hold time 99h 59m 59s Minimum hold time 1s Gradient calculator Yes Incremented decremented temperature Yes Incremented decrement
3. Beacon Road Stone Staffordshire ST15 OSA E mail service bibby scientific com Phone 44 0 1785 810475 Fax 44 0 1785 810405 In the USA please contact service techneusa com or call 1 609 589 2560 We are continually striving to improve our products and software lf you have any comments and suggestions on how we can do things better please send them to us at technehelp bibby scientific com 64 ADDITIONAL INFORMATION USER MAINTENANCE Before cleaning your unit disconnect it from the power supply The outer case of the Prime Elite may be cleaned with a cloth dipped in water or ethanol hexane or 50 methanol can also be used No part of the case or cover should be immersed in the solvents Do not use aggressive solvents such as acetone or abrasive cleaners The block may be wiped with water ethanol or propan 2 ol and may be decontaminated by wiping with 2 Neutracon or 1 bleach solution Before using any cleaning or decontamination method except those recommended here the responsible person should check with Techne that the proposed method will not damage the equipment FAULT FINDING Note that this equipment should only be dismantled by properly trained personnel Removing the outer cover exposes potentially lethal mains voltages There are no user serviceable parts within this equipment Should you have any problems with your Prime Elite which cannot be easily remedied you should contact your supplier and retu
4. Initial Denaturation Final Extension 94 C 95 C 60 C 72 C 72 C 00 05 00 00 00 30 00 00 40 00 01 00 00 05 00 35 cycles Program Test 1 End time 02 03 2010 14 40 Note lt is not possible to send the program to connected Satellite units from a view screen e Touch Edit to edit the program e Touch Back to return to the Programming Screen Note The temperature log will remain blank until the program has been started If a step has a gradient programmed into it the bar will be shown thicker and indicate the upper and lower temperatures of the gradient range If a step has an incremented or decremented temperature this will be indicated by a white spot next to the temperature If a step has an incremented or decremented time this will be indicated by a white spot next to the time 44 C I 62 5 C IE 72 C 60 Ce 72 C 00 00 40 00 01 00 00 00 40 00 01 00 00 00 40 00 01 00 DELETE This is used to delete an entry First touch the required segment followed by Delete UP AND DOWN ARROWS Use these buttons to scroll through a program SAVE Touch this button to save the program CANCEL Touch this button to cancel changes to the program and return to the Home Screen 45 RUN A PROGRAM From the Home Screen touch one of the shortcuts to run one of the listed programs or touch Run a Program to search and select from other programs and templates saved on the unit Se
5. RT PCR Template Used Last Friday 1 27 PM Keywords 2009 Wheat Lab Create a new keyword With gradient 49 Search the programs by user e Touch Search by User and this will open the list of user names stored on the unit e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the Program selection screen Only the programs with the selected user name saved with them will be listed e To clear the user name search touch Clear User Search Search the programs by keyword and user Sort By cca A Program Keyword Clear User e Touch Search by Keyword and this will open el Search the list of keywords stored on the unit Eated Lid Preheat Li 15 C on Final Ho ld 10 e Select one or more keywords by touching the Used Today 3 42 PIV 00 tas A gt buttons to highlight them Touch again to de 00 05 00 94 select e When all keywords have been selected touch Done to return to the Program selection screen Only the programs with the selected keyword s saved with them will be listed e Touch Search by User and this will open the list of user names saved with previously keyword searched programs e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the Program s
6. Temperature Log from 123456 Program ri 2 Step Template 2 Step Template ema eni pom ser None selecte Jser None selecte Oo Use the up and down arrow buttons to scroll Created Yesterday 1 44 PM Used Today 9 30 AM through the list of saved files rosal asia eee da an capi selected ser None selecte User None selected e Touch Sort By Program Name to list the Created Today 9 30 AM Created Yesterday 1 48 PM programs in order The options are pap Aa o ping Keywords None selected Keywords None selected UserNone Seia gt ped o Program Name ABC ZYX E ted 29 03 2010 emperature Log from rogram Recently Used ABC ZYX 3 Step Template 3 Step Template e Most Used ABC ZYX UserNone selected UserNone selected Created 29 03 2010 Used Today 9 31 AM e User ABC ZYX Search the files by keyword Keywords 2009 Wheat Lab e Touch Search By Keyword and this will open the list of Keywords stored on the unit dano e Select one or more keywords by touching the With gradient buttons to highlight them Touch again to de select e When all keywords have been selected touch Wheat Lab Done to return to the File Manager screen Only the files with the selected keyword s saved with them will be listed e To clear the keyword search touch Clear Keyword Search 56 Search the files by user e Touch Search By User and this will open the list of user names stored on the unit e Select the required user name b
7. memory stick then viewed on a PC using the a BEE Techne Workbench software which can be En nem Nero downloaded free of charge from www techne com e Isa 0 See the directions given in the next section for E Tenperare Log 1235323617720 imporre i Seumen 7 2 Step Template cyclerprogram copying files to a USB memory stick a so My Computer amp ALU 2 cyclerprogram AF ALU 2 steps cyclerprogram s e Copy the files to a PC and open the Workbench ui Fanar software e Use Settings to select the path for the saved files or click on Open to browse for the saved files e Select the required temperature log and click Open Note Since the temperaturelogdata file is a text file it can also be opened in applications such as Excel for further analysis 98 When opening a temperature log file the Temperature Log Monitor screen will be displayed To view the complete temperature log drag the mouse across the screen to scroll through the data points The view will show a graphical representation of the actual temperature changes second by second throughout thermal cycling program Clicking on the Program View button of this screen will display the program that generated the temperature log For further information on using the Techne Workbench software see the separate user manual which can be downloaded from www techne com COPYING FILES Files can either be copied onto the unit for editing or to and from
8. 1986 Proc Natl Acad Sci USA 83 pp 3746 3750 The Oligonucleotide Tm calculator can be found in the Settings module where the user can input the oligonucleotide sequence its concentration in the reaction and the salt concentration of the reaction mix 22 PROGRAMMING TEXT TEMPERATURE AND TIME This section gives instructions for the basic programming of text temperature and time which are required in later sections TEXT ENTRY When giving a name to a program or stage or when entering a keyword or a password a text entry screen will be opened Touch individual characters to create the name Test 1 BR CLR DEL e For words with all upper case letters touch qwertyuiop CAPS e Touch SHIFT if only the first letter is required in spoor caso BBO RAO RDS e For numbers touch 123 xev m e For commonly used symbols touch SYM e Touch the space bar not labelled for spaces between characters e To clear the typed name touch CLR e To delete the last character touch DEL Once the name is complete touch OK TEMPERTURE ENTRY When touching a temperature parameter a temperature entry screen will open There are two forms of temperature entry screen e A simple form for adjusting the temperature of the instrument parameters such as the heated lid and program parameters such as initial denaturation and final extension e An advanced form when programming step temperatures within a cycling stage that includes the options
9. CLR to delete the whole sequence Use the arrow keys to scroll through the sequence Touch OK to return to the calculator screen Enter the primer concentration in the PCR mix Enter the monovalent salt concentration of the PCR mix Touch Calculate to calculate the T of the primer Enter The Oligo Sequence Primer Concentration Enter the concentration of the primer in pM Salt Concentration Enter the salt concentration in mM DNA Base Entry ACGGCAATTGTAATTCGTAC Primer Concentration Enter the concentration of the primer in pM Salt Concentration Enter the salt concentration in mM To check the T of another primer with the same primer and salt concentrations touch Back and enter the new primer sequence Be ie 50mM salt and 0 5 M primer Touch Reset to clear the entries ACGGCAATTGTAATTCGTAC Touch Back to return to the Settings menu 58 94 C Calculate Once all the settings and defaults have been set as required touch Save to save the changes and return to the Home Screen If you do not wish to change any settings touch Cancel to return to the Home Screen 3 CREATE A NEW PROGRAM From the Home Screen touch the Create A New Program button This will open a screen where you can build a program by adding stages and steps and define the temperatures and hold times The function of each of the buttons on this screen is described below NAME THE PROGRAM e Touch this button to give the
10. Ger t auftragen SICHERHEIT DES BEDIENPERSONALS Alle Benutzer von Techne Ger ten m ssen Zugang zu der entsprechenden Literatur haben um ihre Sicherheit zu gew hren Es ist wichtig da diese Ger te nur von entsprechend geschultem Personal betrieben werden das die in dieser Gebrauchsanweisung enthaltenen Ma nahmen und allgemeine Sicherheitsbestimmungen und vorkehrungen beachtet Wenn das Ger t anders eingesetzt wird als vom Hersteller empfohlen kann dies die pers nliche Sicherheit des Anwenders beeintr chtigen Die Ger te von Techne entsprechen den internationalen Sicherheitsbestimmungen und sind mit einem automatischen Ubertemperaturabschalter ausgestattet Wenn ein Sicherheitsproblem auftreten sollte mu das Ger t ausgeschaltet und vom Stromnetz getrennt werden INBETRIEBNAHME Das Ger t mit beiden H nden tragen Das Ger t unter keinen Umst nden transportieren wenn es in Betrieb ist oder w hrend das Ger t noch am Netz angeschlossen ist 1 Alle Ger te von Techne werden mit einem Netzkabel geliefert das entweder eingesteckt wird oder fest mit dem Ger t verbunden ist Vor dem Anschluss bitte kontrollieren ob die Stromversorgung den Angaben auf dem Typenschild auf der Ger ter ckseite entspricht Um die elektrische Sicherheit zu gew hrleisten muss dieses Ger t geerdet werden Schlie en Sie das Netzkabel entsprechend der folgenden Tabelle an einen geeigneten Stecker an Anschluss 220 240V 50 60Hz 110
11. Ltd gewahrleistet dass dieses Ger t vier 4 Jahre lang keine Material oder Herstellungsfehler aufweist wenn es unter normalen Laborbedingungen verwendet wird In einem berechtigten Garantiefall wird Bibby Scientific Ltd alle defekten Komponenten oder das Ger t kostenlos austauschen Diese Garantie gilt nicht wenn der Schaden durch ein Feuer einen Unfall Missbrauch Nachl ssigkeit falsche Einstellungen oder Reparaturen falsche Installation Adaptierung Ver nderung den Einbau nicht zugelassener Teile oder die Reparatur durch nicht autorisiertes Personal verursacht wurde Die Garantie von Bibby Scientific Ltd ist beschr nkt auf die Kosten der Reparatur oder den Austausch des Produkts und schlie t ausdr cklich indirekte und nachfolgende Verluste Sch den Kosten oder Ausgaben aus einschlie lich aber nicht beschr nkt auf Zeit Material und Geldverlust oder den Verlust des Gebrauchs von Gewinn Produktion Einkommen erwarteten Einsparungen und des Firmenwerts Um einen Garantiefall zu melden wenden Sie sich bitte an den Vertriebspartner des Ger ts Diese Garantie gilt zus tzlich zu und nicht anstelle von geltendem Recht Diese Anleitung wurde zur Information der Kunden von Techne erstellt und stellt in keinster Weise eine Gew hrleistung Bedingung oder Darstellung bez glich der Beschreibung Marktg ngigkeit oder Zweckdienlichkeit dieser Ger te oder Bauteile dar Unabh ngig von Beschreibung und Spezifikation en des hier beschri
