Home

Primer Express® Software v2.0

1. IUPAC C Ode sa GE Ut G Formula Used in Primer Express Nearest Neighbor Algorithm for T Calculations G 1 VOOR CAM ss 522 decd jay ds demus del fu G 1 H Bibliography References o eire uento au ere re H 1 I Software License Applera Corporation Software License and Limited Product Warranty I 1 Watrantv Statermeblbs edo o sete dedos se 1 1 COPY UO soba 1 1 1 1 ISCStEIC DOS ate durat 1 2 fcm e em ERE E OEC I 2 L ariitation m 2 A RO dr RN She ee qct oua caua aue 1 3 Miscell NEOUS TC 1 3 Glossary Index Introducing Primer Express Software Introduction In This Chapter Topics in this chapter include the following Topic See page About the Primer Express Software 1 2 Contacting Technical Support 1 3 Introducing Primer Express Software 1 1 About the Primer Express Software Definition The Primer Express software allows you to independently design and Oligo Design Documents for Sequencing Batch Processing Ev
2. 1 In This ADDeldIx tedio tb qe 1 How to View the 1 Viewing th WANG OW scudo dottore ture Formas der 1 ADOLE Con Seek 2 ING OGUCHOM IUe aunt ie 2 bt hc ene aden 2 MI PR PEN A 2 E eee aaa 2 E vare detras 3 Repeat ide S UE ecu ae ae toto Scent A 3 Secondary Sime E ew ENS A 3 Primer Site Unique Westy sag a ap ae Eee cS dE 4 Amplicon Test dre REA 4 teda A Eo dos ewes 5 r S a S N A A 5 Amplicon Dm et ata es ee ead NE ds Aaa A 5 ects mr A 5 B Calculating Penalty Score DOUG Penalby x equis icio deo E ULP een toe doe bap na B 1 Assigning Penalty Score B 1 How the Penalty Score is B 1 Displaying Penalty Score Dialog B 2 Weieltunes of the Values iu s ed ade CE dei e ede KR ra B 2 ACU fe aS desde duced B 2 C File Types Supported INMOdUCHOR
3. CACAAAGAGT 400 AAGTGGCTTC ATCTATGGNG TNMNTITGATA GCCTAAAATT 450 laNCATGAATG NAAT TTAAG N 471 Ready to Calculate find primers select Find Primers Mow under Options menu Site annotation inserted blue Click the word Site once to select it then type your annotation text 6 26 Using the Annotation Tools Moving a Site To move a site annotation Annotation Step Action 1 Click the Select tool on the tool palette 2 Position the Select tool cursor over the site annotation arrow 3 When in the correct position the I beam cursor changes to the transparent open hand cursor 47 4 Click and hold the cursor The piece of sequence data at the site currently annotated highlights with a small highlight box 5 To move the annotation site drag the highlight box in any direction Removing Site The following procedure describes how to remove a site annotation Annotations To remove a site annotation Step Action 1 Click the Select tool on the tool palette 2 Click the annotation text once to select it then press the delete key to remove the annotation text 3 Click anywhere in the sequence data to remove the annotation site from the sequence 6 28 Using the Annotation Tools Primer Express Software Menus Introduction In This Chapter The Primer Express software i
4. CTGCAACATA ACCTATGAAT GATGTGCTGA GATGGGAAAC CCAAAATMAT GGTAAATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG CAACCCAAAA AACAGCAGTC ACAGTCTAGG TCTTTCCAGA AGAGCCCCTG ATGCTGGAGA AGTGTCTGCT GCAGCTGCCA TTGTTGCTGT TGTICCATIT GCAACTTCTC GAACCAGGAT GTGGICCTAA TTGACAAGGU TGCTATDGGAA AACCTATGCA TAGTCTTAGC CACAAAGAGT AAGTGGCTTC Ae ee ee ee AE Atotal of 499 primer pairs found examine primer pairs click the Primers tab 7 The Cycle Sequencing document provides the ability to find forward and reverse primers The Primer Express software uses the same criteria to evaluate candidate sequencing primers that it uses to evaluate PCR primers In addition you can specify Primer Position Hequirements to make certain that all primers found are a specified distance from the end towards which they prime To start a new Cycle Sequencing document choose New from the File menu and select Cycle Sequencing Document from the submenu Primer Express Documents 4 57 Cycle Sequencing Applications Introduction Primer Annealing Requirements for Cycle Sequencing In vitro DNA synthesis as in DNA sequencing based on the chain termination method developed by Sanger et al 1977 re
5. ACAGTCTAGG TCTTTCCAGA AGAGCCCCTG 200 ACAGAACACA ATGCTGGAGA AGTGTCTGCT 250 GCAGCTGCCA TTGTTGCTGT TGTICCATIT GCAACTTCTC AGTCTCAAAG 300 GTGACAGC AA CATASAGGNG GTGGICCTAA 350 AACCTATGCA CACAAAGAGT 400 AAGTGGCTTC ATCTATGGNG 450 ANCATGAATG NAATGTTAAG 471 You can use the Select tool to move lengthen or shorten any existing Forward Primer End annotation For instructions on modifying or removing Forward Primer End annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 15 How to Set a Sequence Region as the Reverse Primer Introduction Use the Reverse Primer tool for setting a particular sequence region as the reverse primer A primer specified using this tool does not need to meet the criteria specified in the Params page Note Only one Reverse Primer annotation is allowed in each Primer Express document Creating a new Reverse Primer annotation automatically deletes any existing one as well as deletes any Reverse Primer End annotations and incompatible Target annotations Adding a Reverse add a reverse primer annotation Primer Annotation Step Action 1 Click the Reverse Primer tool to select it The cursor changes to
6. CTGCAACAT GATGTGCTGA GATGGGAAAC CCAAAATNAT GGTAAATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG CAACCCAAAA AACAGCAGTC ACAGTCTAGG AAGTAAATGT AGAGCCCCTG ATGCTGGAGA AGTGTCTGCT Ready to Calculate To find primers select Find Primers Now under Options menu Sequence text underlined magenta 6 22 Using the Annotation Tools Modifying a Line You use the Select tool to move lengthen or shorten any existing Annotation line annotation For instructions on modifying or removing Line annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 23 How to Create a Junction Annotation Introduction Primary Uses Creating a Junction Annotation Use the Junction tool to create a junction annotation across two adjacent bases This tool allows the user to mark exon junctions When the Primer Express software calculates primers at least one primer in each pair crosses at least one exon junction One of the primary uses of the Junction Tool is to mark the positions of the exon junctions This creates primers that amplify only mRNA or CDNA made from it but not genomic DNA You can annotate sequence data on the Sequence page with any number of Junction annotations The following procedure describes how to create a junction annotation To create a junction annotation Step Action 1 C
7. Feature Description Primer Parameters that control the maximum number of Composition repeated bases default 2 and the maximum Requirements number of ambiguous bases default 0 allowed in each primer 5 22 Primer Express Pages Feature Description Primer Secondary Structure Requirements Parameters that pane control the maximum number of consecutive base pairings default 4 and maximum number of base pairings default 8 allowed Base pairings cause hairpin loops to form Primer Site Uniqueness Requirements Parameters that control the degree of similarity a primer has to any other region of the sequence Max Consec Match controls the maximum number of consecutive primer residues that match any other region default 9 Max Match controls the maximum allowable percentage of primer sequence that matches any other region default 75 Max 3 Consec Match controls the maximum number of consecutive primer residues at the 3 end that match any other region default 7 Primer Express Pages 5 23 How to Set Parameters Primer Design When starting an oligo design it is best to start with the default Strategy parameters until you have experience using the Primer Express software After you evaluate the primer pairs found using the default parameters then you can begin to modify one parameter at a time evaluating each time the effect of the previous change on the pr
8. AGAGCCCCTG ATGCTGGAGA AGTGTCTGCT GCAGCTGCCA TTGTTGCTGT TGTICCATIT GAACCAGGAT CATAAAGGNG GTGGICCTAA TGCTATDGGAA CACAAAGAGT AAGTGGCTTC ATCT AT CSRS GEAT F i Ae ee ee Atotal of 488 primer pairs found To examine primer pairs click the Primers tab 7 The Primer Express software uses the same criteria to evaluate candidate sequencing primers that it uses to evaluate PCR primers In addition you can specify Primer Position Requirements to make certain that all primers found are a specified distance from the end towards which they prime For more information about setting parameters for the Sequencing Primer document see Parameters Page for Sequencing on page 5 29 To start a new Sequencing Primer document choose New from the File menu and select Sequencing Primer Document from the submenu For more information about the pages contained in the Sequencing Primer document see Chapter 5 Primer Express Pages 4 60 Primer Express Documents Batch Processing Document When to Use the Document Batch Processing Document Example How Much You Can Import The Batch Processing document is used to process a group of sequence files automatically as multiple Primer Express documents A Batch Processing docum
9. Reverse Primer 58 GC 46 Start Probe AGCTGCCATTGTTGCTGTTGTTCCATT Tm Bg TGC 44 Start 100 150 200 250 200 250 400 450 471 Primer Express Documents 4 9 Primer and Probe We recommend the following guidelines for designing primers and Design Guidelines probes for custom 5 nuclease assays for quantitation Note The default values on the Params page in the Primer Express software follow the guidelines stated below Target Sequence and Amplicon Size Guidelines A target template is a DNA cDNA plasmid nucleotide sequence Design primers to amplify short segments of DNA within the target sequence These short segments are called amplicons The shortest amplicons work the best Consistent results are obtained for amplicon size ranges from 50 150 bp TaqMan Probe Design Guidelines Keep G C content the 30 80 range Avoid runs of an identical nucleotide This is especially true for guanine where runs of four or more Gs should be avoided Do not put Gs on the 5 end Select the strand that gives the probe more Cs than Gs The T of the probe should be 68 70 Primer Design Guidelines Choose primer sequences after you chosen the probe sequence Design primers as close as possible to the probe without overlapping the probe Keep G C content in the 30 80 range Avoid runs of an
10. aunts caw mews Mimo e ie 5 2 Pase Names Tab Names 5 2 NICW ING iet be inact te edic d 5 2 Dynamically Linking 5 3 Dynamic Linking Example 5 3 Standard Sequence LEX 5 4 ADoutdle stink be dat SE ae dink RE ERG Su 5 4 sequence Pase Exanple a uc RE d 5 4 DNA Sequence File 5 5 Alignment File 5 5 a bir 5 5 sequence Page Allele Specific PCR 5 8 ADoOUthlie Pase sos a o tS 5 8 Allele Specific PCR Sequence Page 5 8 Ig Pc PR 5 9 Wotking With Sequetngees s Sx eR eS ERE RE EE 5 11 IntfOGUCLIOIE ost EPA 5 11 a Sege s etes taco beoe dr fee 5 11 Epternne a SCQUCNCC vsu eene dete ede ta 5 12 Locking and Unlocking a 5 13 Editi a Sequence ai fece betes 5 13 Annota ng a 5 15 How to Find iov tee SERA FERS 5 16 Introduce HOn s ii cat
11. Factory Defaults button 5 22 Factura file type 2 FASTA file type C 2 Field Service in North America contacting 1 4 File menu 7 2 to 7 7 Close command 7 5 Export command 7 6 Import command 7 6 New command 7 2 7 3 Open command 7 3 to 7 4 Open Results command 7 4 to 7 5 Quit command 7 7 Save As command 7 5 files exported file types 3 imported file types 2 alignment files 2 navigation 5 11 Find and Exclude command 7 11 to 7 12 Find Primers Now command 7 14 to 7 15 Find Sequence command 7 9 to 7 11 how to find the sequence 7 10 Find Target command 7 11 forward primer definition Glossary 1 tool using 6 12 to 6 13 Forward Primer End tool using 6 14 to 6 15 Forward Reverse Primer Primer Test document 4 68 G GC Clamp Glossary 1 GC content parameters 5 20 GC test 2 GCG type 2 GenBank file type 2 getting started about the interface 3 5 about the tutorial 3 7 creating the Archive file 3 3 to 3 4 creating additional file 3 4 starting the first time 3 2 table of steps to use Primer Express 3 5 grouping See sequence H hairpin See secondary structure hardware requirements 2 2 Help button Rxn Cond page 5 31 hot start on Results page 5 51 I blue color Forward Primer End tool 6 14 blue color Forward Primer tool 6 12 blue color Reverse Primer End tool 6 18 blue color Reverse Primer tool 6 16 cursor 5 14 imported file types 2 alignment files C 2 importing command
12. Modifying a Probe You can use the Select tool to move lengthen or shorten any existing Annotation Probe annotation For instructions on modifying Probe annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 9 How to Exclude a Sequence Region Introduction Use the Exclude Region tool for specifying a particular sequence region that you want excluded from amplification by the PCR reaction Adding an Exclude To add an exclude annotation Annotation Step Action 1 Click the Exclude tool to select it The cursor changes to the red cursor 2 Position the l beam cursor over the sequence base where you wish to begin the Exclude annotation 3 Click and drag to highlight the desired data When you release the mouse button the highlighted sequence text is annotated as the excluded region using a strike through red line 5 Cycle Sequencing Primer 1 TeMRGeEHMMeG6 TRCCCTTTCR RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCRRCRTR RCCTRTGRRT GRTGTGCTGR GRTGGGRRRC CCRRRRTHRT GGTRRRTCRG RGTGGCRCTR RGGCCRTTGT CTCACCATGG CRRCCCRRRR RRCRGCRGTC ACAGTCTAGG TCTTTCCRGR RRGTRRRTGT RGRGCCCCTG RCRGRRCRCR TTCCTCCTTR CRBCRCTRTR RTGCTGGRGR RGTGTCTGCT vieron GCRRCTTCTC AGTCTCAAAG TGRCRGCRR GRRCCRGGRT CATARAGGNG datreroons RRCCTRTGCR TAGTCTTAGC CACAAAGAGT NAAAGGTCAA RRGTGGCTTC ATCTATG total of 105 prim r pairs found To examine primer pairs click the Pri
13. Display button on page 5 34 the results are sorted from low to high based on starting location The default sorting parameter is by Penalty score For more information see Appendix B Calculating Penalty Score The following table lists the actions that you can take Take this action Comment change the sort Click any heading to You can use the headings named order of the toggle the display from Start Length T GC and results low to high or Penalty to sort the primer results high to low view only the Select the checkbox Optimal results are calculated optimal primer labeled Optimal Only based on the values entered by results you or the default in the Parameters page under Optimal Tm and Optimal Length view interim Select Show Interim For more information see results of a variety Results from the Show Hide Interim Results on of primer Options menu page 7 15 calculations 5 36 Primer Express Pages Saving the List of save the primer results click the button labeled Save List Primer Primers results are saved to your hard drive as tab delimited ASCII text unformatted suitable for importing into a spreadsheet application How to Order Primers Ordering Primers Pressing the Order button displays a text window from which you can Modify the text Copy and paste the text into your regular electronic mail program Use the Save As command to save the text as a f
