Home
pEco™-T7-cHis PCR Cloning kit
Contents
1. PCR cloning kit with a built in vector non T7 promoter based in provided cloning cells for E Coli expression of N term His tagged protein specially designed for toxic proteins PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of N term GST tagged protein PCR cloning kit with a built in mammalian expression vector with Neomycin selection marker in provided cloning cells for mammalian expression of C term His tagged protein Eco Cloning of pEco T7 cHis product manual Page 8 of 8 www gentarget com GenTarget Inc Copyrights 2015
2. 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com pEco T7 cHis PCR cloning Kit User Manual Patent pending Cloning PCR products for E Coli expression of C term His tagged protein Cat Contents Amounts Application pEco T7 cHis vector built in 10 tubes x 50ul ea Eco Cloning cells for 10 rxn E Coli expression of C IC 1006 Positive PCR insert 1 x 10ul ea term His tag protein Sequencing primer pair Forward and reverse 15ul each 25ng ul Storage Eco Cloning Kit is shipped on dry ice Upon received stored at 80 C Once thawed must be used do not re freeze Product should be stable for 6 months Product Description 1 Introduction The revolutionary Eco Fusion in vivo cloning method is the easiest PCR cloning method available 1 Simply amplify your gene of interest with a primer pair that is flanked with short arms homologous to the expression vector 2 Add 2 ul of purified PCR into the engineered vector build in cloning cells 3 Immediately proceed to transformation 2 How it works The engineered E Coli strain in GenTarget s Eco PCR Cloning Kit has an enhanced E Coli competent cells enabling an in vivo joining reaction for cloning with no tube reactions Let the E Coli do the job for you In Vivo GenTarget provides E Coli cloning cells with a selection of built in vectors for mamm
3. CR insert cells usually form background colonies the no insert negative control also generates a few colonies In the presence of PCR insert however gt 90 colonies are positive Colony number varies depending on the quality and quantity of the PCR products The concentration of purified PCR product can be from 20 ng ul to 150 ng ul with sizes ranging from 200 bp to 10 kb For simplicity and particularly for high throughput cloning we recommend adding 1 2 ul of PCR product into the cloning cells Regardless of the PCR product s concentration and size it will generate enough colonies 5 100 colonies in general for downstream work 4 Save glycerol stocks for later expression and verification of positive clones Pick 2 5 colonies propagate in LB Amp and incubate at 37 C overnight Save an aliquot of each clone in LB Glycerol medium containing 100 ug ml ampicillin at a final concentration of 15 Glycerol Isolate the plasmid DNAs using a DNA miniprep kit Confirm the positive by restriction digestion PCR inset can be cut out by BsrGI Run 1 2 agarose the positive clones will show two bands 5 79 kb backbone the PCR insert or multiple bands if BsrGI has extra cuts within the PCR insert Final sequencing verification Use the provided sequencing primer pair The sequencing primer comes in a ready to use dilution use 1ul for each sequencing reaction with 500ng plasmid in 20ul volume Cat Vector For
4. CR products of varying sizes from 200 bp to 10 kb The same PCR product can be used to construct multiple different expression vectors e Engineered E Coli expression vectors for high protein yields e Great for high throughput cloning 4 Protocol Outline Eco Cloning of pEco T7 cHis product manual Page 2 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Produce and clean PCR products v Add 1 2 ul of PCR product into the cloning cells provided briefly mix and immediately proceed to transformation v Pick colonies save glycerol stocks and isolate plasmids by miniprep to verify the positive clones v Express protein from the saved glycerol stock 5 Detailed Protocol 1 PCR primer design PCR primers used for generating inserts for Eco Cloning must contain a 20 25bp homologous sequence corresponding to the built in vector Design your primer pair as follows Fwd 5 tttgtacaaaaaagcaggcacc 20bp of 5 end gene specific forward sequence Rev 5 tttgtacaagaaagctgggtt 20bp of 3 end gene specific reverse sequence A protein cleavage site may be included in the forward primer to allow excision of the C term tag if desired Its codon sequences must be in frame and set between the homologous leader and the 20bp gene specific sequence An example of