12. Settings to return to the top of the Program Defaults menu or Back to return to the Settings menu SERVICE SETTINGS The service settings are for the use of authorised service engineers only service engineer s password is required to access these settings GRADIENT CALCULATOR The Gradient Calculator can be used to calculate the temperature for each column of the block for a user specified temperature and gradient range e Touch the target temperature button and enter the required temperature Target Temperature Enter the temperature used for the gradient e Touch OK Temperature Gradient e Touch the gradient button and enter the Enter the temperature gradient used required gradient range followed by OK e Touch OK 90 7 51 2 52 3 53 3 54 3 549 55 5 56 2 56 9 58 1 59 2 59 7 The calculated temperatures for each of the columns of the block will now be displayed Note With the 384 well block the columns are paired as it is not possible to individually control 24 columns Therefore only 12 column temperatures are available across this block 39 OLIGO Ty CALCULATOR The oligo Tm calculator can be used to estimate the T of the PCR primers and help in selecting an appropriate annealing temperature for the thermal cycling program 36 Touch Enter The Oligo Sequence in order to input the sequence of the primer Touch the A C G T buttons to enter the primer sequence Touch DEL to delete the last character Touch
13. de mat riaux et les d penses ou perte d utilisation de profit de production de chiffre d affaires d conomies escompt es ou carts d acquisition En cas de r clamation veuillez prendre contact avec le fournisseur de cet appareil Cette garantie s ajoute vos droits l gaux et n affecte en rien ces derniers Le pr sent manuel a t exclusivement r dig l attention des clients de la marque Techne et rien dans son contenu ne doit tre pris comme une garantie une condition ou une affirmation concernant la description la commercialisation l ad quation un usage particulier de l appareil ou de ses composants Malgr la description et les caract ristiques techniques des appareils donn es dans le manuel de l utilisateur la soci t Techne se r serve le droit d apporter les changements n cessaires l appareil ou tout l ment qui entre dans sa composition SICHERHEITS INFORMATIONEN Lesen Sie diese Anleitung vor Verwendung des Prime Elite bitte sorgf ltig durch ACHTUNG HOHE TEMPERATUREN STELLEN EINE GEFAHRENQUELLE DAR Sie k nnen schwere Brandverletzung verursachen und brennbare Stoffe entz nden Der Benutzer sollt sich mit den m glichen Gefahren vertraut machen e UMSICHTIG VORGEHEN UND SCHUTZHANDSCHUHE TRAGEN e KEINE brennbaren Stoffe in der N he hei er Gegenst nde verwenden e Das Ger t NICHT in der N he entz ndlicher Fl ssigkeiten oder Gase betreiben e Fl ssigkeiten NICHT direkt auf das
14. for introducing an incremented decremented step temperature for example in touchdown PCR or a temperature gradient Simple temperature entry e Enter the temperature by typing in the required value The decimal point can be used for 0 1 C resolution a e To clear the entry press DEL e f an entered temperature is invalid a prompt will indicate the acceptable range e Once the temperature is correct touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required 23 Advanced temperature entry e First ensure the number of cycles for the stage has been set then enter the required hold temperature as described above Note Increase Decrease Per Cycle will be inactive unless the number of cycles set is greater than 1 To increase the step temperature per cycle e For an increase in temperature per cycle touch the button below Increase Per Cycle to turn this function on Next touch the temperature entry button below this A new screen will open which is similar to the simple temperature entry screen The maximum increase in temperature per cycle based on the number of cycles and the temperature limits of the unit will be shown e Enter the required value e Touch DEL to clear the entry e f an entered incremented temperature is invalid a prompt will indicate the acceptable range e Touch OK to accept and return to the previous screen The increase
15. o gases inflamables e NO coloque un l quido directamente en el instrumento SEGURIDAD DEL OPERARIO Todos los usuarios de equipos Techne deben disponer de la informaci n necesaria para asegurar su seguridad De acuerdo con las instrucciones contenidas en este manual y con las normas y procedimientos generales de seguridad es muy importante que s lo personal debidamente capacitado opere estos aparatos De no ser as la protecci n que el equipo le proporciona al usuario puede verse reducida Todos los equipos Techne han sido dise ados para cumplir con los requisitos internacionales de seguridad y traen incorporados un sistema de desconexi n en caso de sobre temperatura En caso de que surgiera un problema de seguridad desconecte el equipo de la red INSTALACI N El instrumento se debe transportar con las dos manos No mueva ni lleve el instrumento cuando se utilice o est conectado al suministro el ctrico principal 1 Todos los instrumentos Techne se suministran con un cable de alimentaci n que puede ser integrado o enchufable Antes de conectar el instrumento al suministro el ctrico compruebe que el voltaje coincida con el indicado en la placa de r gimen situada en la parte trasera de la i unidad El instrumento debe disponer de una toma de tierra para garantizar la seguridad el ctrica adecuada Conecte el cable de alimentaci n a un enchufe adecuado seg n la siguiente tabla Conexi n 220 240V 50 60Hz 110V
16. of creating a program by just changing a few key parameters However it is not possible to save changes to the templates installed on the thermal cycler If the edited program is a template touching Save will open the message box shown opposite e Touch the None button next to New Program Name and enter a name for the edited program e Touch Save As New Program to save the changes The re named program will now be listed in the program list Test 1 Program Options Amplification 35 cycles This Program Is A Template A template is a program which comes installed on the thermal cycler and cannot be changed You can save the changes made to the template Save As New Program Cancel 53 EDITING PASSWORD PROTECTED PROGRAMS If the edited program is password protected This Program Is Locked touching Save will open the message box shown You can save any changes made by entering the password or save the opposite To save the changes elther new program details as a new program with a different name e Touch the None button next to Password and enter the correct password followed by Save Note this will overwrite the existing program or e Touch the None button next to New Program Name and enter a new name for the edited Save As New c ancel program followed by Save as a New Program Program The re named program will now be listed as a separate program in the program list 54 CURRENT STATUS The
17. password The default password is 1234 e Touch OK to enter the Administrator Settings Cancel menu e Touch Cancel to return to the menu without making any changes Remove Passwords rogram Name Search By Search By Select AI e From the Administrator menu touch Remove a ee Remove Passwo Pas SWO rd S Program Program i i 2 Step Template es e Touch the file with the password to be removed Used Today 10 02 PM Program Ice Bucket e Touch Remove Password Keywords None selected Used Never used Program The password will now be removed and the test ae program can be deleted if required eee a elected Used Never used er used Program e Touch Close to return to the menu s None selected 32 Change Administrator Password This allows the administrator to change the default password 1234 e From the Administrator menu touch Change Administrator Password e Touch None entered and enter the new password e Touch the second None entered to confirm the new password Note lt is recommended that the administrator keeps a record of the new password e Touch OK to return to the menu or Cancel to return without making any changes Restore Factory Settings All changes to the instrument defaults and settings can be removed and the unit returned to its factory settings e From the Administrator menu touch Restore Factory Settings e Touch the None button and enter the administrator password e Touch Restor
18. pause with the block held at 4 C Initial and the program will not commence until the unit is Denaturation manually un paused e Touch On Off to toggle between settings Hot Start 95 0 C Initial Denaturation Use this to denature the sample and or activate the enzyme before the thermal cycling program begins 00 05 00 More Settings e Touch On Off to toggle between settings e Touch the time button to set the required hold time e Touch the temperature button to set the required temperature Hot Start This will cause the unit to pause at the set temperature The program will not continue until the unit is manually un paused e Touch On Off to toggle between settings e Touch the temperature button to set the required temperature 34 e Touch More Settings for further program defaults or Back to return to the Settings menu Final Extension Use this to add a final extension step to the Final 00 05 00 Lia Extension program to ensure complete amplification of the products e Touch On Off to toggle between settings nel aek e Touch the time button to set the required hold time e Touch the temperature button to set the required temperature More Settings Final Hold This will hold the block at the set temperature at the end of a program until the user manually stops the unit e Touch On Off to toggle between settings e Touch the temperature button to set the required temperature e Touch More
19. screen format The software is structured into five modules which are accessed from the Home Screen These allow the user to e Run an existing program selecting from Run a program templates or programs saved on the unit 2 Step Template Create a New program Used Yesterday 5 35 PM A 1 3 Step Template n gt e Set instrument and program defaults and Used 14 11 2012 1 D Q ep preferences Includes calculator tools Ice Bucket A 3 Create a new Used 14 11 2012 program i i RT PCR Template e View the current status of connected units cure Version 1 200 01 55 e View and search for files stored on the unit View files TEMPLATE PROGRAMS To help with programming a number of program templates are installed on the unit which are available to copy and edit or can be run directly without changes Details of the installed program templates are given below Instrument and program defaults Parameter 2Step Template 3 Step Template RT PCR Template Pause before program Initial denaturation 72 0 C 01m00s 20 The Ice Bucket and Ligation programs are simple temperature holds with the former having an infinite hold at 4 C and the latter at 15 C In both of these programs the heated lid is switched off and the initial denaturation hot start and final extension functions disabled INCREMENTED DECREMENTED TIME AND TEMPERATURE The software allows the user to either increment or decrement