14. Each sequence annotation displays in a color identical to its counterpart annotation on the Sequence page The table below shows the relationship between the annotation graphics on the Sequence page and its counterpart in the feature map on the Map page 5 40 Primer Express Pages Feature Description Annotation Sequence page description Map page description Target Region green lower case text green outline around region Exclude Region red line through text red solid box through region Forward Primer light blue arrow 4 light blue solid arrow 4 Forward Primer End light blue dashed arrow J light blue dashed arrow J Reverse Primer light blue solid arrow T light blue solid arrow T Reverse Primer End light blue dashed arrow T light blue dashed arrow T ORF red 3 letter AA red outline arrow designations Line magenta line magenta outline around under text region Junction dark blue line dark blue solid small box under 2 bases Site dark blue arrow dark blue arrow with site with site name name Scroll Bars Two scroll bars let you view primer pair graphics that are outside the viewing area of the Primer pane Primer Express Pages 5 41 Primer Pane About the Primer Pane The Primer pane is the lower pane in the Map page and displays a graphic for each primer pair found by the Primer Express software
15. as oe ea ARCU Oe ee eee ees 3 1 How to Start the Primer Express Software the First 3 2 dec Ateneo wee yates Aes 3 2 Starting the Primer Express Software 3 2 How to Create the Primer Express Software Archive File 3 3 About tie Archive Pile o OC eR eR DR 3 3 Creatine the Archive Ele ee E EU P Eua de qd 3 3 Creating Additional Archive 3 4 How to Use the Primer Express 3 5 About the MENi E 3 5 MVIeWIng APACS sx saben qu VU Sede te dele ur eed 3 5 Process of Using the Primer Express Software 3 5 Howto Lear be Mex 3 7 Primer Express Software Applications Tutorial 3 7 Primer Express Software Document 3 7 Listof Document eeu reta ee a a crore t 3 8 4 Primer Express Documents 2 hea Aa 4 1 525 eod bh dud 4 1 About the Documents 2555255 des 4 3 What Are the Documents does 4 3 Each Document TY pC zinc ACER MC b ie A 4 3 Last ot DOCUMEIS OPUS
16. care ae ee Raw es 5 38 ADOMIS PAGE coda ee int Ve es C ERRANT EE PRG ER EE 5 38 Nap Pase Example 421222574 ARS 5 38 dat 5 39 555 Erb 5 42 Scale Control Buttons srties 2 9 e rebas he Sd 5 43 Map Pave tor Nested POR ous Ee bike ar act PUn s PUR cutn 5 44 ADOUCTIe Page oes oto et EE dr fuse Rs ec 5 44 Map Pace Example eio ih dede ob dies 5 44 SOPUTIS He PEITHCE 20 pct onec Uni 5 44 Standard ews E ER ROREM BE RS dev 5 45 About die Paseo cee s epe hate ease ade quat 5 45 Standard Recipe Page 5 45 ani e 5 46 Creating the Reaction Protocol 5 46 Recipe Page for Cycle 5 47 About lie do FRAN et 5 47 Results Pase Example ea e EE a 5 47 a sator dace ava ACE te Eee aed er bes 5 48 Recipe Page for Sequencing 5 49 ZADOUCIIIG oct io a ertet d dnb 5 49 Recipe Page Bx ample 41 ER den REN OG EG 5 49 en
17. correct the error in a subsequent release of the SOFTWARE which shall be supplied to you free of charge or ii accept a return of the SOFTWARE from you and refund the purchase price received for the SOFTWARE PE Corporation NY does not warrant that the SOFTWARE will meet your requirements will be error free or will conform exactly to the documentation Any sample or model used in connection with this Agreement is for illustrative purposes only is not part of the basis of the bargain and is not to be construed as a warranty that the SOFTWARE will conform to the sample or model Limitation EXCEPT AS SPECIFICALLY STATED IN THIS AGREEMENT THE Liability Term Miscellaneous SOFTWARE IS PROVIDED AND LICENSED AS IS THE ABOVE WARRANTY IS GIVEN IN LIEU OF ALL OTHER WARRANTIES EXPRESSED OR IMPLIED INCLUDING THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE NOTWITHSTANDING ANY FAILURE OF THE CENTRAL PURPOSE OF ANY LIMITED REMEDY PE CORPORATION NY S LIABILITY FOR BREACH OF WARRANTY SHALL BE LIMITED TO A REFUND OF THE PURCHASE PRICE FOR SUCH PRODUCT IN NO EVENT WILL PE CORPORATION NY BE LIABLE FOR ANY DAMAGES INCLUDING INCIDENTAL OR CONSEQUENTIAL DAMAGES EVEN IF PE CORPORATION NY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES You may terminate this Agreement by destroying all copies of the SOFTWARE and documentation PE Corporation NY may terminate this Agreement if you fail to comply with all of its
18. deleting annotations 7 8 Design Guidelines 4 7 discriminatory residue Glossary 1 DNA PCR document 4 39 applications 4 40 primer design considerations 4 40 to 4 42 DNA translating to amino acid sequence 6 20 to 6 21 documents about 4 3 to 4 6 Allele Specific PCR document 4 48 to 4 51 parameters page 5 27 Index 2 sequence page 5 8 to 5 10 Batch Processing document 4 61 to 4 63 using the document 4 64 to 4 66 Cycle Sequencing document 4 57 applications 4 58 to 4 59 parameters page 5 29 Recipe page 5 47 to 5 48 DNA PCR document 4 39 moving on the desktop 4 5 Multiplex PCR document 4 52 to 4 53 calculating primers 4 54 to 4 56 parameters page 5 25 to 5 26 Nested PCR document 4 46 to 4 47 Map page 5 44 Results page 5 52 to 5 53 primer design considerations 4 40 to 4 42 Primer Test document 4 67 to 4 68 about 4 67 features 4 68 starting the document 4 68 resizing 4 6 RT PCR document 4 43 to 4 44 selecting type Batch Processing 4 65 Sequencing Primer document 4 60 parameters page 5 29 Recipe page 5 49 TaqMan MGB Probe and Primer Design document 4 29 TaqMan Probe and Primer Design document 4 9 4 17 Documents on Demand 1 9 dUTPs 5 48 5 49 dynamic linking 5 3 E Edit menu 7 8 to 7 13 e mail address for technical support 1 3 EMBL file type C 2 enzyme See PCR enzyme Eraser tool using to delete annotation 6 5 exclude region definition Glossary 1 tool using 6 10 to 6 11 Export command 7 6 exported file types 3
19. end of the forward primer When you make an annotation of this type the Primer Express software calculates only those forward primers that end with the specified residue Note Only one Forward Primer End annotation is allowed in each Primer Express document Creating a new Forward Primer End annotation automatically deletes any existing one as well as deletes any Forward Primer annotations and incompatible Target annotations Adding a Forward The following procedure describes how to add a forward primer end Primer End annotation Annotation To add a forward primer end annotation Step Action 1 Click the Forward Primer End tool to select it The cursor changes to the blue l beam cursor 1 Position the cursor over the sequence base where you wish to begin the Forward Primer End annotation 6 14 Using the Annotation Tools Modifying Forward Primer End Annotation To add a forward primer end annotation continued Step Action 3 Click the mouse button to insert the Forward Primer End annotation Forward Primer End annotation inserted blue TaqMan Probe 3 L TCHMAGCWNGG AGAAAGAAAL CTGCAACAT GATGTGCIGA 100 GGTASATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG 150
20. or you can print the data file To create a Primer Data file a Import a sequence or alignment then calculate primers b Change to the Primers page Click the Save List button d Navigate to the location you wish to save the Primer Data file e Click Save to save the data File Types Supported PCR Enzymes and Primer Express Designating the PCR Enzyme Introduction The Reaction Conditions Rxn Cond page features a pop up menu for Each Enzyme For PCR Application designating the PCR enzyme used in the reaction This pop up menu contains four enzyme options AmpliTaq DNA Polymerase AmpliTag Stoffel Fragment rTth DNA Polymerase Each PCR enzyme has special salt and MgCl magnesium chloride requirements and is used for a different type of PCR application The salt and MgCl concentrations determine the quality of primers selected by the Primer Express software quality in this case is expressed primarily in terms of Tn PCR Enzymes and Primer Express D 1 Reaction The following is an example of the Reaction Conditions Rxn Cond Conditions Page page Diagram Enzyme pop up menu Pop Up Menu The following table lists the composition and uses of each enzyme Items contained in the pop up menu Menu item Description AmpliTag DNA Brand name for the generic Taq Thermus aquaticus Polymerase DNA polymerase which is a standard polymerase chosen for most gener
21. the Undo command does not function Use this command to find and exclude repeat sequences such as ALU or vector sequences The Find and Exclude commands find subsequences within the sequence text and marks those subsequences with the Exclude annotation The Find and Exclude dialog box provides several data fields to control the threshold at which similar sequence data is excluded along with buttons for adding and removing sequence files Primer Express Software Menus 7 11 EE Find and Exclude Mark Excluded subsequences with at least similarity over 20 residues to the sequences al Add Sequence Remove seguente 2 Cancel The following table describes the fields in the Find and Exclude dialog box Field Description Similarity Any data in the imported sequence that has similarity greater than or equal to the specified value default 75 is found and marked with the Exclude annotation For information about the Exclude annotation see How to Exclude a Sequence Region on page 6 10 Over X Residues Find and Exclude examines a window of the specified size default 20 to determine the similarity Add Use these buttons to add or remove sequences from Sequence Remove the scrolling pane Sequence buttons Show Hide Page Use this command to toggle the display of page breaks in the Breaks Command Sequence Primers and Map pages You can u
22. 1 From the File menu highlight New until the submenu appears to the right 2 Still holding down the mouse button move the cursor to the submenu then down to the document type you wish to open 3 Release the mouse button to open the new document Open Command General Information Use this command to open any document Figure 7 1 currently saved in the Primer Express software Archive file The saved documents are displayed in a Document Archive window that appears Sorting the Headings You can sort the headings by clicking one of the headings The heading currently used to sort is underlined default Name Note Use the Import option to open sequence or other files located in your program file For more information see Import Command on page 7 6 Document Archive Jof STET Delete Mame Sequence Length MumPP Type User bhod Date ox208 131 Primers 208 131 471 200 Administrator D6 08 200 2 Figure 7 1 Document Archive Window Primer Express Software Menus 7 3 About the Buttons The following table describes the buttons Button Description Open button Opens the selected highlighted document listed in the Document Archive Delete button Deletes the selected highlighted document from the Document Archive Help button Activates Primer Express Guide Open Results General Information Command Use this command to dis
23. 2 Stages for calculating primer pairs Stage Description 1 Calculate the length of the amplified sequence generated by the primer pair IF the THEN amplified sequence is too reject the primer long or too short amplified sequence is test further Amplicon acceptable Requirements Min Max Length 2 Calculate the difference between the T values of the forward and reverse primers in the pair IF the THEN difference exceeds the reject the primer parameter value parameter value is met test further Primer Tm Requirements Maximal Tm difference 3 Calculate the of the amplified sequence based GC content and length IF the THEN calculated is too high or too low reject the primer calculated T meets specification test further Amplicon Requirements Min Max Tm Table E 2 Stages for calculating primer pairs continued Stage Description 4 Calculate all possible primer dimer formation between the two primers IF THEN any 3 sequence data on reject the primer one primer matches any sequence data on the other primer there no 3 sequence the primer pair is acceptable data on one primer that matches any sequence data on the other primer 5 Up to 200 primer pairs are passed to the user If 200 pairs are passed then they are the 200 pairs with the lowest pe
24. 7 6 sequences 5 11 Inosine 1 installing 2 3 to 2 4 Interim Results window A 1 to A 5 tests A 2 to 5 viewing the window 1 Internet address customer training information 1 10 Documents on Demand 1 9 invalid base F 1 IUPAC codes 1 J junction annotation creating 6 24 to 6 25 L Line tool using 6 22 to 6 23 link dynamic 5 3 locking unlocking a sequence 5 13 M magnesium concentration D 1 definition Glossary 1 setting the concentration 5 51 Map page 5 38 to 5 43 about 5 38 changing scale 5 43 Index 3 features 5 39 to 5 41 Nested PCR documents for use 5 44 Primer pane 5 42 mg See magnesium concentration mispriming 4 modified bases F 1 modifying annotation 6 4 exclude annotation 6 11 Forward Primer annotation 6 13 Forward Primer End annotation 6 15 junction annotation 6 25 line annotation 6 23 probe annotation 6 9 Reverse Primer annotation 6 17 Reverse Primer End annotation 6 19 target annotation 6 7 translation annotation 6 21 moving documents 4 5 site annotations 6 27 multiple sequences importing 5 11 multiple targets 4 56 Multiplex PCR document 4 52 to 4 53 calculating primers 4 54 to 4 56 parameters page 5 25 to 5 26 sequence pop up menu 5 6 N nearest neighbor algorithm for calculations 1 Nested PCR document 4 46 to 4 47 Map page 5 44 Results page 5 52 to 5 53 New command 7 2 7 3 notebook concept 4 3 OD260 scale 5 31 oligo designs storing information about