5. GCGAAATTAA AGAGCTAGGG CGCTTTAATT T7 promoter TACGACTCAC TATAGGGGAA ATGCTGAGTG ATATCCCCTT ATAACAATTC CCCTCTAGAA TATTGTTAAG GGGAGATCTT BsrGI CACAAGTTTG TACAAAAAAG GTGTTCAAAC ATGTTTTTTC BsrGI TGTACAAAGT GGTGATCAAT ACATGTTTCA CCACTAGTTA CCTCTCCTCG GTCTCGATTC GGAGAGGAGC CAGAGCTAAG ATAATTTTGT TTAACTTTAA TATTAAAACA AATTGAAATT PCR Insert CAGGCACCNN NNNNNNNAAC GTCCGTGGNN NNNNNNNTTG TCGAAGCTTG AAGGTAAGCC AGCTTCGAAC TTCCATTCGG TACGCGTACC GGTCATCATC TTGTGAGCGG AACACTCGCC GAAGGAATAT CTTCCTTATA CCAGCTTTCT GGTCGAAAGA TATCCCTAAC ATAGGGATTG 6His ACCATCACCA ATGCGCATGG CCAGTAGTAG TGGTAGTGGT TIGAGTTTGA TCCGGCTGCT AACAAAGCCC GAAAGGAAGC TGAGTTGGCT AACTCAAACT AGGCCGACGA TTGTTTCGGG CTTTCCTTCG ACTCAACCGA 7 Troubleshooting Solution Be sure to set up a positive control transformation using the provided positive PCR insert1 which should give you 10 100 colonies Spread all of the transformation mixture onto the plate Problems No colony Background colonies Be sure to set up a background control plate in which no PCR product was added to the cells It should generate 0 5 colonies or less than 10 compared to plates with the insert Note in the absence of a PCR insert cells force vector self ligation resulting in a few background colonies Make sure that the PCR s template does not cause background colonies If it does clean PCR products by gel isolation or treat
6. PCR primer design To design the primer pair for the following gene sequence atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgct tacctgttgccaacattgggccaacccgaattcttcccaatctttatcttggctgcca gcgagatgtcctcaacaaggagctgatgcagcagaatgggattggttatgtgtta aatgccagcaatacctgtccaaagcctgacttttta The PCR primer for vector pEco T7 cHis will be Fwd 5 tttgtacaaaaaagcaggcaccatggcctctgtgaaggaaaa Rev 5 tttgtacaagaaagctgggttaaagtcaggctttggacagg Eco Cloning of pEco T7 cHis product manual Page 3 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 ell arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com If inserting a protein cleavage site the reverse primer will be Rev 5 tttgtacaagaaagctgggttNNNNNNaaagtcaggctttggacagg where the NNNNNN is the in framed cleavage site codon reverse sequence Notes 1 GenTarget s cloning kits with the same terminal tags share PCR insert sites The three Eco cloning kits with N terminal tags Cat IC 1001 IC 1002 and IC 1003 can share the same PCR insert and the two cloning kits with C terminal tags Cat IC 1006 and IC 1007 can share the same PCR insert 2 A stop codon does not need to be included in the PCR reverse primer since a stop codon is already built in immediately after the PCR insert 2 Target amplification by PCR Amplify your target using any PCR amplification protocol that works f
7. add an appropriate amount of IPTG continue grow for 17 24 hours with vigorously shaking at 300C 300rpm e Harvest cells by centrifugation e QC Cell pellet was lysed using lysis reagent Following the lysis protocols run protein gel for analysis e Purification use your favorite protocols and reagent to purify the expression His tagged protein by His tag affinity column e Purity and function analysis of the expressed protein using your favorite protocols 6 Vector maps The figure below summarizes the vector map of pEco T7 cHis The complete nucleotide sequence is available for downloading from our Website at Support page www gentarget com To make your clone map simply paste your gene sequence not included the flanking sequences of both ends in the Red highlighted position replacing the NNNN NN In most case the pasted sequence is ATG to last codon pEco T7 cHis vector BsrGl T7 promoter 5 GOI cloning ends BsrGI 6His 525 542 T7 term 557 685 Amp 1085 1942 pBR322 ori 2763 2091 _ oni lacl 5728 4637 T7 promoter 318 334 pEco T7 cHis i plo lacO 337 361 GOI cloning ends 428 429 Eco Cloning of pEco T7 cHis product manual Page 6 of 8 www gentarget com GenTarget Inc Copyrights 2015 GenTarset inc 7930 Arjons Drive Suite B San Diego CA 92126 Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Cloning site for pEco T7 cHis vector TCTCGATCCC
8. alian or E Coli expression systems A proprietary process for making ready to use E Coli cells with built in vectors ensures low background and a positive cloning rate of greater than 90 Eco Cloning of pEco T7 cHis product manual Page 1 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Target PCR Add PCR to cells ee e ap 4 _ Transformation I EP aie aul Sey In vivo cloning Oe pEco T7 cHis cloning cells has a built in pET based T7 expression vector PCR insert will be cloned in framed with a C terminal His tag 3 Key Features e The easiest and most cost effective PCR cloning method available Simply add iul of PCR insert into provided cells for transformation regardless of the insert s size and concentration e No need to buy vectors and no tedious bench work preparing a vector backbone e No need to buy cloning competent cells e No need for any enzymes or any tube reactions e Precisely directional cloning of PCR products with a in frame His tag C term 6His e Flexibility to allow addition of any cleavage site for removal of C terminal His tag if desired e Compatibility with any PCR product with or without a 3 A overhang the extra A overhang if it exists will be removed in the cloning step e Can be used with P