20. selected button next to Keywords Other keywords that have already created will be listed To create a new keyword touch the Create a new keyword button Type in the keyword and touch OK The new key word will be added to the list To select a keyword touch the button to highlight it Touch it again to de select it More than one keyword can be selected To delete a keyword from the list select the keyword s and touch Delete Touch Done to return to Program Options The keyword s will now appear on the Program Options screen 42 Touch the Program button to return the programming screen Keywords None selected Create a new keyword With gradient O ee Keywords 2009 Wheat Lab Create a new keyword With gradient Wheat Lab Keywords Password Passwords A password can be created to protect the program from being edited and deleted by other users The password will be requested if a user attempts to edit or delete the program e To create a password touch the None button next to Password e Enter the required password then touch OK The password is case sensitive e Touch Cancel to return to Program Options without entering a password e Touch the Program button to return to the Programming screen e To change or remove the password from the Password Required Program Options screen touch the button next Before changing or removing the password from this program please to Pass
21. sicurezza disconnettere l apparecchio dalla rete INSTALLAZIONE Occorre trasportare lo strumento usando entrambe le mani Non spostare n trasportare lo strumento quando in funzione o collegato all alimentazione elettrica di rete 1 Tutti gli strumenti Techne sono forniti con un cavo di alimentazione pu essere integrale o plugin _ Prima di collegare lo strumento all alimentazione elettrica di rete controllare la tensione confrontandola con la targhetta riportante i valori nominali si trova sul retro dell unit Notare che al fine di garantire la corretta sicurezza elettrica occorre che l unit sia messa a terra Collegare il cavo di rete ad una presa idonea secondo la tabella riportata alla pagina successiva Connessione 220 240V 50 60Hz 110V 120V 50 60Hz 3 SOLO REGNO UNITO la spina con fusibile fornita con il cavo di rete dotata di un fusibile da 10 Amp per proteggere lo strumento e l utente Le unit sono stimate funzionare a 100 230V 50 60Hz Collocare l unit su un banco piano idoneo o in una cappa aspirante se necessario assicurandosi che gli sfiati delle prese d aria nella parte inferiore non siano ostruiti 6 Inserire il cavo di rete nella presa che si trova sul retro dello strumento 11 7 Accendere lo strumento per mezzo dell interruttore situato sulla parte anteriore dell unit Cavo di ricambio Qualora occorra sostituire il cavo di rete si dovr utilizzare un cavo di 1mm codic
22. the files to the unit or to the USB memory stick e Touch the upper button to save the file s to the USB memory stick e Touch Cancel to return to the File Manager screen The file s will be saved on the USB memory stick in a folder called FileSystem as a cyclerprogram file To copy files from a USB memory stick e Insert a USB memory stick into the port on the front of the unit A message screen will appear confirming that the USB memory stick has been inserted e Touch Yes to view the programs on the USB memory stick within the File Manager A USB button will be visible in the top right corner indicating that the files are being read from the USB memory stick e Select one or more files for copying by touching the appropriate file button or e Touch Select All to select all files e Touch Copy A message screen will appear giving the option of saving the files to the unit or to the USB memory stick 60 USB flash drive inserted Would you like view any programs or temperature logs on the USB flash drive using the file manager Cancel Save a copy of the file s on the currently inserted USB flash drive Save a copy of the file s on this Prime Elite AAA Cancel Sort By rogram Name ABC Only Programs Search By Search By Select Keyword User lect All Program Copy of GAPDH Keywords wheat gradient User Jayne Never used e Touch the upper button to save the fil
23. the temperature of each column during the gradient stage The temperatures for any particular gradient are calculated from an algorithm stored in the block firmware 21 OLIGONUCLEOTIDE Ty CALCULATOR One of the most important parameters in a PCR is the annealing temperature of the reaction This can be determined theoretically using various software programmes to calculate the melting temperature Tm of the primers The Tm is defined as the temperature at which half the DNA strands are single stranded and half are double stranded when base paired to a complimentary strand Using annealing temperatures that are well below the T of the primers can result in mismatching false priming and may lead to primer dimer artefacts Annealing temperatures that are significantly higher than the primer Tm may result in reduced priming or prevent priming altogether The Prime Elite uses the Nearest Neighbour method for calculating the T of an oligonucleotide The Tm is calculated using the following equation hia AH x 1000 A AS R In C 4 273 15 16 6 x log Na Where APP The sum of the Nearest Neighbour enthalpy changes Kcal mol A Helix initiation correction constant AS The sum of the Nearest Neighbour entropy changes cal K mol R The Gas Constant 1 99 cal K mol C Concentration of the oligo M Na Concentration of monovalent ions M Breslauer K J Frank R Blocker H and Marky L A
24. the time and or temperature of a step within a cycling stage These features are used with applications such as touchdown PCR where the annealing temperature is gradually decreased during the cycling process and long PCR where due to the size of the product long annealing extension times are required and the extension time is increased by 15 to 20s per cycle during the final stages of the reaction GRADIENT The gradient feature of the Prime Elite can be useful in optimising the annealing conditions for primers A gradient can be set around a temperature in any step of a program The set temperature is the temperature in the middle columns of the block and the gradient is the variation at the two extremes of the block the left hand columns being the coolest and the right hand columns the hottest 12345 6 7 8 9101112 00000000000 00000000000 0000000000C0O 2222225522595 999990550500 989889000000 LONNMOOWX gt Lowest Set Highest temperature temperature temperature Gradient The maximum temperature gradient range which can be set is 30 C and the minimum is 1 C the lowest temperature is 10 C or 20 C below ambient and the hottest temperature is 100 C Examples are given in the table below Lowest temperature Set temperature Highest temperature Gradient C C C C 50 55 60 10 10 25 40 30 80 90 100 20 A gradient calculator is included in the Settings module so the user can obtain an accurate estimation of
25. 0 C y 30 C Se han realizado pruebas para comprobar la interferencia de radiofrecuencia del instrumento el cual cumple la normativa EN61326 GARANT A Bibby Scientific Ltd garantiza que este equipo estar libre de defectos de materiales y mano de obra si se utiliza en condiciones normales de laboratorio durante un per odo de cuatro 4 a os En caso de reclamaci n justificada Bibby Scientific Ltd sustituir cualquier componente defectuoso o cambiar la unidad gratuitamente Esta garant a no es aplicable si los da os han sido ocasionados por incendios accidentes usos inapropiados negligencias ajustes o reparaciones incorrectas as como si se trata de da os ocasionados por la instalaci n adaptaci n modificaci n o incorporaci n en el instrumento de piezas no aprobadas o su reparaci n por personal no autorizado La responsabilidad de Bibby Scientific Ltd se limita al coste de la reparaci n o sustituci n del producto y excluye espec ficamente p rdidas da os costes o gastos indirectos o accidentales incluyendo pero sin estar limitado a ello p rdidas de tiempo materiales y gastos o p rdida de uso beneficios producci n ingresos ahorros previstos u oportunidades comerciales Si desea realizar una reclamaci n p ngase en contacto con el suministrador del equipo Esta garant a complementa y no afecta a sus derechos legales Este manual se ha preparado con una finalidad informativa para los clientes de Techne y nin
26. 0 amp fuse to protect the instrument and the operator 4 The units are rated to operate at 100 230V 50 60Hz 5 Place the unit on a suitable flat bench or in a fume cupboard if required ensuring that the air inlet vents on the underside are free from obstruction 6 Plug the mains cable into the socket on the back of the instrument 7 Switch on the instrument using the switch located on the front of the unit Replacement cable Should the mains lead need replacement a cable of 1mm of harmonized code HO5VV F connected to an IEC320 plug should be used IF IN DOUBT CONSULT A QUALIFIED ELECTRICIAN ENVIRONMENTAL CONDITIONS The Prime Elite is designed operate under the following conditions Indoor use Ambient temperature range 5 C to 40 C Altitude to 2000m Relative humidity not exceeding 80 Mains supply fluctuations not exceeding 10 Over voltage category Il IEC 60364 4 443 Pollution degree 2 Note The control specifications are quoted at an ambient temperature of 20 C The specification may deteriorate outside an ambient temperature of between 10 C and 30 C The instrument has been tested for radio frequency interference and is certified under EN61326 WARRANTY Bibby Scientific Ltd warrants this instrument to be free from defects in material and workmanship when used under normal laboratory conditions for four 4 years In the event of a justified claim Bibby Scientific Ltd will replace any defective component or
27. 120V 50 60Hz Toma de tierra Verde amarillo J S LO PARA EL REINO UNIDO El enchufe suministrado con el cable de alimentaci n incluye un fusible de 10 amperios para ofrecer protecci n al instrumento y al usuario Las unidades se clasifican para funcionar en 100 230V 50 60Hz Sit e la unidad sobre una mesa plana o en una campana de laboratorio si es necesario y aseg rese de que los orificios de ventilaci n situados en la parte inferior no tienen ninguna obstrucci n Conecte el cable de alimentaci n en el enchufe situado en la parte trasera del instrumento Encienda el instrumento usando el interruptor situado en el frente de la unidad 13 Cable de repuesto Si es necesario sustituir el cable de alimentaci n se debe utilizar un cable de 1mm de c digo armonizado HO5VV conectado a un enchufe IEC320 EN CASO DE DUDA PONGASE EN CONTACTO CON UN ELECTRICISTA CONDICIONES AMBIENTALES El Prime Elite est dise ado para utilizarse en las condiciones siguientes Uso en interior Intervalo de temperatura ambiente 5 C a 40 C Altitud hasta 2000 m Humedad relativa no superior al 80 Fluctuaciones del suministro el ctrico no superiores al 10 Categoria de sobrevoltaje Il IEC 60364 4 443 Nivel de contaminaci n 2 Nota Las especificaciones de control corresponden a una temperatura ambiental de 20 C Las especificaciones pueden empeorar si se utiliza el instrumento fuera del intervalo de temperatura comprendido entre 1
28. 25 The temperature value will now appear orange in en the programming screen indicating that it contains a i _ modified function Note lt is not possible to both increase and decrease the temperature of the same step To enter a temperature gradient on a step e Touch the button below Temperature Gradient to turn this function on Next touch the temperature entry button below this A new screen will open which is similar to the simple temperature entry screen The maximum temperature gradient based on the set hold De Gradient temperature and the temperature limits of the unit Maximum gradient is 30 0 C will be shown e Enter the required value e Touch DEL to clear the entry e f an entered gradient temperature is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The temperature gradient for the step will now be displayed e Touch OK again to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required 26 Settings The temperature value will now appear orange in the programming screen indicating that it contains a modified function TIME ENTRY Insert a new step When touching a time parameter a time entry screen will open There are two forms of time entry screen e A simple form for adjusting the time of the program parameters such as initial denaturation and final extension e An advanced