25. CACCACCCAG nrThrThrGIn TS8RTCGTCBG etlIlellalfl 5 Multiplex 1 Rn Cond Primers Recipe Imported file BACMAL LI pop up CAGACACGAA GRRGCCGGGC CCGTGACATG CCCGCCATGG RCTGCTGCTC menu TTGCGACCCG ARAGCCGACT CCRCCCGCCT GATCCTGCAT TCCARGGCCC ylysHspPro LusRlaHspS erThrArgle leLeuHis SerLysHlab AGAACACCGT CATGGAGATG GCCGCRTCCG CCGGCTCGGG TGAAGACCTC To load a DNA file click the Import File button To enter data from the keyboard begin typing To start a new Multiplex PCR document choose New from the File menu and select Multiplex PCR Document from the submenu For more information about the pages contained in the Multiplex PCR document see Chapter 5 Primer Express Pages 4 52 Primer Express Documents Multiplex PCR Document Functions Multiplex PCR Document Options Setting Multiplex Parameters You can import up to 16 sequences into a Multiplex document then independently annotate each sequence For more information see Importing a Sequence on page 5 11 The following are standards for primer calculations in a Multiplex PCR document All primer pairs calculated must pass all tests for primers T values for all primers must be close to each other primer dimer reactions are allowed among any of the primers the reaction Amplified products of all PCR reactions must differ from each other in length by a user selectable margin sufficien
26. Determine the primer length IF the primer THEN is too long or too short reject the primer is acceptable test further Primer Length Requirements Min and Length 2 Count the number of ambiguous residues those that are not A C Gor T IF the primer THEN count exceeds the reject the primer specification count meets the test further Primer specification Composition Requirements Max Num Ambigs 3 Determine whether the primer has the required number of G or C residues at its 3 end IF the primer THEN does not quality reject the primer qualifies test further Primer GC Content Requirements 3 GC Clamp Theory of Operations 3 Table E 1 Stages for calculating individual primers continued Stage Description 1 Determine the GC content of the candidate primer IF the primer THEN GC content is too high ortoo reject the primer low GC content is acceptable test further Primer GC Content Requirements Min Max GC 2 Determine the T of the primer using the nearest neighbor algorithm IF the primer THEN T is too high or too low reject the primer Tm 5 acceptable test further Primer Requirements Min Max 3 Determine the longest run of repeated G bases in the primer IF the primer THEN exceeds the number of reject the primer repeated bases exceeds the specified maximum th
27. Diu Gin ds 5 28 Parameters Page for 5 29 Abou TMC ACC oco doses aie woes teases edo ind he ele tede bed 5 29 Parameters Page for Sequencing Documents Example 5 29 Sa b E EAE ee Oe oe ee dle uod 5 29 Reaction Conditions 5 30 About the P396 buie oe opt d qu Duda rc ada ew 5 30 Reaction Conditions Page 5 30 FCA rode ebd aite x M aat AN 5 31 Setting Reaction Condition 5 32 Primers Pace nce tie debt gas xd vL 5 33 ADOUE Che Page eo eub doa 5 33 Primers Page Example sariro topsn rana ho ek nS eS ER 5 33 Pure Avian 5 34 Primer DataoWIBdOWs dett Ce bf 5 35 Primer Data Window Examples 5 35 How to View the 5 36 Features of the Primer Data Window 5 36 WIC WAS PETI USES cairn so o ied he 5 36 saving the List of Primers 5 37 Howto Order Pines s 39290 dc ond bs 5 37 Ordering Preis doped ke dieu 5 37 IMAP Dee cad
28. Edit menu select Cut or Clear or you can press the Delete key 5 14 Primer Express Pages Step Action 5 If you make a mistake select Undo from the File Menu Note Undo Redo affects only the single most recent action in the Primer Express software How to Completely Remove the Current Sequence Data Step Action 1 Unlock the sequence data For more information on unlocking the sequence data see Locking and Unlocking a Sequence on page 5 13 2 From the Edit menu choose Select All to select all the current sequence data 3 Press the delete key to remove all sequence data from the Sequence page Note If you delete all the text of an imported sequence you cannot import another sequence file the Import DNA button is dimmed You must open a new document in order to import a sequence Annotating a You can mark annotate sequence data to control the location of Sequence primers and to highlight features of importance such as intron exon junctions excluded regions and so on For information about annotating a sequence see Chapter 6 Using the Annotation Tools Primer Express Pages 5 15 How to Find Primers Introduction Depending upon the power of your computer the document type the size of the sequence s and the quantity of annotations the Primer Express software can take from one second up to several minutes to find primers The sta
29. MSDSs and certificates of analysis see To Obtain Technical Documents on page 1 9 By E Mail To contact Applied Biosystems Technical Support by e mail for help in the following product areas Product Product Area E mail address Genetic Analysis DNA Sequencing galab appliedbiosystems com Sequence Detection Systems Real Time PCH and PCH pcrlab appliedbiosystems com Protein Sequencing Peptide and DNA Synthesis corelab appliedbiosystems com Biochromatography tsupport appliedbiosystems com ExpiditeX 8900 Nucleic Acid Synthesis Systems Mass Genotyping Solution 13 MGSI Systems PNA Custom and Synthesis Pioneer Peptide Synthesizers Proteonomics Solution 1 PSI Systems gt Reagent PerSeptive DNA PNA and Peptide Synthesis systems gt 8100 HTS System Mariner Mass Spectrometers Voyager Mass Spectrometers CytoFluor 4000 Fluorescence Plate Reader LC MS Applied Biosystems MDS SCIEX Chemiluminescence Tropix tropix appliedbiosystems com Introducing Primer Express Software 1 3 By Telephone or In North America Fax To contact Applied Biosystems Technical Support in North America use the telephone or fax numbers in the table below Note To schedule a service call for other support needs or in case of an emergency dial 1 800 831 6844 then press 1 ABI PRISM9 3700 DNA Analyzer 1 800 831 6844 1 650 638 5981 then press 82 DNA Synthesis 1 800 831 6844 1 650 638 5981 press
30. MgCl magnesium chloride after chelation of the manganese ion with Ethyleneglycol Bis aminoethylether Tetraacetic Acid EGTA Consequently you can use rTth as both a thermostable reverse transcriptase and as a thermostable DNA polymerase in successive reactions in the same tube PCR Enzymes and Primer Express D 3 Theory of Operations Introduction In This Appendix This section describes the internal processes that the Primer Express software uses to calculate satisfactory PCR primer pairs For complete descriptions of the Individual tests shown in the Interim Results window see Appendix A Interim Results Window Effects of individual annotations on finding primers see Chapter 6 Using the Annotation Tools Topics in this appendix include the following Topic See page How the Primer Express Software Finds Primers E 2 Stages for Calculating Individual Primers E 3 Stages for Calculating Primer Pairs E 6 Theory of Operations 1 How the Primer Express Software Finds Primers E 2 Overview Primer Pair Searching Order of Tests Theory of Operations The Primer Express software finds PCR primer pairs by screening potential primer pairs against default or user supplied criteria then returning only those pairs that meet the criteria A series of tests to find acceptable primer pairs are performed first on all candidate primer sequences then further on those forw
31. PCR document is different in several ways Unlike most other Primer Express documents the Multiplex PCR Parameters page does not have a Fewer Params option because of the many parameters required to set up a Multiplex PCR document The Multiplex PCR Parameters page also contains a Primer End Composition pop up menu Multiplex PCR following is an example of the Parameters page for Multiplex PCR Parameters Page Example Multiplex 2 Params Primer Express Pages 5 25 Features The following table lists the features for the Parameters page for Multiplex PCR For a description of the complete set of parameters available see Standard Sequence Page on page 5 4 Feature Description Max Difference Sets the maximal difference among any set of two Among Sets primers which guarantees that all primer pairs in the Multiplex PCR have similar T s default Primer End The Last four positions contain pop up menu provides Composition four options that help to avoid 3 end complementarity by controlling the makeup of the final four bases in the primers Choose one of the following four options Maximal A Low T No C default Maximal T Low A No C Maximal C A Low T No Maximal C T Low A No Controlling the base composition at the 3 ends allows you to prevent the possibility of primer dimer formation among any of the primers in the reaction No one o
32. Processing document This button is inactive until at least one sequence file has been added Prefs Button Displays the Preferences dialog box For more information see Preferences Command on page 7 13 Go Button Causes the Primer Express software to calculate primers for every sequence file contained in the Batch Processing document While primers are being calculated the button becomes the Stop button Click the Stop button to interrupt the primers being calculated The Go button becomes inactive after primers have been calculated for all the sequences in the Batch Processing document Primer Express Documents Item Description Summary Button Displays a window Figure 4 3 that contains the number of primers calculated and the primer data for each sequence in the Batch Processing document This button is active only after primers have been calculated You can copy the text in the Summary window and paste it using standard PC commands Batch 1 Summary PCR Primer Pairs found for the sequence ACHIFH Best primer pair Forward Primer CTGGACTTCGTGTTCTACGACG 695 716 Tm 59 860 55 Length 22 nt Reverse Primer AACTCCATCAGCAGCTCTTICG 1152 1132 Tm 56 60 52 Length 21 nt Amplicon Length 458 bp Im 65 GC 62 62 0 Nested PCR Primer Pairs found for the sequence oxz08 131 0 Taghan Sets found for the sequence RATNALS Sequencing Primer
33. Several different numerical attributes are shown next to each primer pair graphic Figure 5 5 Forward primer Heverse primer Amplicon length 152 bp Forward 125 276 Reverse primer start Tm 8n Tm 52 primer start location location Amplicon Forward primer Reverse primer Figure 5 5 Primer pair graphic Sorting the List You can sort the list of primer pair graphics by any of the attributes The current sort is shown by the attribute being underlined Click on the attribute to toggle the sort between a low to high or high to low sort 5 42 Primer Express Pages Scale Control You can change the scale magnification of the display using the scale Buttons controls located at the bottom left of the Map page The following table describes how to use the scale controls IF you want to THEN click the Zoom in plus sign Zoom out minus sign Select the scale a Click and hold the view scale amp 15 21818 The pop up menu appears You need a ce for primers b Select the desired scale from the pop up menu Primer Express Pages 5 43 Map Page for Nested PCR About the Page Map Page Example Internal primer pair External primer pair Sorting the Primer The Map page for a Nested PCR document graphically shows both the external and internal primer pairs The following is an example of the Map page for Nested
34. To import DNA file for generating a list of potential primers and probes Step Action 3 Select the following checkboxes for primer selection Double Stranded Limit 3 G C The sense and antisense sequences appear on the Sequence tab 4 Label the polymorphism within the sequence using the Line tool a From the Tools palette click the Line tool b Select the polymorphic sequence Polymorphism TATCCGCTCA CAATTCCACA CAACATACGA GCCGGAAGCA ATAGGCGAGT GTTAAGGTGT GTTGTATGCT CGGCCTTCGT The software automatically underlines the polymorphism 5 Following steps 1 4 import the sequence for the other allele into a separate TaqMan Probe document Primer Express Documents 4 19 TaqMan Probe The location of the polymorphism dictates the placement of the probe Design Guidelines Because mismatches near the end of the probes tend not to be as disruptive to hybridization Applied Biosystems generally recommends designing probes so that the polymorphic site is near the center of the probe Guidelines for Designing TaqMan Probes Use the VIC and FAM reporter dyes to label the allelic discrimination probes Avoid runs of an identical nucleotide This is especially true for G where runs of four or more Gs should be avoided The Primer Express software estimated T for the probes should be between 65 67 The 5 end of a probe cannot be G residue G residue adjacent to the reporter dye
35. Use the Select tool to select and copy sequence text as well as modifying annotations Selecting Sequence When you move the cursor over the text in the Sequence page the Text arrow cursor x changes to an Il beam cursor similar to that used in many word processing programs To select sequence text click and drag to highlight the desired data Once sequence text is selected you can cut or copy the text using standard PC commands or you can copy the text into a clipping file Modifying an You can use the Select tool to move lengthen or shorten existing Annotation annotations The following procedure describes how to modify an annotation To modify an annotation Step Action 1 Click the Select tool on the tool palette 2 If any sequence text is highlighted click anywhere in the text to eliminate the highlighting Note You cannot modify an annotation when any sequence text is highlighted 3 Position the Select tool cursor over the beginning or end of the annotation 4 When in the correct position the arrow or cursor changes to the transparent open hand cursor 5 Click and hold the cursor The end piece of sequence data highlights with a small highlight box 6 To move or change the length of the annotation drag the highlight box in any direction 6 4 Using the Annotation Tools Removing an Annotation You can remove many but not all annotations by