9. ment with DPNI Plate less transformation mixture onto the plate Be sure to use the right amount of antibiotics in the LB plate and make fresh LB plates if necessary Satellite colonies Eco Cloning of pEco T7 cHis product manual Page 7 of 8 www gentarget com GenTarget Inc Copyrights 2015 GenlTarset inc 7930 Arjons Drive Suite B San Diego CA 92126 Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Use carbenicillin instead of ampicillin if applicable Do not incubate plates longer than 16 hours Try to avoid picking the tiny satellite colonies References 1 Oliner et al 1993 Nucleic Acids Res 1 5192 97 2 Aslanidis et al 1994 Genome Res 4 172 177 3 Kaluz et al Nucl Acids Res 1992 20 4369 4370 Related Products Cat Product Name Amount Application IC 1001 PCR cloning kit kit PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of N term His tagged protein IC 1002 PCR cloning kit kit PCR cloning kit with a built in mammalian expression vector with neomycin selection marker in provided cloning cells The vector containing an engineered super CMV promoter for high yield mammalian expression of N term His tagged protein IC 1003 IC 1004 IC 1007 PCR cloning kit PCR cloning kit PCR cloning kit kit kit kit
10. or you To minimize PCR errors we recommend using high fidelity DNA polymerase Use any PCR purification column to clean your PCR products If you do not obtain a single discrete band from PCR gel purify your fragment Important if your PCR template can generate background clones having Amp resistance treat the PCR product with DPNI or perform gel purification 3 Transformation Thaw Eco Cloning cells in ice water After they are completely thawed add 1 2 ul purified PCR product from 20ng to 150ng into each vial of cells and mix briefly by tapping the tube with your finger For control vials add ipl positive PCR insert provided as a positive control and then add ul water to a negative control cells vial Put tubes back on ice and proceed to heat shock at 42 C for 40 seconds Note Do not leave DNA cells mixture on ice for prolonged period less than 15min are fine Put tubes back on ice for 1 min add 250 pl of SOC medium and incubate at 37 C shaking for 1hr Eco Cloning of pEco T7 cHis product manual Page 4 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Plating take a 250 wl competent cells above spread out on pre warmed LB agar plates containing 100 ug ml ampicillin Grow colonies at 37 C overnight Note In the absence of a P
11. ward primer Reverse primer IC 1006 pEco T7 cHis IC 1006 fwd IC 1006 rev 5 taatacgactcactataggg 5 tgctagttattgctcagcge 5 Protein expression Once positive clones are confirmed they can be used directly for protein expression without re transformation into another strain Transformation transform the sequencing verified plasmid DNA into any strain containing a T7 RNA polymerase such as BL21 DE3 or BL21 DE3 pLys from which protein are expressed upon IPTG induction Transformation uses standard heat shock protocol such as add 1ul DNA into 50ul competent cell set ice 5 15min heat shock at 420C Eco Cloning of pEco T7 cHis product manual Page 5 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com for 30 seconds back to ice for 2min add 250ul SOC recovery at 370C shaking for 1 hour Plate 10 to 100ul onto LB plates containing 100ug ml ampicillin Grow colonies at 370C incubator for overnight e Propagation Pick one clone grow in LB medium with ampicillin at 370C shaking overnight Add overnight culture into appropriate amount of LB medium containing 100ug ml of ampicillin by making 1 40 dilution keep medium volume at 20 of flask volume for better aeration vigorously shake at 300C 300rpm e Induction measure growth OD600 at the time when OD600 0 5
Download Pdf Manuals
Related Search
Related Contents
Catálogo de producto (pdf esp) DeVilbiss® Oxygen Concentrator Instruction Guide Guía de Samsung BCD-212NKSS 用户手册 Manuale K140.cdr - Infissi in Alluminio Heath Zenith Secure Home 598-1347-00 User's Manual 6 Antenna to 2 Radio Antenna Switch Local and Remote Control Technical-Spotlight_vol11 Copyright © All rights reserved.
Failed to retrieve file