29. 27 e Enter the required value using the and Minutes buttons e lf an entered incremented time is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The increase in hold time per cycle will now be displayed e Touch OK again to return to the programming screen Increase Per Cycle Decrease Per Cycle e Touch Cancel to return to the programming screen if no changes are required BCE The time value will now appear orange in the programming screen indicating that it contains a modified function 28 To decrease the step hold time per cycle Minutes e For a decrease in hold time per cycle touch the button below Decrease Per Cycle to turn this function on Next touch the time entry button below this Increase Per Cycle Decrease Per Cycle e 00 00 00 00 00 00 A new screen will open which is similar to the simple time entry screen The maximum decrease in hold time per cycle based on the number of n 7 lana ecrease Per Cycle cycles and the time limits of the unit will be shown Maximum decrease per cycle is 00 00 08 e Enter the required value ja e f an entered decremented time is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The decrease in hold time per cycle will now be displayed e Touch OK again to return to the programming screen screen if no changes are required Increase Per Cyc
30. A Prime Elite OPERATOR S MANUAL Bibby Scientific ET Part code ELITE M1 CONTENTS INTRODUCTION BEFORE USE Unpacking SAFETY INFORMATION English Francais Deutsch Italiano Espa ol CONTACT INFORMATION Prime Elite SPECIFICATION INSTALLATION GENERAL SOFTWARE FEATURES Introduction Template programs Incremented decremented time and temperature Gradient Oligonucleotide Tm calculator PROGRAMMING TEXT TEMPERATURE AND TIME Text entry Temperature entry Time entry INSTRUMENT SETTINGS AND DEFAULTS User preferences Instrument settings Program defaults Service settings Gradient calculator Oligonucleotide Tm calculator CREATE A NEW PROGRAM Name the program Insert delete a stage Insert delete a step Insert delete a pause Program options Settings View Delete Up and down arrows Save Cancel RUN A PROGRAM Running a program from the shortcut list The pre run screen The run screen Searching for a program not in the shortcut list Running a program not on the shortcut list EDITING A PROGRAM Editing saved programs Editing templates Editing password protected programs CURRENT STATUS VIEW FILES File searching Viewing a program file Viewing a temperature log file Copying files Deleting files UPDATING THE Prime Elite SOFTWARE FAQs TECHNICAL SUPPORT AND SERVICING ADDITIONAL INFORMATION User Maintenance Fault Finding Fuses Insulation Testing REPLACEMENT PARTS DECLARATION
31. Current Status area of the Home Screen provides status information on the Prime Elite and any connected Satellite units On the Home Screen the Current status area shows the versions of software and firmware loaded on the unit e Touch the Current status button to view the status of the Prime Elite and any connected units The Prime Elite and any satellite units connected to it will be listed The ID shows the serial number of the unit in brackets and for Satellite units the ID number allocated in square brackets If a unit is running a program as shown by the status the Run Screen can be viewed Runs can then be paused or stopped as required e Touch the area to select the required unit e Touch View e Touch Cancel to return to the Home Screen Reset Satellite IDs When first connected a Satellite unit is allocated an ID number by the Prime Elite The ID numbers can be reset following the instructions given below e Remove the USB cables from the rear of the Satellite units e Touch Reset Satellite IDs e During the next 120 seconds re insert the USB cables in the order you wish the Satellite IDs to occur e When done touch OK ra Run a program 2 Step Template Used Yesterday 5 35 PM n 1 3 Step Template Used 14 11 2012 ice Bucket Create a new Used 14 11 2012 program RT PCR Template Never used Current status Version 1200 01 55 Settings View files Current status Reset Sat
32. OF CONFORMITY 48 49 51 53 53 53 54 55 56 56 58 58 59 61 62 63 64 65 65 65 65 65 66 67 INTRODUCTION The Prime Elite is an advanced gradient thermal cycler designed to accurately and rapidly control the temperatures of samples between 4 C or 20C below ambient and 100 C It has many scientific applications including PCR reverse transcription ligation and sequencing It is available in a range of block formats to allow for most commonly used consumables including 0 2ml x 96 well plates and 0 2ml tubes 0 5ml tubes and 384 well plates The heated lid automatically applies the correct pressure to suit the consumable used The Prime Elite is programmed via a 5 7 colour VGA LCD touch screen using simple and intuitive software Programs and run progress can be viewed as a temperature step graphical display allowing the user to readily check the status or position within a run Files can be saved with user names and or keywords which allows for rapid searching and retrieval A USB port on the front of the unit allows transfer of files to and from a USB memory stick and for the easy update of instrument software The thermal block incorporates the very latest in Peltier design featuring the Thermal Energy Recovery System TERS This allows the Prime Elite to achieve ramp rates of up to 5 C s and is also energy saving resulting in reduced running costs The Prime Elite can be used as a stand alone unit or for high throug
33. V 120V 50 60Hz 3 NUR F R GROSSBRITANNIEN der mit dem Netzkabel gelieferte Sicherungsstecker enth lt eine 10 Amp Sicherung zum Schutz des Ger ts und des Anwenders Die MaBeinheiten werden veranschlagen um an 100 230V 50 60Hz zu funktionieren Stellen Sie das Ger t auf einen geeigneten ebenen Tisch oder in einem Abzugsschrank auf und sorgen Sie daf r dass die Lufteinlassschlitze auf der Ger teunterseite nicht blockiert sind Stecken Sie das Netzkabel in die Buchse auf der Ger ter ckseite ein Schalten Sie das Instrument unter Verwendung des Schalters an der auf der Frontseite der Ma einheit gelegen ist Ersatzkabel Bei einem eventuellen Austausch des Netzkabels wird ein Kabel vom Typ HO5VV F mit 1 mm Adernquerschnitt und Europastecker IEC 320 ben tigt IM ZWEIFELSFALL EINEN ELEKTRO FACHMANN HINZUZIEHEN UMWELTBEDINGUNGEN Der Prime Elite ist f r den Einsatz unter folgenden Bedingungen ausgelegt Gebrauch in Innenr umen Umgebungstemperatur zwischen 5 C to 40 C Hohe bis zu 2000 m Relative Feuchte nicht ber 80 Netzspannungsschwankungen nicht ber 10 Uberspannungsklasse 2 IEC 60364 4 443 Verschmutzungsgrad 2 Hinweis Die Ger tespezifikationen beziehen sich auf eine Umgebungstemperatur von 20 C und k nnen sich auBerhalb des Bereichs 10 C bis 30 C verschlechtern Das Ger t wurde auf HF St reinfl sse gepr ft und entspricht den EMV Bedingungen nach EN61326 GARANTIE Bibby Scientific
34. a USB memory stick To copy files to the unit e Select one or more files for copying by touching the appropriate file button Note Multiple file selection is optional and can be set up in the User Preferences section of the Settings Module or e Touch Select All to select all files e Touch Copy A message box will confirm that the files have been copied The copied file s will now be highlighted and listed as Copy of and can be edited as required Temperature Log Monitor 00 11 40 00 11 40 C holding Program PCN Progress 00 11 41 01 07 12 Pause End time Today 15 38 Instrument Rob s Satellite Program View Search By Search By Select A Keyword Select All Program 2 Step Template i Defra 2008 Program of 2 Step Template ds None one selected Used 01 01 0001 Program Program Ice Bucket Ligation 15 C Keywords None Keywords IPCA 3 bidge one selected sed Saturday 6 59 PM Used Last Thursday 6 59 PM Copying Files 1 file copied 99 To copy files to a USB memory stick e Insert a USB memory stick into the port on the front of the unit A message screen will appear confirming that the USB memory stick has been inserted e Touch Cancel to return to the File Manager Screen e Select one or more files for copying by touching the appropriate file button or e Touch Select All to select all files e Touch Copy A message screen will appear giving the option of saving
35. areils Techne sont livr s avec un c ble d alimentation qui peut tre int gr l appareil ou raccorder Avant de raccorder l appareil l alimentation lectrique sur secteur v rifier la tension requise indiqu e sur la plaque d identification situ e au dos de l appareil Il est f important que l appareil soit reli a la terre pour assurer la protection lectrique requise Brancher le c ble secteur sur une prise appropri e voir tableau ci apr s Connexions 220 240 V 50 60 Hz 110 120 V 50 60 Hz 3 ROYAUME UNI SEULEMENT La prise avec fusible int gr fournie avec le c ble secteur est munie d un fusible 10 A destin prot ger l appareil et l utilisateur 4 Les unit s sont valu es pour fonctionner 100 230V 50 60Hz 5 Placer l appareil sur une surface plane ou si n cessaire sous une hotte d aspiration veiller a ce que les trous d a ration situ s sous l appareil ne soient pas obstru s 6 Raccorder le c ble d alimentation la prise situ e l arri re de l appareil 7 Allumer l appareil utilisant le commutateur situ sur l avant de l unit C ble de rechange S il s av re n cessaire de remplacer le cordon d alimentation utiliser un cable de 1 mm conforme a la norme HO5VV F reli a une prise IEC320 EN CAS DE DOUTE CONSULTER UN ELECTRICIEN QUALIFIE CONDITIONS ENVIRONNEMENTALES Le Prime Elite est concu pour fonctionner dans les conditions suivantes Pour un usage int r
36. ause between two previously programmed stages it is necessary to first delete the later stages to where the pause is required PROGRAM OPTIONS e Touch this to view the program defaults as set up in the Settings module Any of these parameters can be edited by touching the appropriate button and will be saved for the current program only e Touch Program to return to the programming screen 40 Temperature Temperature Password Program Options Settings Cancel User User names can be entered and linked to the program to help in searching and identifying programs e To enter a user name touch the None selected button next to User e User names that have already been created will be listed e To create a new user name touch the Create a new user button e Type in the user name and touch OK The new user name will be added to the list e To select a user name touch the button to highlight it Touch it again to de select it e To delete a user name from the list select the user name and touch Delete e Touch Done to return to Program Options The user name will now appear in the Program Options screen e Touch the Program button to return the programming screen User None selected Create a new user Password Program Cancel 41 Keywords Keywords can be entered and linked to the program to help in searching for related programs To enter a keyword touch the None
37. cols such as Touchdown PCR where the first cycle starts with a high annealing temperature and over the number of cycles in the stage there is a gradual decrease in the temperature This ensures that only the specific product is amplified What is a gradient thermal cycler Gradient blocks enable a particular temperature step in a protocol to be programmed so that the temperature varies across the block By specifying a temperature and the gradient to be applied each column will achieve a different temperature The set temperature is in the middle of the block the lowest on the left and the highest on the right The gradient is the total difference across the block for example if the set temperature was 60 C and the gradient 10 C then the temperatures would range from approximately 55 C to 65 C from left to right Why is a temperature gradient required The annealing temperature of the specific primers used in DNA amplification often requires optimisation Instead of running multiple experiments with different annealing temperatures the gradient thermal cycler allows the testing of up to 12 different annealing temperatures simultaneously 63 TECHNICAL SUPPORT AND SERVICING If you require further technical or application assistance please contact Techne at E mail technehelp bibby scientific com Phone 44 0 1785 810433 Fax 44 0 1785 810405 For servicing information please contact Service Department Bibby Scientific Ltd