36. Using a Nested Primer Gene Amplification Assay Journal of Clinical Microbiology 28 9 1913 1917 Rychlik W 1995 Priming Efficiency PCR Biotechniques 18 1 84 Bibliography References H 1 Rychlik W Spencer W J and Rhoads 1990 Optimization of the annealing temperature for DNA amplification in vitro Nucleic Acids Research 18 21 6409 6412 Sanger F Nicklen S and Coulson 1977 DNA sequencing with chain terminating inhibitors Proceedings of the National Academy of Sciences USA 74 5463 5467 sommer S S Groszbach and Bottema C D K 1992 PCR Amplification of Specific Alleles PASA is a General Method for Rapidly Detecting Known Single Base Changes Biotechniques 12 1 82 87 Tada M Omata Kawai S Saisho Ohto Saiki R K and oninsky J J 1993 Detection of ras Gene Mutations in Pancreatic Juice and Peripheral Blood of Patients with Pancreatic Adenocarcinoma Cancer Research 53 2472 2474 H 2 Bibliography References Software License PE Corporation NY Software License and Limited Product Warranty Warranty Statement Copyright License PURCHASER CAREFULLY READ THE FOLLOWING TERMS AND CONDITIONS THE AGREEMENT WHICH APPLY TO THE SOFTWARE ENCLOSED THE SOFTWARE YOUR OPENING OF THIS PACKAGE INDICATES YOUR ACCEPTANCE OF THESE TERMS AND CONDITIONS IF YOU DO NOT ACCEPT THEM PROMPTLY RETURN THE COMPLETE PACKAGE TO APPLIED B
37. a lowercase letter 4 Highlight potential probe sequences until you identify a probe that meets the guidelines outlined in TaqMan Probe Design Guidelines on page 4 20 5 With the desired probe sequence highlighted select Trim from the Edit menu The software eliminates all but the selected nucleotide sequence from the Primer Test document 4 24 Primer Express Documents Designing Primers To design the probe for Allele 2 continued Step Action 6 Copy and paste the final sequence for the Allele 2 probe into a text document for ordering After selecting probes for the assay choose primers based on the guidelines below Amplicons should be 50 150 bp in length By limiting the parameters for amplicon design such as amplicon size it is possible to run all reactions with a single reaction buffer such as TaqMan Universal PCR Master Mix P N 4304437 and a single thermal cycling protocol Guidelines for Designing Primers Avoid runs of an identical nucleotide This is especially true for guanine where runs of four or more should be avoided The T of the primers should be 58 60 C Keep the C content within 30 80 Make sure the last five nucleotides at the 3 end contain no more than two C residues Place the forward and reverse primers as close as possible to the probe without overlapping it Steps for Designing Primers IMPORTANT Design primers after
38. a Sequence on page 5 13 2 Length Shows the number of base pairs contained in the sequence being displayed on the Sequence page If no sequence file has been imported this display reads bp 3 File Name Shows the name of the sequence currently imported into the document In a Multiplex PCR document the names of all imported sequences appear in a pop up menu The name of the sequence currently displayed on the Sequence page appears in the pop up menu If no sequence file has been imported this display reads No File Loaded You can change the text in the File Name data display by highlighting the existing name and typing a new name If you change the sequence name then use the Export function For more information see Printing Settings on page 7 6 Selection Shows the beginning and ending range of highlighted bases Import DNA Allows you to import a sequence file through the standard PC file navigation File button dialog box In a Multiplex PCR document you can import multiple sequences After you import a file the button is grayed out except Multiplex PCR For more information on importing sequences see Importing a Sequence on page 5 11 6 Double When the checkbox is selected displays both strands of the sequence data Stranded View Checkbox 7 Limit 3 G C Used in TaqMan probes used to limit the guanine cytosine residues in analysis 8 Sequence Contains sequence data entered using the keyboard or imported Data
39. a technique used to improve either the sensitivity or the specificity of PCR by using two sets of PCR primers instead of one For example nested PCR is often chosen for single cell amplification or to amplify a single gene from an array of duplicated or pseudo genes Nested PCR is also used to generate PCR templates from genomic DNA for subsequent DNA sequencing An inner and outer set of primers are used in nested PCR Typically the outer primers are used for the initial cycles of amplification of the target DNA The inner primers are used for subsequent cycles of amplification to produce a highly specific PCR product Because of the complexity of the nonspecific complementarity of primer primer and primer template sequences the Primer Express software makes it a lot easier to design primers for Nested PCR For more information on Nested PCR refer to Plikaytis et a 1990 Primer Express Documents 4 47 Allele Specific PCR Document When to Use the Document Allele Specific PCR Document Example The Allele Specific PCR document is designed for calculating primers that amplify a sequence within one or more alleles and that specifically do not amplify a sequence within one or more different alleles You can also design a universal primer that amplifies all the alleles The following is an example of an Allele Specific PCR document showing the Sequence page 5 Allele Specific PCR 1 To load a alignment file click
40. ah agate ERE rU ausu esed mpi 5 49 IRE SUNS Paes erano eue treed Salida eeu ae oat ei nde a ahha 5 50 ZADOUC TNE Ed deo gh d dh ee oh 5 50 Examples 25 4 060 ebd 5 50 mun NULLE a deba e e Ro dE 5 51 Results Pace Tor Nested ord howd Rew TES eR be 5 52 ZABOUEC le Dae cou era drca Cera e sace e e e t hia 5 52 Results Page 5 52 Annota ng Your Results s 5 52 Savine YOU Results ied e ae ee ee 5 52 Viewing and Modifying Saved 5 65 5 53 Other Primer Express Software Views 5 53 Bate PROCES SINS ues aes 5 53 Primer TSC ous Ie desde 5 53 Using the Annotation Tools InttOdU e DOT 426 us ue BEE aM I M Ea e qn Pbi 6 1 En Eis Chapter ts eu dd doe tto deal odo Ted idea 6 1 About the Annotation 1 5 6 2 Itt Oct EO IO aad eR ETE S 6 2 Annotation Tool Palette 6 2 TOOL OTOBUDITIUS dd ata S axes WEG Ete 6 3 IVIovane the Pale Me oio Ta qot INE tae pire deo 6 3 Selecting and Moving Sequence 6 4 Pr m 6 4 Se
41. an Annotation on page 6 4 You can use the Eraser tool to remove any existing junction annotations For instructions on removing junction annotations see How to Delete Annotations on page 6 5 Using the Annotation Tools 6 25 How to Create Restriction Enzyme Site Introduction Use the Site tool to create restriction enzyme or cloning site annotations When you insert a site annotation you can name the site with a label containing up to 15 characters Adding Site To add site annotations Annotations Step Action 1 Click the site tool to select it Site The cursor changes to the site arrow cursor Position the site arrow cursor over the sequence base you wish to annotate and click the mouse button to insert the site annotation 5 TaqMan Probe 3 208 131 E ns L TCHMAGCWNGG TACCCTTTCA AAAAAAAAAA GATGTGCTGA CCAAAATNAT 100 GGTASATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG 150 AACAGCAGTC TCTTTCCAGA AGAGCCCCTG 200 ACAGAACACA TTCCTCCTTA ATGCTGGAGA AGTGTCTGCT 250 fi be GCAGCTGCCA TTGTVGCTGT TGTTCCATTT GCAACTTCTC 300 GTGACAGC AS CATASAGGNG GTGGICCTAA 350 TGCTATGGSA
42. available only in a TagMan Probe and TagMan MGB document and takes the place of the Target tool The Probe tool is used in the same way as the Target tool Figure 6 1 shows how the Probe appears on the Sequence page after primers and probes are calculated TRCCCTTTCR RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCARCATA RCCTRTGRRT GATGTGCTGA GRTGBGRRRC CCRRRRTHRT GGTRBRTERG AGTGGCACTA CTCACCATGG CRRCCCRRRR AACAGCAGTC ACAGTCTAGG TETTTCCRGR RRGTRRRTGT AGAGCCCCTG RCRGRRCRCR TTCCTCCTTA CAGCACTATA ATGCTGGAGA AGTGTCTGCT GCAGCTGCCA TTGTTGETGT TGTTCCATTT GCARCTTCTC AGTCTCARAG GTGRCRGCRR GRRCCRGGRT CATARAGGNG GTGGTCCTRR TTGACAAGGC TGCTRTGGRR RRCCTRTGCR TAGTCTTAGC CRCRRRGRGT NARAGGTCAR AAGTGGCTTC 95 FREER ES EERE HH Primers total of 53 primer pairs found To examine primer pairs click the Primers tab Figure 6 1 TaqMan Probe document 6 8 Using the Annotation Tools Adding a Probe To add a probe annotation Annotation Step Action 1 Click the Probe tool to select it BS Probe The cursor changes to the green 1 cursor 2 Position the l beam cursor over the sequence base where you wish to begin the target region annotation 3 Click and drag to highlight the desired data When you release the mouse button the highlighted sequence text is annotated in green lower case text as the Probe region
43. deletes any existing one as well as deletes any Reverse Primer annotations and incompatible Target annotations Adding a Reverse The following procedure describes how to add a reverse primer end Primer End annotation Annotation To add a reverse primer end annotation Step Action 1 Click the Reverse Primer End tool to select it The cursor changes to the blue beam cursor 7 Position the cursor over the sequence base where you wish to begin the Reverse Primer End annotation Click the mouse button to insert the Reverse Primer End annotation 5 TaqMan Probe 3 Params RxnCond Primers Recipe Results ox208 131 rose MEI RIS TCNAGCNNGG AAAAAAAAAA AGAAAGAAAG AAAAAGAAAT CTGCAACAT ACCTATGAAT GATGTGCTGA GATGGGAAAC CCAAAATNAT GGTAAATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG CAACCCAAAA ACAGTCTAGG AAGTAAATGT AGAGCCCCTG TTCCTCCTTA CAGCACTATA ATGCTGGAGA AGTGTCTGCT GCAGCTGCCA TTGTTGCTGT TGTTCCATTT GCAACTTCTC AGTCTCAAAG GTGACAGCAA GAACCAGGAT CATAAAGGNG GTGGTCCTAA TTGACAAGGC TGCTATGGAA AACCTATGCA TAGTCTTAGC NAAAGGTCAA AAGTGGCTTC ATCTATGGNG TNNTTTGA L GCCTAAAATT ANCATGAATG NAATGTTAAG N Ready to Calculate To find primers select Find Primers Now under Optibns menu
44. displays the number of primer pairs found up to a maximum of 200 primer pairs If 200 pairs are found then they are those 200 that have the lowest penalty scores of all possible pairs for more information about penalty scores see Appendix B Calculating Penalty Score The complete set of primers found is listed on the Primers and Map pages If you are dissatisfied with the number of primer pairs found you may make sequence annotations or change parameters on the Rxn Cond or Params pages For information about Making sequence annotations see Annotating a Sequence on page 5 15 Changing parameters see on page 5 28 Standard Parameters Page on page 5 19 or the Reaction Conditions Page on page 5 30 Primer Express Pages 5 17 When the Primer When the Primer Express software does not find primers the status bar Express Software displays the message No Acceptable Primer Pairs Found Does Not Find Primers To generate primers make one or more of the following changes Change or more parameters on the Params page Start by 5 18 Primer Express Pages relaxing the and Primer Length parameters For information about changing parameters see Standard Parameters Page on page 5 19 Import a different sequence by opening a new Primer Express document Erase or change one or more sequence annotations For information about making sequence annotations see Annotating a Sequence on page 5 15
45. eee 6 24 oue cba Pp SET a 6 24 Creating a Junction Annotation 6 24 Modifying a Junction Annotation 6 25 Removing a Junction 6 25 How to Create Restriction Enzyme 6 26 ntfOdue HOD 43 os pa Sm PRESE he hawk le ae ehh Ge ees 6 26 Adding Site Annotations 6 26 Moving a Site Annotation 6 27 Removing Site 6 27 7 Primer Express Software Menus EntEOG UC ODE n a DOS ERROR be dut pe 7 1 eap een hy E S ete qute decuit des 7 1 rp 7 2 About the File Menu Qe IR S e eR ea ares 7 2 New COminanG a ctl qu PY a NEN 7 2 Command x22 212322455803 qutt Rate ts 7 3 Open Results C 2249 5 441555 oh died viae edu uS 7 4 Close Command eded nr aos pus Robes etre 7 5 Save Save As Command ue 7 5 Inport COImtiand os uus heels DURS hoe P 7 6 Expor CODI ia adu 7 6 Prirntine Settihgs cei ada Set ueni Senn bd enis 7 6 Quit Omi ain at Ra o ent act et ule 7 7 PGES INES ox pss oor Satius acu
46. file as an unformatted text file ASCII Text The Primer Express software recognizes only unformatted ASCII text You cannot import formatted files from word processing or page layout programs such as Microsoft Word or PageMaker To import the sequence text from these applications save the file as an unformatted text file Imported You can import the following file types into an Allele Specific document Alignment Files File type Description Sequence ABI PRISM software for producing multiple alignments Navigator C 2 File Types Supported Exported Files Table of Exports following table lists the files that you can export Files File Description Primer Express File A Primer Express file is a complete Primer Express document saved on your hard disk that you can transfer between users or computers To create a Primer Express software file a Import a sequence or alignment then calculate primers b Select Export from the File menu c Navigate to the location you wish to save the Primer Express document d Click Export to save the document Primer Data File A Primer Data file is a text file that contains tab delimited text including headings from the Primers page of a Primer Express document A Primer Data file is saved on your hard drive so you can import the data into a word processor spreadsheet or other application
47. importing a sequence 5 11 locking locking a sequence 5 13 Sequencing Primer document 4 60 parameters page 5 29 Recipe page 5 49 Sequencing Primer Recipe page stock concentrations 5 49 Show Page Breaks command 7 12 Show Hide Annotation Tools command 7 15 Show Hide Interim Results command 7 15 Show Hide Primer Data command 7 15 Show Hide Primer Secondary Structure command 7 16 Show Hide Status Bar command 7 16 site arrow cursor 6 26 Site tool using 6 26 to 6 27 site restriction enzyme locating 7 9 slop factor See pipeting excess software requirements 2 2 virus protection 2 3 sorting primer data 5 3 Standard Parameters page 5 19 to 5 23 about 5 19 features 5 20 to 5 21 more parameters 5 22 Standard Recipe page 5 45 to 5 46 Standard Sequence page 5 4 to 5 6 status bar using 4 6 stock concentrations number of tubes 5 46 pipeting excess 5 46 reaction volume 5 46 5 48 5 49 Results page 5 48 Sequencing Primer Recipe page 5 49 volume 5 46 Stoffel See PCR enzyme Index 7 T4 definition Glossary 2 Taq Polymerase See Standard Recipe page TaqMan Assay Design Guidelines 4 7 TaqMan Conventional Probe about 4 8 amplifying custom target sequences 4 9 amplifying target sequences 4 16 definition Glossary 2 generating a list of candidate primers and probes 4 11 Primer and Probe Design Guidelines 4 10 quantitation 4 9 selecting primers and probes 4 14 TaqMan Probe and Primer Design document 4 9 using for allelic discrimination