38. contains semiconductor components which may be damaged by electric field effects 65 REPLACEMENT PARTS The following replacement parts can be obtained from Bibby Scientific Ltd or your Techne distributor Product code HH179 S HH180 S FCABLEUS 6205046 ELITE M1 ELITE 02 B ELITE 05 B ELITE 384 B Description UK 230V mains lead with plug European mains lead with plug US mains lead with plug USB cable Operator s Manual Prime Elite gradient block for 96 x 0 2ml micro tubes or plates Prime Elite gradient block for 60 x 0 5ml micro tubes Prime Elite gradient block for 384 well plates Please note that replacement blocks can only be fitted by a trained service engineer 66 DECLARATION OF CONFORMITY Declaration of Conformity Thermal Cycler Models Prime Prime Prime Elite Prime Elite Satellite These products comply with the requirements of the EU Directies listed below 2004 108 E EMC Directive 2006 95 EC Low voltage Directive LVD Compliance with the requirements of these Directives is daimed by meeting the following standards EN 61326 1 2006 Electrical Equipment for Measurement Control and Laboratory use EN 61010 1 2001 Safety Requirements Electrical Equipment for Measurement Control and Laboratory use EN 61010 2 010 2003 Particular Requirements for Laboratory Equipment for Heating of Materials CE mark affixed 2012 signed Mr Marriott Date e fel n pe Authority Tec
39. e Settings and the unit will be reset to factory defaults e Touch Cancel to return to the Settings menu without making any changes Change Administrator Password To change the administrator password the new password must be entered twice below Cancel Restore Factory Settings The administrator password is required again to restore factory settings to the instrument Restore Settings Cancel 33 PROGRAM DEFAULTS The program default settings will apply to every new program created on the Prime Elite However individual programs can be edited as required Heated Lid Use this to set the heated lid temperature to Heated Lid 105 0 C approximately 10 C higher than the hottest block temperature in the program e Touch On Off to toggle between settings FREE OR off e Touch the temperature button to set the required lid temperature 35 to 115 C Sample Cooling Off Preheat lid Set to On to pre heat the lid to the set temperature More Setti before the thermal cycling program begins go e Touch On Off to toggle between settings Sample Cooling Set to On to cool the block to 4 C while the lid preheats e Touch On Off to toggle between settings e Touch More Settings for further program defaults or Back to return to the Settings menu Pause This will cause the unit to pause before the program starts at the ambient temperature of the block unless Sample Cooling has been set to On in this case the unit will
40. e armonizzato HO5VV F collegato ad una spina IEC 320 IN CASO DI DUBBIO RIVOLGERSI A UN ELETTRICISTA QUALIFICATO CONDIZIONI AMBIENTALI Il Prime Elite stato progettato per funzionare nelle seguenti condizioni uso interno range di temperatura ambiente da 5 C a 40 C altitudine massima 2000 m umidit relativa non superiore all 80 oscillazione dell alimentazione di rete non superiore al 10 categoria di sovratensione Il IEC 60364 4 443 grado di inquinamento 2 Nota le specifiche di controllo sono indicate ad una temperatura ambiente di 20 C Le specifiche potrebbero peggiorare fuori da una temperatura ambiente compresa tra 10 C e 30 C Lo strumento e stato collaudato per interferenze da radiofrequenze ed e certificato secondo la norma EN61 326 GARANZIA Bibby Scientific Ltd garantisce che per un periodo di quattro 4 anni e se utilizzato nelle normal condizioni di laboratorio questo strumento non presenter alcun difetto dei materiali o di fabbricazione In caso di reclamo giustificato Bibby Scientific Ltd sostituir qualsiasi componente difettoso o rimpiazzer l unit in modo gratuito Questa garanzia non si applica ai danni causati da incendio incidenti utilizzo improprio negligenza regolazioni o riparazioni scorrette danni dovuti a installazione non corretta adattamenti modifiche o installazione di parti non approvate oppure riparazioni eseguite da personale non autorizzato La responsabilit di Bibby Scient
41. e s to the Prime Elite unit e Touch Cancel to return to the File Manager screen DELETING FILES Unused or old files can be permanently deleted from the unit or a USB memory stick e Select one or more files for deleting by touching the appropriate file button Note Multiple file selection is optional and can be set up in the User Preferences section of the Settings Module or e Touch Select All to select all files e Touch Delete A message box will appear asking for confirmation of delete e Touch Yes to confirm the delete e Touch Cancel to abort the delete If the delete is confirmed a message box will confirm that the files have been deleted e Touch OK Confirm Delete Are you sure you would like to delete these files Once a file has been deleted it cannot be recovered Cancel Deleting Files 1 file deleted 61 UPDATING THE PRIME ELITE SOFTWARE The Prime Elite software can be updated by downloading the latest version from the Techne website www techne com You will need a USB memory stick on which to save the update Note that the update tool requires at least Windows XP SP2 and the Microsoft Net Framework 3 5 SP1 which if needed can be downloaded from http www microsoft com downloads details aspx familyid AB99342F 5D1A 413D 8319 81DA479AB0D78displaylang en e From the website click on Support followed by RETI Prime Exe Un To PRI Software Downloads Choose a USB me
42. eae B Alu pa 2 step Ala ps 3 step e Search for the required program file and touch it Keywords Alu opt Keywords Alu opt A User Jayne UserJayne to highlig ht It Used 30 03 2010 Used 30 03 2010 Delete Program Program Ice Bucket Ligation 15 C e Touch View to open the temperature profile Keywords None selected Keywords None selected Used 19 04 2010 Never used User None selected UserNone selected Pre run Screen of the program Program Program pBR pBR fast Keywords None selected Keywords None selected User Jayne User Jayne i Used 13 04 2010 Used 13 04 2010 View Program Program RT PCR Template GAPDH Keywords None selected Keywords None selected Close User None selected User Jayne Used Yesterday 1 45 PM Never used nd e Touch Start to start the program Note It is not possible to send a program to a connected Satellite unit from the View screen e Touch Edit to edit the program FrenestLid Denat raton Final Extension 105 C 94c 95 c 6o c 72 c 72 C e Touch Back to return to the previous screen 00 05 00 00 00 30 00 00 40 00 01 00 00 05 00 35 cycles Note The temperature log will remain blank until Alza the program has been started GAPDH ua End time l Today 2 59 PM Back VIEWING A TEMPERATURE LOG FILE It is not possible to view a temperature log file on the Prime Elite It must first be copied to a USB New Program Open Search Delete Library
43. ebenen Ger ts beh lt sich Techne das Recht vor Anderungen an diesem Ger t oder dessen Bauteilen vorzunehmen 10 INFORMAZIONI DI SICUREZZA Leggere attentamente il presente manuale prima di usare il Prime Elite AVVERTENZA Le ALTE TEMPERATURE SONO PERICOLOSE in quanto possono provocare serie ustioni agli operatori e dare fuoco al materiale combustibile Gli utenti devono conoscere i seguenti pericoli potenziali e PRESTARE ATTENZIONE ED INDOSSARE GUANTI PROTETTIVI PER LE MANI e NON usare sostanze combustibili vicino ad oggetti caldi e NON mettere in funzione lo strumento nei pressi di liquidi o gas infiammabili e NON collocare alcun tipo di liquido direttamente nello strumento SICUREZZA DELL OPERATORE Il personale che utilizza l apparecchiatura Techne deve avere a disposizione la documentazione necessaria al fine di assicurare la loro incolumit E importante che solo personale adeguatamente addestrato utilizzi questo apparecchio in conformit alle istruzioni contenute in questo manuale e nel rispetto delle normative e procedure generali di sicurezza Se l apparecchio utilizzato in modo non specificato da Bibby Scientific Ltd la protezione fornita dall apparecchiatura all utilizzatore potrebbe essere a rischio Tutte le unit Techne sono state progettate in conformit ai requisiti internazionali di sicurezza e sono equipaggiate con un interruttore anti surriscaldamento Se si dovesse verificare qualche problema di
44. ed time Yes Pause facility Yes Program naming Alpha numeric plus symbols Password protection Yes Keyword selection Yes Run completion time Yes End of program alarm Yes Auto resume on power failure Oligonucleotide Tm calculator Yes with options of 10min 30min 1h or always Yes based on the Nearest Neighbour method Programming for Satellite units is via a Prime Elite unit or Techne Workbench PC software Breslauer K J Frank R Blocker H and Marky L A 1986 Proc Natl Acad Sci USA 83 pp 3746 3750 16 INTERCONNECTIVITY Connection to PC control software Yes Satellite units only Software updates Free of charge from www techne com COMMUNICATION PORTS Prime Elite Connections for Satellite units 3 x USB ports on rear of unit Connection for memory stick USB port on front of unit Satellite unit Connection to PC or Prime Elite USB port on rear of unit DIMENSIONS Height mm 312 Width mm 276 Depth mm 375 Weight kg 14 POWER Voltage 100 230V Power 1000W 17 INSTALLATION See also the Safety Information sections on pages 5 to 14 Front view BAMAA LA AAA A AAA ALA Prime Elite Prime Elite Satellite 1 Prime Elite 5 7 colour VGA LCD touch screen display 2 Drawer release push panel 3 Prime Elite USB port for memory stick 4 Power on off 5 Prime Elite Satellite ID and status indicator Rear view Lifting Handle USB ports for connection of Satellite units Prime Elite
45. election screen Only the programs with both the selected user name and key word s saved with them will be listed 50 RUNNING A PROGRAM NOT ON THE SHORTCUT LIST e Once the required program has been identified touch it to highlight it The Program Selector Screen will show a summary of the program the instrument settings and a graphical representation of the thermal cycling program e Touch Edit to edit the program if required e Touch Back to return to the Home Screen e Touch Start to proceed to the Pre run Screen If there is one or more Satellite unit s connected to the Prime Elite an additional screen will ask if you wish to run the program on a selected Satellite unit or the Prime Elite e Touch the required button to select e Touch Cancel to return to the Home Screen If it is decided to run the program on a Satellite unit an additional screen will allow selection of the required unit e Touch to select the required Satellite unit e Touch Identify if necessary to ensure the correct Satellite unit has been selected The selected Satellite unit will beep and flash its indicator lights e Touch Send e Touch Cancel to return to the previous screen A Choose a program Suazo Search By Search By gran Keyword Name ABC Preheat Lid 109 C Off 2 Step Template CEL Final Hold Used Today 3 43 PM L C 10 O Hot Start Off 3 Step Template RT PCR Template Used Last Friday 1 27 PM Ru
46. ellite This Instrument ID Prime Elite 301542 Status Idle Program View for more details End time View for more details Accessed Today 5 34 PM Satellite ID Prime Elite 000004 3 Status Running Program 2 Step Template identify End time Today 6 50 PM Accessed Today 5 35 PM Cancel Reset Satellite IDs For the next 2 minutes any satellite unit connected to this Prime Elite will be given a new ID IDs will be assigned sequentially starting from 0 55 VIEW FILES The View files module opens the File Manager and allows access to all the program and temperature log files From here it is possible to copy program files to the unit for editing Files can also be deleted or copied to a USB memory stick for transfer to a PC or storage FILE SEARCHING There are four ways to search for a file e Search program files or temperature logs from 2 Step Template the complete list of saved files AI e Search by keyword 3 Step Template e Search by user Used 14 11 2012 o e Search by keyword and user Ice Bucket Create a new Used 14 11 2012 program Dd RT PCR Template Never used Current status Version 1 200 01 55 e To search for a file saved on the unit touch View files to open the File Manager screen View files Search from a list Programs And Saale Search By Search By Select All e Touch Programs And Logs to display either 1095 Name ABC Keyword User programs only temperature logs only or both
47. enter the current date e Use the and keys to set the date values e When the correct date has been set touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required Temperature Log Recording Always Never Auto Resume On Power Loss 10 minutes 30 minutes 1 hour Always Date and Time Settings More Settings Date Current date is 21 11 2012 Set Date Time Current time is 13 36 Date Format dd mm yy dd mm yy 21 11 12 mm dd yy 11 21 12 Set Time More Settings 31 Time e Touch Time in order to enter the current time Enter a new time using the 24 hour clock e Use the and keys to set the time values e When the correct time has been set touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required Date Format Touch the Date button to set the required date format The options are dd mm yy or mm dd yy e Touch Back to return to the Settings menu e Touch More Settings to access further instrument settings Administrator Settings Administrator Password Required This allows an administrator to remove passwords The administrator password is required to access administrator settings from password protected programs change the Administrator password and restore the unit to its factory settings The password is correct e Touch None and enter the administrator
48. et enflammer les mat riaux combustibles Les utilisateurs doivent porter une attention toute particuli re aux points suivants e PROCEDER AVEC PRUDENCE ET PORTER DES GANTS POUR SE PROTEGER LES MAINS e NE PAS utiliser de mat riaux combustibles aupr s d objets chauds e NE PAS utiliser l appareil proximit de liquides ou de gaz inflammables e NE PAS verser de liquides directement dans l appareil SECURITE DE L OPERATEUR Tous les utilisateurs de produits Techne doivent avoir pris connaissance des consignes et instructions n cessaires la garantie de leur s curit Important cet appareil doit imp rativement tre manipul par un personnel qualifi et tre utilis selon les instructions donn es dans ce document en accord avec les normes et proc dures de s curit g n rales Dans le cas o cet appareil ne serait pas utilis selon les consignes pr cis es par Bibby Scientific Ltd la protection pour l utilisateur ne serait alors plus garantie Tous les appareils Techne sont con us pour r pondre aux normes de s curit internationales et sont dot s d un coupe circuit en cas de surchauffe En cas de probleme de s curit couper l alimentation lectrique au niveau de la prise murale et enlevez la prise connect e l appareil INSTALLATION Porter l appareil deux mains Ne jamais d placer ou transporter l appareil lorsqu il est en fonctionnement ou branch l alimentation lectrique 1 Tous les app
49. form when programming step hold times within a cycling stage that includes the options for introducing incremented decremented time for example in long PCR Simple time entry Enter the time using the or buttons to increase or decrease the number of hours minutes or seconds Using the button with the value set at O will scroll to the maximum permitted value Touching Hide Hours will remove the hour time selector and just display selectors for minutes and seconds Once the time is correct touch OK to return to the previous screen Touch Cancel to return to the previous screen if no changes are required Advanced time entry e First ensure the number of cycles for the stage has been set then enter the required hold time as described above Final Extension Time Final Extension Time Minutes Note Increase Decrease Per Cycle will be inactive unless the number of cycles set is greater than 1 21 To increase the step hold time per cycle Minutes e For an increase in hold time per cycle touch the button below Increase Per Cycle to turn this function on Next touch the time entry button below this Increase Per Cycle Decrease Per Cycle e 00 00 00 00 00 00 A new screen will open which is similar to the simple time entry screen The maximum increase in hold time per cycle based on the number of Increase Per Cycle cycles and the time limits of the unit will be shown increase per cycle is 02 56
50. guna parte del manual se deber considerar como una garant a condici n o reflejo con respecto a la descripci n comerciabilidad idoneidad para un fin determinado o de otro tipo de la unidad o sus componentes Con independencia de la descripci n y las especificaciones del instrumento que se indican en el manual del operario Techne se reserva el derecho de realizar cambios en el instrumento o en cualquiera de sus componentes cuando lo estime oportuno 14 CONTACT INFORMATION For technical sales or servicing information contact your local Techne distributor or UK Bibby Scientific Ltd Beacon Road Stone Staffordshire ST15 OSA UK Tel 44 0 1785 812121 Fax 44 0 1785 810405 E mail sales bibby scientific com www techne com France Bibby Scientific Limited B timent Le Deltaparc Parc Silic PN2 7 rue du Canal BP 55437 VILLEPINTE 95944 ROISSY Charles de Gaulle France Tel 33 0 148 63 78 03 Fax 33 0 148 63 78 01 E mail ventes bibby scientific com www bibby scientific com Middle East Bibby Scientific Middle East Ltd PO Box 27887 Engomi 2433 Nicosia Cyprus Tel 357 22 660 423 Fax 357 22 660 424 e mail sales bibby scientificme com North and South America Bibby Scientific US Inc t a Techne Inc 3 Terri Lane Suite 10 Burlington N J 08016 USA Toll Free in NA 800 225 9243 Tel 1 609 589 2560 Fax 1 609 589 2571 E mail labproducts techneusa com www techneusa com
51. he lid pre heat phase This maintains the block at 4 C while the lid is heating to temperature and avoids any increase in sample temperature due to the heated lid before the thermal cycling program begins How does TERS work TERS harnesses the heat released during the cooling phase for use in the next heating phase By switching the fans off for a very short time at the end of the cooling period the heat is not removed from the heat sink but is instead stored as heat energy Heat is therefore available as soon as the Peltiers switch from cooling to heating This results in faster heating requires less energy to heat the block and subsequently costs less to run What is Hot start The Hot Start step is used to pause the machine at a specific temperature typically around 70 C after the initial template denaturation The reason is to allow the manual addition of unmodified Tag DNA polymerase which may lose activity if added during the initial denaturation step Heat activated Taq or Hot Start enzymes do not require this step What is the incremented time and temperature function for Incremented decremented time and temperature are used to increase or decrease either the time or temperature incrementally over the number of cycles in a stage Incrementation of extension time is used with Long PCR which is when large template fragments are to be amplified e g 27kb lambda DNA 40kb genomic DNA Decremented temperature is used for proto
52. hnical Director Bibby Scientific Ltd g Ni e e pe cron Bibby Scientific ibby Scientific di stone Staffs 5715 054 UK Tel 44 0 1785 812121 Fax 44 0 1785 813748 67
53. hput applications to control up to three additional Satellite units via USB connections Satellite units can also be remotely controlled from a PC using the Techne Workbench software Programs and temperature files are saved as text files for integration into a LIMS System BEFORE USE Before using the Prime Elite please make sure you have read this manual carefully If there is any doubt relating to the proper use of this equipment the staff at Bibby Scientific Ltd or your supplier will be happy to assist you UNPACKING When unpacking the unit please ensure that the following have been removed from the packaging Prime Elite with block Mains cables UK EU and US USB cable Operator s manual Warranty card The user is advised to keep the original packaging in case the instrument ever needs to be returned for service or repair Bibby Scientific Ltd accepts no responsibility for damage incurred unless the unit is correctly packed and transported in its original packaging SAFETY INFORMATION Please read all the information in this manual before using the Prime Elite WARNING HIGH TEMPERATURES ARE DANGEROUS they can cause serious burns to operators and ignite combustible material Users should be aware of the following potential hazards e USE CARE AND WEAR PROTECTIVE GLOVES TO PROTECT HANDS e DO NOT use combustible substances near hot objects e DO NOT operate the instrument in the vicinity of inflammable liquids or gases
54. ieur seulement Temp rature ambiante 5 C a 40 C Altitude inf rieure 2000m Humidit relative ne d passant pas 80 Fluctuations de l alimentation n exc dant pas 10 de la valeur nominale Cat gorie Il IEC 60364 4 443 de surtension Degr de pollution 2 Remarque Les param tres sont indiqu s pour une temp rature ambiante de 20 C Ces caract ristiques peuvent se d t riorer en dehors d une temp rature ambiante de 10 30 C L appareil a t test en mati re de radiofr quences et est certifi selon la norme EN61326 GARANTIE Bibby Scientific Ltd garantit cet instrument contre tout vice de mati re et de fabrication quand il est utilis dans des conditions normales de laboratoire pendant quatre 4 ans En cas de r clamation justifi e Bibby Scientific Ltd procedera gratuitement au remplacement de tout l ment d fectueux ou au remplacement de l appareil Cette garantie ne s applique pas aux dommages provoqu s par les incendies accidents m susages n gligences r glages ou r parations incorrects aux dommages dus une installation incorrecte adaption modification au montage de pi ces non homologu es ou r paration par un personnel non autoris La responsabilit de Bibby Scientific Ltd se limite aux co ts de r paration ou de remplacement du produit et exclut en particulier les pertes dommages co ts ou d penses indirects et con cutifs parmi lesquels mais sans s y limiter les pertes de temps
55. ific Ltd limitata al costo della riparazione o della sostituzione del prodotto ed esclude in particolare qualsiasi perdita indiretta o secondaria danno costo o spesa ivi inclusi a titolo di esempio e in modo non esaustivo perdite di tempo materiali e spese oppure perdite di utilizzo profitto produzione ricavo risparmio atteso o avviamento Per esporre un reclamo contattare il fornitore dello strumento Questa garanzia in aggiunta ai diritti di legge e non ha alcun effetto su di essi Il presente manuale stato preparato ad uso dei clienti di Techne e niente di quanto in esso contenuto costituisce garanzia condizione o rappresentanza riguardo la descrizione la commerciabilit l idoneit allo scopo o altrimenti dell unit o dei componenti Nonostante la descrizione e le specifiche dello strumento contenuti nel manuale dell operatore Techne si riserva il diritto di apportare le modifiche ritenute opportune agli strumenti o a qualsiasi loro componente 12 INFORMACI N DE SEGURIDAD Lea atentamente este manual antes de utilizar el Prime Elite ADVERTENCIA LAS ALTAS TEMPERATURAS SON PELIGROSAS ya que pueden ocasionar quemaduras graves a los operarios y prender el material combustible Los usuarios deben conocer los posibles riesgos e TENGA CUIDADO Y LLEVE GUANTES DE PROTECCI N PARA PROTEGERSE LAS MANOS e NO utilice sustancias combustibles cerca de objetos calientes e NO utilice el instrumento cerca de l quidos