48. label from the Sites pop up menu If you select one of the common restriction site labels from the pop up menu the sequence that corresponds to that label appears in the upper entry field and the site label appears in the lower entry field If you wish the Primer Express software to label the sequence differently from the default enter the label in the lower entry field If you leave the label field empty the Primer Express software underlines any sequences found rather than label the sequence with a site annotation 7 10 Primer Express Software Menus Find Target Command Find and Exclude Command To find a sequence continued Step Action 3 Press OK to find and annotate the sequence Note The Undo option does not function after the Find Sequence or Find Target option has been used Use this command to simultaneously find and annotate occurrences of repeated patterns on the Sequence page The Find Target dialog box appears Find Target beginning of the sequence 7 For example if you use the default data in the Find Target dialog box the Primer Express software searches for the sequence CACACACACACACACA Any sequence data that matches the specified repeated sequence data pattern is annotated as a target region For more information see How to Specify a Sequence Region on page 6 6 Note After you have used the Find Sequence or Find Target command
49. over a network If you have changed the sequence name on the Sequence page this name is used in the Export navigation dialog box Printing Settings The following table lists settings for printing the sequence primers and map pages Printing settings To print the Set Sequence Print Setup page Reduce or Enlarge 90 Orientation Landscape mode Document Setup Resize the Primer Express document to 100 bp wide This produces a printed page that holds up to 3600 bp Primers page The data on the DNA PCR Primers page forward primer reverse primer and amplicon data fits best on a standard 8 5 x 11 inch paper Print Setup Reduce or Enlarge 85 Orientation Landscape mode If you are printing a Primer Express document that has more heading on the Primers page Nested PCR or Multiplex PCR you have to experiment with reduction and page orientation 7 6 Primer Express Software Menus Printing settings continued To print the Set Map page You have to experiment to determine the best layout for printing your Map page If you are printing at 1X magnification then set up your printer as follows Print Setup Reduce or Enlarge 100 Orientation Portrait mode Quit Command Note You cannot save Batch Processing and Primer Test documents Use this command to exit from an application If you quit after adding or modifying sequence data you can save the
50. regions as part of a sequence file or you can annotate them For more information see How to Exclude a Sequence Region on page 6 10 To increase the number of primer pairs found remove or shorten any Exclude Region annotations The T Match Test calculates the difference between the T values for the forward and reverse primers If this difference is less than or equal to the Maximal Difference value the primer pair passes this test To increase the number of primer pairs found increase the Maximal Tm Difference parameter values The Amplicon Test calculates the of the amplified sequence based on GC content and length If the calculated is greater than or equal to the Amplicon Min T value and less than or equal to the Amplicon Max T value the primer pair passes this test To increase the number of primer pairs found increase the Amplicon Max parameter value and or decrease the Amplicon Min parameter value The Target Test checks each primer pair to determine if the Target Region is amplified If the Target Region is amplified the primer pair passes this test Target Region annotations are made by the user For more information see How to Specify a Sequence Region on page 6 6 To increase the number of primer pairs found remove or shorten any Target Region annotations Interim Results Window A 5 Calculating Penalty Score About Penalty Score Assigning Penalty When calculating prim
51. residues outside the selected region from the calculation Probe 2 GTGBRH sd Tm 667 xot 533 Length 15 Excluded from the calculation Tm reflects this region only From the Edit menu select Trim The software eliminates all but the selected nucleotide sequence from the TaqMan MGB Probe Test document Copy and paste the final sequence for the Allele 1 probe into a text document for ordering Double click the unused Allele 1 probe sequence and press the delete key The software clears the unused probe sequence from the TaqMan MGB Probe Test document 4 34 Primer Express Documents To design the probe for Allele 1 continued Step Action 9 Label the selected Allele 1 probe a From the TaqMan MGB Probe document for Allele 1 click the Sequence tab b Click the Probe tool Probe c Highlight the final probe sequence The software labels the probe in green lowercase letters Probe TATCCGCTCA CAATTCCACa caacataega gecoGAAGCA TAAAGTGTAA Sequence ATAGGCGAGT GTTAAGGTGt gttgtatget eggeCTTCGT ATTTCACATT Designing the Allele 2 Probe To design the probe for Allele 2 Step Action 1 In the TaqMan MGB Probe document for Allele 2 click the Sequence tab The Sequence tab appears Primer Express Documents 4 35 To design the probe for Allele 2 continued Step Action 2 Se
52. temperatures of the primers to greater than 50 C to help reduce the likelihood of mismatch extension Use of the Stoffel fragment of DNA polymerase helps to reduce false positives in many allele specific PCR assays If Stoffel is used consider salt concentrations in the Stoffel buffer for estimating primer T m For more information on Enzyme selection see Appendix D PCR Enzymes and Primer Express Allele specific PCR refer to Sommer et al 1992 and Tada et al 1993 Primer Express Documents 4 51 Multiplex PCR Document When to Use the Document Multiplex PCR Document Example Starting the Document The Multiplex PCR document is used to calculate many sets of primers that you can use in the same PCR reaction to amplify many different target sequences simultaneously The following is an example of a Multiplex PCR document showing the Sequence page CGTCGCCGCA CGCCRCTTCC TGCRCCRGCC ATGGGAACGS ATCGCCGCOG CGTTACTACC CGACGCAGAT CGCTGCCGTC CGRCTCCCGR RRRTRTCGCT GRRRRCRTRT TRCTGGTTTT CATATGAAAT TCRCRTCTTG RTGGCRCCRC CACCAGTCAA RCGCCRCGRR TCAATGGAGG AGTGTGCAAT TTRCGGCRRG GGTGGTRTCG InCysAlall eTyrGlyLys GlyGlylleG RRCCT6GTCG CCGCGCTCGC C6RGGCCGGC AsnLeullalA loAlaleuAl oGluAlaGly GGCATGAACC GGTACGCCOC CACATGCCAT TTTATCCAAA CCTTGCTCCA TTCCRRGRTG Met GCAAGTCCAC lyLysSertTh RRGRRGGTGR LuysLuslla 1T CCGGTACCAC CAGCCCGGGA ATGCAGCATG RRRCRRRCRR TCCCCTGCGA GCATTGCGTC AlaLeuArgG
53. terms in which case you agree to return to PE Corporation NY all copies of the SOFTWARE and associated documentation 1 Failure to enforce any of the terms and conditions of this Agreement by either party shall not be deemed a waiver of any rights and privileges under this Agreement 2 In case any one or more of the provisions of this Agreement for any reason shall be held to be invalid illegal or unenforceable in any respect such invalidity illegality or unenforceability shall not affect any other provisions of this Agreement and this Agreement shall be construed as if such invalid illegal or unenforceable provisions had never been contained herein 3 This Agreement shall be construed and governed by the laws of the otate of California 4 This Agreement and the PE Corporation NY Sales Quotation constitute the entire agreement between PE Corporation NY and you concerning the SOFTWARE Software License 1 3 Glossary 5 Tail A short sequence added to the 5 end of a primer The addition of a 5 end tail provides an increased number of sequences that can be used either as universal priming sites for sequencing or as restriction enzyme sites for cloning When a 5 tail is entered the Primer Express software calculates two T for the sequence specific primer and one T for the tailed primer Tm data is displayed as a double number separated by a virgule forward slash for example 60 76 The G C co
54. the Import Alignment File button How to Use the The Allele Specific document imports only sequence alignments Document You can take the following action Result Select which sequences in the alignment you want amplified and which not Each primer pair found must contain at least one discriminatory residue The Primer Express software determines which residue positions discriminate between sequences in the amplified set and those in the not amplified set The Sequence page see DNA PCR Document Example on page 4 39 is unique to the Allele Specific PCR document For information describing the features of the Allele Specific Sequence page see Features on page 5 9 4 48 Primer Express Documents Starting the To start a new Allele Specific PCR document choose New from the File Document menu and select Allele Specific PCR Document from the submenu For more information about the pages contained in the Allele Specific PCR document see Chapter 5 Primer Express Pages Primer Express Documents 4 49 About Allele Specific PCR Applications What is Allele Allele specific PCR is a technique used to identify point mutations that Specific PCR occur at known locations in a target DNA for example sickle cell anemia This method allows direct detection of mutations in genomic DNA without probe hybridization ligation or restriction enzyme cleavage Process The following describes the ho
55. the blue beam cursor 7 Position the cursor over the sequence base where you wish to begin the Reverse Primer annotation Click and drag to highlight the desired data When you release the mouse button the highlighted sequence text is annotated as the Reverse Primer Probe 3 208 131 mpoto TTCCTCCTTA CAGCACTATA ATGCTGGAGA AGTGTCTGCT GCAGCTGCCA TTGTTGCTGT TGTTCCATTT GCAACTTCTC AGTCTCAAAG ANCATGAATG NAATGTTAAG M Ready to Calculate To find primers select Find Primers Now under Optionls meni Reverse Primer annotation inserted blue 6 16 Using the Annotation Tools Modifying a You use the Select tool to move lengthen or shorten any existing Reverse Primer Reverse Primer annotation For instructions on modifying or removing Annotation Reverse Primer annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 17 How to Select a Sequence Region as Reverse Primer End Introduction Use the Reverse Primer End tool for setting a particular sequence residue as the end of the reverse primer When you make annotation of this type the Primer Express software calculates only those reverse primers that end with the specified residue Note Only one Reverse Primer End annotation is allowed in each Primer Express document Creating a new Reverse Primer End annotation automatically
56. the file to save the results The file will be saved in the Primer Express Document Archive folder IMPORTANT Itis not necessary to design primers for the Allele 2 probe as the same primer pair will be used for both Allele 1 and Allele 2 Note The reaction conditions recipe and results pages should not be used when designing a TaqMan probe assay 4 26 Primer Express Documents Using TaqMan MGB Probes for Amplifving Target Sequences for Allelic Discrimination How Allelic In allelic discrimination assays the PCR assay includes a specific Discrimination fluorescent dye labeled probe for each allele The probes contain Assays Work different fluorescent reporter dyes FAM and VIC to differentiate the amplification of each allele During PCR each probe anneals specifically to complementary sequences between the forward and reverse primer sites AmpliTaq Gold DNA polymerase can cleave only probes that hybridize to the allele Cleavage separates the reporter dye from the quencher which results in increased fluorescence by the reporter dye Thus the fluorescence signal s generated by PCR amplification indicate s the alleles that are present in the sample Mismatches Between Probe and Allele Sequences Mismatches between a probe and allele reduce the efficiency of probe hybridization Furthermore AmpliTaq Gold DNA polymerase is more likely to displace the mismatched probe rather than cleave it to release reporter dye
57. well as view and sort primer data on several different pages Each page of the Primer Express software is dynamically linked to all the others so that when you sort data or calculate primers on one page the results are reflected on every page see Dynamic Linking Example Dynamic Linking The following is an example of the Sequence page Primers page and Example Map page showing feature connected by means of dynamic linking Sequence page GTGACAGCAA GAACCAGGAT CATAAAGGNG GTGGTCCTAA TTGACAAGGC 350 TGCTATGGAA AACCTATGCA TAGTCTTAGC CACAAAGAGT NAAAGGTCAA 400 AAGTGECTTC ATCTATGGNG CCATTTTAAG TNNTTTGATA GCCTAAAATT 450 ANCATQAATG NAATGTTAAG N Primers page DNA PCR 6 52 TGCTGAGATGGGAAACCCA TGTGCTGAGATGGGAAACCC GTGCTGAGATGGGAAACCCA 253 20 59 50 AGCTGCCATTGTTGCTGTTG 254 20 588 50 GCTGCCATTGTTGCTGTTGT Forward primer sequence 262 21 58 43 TGTTGCTGTTGTTCCATTITGC 5 265 21 58 43 TGCTGTTGTTCCATITGCAAC 5 data updated 301 22 59 50 GTGACAGCAAGAACCAGGATCA 5 5 TGCTGADATGGGAAACCEA 125 24 5 1 2 7 simultaneously on all BeTAAGGCCATTGTCTCACCA 166 23 201 pages when selected or 48 BGCTGCCATTGTTGCTGTTGTT 304 24 5 41 TTGTTGCTGTTGTTCCATTTGC 23 5 modified 41 TGCTGTTGTTCCATITGCAACT 315 23 5 E 60 43 GCTGTTGTTCCATTITGCAACTTC 316 22 5 DNA PCR 6 5 x 48 GTGACAGCAAGAACCAGGATCAT 351 22 5 M M 48 CACTAAGGCCATTGTCTCACCAT 166 23 6 RxnCond Primers 58 TGTCTCACCATGGCAA
58. working in a TaqMan Probe document If AutoFind not selected OFF you can direct the Primer Express software to calculate primers by selecting the Find Primers Now command Use this command to toggle the display of the Annotation Tools Palette For more information see Chapter 6 Using the Annotation Tools Use this command to toggle the display of the Primer Data Window For more information see Features on page 5 5 Use this command to toggle the display of the Interim Results window This window contains the results of a number of different tests the Primer Express software runs when calculating primers For a complete description of each test see Appendix A Interim Results Window Interim Results Primer tests Primer pair tests Primer Express Software Menus 7 15 Show Hide Primer Secondary Structure Show Hide Status Bar Use this command to toggle the display of the Secondary Structure window which shows the maximal possible secondary structure and primer dimer structure that each primer of the selected primer set may form The upper lines indicate the maximal consecutive complementary bases and the lower lines indicate the maximal nonconsecutive complementary bases zh Maximal consecutive complementary Maximal consecutive complementary Use this command to toggle the display of the status bar located at the bottom of the document The status bar informs you about the status of