56. in temperature per cycle will now be displayed e Touch OK again to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required 24 55 DIN a2 3145167 Leo Increase Per Cycle Decrease Per Cycle Temperature Gradient Increase Per Cycle Maximum increase per cycle is 1 6 C Cancel AEENCEGGARE The temperature value will now appear orange in the programming screen indicating that it contains a modified function To decrease the step temperature per cycle e For a decrease in temperature per cycle touch the button below Decrease Per Cycle to turn this function on Next touch the temperature entry button below this new screen will open which is similar to the simple temperature entry screen The maximum decrease in temperature per cycle based on the number of cycles and the temperature limits of the unit will be shown e Enter the required value e Touch DEL to clear the entry e l an entered decremented temperature is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The decrease in temperature per cycle will now be displayed e Touch OK again to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required Insert a new step 55 0 ISS 1234567890 Decrease Per Cycle Maximum decrease per cycle is 1 9 C 55 0 1234567890
57. le Decrease Per Cycle e Touch Cancel to return to the programming 00 00 00 00 00 05 The time value will now appear orange in the programming screen indicating that it contains a modified function Note It is not possible to both increase and decrease the time of the same step 00 01 00 00 05 00 Tarart a maun otana Tmoanrt a mai ina A 29 INSTRUMENT SETTINGS AND DEFAULTS From the Home Screen touch the Settings button to access the instrument Settings menu e Touch any of the buttons to view and edit the settings e Touch More Settings to access further options e Once all the settings and defaults have been set as required touch Save to save the changes and return to the Home Screen e f you do not wish to change any settings touch Cancel to return to the Home Screen USER PREFERENCES Language e Touch the Language button to set the required language The options are English French Spanish Italian and German Temperature Display e Touch the Temperature units button to set the required temperature units The options are C and F Home Screen File List Sort This sets the user preference for listing the program shortcuts on the Home Screen e Touch the button to set the required sorting preference The options are recently used first or most used first e Touch More Settings for further user preferences Select Multiple Items in File Manager This allows either multiple files or only si
58. lected programs can be run directly or edited before running RUNNING A PROGRAM FROM THE SHORTCUT LIST On the Home Screen the Run a program area displays shortcuts to four programs User Preferences in the Settings module can be used to select whether this displays the four most recently used programs or the four most frequently used programs e To run one of the programs in the shortcut list Run a program touch the button to open the Pre run Screen 2 Step Template a 4 Used Yesterday 5 35 PM 3 Step Template A 2 Used 14 11 2012 Ice Bucket n 3 Create a new Used 14 11 2012 program RT PCR Template A4 Never used Settings Current status Version 1 200 0155 View files If there is one or more Satellite unit s connected to the Prime Elite an additional screen will ask if you wish to run the program on a selected Satellite unit or the Prime Elite Run the program using a connected satellite e Touch the required button to select Run the program on this Prime Elite e Touch Cancel to return to the Home Screen Cancel If it is decided to run the program on a Satellite Connected Satellites Sending unit an additional screen will allow selection of the atellite required unit ID Prime Elite 000004 3 Status Idle Accessed Yesterday 5 42 PM e Touch to select the required Satellite unit e Touch ldentify if necessary to ensure the correct Satellite unit has been selected The selected Satel
59. lite unit will beep and flash its indicator lights e Touch Send Cancel e Touch Cancel to return to the previous screen 46 Note lf the user attempts to send a program to unit while it is already running the warning screen shown opposite will be displayed e Touch OK to exit THE PRE RUN SCREEN Program Is Already Running A program is already running on the instrument you have selected Please either stop the program or wait for it to complete before trying again The Pre run Screen shows a graphical representation of the program allowing for a rapid check of the temperature parameters The centre of the screen shows each temperature step and hold time not to scale Stages are indicated by a white bar spanning the steps within the stage The bottom of the screen shows the program name the date and the expected end time if it was started immediately e Touch Start to start the program e Touch Edit to edit the program e Touch Back to return to the previous screen Note The temperature log will remain blank until the program has been started If a step has a gradient programmed into it the bar will be shown thicker and indicate the upper and lower temperatures of the gradient range If a step has an incremented or decremented temperature this will be indicated by a white spot next to the temperature If a step has an incremented or decremented time this will be indicated by a white spot nex
60. mory stick to use for the update To update a Prime Elite you ll need a USB memory stick with at least 5MB of free e Select the Prime Elite Update and choose the ELE DERE opti on t o run th e fi e fa cara A Pre to use for the update A folder called 2 Turn the Prime Elite off and put the stick into one of the front USB ports e nsert a USB mem ory stick into the PC and cl ick 3 Turn the Prime Elite on and follow the instructions on screen to select gt GA nr 1 3GB free space e Click on Prepare the USB memory stick This will copy the update to the USB memory stick e Turn the Prime Elite off and insert the USB stick into the front USB port e Turn the Prime Elite on and follow the instructions on the screen The update will take several minutes When finished the home screen will be displayed e Remove the USB memory stick from the Prime Elite 62 Q1 Ai Q2 A2 Q3 A3 Q4 A4 Q5 A5 Q6 A6 Q7 A7 Q8 A8 FAQS How do adjust the pressure of the heated lid for my tubes or plates No adjustment is necessary The lid automatically applies the correct pressure Ensure that all consumables used in the block are of the same height Do need a different block for fully skirted plates No The Prime Elite 96 well block will accommodate fully skirted as well as half skirted and non skirted PCR plates What is Sample Cooling Sample cooling can be applied during t
61. n the program using a connected satellite Run the program on this Prime Elite Connected Satellites Sending Satellite ID Prime Elite 000004 3 Status Idle Accessed Yesterday 5 42 PM Identify 91 Note If the user attempts to send a program to unit while it is already running the warning screen shown opposite will be displayed e Touch OK to exit e From the Pre run Screen touch Start to run the program See THE RUN SCREEN on page 48 for further information on instrument status and progress during a run 92 Program Is Already Running A program is already running on the instrument you have selected Please either stop the program or wait for it to complete before trying again Initial Denaturation 94 C 94 C 60 C 00 05 00 00 00 30 00 01 00 stag 30 Cycles Program 2 Step Template End time Today 10 45 AM Final Extension Final Hold 72 C 10 C 00 05 00 Edit Temperature Log Back EDITING A PROGRAM EDITING SAVED PROGRAMS First select the required program by searching the Run a program module e To edit a selected program touch the Edit button Any of the Program Options Settings or thermal cycling parameters can be edited e Once all the required changes have been made touch Save Note this will overwrite the existing program To copy a program for editing please see section VIEW FILES EDITING TEMPLATES Editing templates can be a quick method
62. ngle files to be selected for copying and deleting when using the File Manager in the View files module e Touch to select on or off e Touch Back to return to the Settings menu 30 More Settings More Settings User Preferences Instrument Settings Program Defaults More Settings Cancel Language English French Spanish Italian German English Temperature Display Le 408 Celsius C Celsius C Fahrenheit F Recently Used First Home Screen File List Sort Most Used First Recently Used First Select Multiple Items in File Manager On Off INSTRUMENT SETTINGS Temperature Log Recording To record the temperature logs block temperature profile of each run touch the button to set this to Always If temperature logs are not required set to Never Auto Resume On Power Loss This determines the time limit after which the unit will restart after a power failure For example if the Auto Resume is set to 30 minutes the unit will restart at the beginning of the step at which it was interrupted if the power failure lasted for 30 minutes or less but not if it was for longer Setting Auto Resume to Always will always allow the unit to re start irrespective of the length of the power failure Date and Time Settings Use these settings to set the current date time and date format on the unit e When set touch Back to return to the Settings menu Date e Touch Set Date in order to
63. only USB port for connection to PC or Prime Elite Satellite units only Mains cable inlet ca edt de 18 Installation 1 Place the unit on a suitable flat bench ensuring that the air inlet vents on the front and rear are free from obstruction Two units may be stacked one on top of the other Prime Elite on a Satellite or Satellite on Satellite Plug the mains cable into the socket on the back of the instrument Connect to the mains electricity supply with the plug provided or one wired correctly for the supply Switch the power ON using the switch located on the front of the unit The front display will then light up 4 Open the drawer by pushing on the front drawer panel then pull the drawer forwards to access the block 5 Place the samples in the block If individual tubes or strip tubes are being used space these out evenly across the block to equalise the pressure from the heated lid 6 To close the drawer push back into the unit until it locks in place Connecting Satellite units to the Prime Elite The Prime Elite has three USB ports on the rear of the unit for connection of Satellite units Three Satellite units can be connected directly to the Prime Elite as shown in the configuration below SH USB memory stick 19 GENERAL SOFTWARE FEATURES INTRODUCTION The Prime Elite software allows the user to quickly and easily create thermal cycling programs using a simple and clear touch
64. program a name e Type in the required name using the text entry screen e Once the name is complete touch OK to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required When saving the program if the chosen name has already been used for another program the message box shown opposite will appear e Touch OK to return to the Programming screen e Touch the program name and enter a different name e Once the name is complete touch OK to return to the programming screen e Touch Save to save the program 38 Name the program Program Options Settings Insert a new stage Insert a pause Cancel E Program Name Already Used The program name is already in use by another program Please choose a different program name INSERT DELETE A STAGE A stage is a section of a program that consists of a number of individual steps that can be cycled repeated a defined number of times Insert a new stage e To insert a stage in a program touch Insert a new stage stage with one step will be inserted Stage 1 e Touch this to give the stage a name optional Enter the name using the text entry screen 1 cycle e Touch this to edit the number of cycles repeats for the stage Enter the required number of cycles then touch OK Temperature e Touch the temperature button to edit the temperature of the step and add any increment decrement or gradient fea
65. replace the unit free of charge This warranty does not apply if damage is caused by fire accident misuse neglect incorrect adjustment or repair damage by incorrect installation adaption modification fitting of non approved parts or repair by unauthorised personnel Bibby Scientific Ltd liability is limited to the cost of repair or replacement of the product and excludes in particular indirect and consequential loss damage costs or expenses including but not limited to wasted time materials and expenditure or loss of use profit production revenue expected savings or goodwill To make a claim please contact the supplier of the instrument This warranty is in addition to and does not affect any statutory rights This manual has been prepared for the convenience of Techne s customers and nothing in this manual shall be taken as a warranty condition or representation concerning the description merchantability fitness for purpose or otherwise of the unit or components Notwithstanding the description and specification s of the instruments contained in the operators manual Techne reserves the right to make such changes as it sees fit to the instruments or to any of the components L INFORMATION DE S RET Veuillez lire attentivement toutes les instructions de ce document avant d utiliser le Prime Elite AVERTISSEMENT Les TEMP RATURES LEV ES SONT DANGEREUSES car elles peuvent provoquer de graves br lures chez l op rateur
66. rn the unit if necessary Please include details of the fault observed and remember to return the unit in its original packing Bibby Scientific Ltd accepts no responsibility for damage to units which are not properly packed for shipping if in doubt contact your supplier giving the full serial number of the unit FUSES If the display on the front panel is not lit one of the two fuses may have blown Check that there is no external cause such as a faulty plug or lead Check both fuses and replace the faulty fuse with a new one of the correct value fuse values are given on the label next to the power inlet Note that fuses should only be replaced by a qualified electrician The holder for the two fuses is built into the mains input socket First remove the power cable and then gently prise the fuse drawer open with a flat bladed screwdriver or similar tool Each fuse can be removed by using the screwdriver as a lever Exchange the faulty fuse in the fuse holder for a working fuse of the correct value Finally replace the fuse drawer in the fuse compartment and push the drawer shut Fuses which blow repeatedly indicate a serious fault and you should return the unit to your supplier for repair INSULATION TESTING This equipment is fitted with RFI suppression circuitry Any check of the electrical insulation by means of high voltage dielectric testing for example as in BS EN 61010 1 must be carried out using only a DC voltage This unit
67. t to the time as 94 C 94 C 60 C 72 C 10 C 00 05 00 00 00 30 00 01 00 00 05 00 Final Extension Final Hold 30 cycles Program 2 Step Template MN End time Edit Today 10 45 AM temperie tog Log Back C I 62 5 C 57 5 C 72 C 60 Ce 72 C 00 00 40 00 01 00 00 00 40 00 01 00 00 00 40 00 01 00e 47 THE RUN SCREEN The Run Screen will be displayed after a program has been started It shows the instrument status and the progress of a run Once the program has been started the timers in the top right hand corner of the screen will indicate how long the program has been running and the total run time The progress bar at the top of the screen also indicates how far the run has progressed The status of the block is indicated by the step bars which display the activity of the block i e ramping to temperature paused or the count down time of the step Program 2 Step Template Progress through the program is indicated by the Today 12 16 PM stage bar s which show at which cycle of the program the unit is currently at Adaptive ramp rate The first time a program is run the unit estimates the total run time based on the ramp rates set in the program After the first cycle has completed the actual time taken to complete the cycle is then used to re calculate the total run time Subsequent runs of the same program will therefore have a more accurate estimate of total run time The estima
68. te also takes into account the ambient room temperature therefore run times will also depend on ambient temperature e Touch Stop to stop the program A prompt will ask you to confirm the stop e Touch Temperature log to view the block 90009 temperatures The previous two minutes of 2000000000000000000000000000000000000 0 temperature readings can be viewed by scrolling across the screen using a finger The complete log is written and saved on the unit gt 00 06 35 00 06 35 Note Touch Program View to return to the 00 06 00 program status Program 2 Step Template End time e Touch Pause to pause the program Today 12 16 PM e f paused touch Continue to un pause the program Note If the drawer is opened while the unit is running the program will pause and only resume when the drawer is closed Note It is possible to access all modules of the software while the unit is running a program e Touch Back to return to the Home Screen and access other modules Once the run has finished Program Finished will be displayed instead of End time 48 Viewing a running program from the Home Screen e Touch Current status e Touch the area for the required instrument e Touch View Current status Reset Satellite This Instrument IDs ID Prime Elite 301542 Status Idle Program View for more details End time View for more details Accessed Today 5 34 PM Satellite ID Prime Elite 000004 3 Status R
69. tures Time e Touch the time button to edit the hold time of the step and to add any increment decrement time features Ramp rate e Touch the ramp rate setting to adjust the ramp rate The range is 0 1 C s minimum to 5 0 C s maximum for heating and 3 0 C s for cooling The value can be entered to 1 decimal place Ramp rate will affect the heating or cooling rate from the previous step to the current step e Once set touch OK to return to the Programming Screen Delete a stage e To delete a stage touch the stage area to highlight it and then touch Delete Program Options Settings Temperature 00 05 00 Insert a new step Cancel Maximum 1234567890 Cancel ES n Temperature Ramp Rate 00 05 00 Maximum Insert a new step 39 INSERT DELETE A STEP Insert a new step e Touch Insert a new step to insert the next step in the current stage e Edit the new step temperature hold time and ramp rate as required Delete a step e To delete a step touch the step area to highlight it and then touch Delete INSERT DELETE A PAUSE Insert a pause e To insert a pause between stages touch Insert a pause The hold temperature will be that of the previous step The unit will not continue with the remainder of the program until it is manually un paused by the user Delete a pause e To delete a pause touch the pause button to highlight it and then touch Delete Note To insert a p
70. unning z Identi Program 2 Step Template dentify End time Today 6 50 PM Accessed Today 5 35 PM Cancel SEARCHING FOR A PROGRAM NOT IN THE SHORTCUT LIST There are four ways to search for a program if it is not in the shortcut list Search from the complete list of saved programs Search by keyword Search by user Search by both keyword and user Search from a list e To search for a program saved on the unit touch Run a Program to open the Program Selection Screen e Use the and buttons to scroll up and down the list of stored programs e Touch Sort By Program Name to list the programs in order The options are Program Name ABC ZYX Recently Used 123 321 Most Used 123 321 User ABC ZYX Search the programs by keyword e Touch Search by Keyword and this will open the list of keywords stored on the unit e Select one or more keywords by touching the buttons to highlight them Touch again to de select e When all keywords have been selected touch Done to return to the Program selection screen Only the programs with the selected keyword s saved with them will be listed e To clear the keyword search touch Clear Keyword Search Choose a program en Search By Search By Name ABC Keyword User 2 Step Template Used Today 3 43 PM 3 Step Template Never usad Select an item from the list to see Ice Bucket program details Used Today 4 19 PM Ligation 15 C Never used
71. word enter the current password e On the Password Editing screen touch the None button and enter the password Remove SI Change Password Cancel e To remove the password touch Remove Password Required Password Before changing or removing the password from this program please enter the current password e To change the password touch Change Password and type in the new password followed by OK The password is correct e Touch Cancel to return to the Program Options screen if no change is required Cancel 43 SETTINGS e Touch the Settings button to view the instrument defaults as set up in the Settings module Any of these parameters can be edited by touching the appropriate button and will be saved for the current program only e Touch Program to return to the programming screen VIEW e Touch View to see a graphical representation of the program e f the program has more stages and steps that are displayed on the screen scroll through the program by dragging a finger across the touch screen The centre of the screen shows each temperature step and hold time not to scale Stages are indicated by a white bar spanning the steps within the stage The bottom of the screen shows the name of the program and the expected end time if it was started immediately Note The program is not saved at this point e Touch Start to start the program Program Preheat Lid Sample Cooling
72. y touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the File Manager screen Only the programs with the selected user name saved with them will be listed e To clear the user name search touch Clear User Search Search the files by keyword and user e Touch Search By Keyword and this will open the list of keywords stored on the unit e Select one or more keywords by touching the buttons to highlight them Touch again to de select e When all keywords have been selected touch Done to return to the Program selection screen Only the programs with the selected keyword s saved with them will be listed e Touch Search By User and this will open the list of user names saved with previously keyword searched files e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the File Manager screen Only the files with both the selected user name and key words saved with them will be listed Sort By Clear Program Keyword Name ABC Search Program GAPDH Keywords gradient User Jayne Used Today 3 56 PM Temperature Log from 123456 GAPDH Keywords gradient User Jayne Created Today 3 56 PM 57 VIEWING A PROGRAM FILE e Touch Programs And Logs to display Only ali Programs rograms Name ABC eywor ser

Download Pdf Manuals

image

Related Search

Related Contents

Doro Phone Easy 331ph  CFC-1000 PDF  moduli supplementari a pulsanti per targhe  Épreuve E2 - BAC PRO SEN Electronique Industrielle  Samsung SCX-4828FN 用戶手冊  apoiada pela UML - liber  別紙お知らせ  Samsung HT-Z110 User Manual  Report Appendices  Service manual Multi Concept MX-Chassis  

Copyright © All rights reserved.
Failed to retrieve file