59. you wish to find occurence of the sequence If you select an entry from the Sites pop up menu both the sequence data and the restriction enzyme label are entered in the two data fields Add button Use to make custom additions to the Sites pop up menu Type label and sequence data into the two data fields then click the Add button to add the label to the bottom of the Sites pop up menu Primer Express Software Menus 7 9 Field Description Starting At pop up Select one of two options from this pop up menu MSS Choose To search from the Current cursor position current cursor position default to the end of the sequence data If any sequence text is highlighted then the search begins at the end of the highlighted area Beginning of the beginning of the sequence sequence data to the end Site pop up menu This pop up menu contains a number of common restriction site labels and their corresponding sequences Find and Select this checkbox to annotate all occurrences of Label checkbox the sequence text with the appropriate site annotation For more information see How to Create Restriction Enzyme Site on page 6 26 Delete All Select this checkbox to delete any existing site Sites checkbox annotations that match the specified sequence data How to Find a Sequence To find a sequence Step Action 1 Enter a sequence in the upper data field or select a site
60. 1 653 3138 Poland Lithuania Latvia and 48 22 866 40 10 48 22 866 40 20 Estonia Warszawa For all other EMT countries not 44 1925 282481 44 1925 282509 listed Central and southeast Europe CIS Middle East and West Asia Japan Japan Hacchobori Chuo Ku Tokyo 81 3 5566 6230 81 3 5566 6507 Lati n America Caribbean countries Mexico and Central America 52 55 35 3610 52 55 66 2308 Introducing Primer Express Software 1 7 Region Telephone Fax Brazil 0 800 704 9004 or 55 11 5070 9694 95 55 11 5070 9654 Argentina 800 666 0096 55 11 5070 9694 95 Chile 1230 020 9102 55 11 5070 9694 95 Uruguay 0004 055 654 55 11 5070 9694 95 Through the At the Applied Biosystems web site you can search through frequently Applied asked questions FAQs or a solution database or you can submit a Biosystems Web question directly to Technical Support Site To search the FAQs Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page then click Frequently Asked Questions The Frequently Asked Questions page opens 3 Click your geographic region for the product area of interest Follow the instructions under the Frequently Asked Questions section 1 to display a list of FAQs for your area of interest To search the Solutions Database Step Action
61. 1 Perform steps 1 and 2 above 2 Follow the instructions under the Search the Solution Database section 2 to find a solution to your problem To submit a question directly to Technical Support Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page then click Frequently Asked Questions The Frequently Asked Questions page opens 1 8 Introducing Primer Express Software To submit a question directly to Technical Support continued Step Action 3 In the Personal Assistance E Mail Support section 3 click Ask Us RIGHT NOW 4 In the displayed form enter the requested information and your question then click Ask Us RIGHT NOW Within 24 to 48 hours you will receive an e mail reply to your question from an Applied Biosystems technical expert To Obtain You can obtain technical documents such as Applied Biosystems user Technical documents MSDSs certificates of analysis and other related Documents documents for free 24 hours a day You can obtain documents By telephone Through the Applied Biosystems web site Ordering Documents by Telephone To order documents by telephone 1 From the U S or Canada dial 1 800 487 6809 or from outside the U S and Canada dial 1 858 712 0317 2 Follow the voice instructions to order documents for delivery by fax Note There is a limit of five documents
62. 2 How to Install the Primer Express Software 2 3 Installing the Primer Express Software 2 1 Hardware and Software Requirements Hardware The following are the hardware requirements Requirements Item Description Computer model Any PC computer with a Pentium III Monitors The Primer Express software makes use of color to show template primer feature and annotation information A color monitor is highly recommended 16 inch or larger monitor is recommended to allow easier editing and viewing of the Primer Express software features Hard disk drive 80 MB minimum Printer Any PC compatible printer The printed results are in black and white For more information about printing see Printing Settings on page 7 6 Software Windows NT 4 0 Service Pack 3 or greater is highly recommended Requirements 2 2 Installing the Primer Express Software How to Install the Primer Express Software Supplied with the Primer Express Software Installing the Software The Primer Express software package contains the following items Primer Express Software User s Manual this document Primer Express Software Applications Tutorial IMPORTANT As is true with most installation scripts it is important that you disable any virus protection software during the installation process After installation is complete you can re enable any virus protectio
63. 2 then press 14 Product Product Area Telephone Fax Fluorescent Fragment Analysis 1 800 831 6844 1 650 638 5981 including GeneScan press 2 then applications press Fluorescent DNA Sequencing 1 800 831 6844 1 650 638 5981 press 2 then press 2 Integrated Thermal Cyclers 1 800 831 6844 1 650 638 5981 ABI PRISM 877 and Catalyst press 2 then 800 instruments press 4 ABI PRISM 3100 Genetic 1 800 831 6844 1 650 638 5981 Analyzer press 2 then press 68 Peptide Synthesis 1 800 831 6844 1 650 638 5981 433 and 43x Systems press 3 then press 18 Protein Sequencing 1 800 831 6844 1 650 638 5981 Procise Protein Sequencing press 3 then Systems press 28 1 4 Introducing Primer Express Software Product Product Area Sequence Detection Systems Real Time PCR and PCR Voyager gt MALDI TOF Biospectrometry Workstations Mariner ESI TOF Mass Spectrometry Workstations MassGenotyping Solution 15 MGS1 System Proteomics Solution 1 PS1 System ICAT gt reagent Biochromatography BioCAD SPRINT VISION2 INTEGRAI Workstations and POROS Perfusion Chromatography Products Expedite 8900 Nucleic Acid Synthesis Systems Pioneer Peptide Synthesizers PNA Custom and Synthesis 1 800 762 4001 1 240 453 4613 then press 1 for PCR 2 for applications and Sequence Detection Systems including ABI Prism 7700 7900 and 57008 6 for the 6700 Autom
64. 3 Table 3 1 Process of how to use the Primer Express software Step Action See 1 Import or enter a sequence Importing a Sequence on page 5 11 2 Click the Params tab to view the How to Set Parameters on design parameters and make page 5 24 changes if desired 3 Select the Find Primers Now Find Primers Now on command from the Options page 7 14 menu and wait for the process to finish Getting Started 3 5 3 6 Getting Started Table 3 1 Process of how to use the Primer Express Step Action See 4 Click the Primers tab to view the How to View the Window on results of the search for primers All the primers that satisfy the design parameters specified in the Params page are displayed page 5 36 How to Learn More Primer Express Whether you are very experienced or new to oligo design the Primer Software Express Software Applications Tutorials give you an excellent starting Applications Point for learning how to use the Primer Express software Tutorial Primer Express Software Document Types The following tutorials are included See Designing TaqMan Probes for Quantitation 2 1 TaqMan MGB Assays for Allelic Discrimination 3 1 Quick and Easy Oligo Design 4 1 Fine Tuning the Oligo Design 5 1 Oligo Design for Allele Specific PCR 6 1 For information describing the essential criteria for designing PCR primers Se
65. 3 3 open arrow cursor 6 20 Open command 7 3 to 7 4 open hand cursor transparent 6 4 6 27 Open Results command 7 4 to 7 5 optimal primer results 5 36 Index 4 optimal definition Glossary 1 Options menu 7 14 to 7 17 Order button Batch Processing document 4 63 Primers page 5 34 ORF open reading frame tool definition Glossary 1 using 6 20 to 6 21 P pages about 5 2 to 5 3 Map page 5 38 to 5 43 Primers page 5 33 to 5 37 Reaction Conditions page 5 30 to 5 32 about 5 30 features 5 31 setting reaction condition values 5 32 Results 5 50 to 5 51 about 5 50 features 5 51 Standard Parameters page 5 19 to 5 23 about 5 19 features 5 20 to 5 21 more parameters 5 22 Standard Recipe page 5 45 to 5 46 Standard Sequence page 5 4 to 5 6 TaqMan Probe document parameters page 5 28 palette moving 6 3 parameters page Allele Specific PCR document 5 27 Cycle Sequencing document 5 29 Multiplex PCR document 5 25 to 5 26 about 5 25 features 5 26 Primers page viewing 5 36 Sequencing Primer document 5 29 TaqMan Probe document 5 28 parameters settings 5 24 PCR applications primer design considerations 4 40 to 4 42 calculating needed components 5 45 to 5 46 designating the PCR enzyme D 1 to D 3 saving results 5 50 to 5 51 two step amp three step 5 51 PCR enzyme 0 2 to D 3 PCR Enzyme pop up menu 5 31 Penalty Definition dialog box using to calculate penalty scores 1 to B 4 penalty pairs calculating B 1 to B 4 pipeting excess def
66. 4 16 TaqMan MGB Probe about 4 8 amplifying target sequences 4 27 definition Glossary 2 features 4 28 loading the sequence 4 31 selecting primers and probes 4 14 TaqMan Probe and Primer Design document 4 29 using for allelic discrimination 4 27 TaqMan Probe document parameters page 5 28 using Probe tool 6 8 to 6 9 target region definition Glossary 2 tool adding target annotation 6 6 to 6 7 Target test A 5 technical support 1 3 to 1 10 e mail address 1 3 Internet address 1 8 regional sales offices 1 6 to 1 8 telephone fax North America 1 4 1 6 Template DNA setting the concentration 5 51 template setting the reactions 5 30 to 5 32 tests to eliminate primers 2 to 5 Ambig test 2 Amplicon Length test 4 Amplicon test 5 Avoid Excludes test 5 Clamp test 2 Index 8 GC test 2 Primer Site Unique test 4 Repeat test 3 Secondary Struc test 3 Target test 5 Tm Match test 5 test theory of operations 1 to E 7 how Primer Express finds primers 2 stages for calculating primer pairs 6 stages for calculating primers E 3 to E 5 three step PCR 5 51 Ts definition Glossary 2 Match test 5 parameters 5 20 test A 3 tools groupings of 6 3 training obtaining information 1 10 transparent open hand cursor 6 4 6 27 tubes for 5 46 Turn AutoFind ON OFF command 7 14 two step PCR 5 51 V virus protection 2 3 W Windows menu 7 17 RES App iec ms 850
67. 46 to 4 47 Map page 5 44 primer design considerations 4 40 to 4 42 Primer Test document 4 67 to 4 68 about 4 67 features 4 68 starting the document 4 68 RT PCR document 4 43 to 4 44 Sequencing Primer document 4 60 parameters page 5 29 Recipe page 5 49 TaqMan MGB Probe and Primer document 4 29 TaqMan Probe and Primer Design document 4 9 4 17 TaqMan Probe document parameters page 5 28 Primer Express file C 3 Primer Express pages about 5 2 to 5 3 linking 5 3 Map page 5 38 to 5 43 about 5 38 changing scale 5 43 features 5 39 to 5 41 Primer pane 5 42 Primer page 5 33 to 5 37 about 5 33 features 5 34 Primer Data window 5 35 to 5 36 saving list of primers 5 37 viewing parameters 5 36 Reaction Conditions 5 30 to 5 32 Index 5 about 5 30 features 5 31 setting reaction condition values 5 32 Results 5 50 to 5 51 about 5 50 features 5 51 Standard Parameters 5 19 to 5 23 Standard Recipe page 5 45 to 5 46 Standard Sequence 5 4 to 5 6 primer pairs calculating penalty scores 1 to B 4 assigning penalty score 1 how it is calculated 1 to B 4 Primer pane window displaying primer pair 5 42 sorting the primer pairs 5 44 Primer Test document 4 67 to 4 68 about 4 67 features 4 68 starting the document 4 68 primers calculate automatically 7 14 display pane 5 34 for multiple targets 4 56 how Primer Express finds primers 2 how to find 5 16 to 5 18 ordering 5 37 show hide 7 15 sorting 5 3 B 1 sorting primer pair gra
68. 60 3 79588268 60 3 79549043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 86735750 43 0 1 867 35 75 11 Belgium 32 0 2 532 4484 32 0 2 582 1886 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 1 6 Introducing Primer Express Software Region Telephone Fax Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 12 06 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d IJssel 31 0 180 392400 31 0 180 392409 or 31 0 180 392499 United Kingdom Warrington Cheshire 44 0 1925 825650 44 0 1925 282502 European Managed Territories EMT Africa English speaking Johannesburg South Africa 27 11 478 0411 27 11 478 0349 Africa French speaking Paris France 33 1 69 59 85 11 33 1 69 59 85 00 India New Delhi 91 11 653 3743 91 11 653 3744 91 1
69. AAAG 300 GACAGCAA GAACCAGGAU CAUAAAGGNG GUGGUCCUAA UUGACAAGGC 350 AUGGAA AACCUAUGCA UAGUCUUAGC CACAAAGAGU NAAAGGUCAA 400 AAGUGGCUUC AUCUAUGGNG CCAUUUUAAG UNNUUUGAUA GCCUAAAATIT 450 ANCAUGSAUG MAAUGU UAAG 471 Primer Data Forward Primer AGCTGCCATTGTTGCTGITGT Tm 59 GC 45 Start Reverse Primer GCAGCCTTIGTCAATTAGGACCA Tm GC 50 Start Amplicon Tm GC 47 Length How the Document When you import a DNA sequence into an RT PCR document the Works Primer Express software converts it to an RNA sequence removes intron sequences and marks the intron locations with Junction annotations Primer Express Documents 4 43 Starting the To start a new RT PCR document choose New from the File menu and Document Select RT PCR Document from the submenu For more information about the pages contained in the RT PCR document see Chapter 5 Primer Express Pages How GenBank File When you import a GenBank file into an RT PCR document the Primer Are Imported Express software modifies the sequence data as follows For a diagram illustrating the DNA sequence before and after importing see Importing Diagram Step Action 1 All T bases are converted into U bases This occurs with all DNA sequence files 2 All the sequence data that makes up the introns is removed and the corresponding locations are marked with Junction annotations This occurs with GenBank files only 3 The resulting
70. CCC 178 25 5 CATTGTTGCTGTTGTTCCATTTG 23 5 E ATI 23 5 Primer Data 5 PRENIE ANER m m 6 rimer Data windo A total af nrimar naire fannd an anw nrimar nair in tha lamar nana Primer Express Pages 5 3 Standard Sequence Page About the Page The Standard Sequence page allows you to import or enter one or more sequences The Standard Sequence page is a part of all the Primer Express documents except the Allele Specific PCR document which has its own special Sequence page see Features on page 5 9 Batch Processing and Primer Test documents which have no Sequence page at all and TaqMan MGB Probe Document Primer Express documents require a sequence or alignment file of some sort to use as the basis for calculating primers Sequence Page The following is an example of a Sequence page from a DNA PCR Example document into which the sequence file ox208 131 has been imported DNA PCR 6 ACCTATGAAT GATGTGCTGA GATGGGAAAC CCAAAA LAATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG CAACCCAAAA IAACAGCAGTC ACAGTCTAGG AAGTAAATGT AGAGCCCCTG CAGCACTATA ATGCTGGAGA AGTGTCTGCT GCAGCTGCCA TTGTTGCTGT TGTTCCATTT GCAACTTCTC AGTCTCAAAG GTGACAGCAA GAACCAGGAT CATAAAGGNG GTGGTCCTAA TTGACAAGGC TGCTATGGAA AACCTATGCA TAGTCTTAGC CACAAAGAGT NAAAGGTCAA AAGTGGCTTC ATCTATGGNG CCATTTTAAG TNNTTTGATA GCCTAAAATT ANCATGAATG NAATGTTAAG N Atotal of 200 primer p
71. Daltons Yeast 9 8 X 10 Daltons Drosophila 9 1 X 1010 Daltons Human 2 2 X 1012 Daltons 9 9 9 9 Forward Reverse Primer Concentrations The primer concentrations directly affect the of all primers calculated that is as the primer concentration is increased the corresponding primer T s increase Three linked data entry fields allow you to enter primer concentrations in any of the following scales OD260 ug ml or nM Salt The salt concentration value directly affects the of all primers calculated that is as the salt concentration is increased the corresponding primer T S increase Mg The Mg concentration value is passed on to the Recipe page but not used in calculating T values For further information see Standard Recipe Page on page 5 44 Defaults button Resets the numbers in the data fields to their original default values You can set these default values in the Preferences dialog box For more information see Preferences Command on page 7 13 Help button Provides specific help for the Rxn Cond page from the Primer Express Guide online help facility Primer Express Pages 5 31 Setting Reaction The following procedure describes how to set reaction condition values Condition Values 5 32 Step Action 1 Highlight the data entry field you wish to change The Parameters page also contains values that affect primer calcul
72. ERA RE 4 3 NoteBook C ONCE PL ud usps ESSEN E Me dea Ta 4 3 Document Dimitattofis 44 9 4339 me BG pd d 4 4 Using the Multiplex PCR 4 4 How to Use the Document 4 5 Document Window 4 5 Actions You Faker ik nC eR ES RAI 4 5 TaqMan Assay Design 4 7 Choose from These TO DIC Sia ick em desee reet nen Ce 4 7 A o t Probes ud ERR px RE E ER 4 8 Two Types of TaqMan Probes Available 4 8 Probes Used in Quantitation and Allelic Discrimination 4 8 How the Probes Work aisi vestes eke lee 4 8 Probe costo cease bance au eyes 4 8 Amplifying Custom Target Sequences for Quantitation 4 9 TaqMan Probe and Primer Document Example 4 9 Primer and Probe Design Guidelines 4 10 Generating a List of Candidate Primers and Probes 4 11 selectins Primers and Probes i4 ey RARUS 4 14 Using Conventional TaqMan Probes for Amplifying Target Sequences for Adlelic ees or bb bere eli PST 4 16 How Allelic Discrimination Assays Work 4 16 TaqMan Probe and Primer Document Example 4 17
73. IOSYSTEMS 850 LINCOLN CENTRE DRIVE FOSTER CITY CA 94404 AND YOUR PAYMENT WILL BE RETURNED THE LAW PROVIDES FOR CIVIL AND CRIMINAL PENALTIES FOR ANYONE WHO VIOLATES THE LAWS OF COPYRIGHT The SOFTWARE including its structure organization code user interface and associated documentation is a proprietary product of PE Corporation NY and is protected by international laws of copyright Title to the SOFTWARE and to any and all portion s of the SOFTWARE shall at all times remain with PE Corporation NY which grants to you the limited rights contained in this Agreement 1 You may install and use each original copy of the SOFTWARE on a separate single computer or on a single network if your software is designated and licensed as a network version You may transfer the SOFTWARE to another single computer or network if a network version so long as you first delete the SOFTWARE from the previous computer or network You shall not have operational SOFTWARE on more than one computer or more than one network if a network version per original copy of the SOFTWARE at any time 2 You may make one copy of the SOFTWARE for backup purposes provided that you reproduce all copyright and other proprietary notices Software License 1 1 Restrictions Limited Warranty I Software License that are on the original copy of the SOFTWARE You may replace the SOFTWARE on any single computer or any single network if applicable with the
74. Junction Annotation 6 24 How to Create Restriction Enzyme Site 6 26 Using the Annotation Tools 6 1 About the Annotation Tools Introduction The Primer Express software provides 12 tools to annotate the sequence you have entered or imported into a Primer Express document The annotation tools are available on a movable palette Annotation Tool The following is an example of the annotation tool palette Palette Select Tool Eraser Tool Target Region Tool Exclude Region Tool Forward Primer Tool Forward Primer End Tool Reverse Primer Tool Reverse Primer End Tool ORF Tool Line Tool Junction Tool Site Tool E Changes to the Probe Tool in a TaqMan Probe document 6 2 Using the Annotation Tools Tool Groupings There are two groupings of annotation tools those that do not affect primer calculations and those that recalculate primers The following table lists the two groupings of the annotation tools palette TO Use these tools not affect primer calculations Select ORF Line Site Eraser recalculate primers if AutoFind is On see Turn AutoFind ON OFF on page 7 14 Targel Exclude Forward Primer Forward Primer End Reverse Primer Reverse Primer End 9 9 9 9 9 9 9 Junction Moving the Palette To move the palette drag the palette title bar to a different location on the desktop Using the Annotation Tools 6 3 Selecting and Moving Sequence Text Introduction
75. Lincoln Centre Drive Foster City California 94404 1128 USA P N 4329500 Rev A
76. Loading the Sequence ete babe rp 4 18 TaqMan Probe Design Guidelines 4 20 Desi Sine ee eee eee oe 4 25 Using TaqMan MGB Probes for Amplifying Target Sequences for Allelic DISCEMNNANON ou cire e S NU HE e vU ris epe eae 4 27 How Allelic Discrimination Assays 4 27 Features of TaqMan MGB Probes 4 28 TaqMan MGB Probe and Primer Document Example 4 29 TaqMan MGB Probe Design Guidelines 4 30 Loadine the axis arbo drs ER aos 4 3 Primer Desin Guidelines eon es 4 37 DNA PCR DOCUMENT 2 tms qos Rente ntu eee hee Se nett 4 39 When to Use the Leere RETE kh 4 39 DNA PCR Document Example 4 39 Starime the DOCUMENT 335645 y pO saad ed eX E ead 4 39 Primer Design Considerations for PCR 4 40 Desitin aveo pte passe POS PIU PIS EAE 4 40 Harp M OOPS st ace ductu t por dex utat ibat ipea al berto dena 4 40 Primer Dimer ud EE ERES 4 41 Increasing Primer SpeclHeliy 52 xs a ene a ene ped 4 4 Base Stacking 4 42 REPCR DOCUPISUU beled ae So 4 43 When the Documents x3 x
77. Man Probe document appears d From the Edit menu select Paste The software pastes the nucleotide sequence into the Sequence tab Primer Express Documents 4 11 To generate a list of potential primers and probes continued Step Action 2 Click the Sequence tab Select the following checkboxes for primer selection Double Stranded Limit 3 G C TagMan Probe 1 ii Sequence File Name ox208 131 Impar We Bile Length 47ibp Selection 230 to 344 Double Stranded v Limit G G M pp GATGTGCTGA GACGTTGTAT CTACCCTITG CAAAATNAT 100 GITTTANTA Select these boxes The sense and antisense sequences appear on the Sequence tab a Click the Params tab b Click the Defaults button c Go back to the Sequence page by clicking the Sequence tab Probe 1 Sequence Primer Tm Requirements Tm 58 Tm BD Optimal Tm 59 Ivaximal Tm difference F Primer GC Content Requirements Mn BGC 3 GC clamp of D residues Primer Length Requirements win length 9 length 4 Optimal length 20 Amplicon Requirements hin Tm Tm 85 Min length length 15 Probe Criteria Taghtan Probe Tm must be 10 00 greaterthan PCR Primer Tm TagMan Probe should not
78. On the Sequence page use the Target tool to select all or part of the region that is highlighted and underlined 8 Repeat step 6b and step 7 until as many underlined regions as possible are also annotated as Target regions 9 From the Options menu select Find Primers Now 10 After the Primer Express software calculates primers note how many are found 11 Change to the Params page In the pop up menu named Last four positions contain select the second option Primer Express Documents 4 55 To calculate primers for multiple targets a single sequence continued Step Action 12 From the Options menu select Find Primers Now 13 Repeat step 10 and step 11 until you have tried all four menu options and determined which option gives you the most primers Using Method 2 To calculate primers for multiple targets in a single sequence file Step Action 1 Open a new Multiplex PCR document 2 On the Params page significantly relax the stringency of the following parameters Primer minimal Tm Primer minimal and maximal length Primer GC content Amplicon minimal 3 On the Params page set the Amplicon minimal and maximal length parameters to the desired target region size 50 to 200 bases 4 On the Sequence page import a DNA sequence For information on importing sequence files see Importing a Sequence on page 5 11 5 Use the Target tool to specify exact
79. PCR documents 22 DNA PCR 6 Atotal of 200 primer pairs found Click on any primer pair in the lower pane to select it Click any of the attributes shown in the Primer pane to sort the primer pair graphics Figure 5 6 by that attribute All the other features of the Nested PCR Map page function identically with the standard Map page Internal primer pair 122 bp 335 438 Tm 62 Tm 6 1 707 bp 310 1106 Tm 60 Tm 60 External primer pair Figure 5 6 Nested PCR graphics 5 44 Primer Express Pages Standard Recipe Page About the Page The Standard Recipe page lets you calculate the amount of the components you need for different PCR reactions starting from a given stock concentration The Standard Recipe page is a part of the following document types DNA PCR RT PCR Nested PCR Allele Specific PCR Multiplex PCR and TaqMan probe The Standard Recipe page functions as a spreadsheet when you change a value in the Stock Concentration column on the left the associated Final Concentration value is calculated and displayed on the right Standard Recipe The following is an example of the Standard Recipe page with default Page Example values 500 500 5 i Primer Express Pages 5 45 Features Standard Recipe page features Feature Description Stock Concentrations column Contains the concentrations of t
80. Pane 5 6 Primer Express Pages Out Item Description Line Length Control Reformats the sequence data to fill the sequence data pane up to a maximum of 120 base pairs per sequence line Sequence line length is controlled by a slider control a solid arrowhead located on the right just above the sequence pane The sequential number of the final base pair on each line is shown in the right margin of the sequence data pane You can display sequence data in lines from 20 120 bp long To change line length a If you are increasing the line length increase the horizontal size of the Primer Express software window b Position the cursor over the slider control When in position the cursor changes to the slider control cursor c Click and drag to change the line length To increase line length drag to the right To decrease line length drag to the left 10 Scroll Bar If the Standard Sequence page contains more sequence data than you can view at one time a scroll bar appears on the right side of the page to allow you to view all the sequence data 11 Base Grouping Control Groups the sequence data into easily read sections of nucleotides The default grouping is ten bases The grouping is controlled by a slider control a hollow arrowhead located on the left just above the sequence data pane Directly beneath the slider control is a ruler that ind
81. Primer Express Software v2 0 Applications Based Primer Design Software User s Manual Applied AS Copyright 2001 Applera Corporation rights Reserved For Research Use Only Not for use in diagnostic procedures Notice to Purchaser License Disclaimer For Software License and Warranty information please see Section I 1 of this manual Notice to Purchaser Purchase of this software product alone does not imply any license under any process instrument or apparatus system composition reagent or kit rights under patent claims owned or otherwise controlled by Applera Corporation either expressly impliedly or by estoppel ABI ABI PRISM and its design Applera Corporation Factura Primer Express GeneScan and Sequence Navigator are registered trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries AmpliTaq TaqMan and UITma are registered trademarks of Roche Molecular Systems Inc Windows and Windows NT are trademarks of Microsoft Corporation other trademarks are the sole property of their respective owners P N 4329500A Contents I Introducing Primer Express Software INOdUCHONS in deseo E ade XR ds opus ies 1 1 Inc Hs eae 1 1 About the Primer Express Software 1 2 DeMMINON aa oer an EO Duos qid 1 2 OUSO DESE MERIT 1 2 Documents f
82. R Doc tbent i 3 5 9 2 V dose 4 52 When to Use the 4 52 Multiplex PCR Document 1 4 52 Starting the ci CS eR 4 52 Multiplex PCR Document 4 53 Multiplex PCR Document Options 4 53 setting Multiplex Paramieters ex RACE 4 53 How to Calculate Multiplex Primers 4 54 errato 4 54 Calculating Multiple 4 54 Calculating Multiple Targets in a Sequence 4 55 Cycle Sequencing Documents ue IDE 4 5 When to Use the DOCUtelt RES eui es 4 5 Cycle Sequencing Document 4 57 What to Use The Document 4 5 Starting the DOCUTBETIE sc ood eiae y E a ERE Saepe es 4 5 Cycle Sequencing 4 58 Intt OdUe OTI o oa aos ERIS eh 4 58 Pomer Annealing See 4 58 Requirements for Cycle 4 58 Sequencing Primer 4 60 When to Use the Document ium eee d 4 60 Sequencing Primer Doc
83. Reverse Primer End annotation inserted blue 6 18 Using the Annotation Tools Modifying a You can use the Select tool to move lengthen shorten any existing Reverse Primer Reverse Primer End annotation For instructions on modifying or End Annotation removing Reverse Primer End annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 19 How to Translate DNA to Amino Acid Sequence Introduction Use the ORF open reading frame tool for translating a selected DNA region into its corresponding amino acid sequence using the three letter amino acid abbreviations directly beneath the sequence data This tool is useful as a mnemonic for protein coding sequences Addinga The following procedure describes how to add a translation annotation Translation Note You can only make annotations in multiples of three bases If you Annotation make an ORF annotation that is not a multiple of three bases the Primer Express software shortens the annotation to the correct length To add a translation annotation Step Action 1 Click the ORF tool to select it MetPhe ORF The cursor changes to the open arrow cursor c Position the open arrow cursor over the sequence base where you wish to begin the annotation Click and drag to highlight the desired data When you release the mouse button the highlighted sequence text is annotated with amino acid translation abbrevia
84. Standard Parameters Page About the Page The Standard Parameters page allows you to view and modify parameters controlling primer and amplicon Tm GC content length 5 tail composition uniqueness and secondary structure DNA PCR The following is an example of the DNA PCR Parameters page with Parameters Page default values Example DNA PCR 7 To examine primer pairs click the Primers tab Primer Express Pages 5 19 Features The following table describes the features in the DNA PCR Parameters page The data fields included on the Standard Parameters page can vary depending upon the document type Feature Description Primer Tm Requirements Parameters that control primer T are contained in this pane of the Parameters page These parameters are used to calculate primer pairs These parameters are The Min T default 57 C and Max T default 63 C parameters display as horizontal dotted lines in the Feature Map on the Map page see Map Page Example on page 5 38 The maximal difference parameter default 2 controls the difference between the of the forward and reverse primers in a primer pair Primer GC Content Requirements Parameters that control GC content are contained in this pane of the Parameters page The default 45 and Max GC default 55 data fields set the boundaries of the GC The GC Clamp data field default 0 sets the number
85. TACTA 5 TGEGTCACCG SerPra bHRHHCURBE GATACGTTEH AspThr TAGCTATTAG aserTyrlTer STHHTYGTYC YHTGTRTSTS GCTACTAGTC nLeubLeullal HHBUHRRTRT RGTATATAAT BTBTGCTV GR TCGCBRTRHH eHrgHsp COTARTYHGH TATCTATATC TyrLeuTuyr Modifying a Translation Annotation You can use the Select tool to move lengthen or shorten any existing translation annotation For instructions on modifying translation annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 21 How to Highlight Sections of Sequence Text Introduction Use the Line tool for highlighting sections of sequence text If you wish to mark a section of the sequence data with an annotation different from any of the other annotations available in the Primer Express software use the line tool Line annotations do not affect the calculation of primers Adding a Line To add a line annotation Annotation Step Action 1 Click the Line tool to select it The cursor changes to the magenta l beam cursor 1 Position the cursor over the sequence base where you wish to begin underlining Click and drag to highlight the desired data When you release the mouse button the highlighted sequence text is underlined 2 TaqMan Probe 3 208 131 1 TCNAGCNNGG AGAAAGAAAG
86. TTIGCAACTICTCAGT 28 ate TTGTTCCATTTGCAACTTCTC ABT 270 24 58 38 TTGTTCCATTTGCAACTTCTCADGT 245 33 na 42 270 24 58 38 TTGTTCCATTTGCAACTTCTCADGT 296 31 na 42 Order Save List Display 2 If the probe you have chosen is from Then the sense strand go to the Primers tab and click the Order button Your results can then be copied and pasted directly into a Word or text based document the antisense strand proceed to step 3 4 14 Primer Express Documents Step Action 3 Note If your probe is from the antisense strand you will have to edit the Order document The Order document will pick the probe sequence only from the sense strand To edit the Order document a Click the Sequence tab b Highlight the entire probe sequence The probe sequence is outlined in green c From the Edit menu choose Copy Complement d Return to the Order document and delete the current probe sequence e Paste the complementary sequence in its place f Your results can be copied and pasted directly into a Word or text based document Alternatively you can save your results by choosing Save from the File menu Primer Express Documents 4 15 Using Conventional TaqMan Probes for Amplifying Target Sequences for Allelic Discrimination How Allelic In allelic discrimination assays the PCR assay includes a specific Discrimination fluorescent dye labeled probe for each allele The prob
87. The figure below illustrates results from matches and mismatches between allele and probe sequences in allelic discrimination assays Livak et al 1995 et al 1999 Match Mismatch AmpliTaq Polymerase Match Mismatch GR1556 Primer Express Documents 4 27 The table below summarizes the possible results of the example allelic discrimination assay shown above A substantial increase in Indicates VIC fluorescence only homozygosity for Allele 1 FAM fluorescence only homozygosity for Allele 2 both fluorescent signals heterozygosity Features of IMPORTANT Applied Biosystems recommends the general use of TaqMan TaqMan MGB MGB probes for allelic discrimination especially when conventional probes Probes exceed 30 nucleotides The new TaqMan MGB probes contain the following features Anonfluorescent quencher at the 3 end Because the quencher does not fluoresce the Sequence Detection Systems instruments can now measure the reporter dye contributions more precisely minor groove binder at the end The minor groove binder increases the melting temperature Tm of probes allowing the use of shorter probes Consequently the TaqMan MGB probes exhibit greater differences in T values between matched and mismatched probes which provides more accurate allelic discrimination 4 28 Primer Express Documents TaqMan MGB Probe and Primer Document Example The following
88. a primer calculation for example how many primers were found or what you need to do to find primers 5 DNA PCR 1 Fie Loaded To load a DNA file click the Import DNA File button To load a DNA file click the Import DNA File button To enter data from the keyboard begin typing Stat u S ba r 7 16 Primer Express Software Menus Copy Page Window Windows Menu About the Windows Menu Making a Document Active Use this command to copy the page currently being viewed and open a new window containing the copied page The copy of the page acts exactly like the original If you make a change in the copy it is the same as making a change in the original page If you are using a larger monitor you can have several copies of windows open on the desktop so that when you make a parameter change you can see the resulting change in the primers without having to click on another page The Windows menu contains the names of all the currently open Primer Express documents The currently active document is indicated by a check mark next to the document name Each document is named by document type and sequential number To make a document active you can Currently active document check mark Select the document name from the Windows menu or Click the document window Primer Express Software Menus 7 17 Interim Results Window Introduction In This Appendix Topics in this appe
89. ading Frame A selected DNA region translated into its corresponding amino acid sequence using the three letter amino acid abbreviations directly beneath the sequence data ORF annotations may be contained in sequence files processed by outside agencies such as GenBank database or Sequence Navigator software or they may be entered in the Primer Express software on the Sequence page using the ORF tool Glossary 1 pipeting excess The quantity of extra mixture you want to create in order to have some to spare Also known as slop factor The number entered is a percentage of the reaction volume primer dimer A primer artifact usually undesirable that results from a primer hybridizing and extending on another primer instead of the target template protocol Instructions for performing PCR similar to a recipe that specify precise quantities of components order of actions and durations of events residue nitrogenous base with single letter designation corresponding to the IUPAC code Also referred to as a base or nucleotide nt For more information see Appendix F IUPAC Codes reverse primer oligonucleotide that primes in the reverse direction either for PCR or sequencing A Nested PCR document calculates two reverse primers in every primer set secondary structure structure within the primer binding site that leads to hairpin loops and other undesirable PCR effects T Annealing temperature of a DNA fragment amplicon or p
90. airs found To examine primer pairs click the Primers tab 5 4 Primer Express Pages DNA Sequence The Primer Express software accepts DNA sequence files in the File Formats Alignment File Formats Features following formats Factura EMBL GenBank ABIF ABI 373 377 310 sample files FASTA GCG Plain text files The Primer Express software accepts alignment files for Allele Specific PCR in Sequence Navigator For more information see Importing Sequence on page 5 11 You may enter sequence data directly from the keyboard if you desire For more information see Entering a Sequence on page 5 12 The following are features of the Standard Sequence page RGRRRGRRRG RRRRRGRRRT CTGCARCATA ACCTATGAAT GATGTGCTGA GATGGGAARC CCRRRRTHRT GGTARATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG CAACCCAAAA ARCAGCAGTC ACAGTCTAGG TCTTTCCAGA RRGTRRRTGT AGAGCCCCTG GAGA AGTGTCTGCT ICA TAGTCTTAGC CACRAAGAGT HRRRGGTCRR ARI GGCTTC RTCTRTGEHe EEFHHH HRRE HHBHHHHSEHHHASEECHHRRERHH FREER HH Ready to Calculate Primer Express Pages 5 5 The following table lists the features of the Standard Sequence page Call Out Item Description 1 Sequence Shows whether the sequence data is Data Lock Locked li Unlocked gj Click the icon to change the lock status For more information see Locking and Unlocking
91. al PCR applications Taq DNA polymerase is the ideal enzyme for most PCR applications because its optimal activity is in the same temperature range at which stringent primer annealing takes place 55 75 D 2 PCR Enzymes and Primer Express Description AmpliTaq Stoffel Modified AmpliTaq DNA polymerase that is more Thermostable than standard Taq DNA polymerase Exhibits optimal activity over a broader range of magnesium ion concentrations 2 10 mM Lacks any intrinsic 5 0 3 exonuclease activity These properties make Stoffel the enzyme of choice for GC rich templates as well as templates known to contain complex secondary structure Stoffel has been known to provide superior performance in sequence specific amplification allele specific PCR of rare genetic variants Because of its unique property of exhibiting optimal activity over a broad range of magnesium ion concentrations Stoffel is highly recommended for Rapidly optimizing PCR reactions and is useful when performing Multiplex PCR Carrying out Arbitrarily Primed PCR AP PCR or Random Amplified Polymorphic DNAs RAPDs rTth DNA Thermostable polymerase that is able to reverse Polymerase transcribe RNA to cDNA quickly and efficiently in the presence of MnCl manganese chloride at elevated temperatures This enzyme also acts as a DNA polymerase for subsequent PCR amplification in the presence of
92. al probe sequences in the complementary strand a Return to the Sequence tab in the TaqMan Probe document for Allele 1 The polymorphic sequence and surrounding nucleotides should still be selected b From the Edit menu select Copy Complement c Return to the Primer Test document and click the Reverse Primer text box d From the Edit menu select Paste Primer Express copies the complementary sequence into the test document and calculates the T of the oligonucleotide Note software calculates the of the probe sequence even though the document is called a Primer Test Document Primer Express Documents 4 21 To design the probe for Allele 1 continued Step Action 4 For easier identification label the polymorphism within each probe sequence a Select the polymorphism within the sequence in the Forward Primer text box Forward Primer TTCCACACAACATACGAGCCG b Press the key corresponding to the letter of the polymorphic base Primer Express replaces the uppercase letter of the base with a lowercase letter Forward Primer TTICCACACAACATACGAGCCG c Repeat steps a and b for the complementary sequence in the Reverse Primer text box Highlight potential probe sequences until you identify a probe that meets the guidelines in TaqMan Probe Design Guidelines on page 4 20 IMPORTANT Primer Express calculates the T for only the highlighted nucleotide s
93. aluating Primers analyze oligos for a variety of PCR and sequencing applications Provides Customized Application specific Documents The Primer Express software addresses all of the primary aspects of oligo design by providing a customized application specific document for each of the following PCR types Standard DNA PCR RT PCR Nested PCR Allele Specific PCR Multiplex PCR DNA PCR with TaqMan probe 9 9 Add New Oligo Designs The Primer Express software allows you to add new oligo designs to a database for maintaining records The software calculates melting temperature T of oligos using the nearest neighbor algorithm The Primer Express software also provides documents for the following sequencing applications Cycle Sequencing Sequencing Primer For speed and convenience the Primer Express software also provides a Batch Processing document that gives you the ability to process multiple PCR primer calculations at the same time The Primer Express software includes a Primer Test document that allows you to evaluate primers for their T secondary structure and primer dimer formation 1 2 Introducing Primer Express Software Contacting Technical Support Overview You can contact Applied Biosystems for technical support By e mail By telephone or fax Through the Applied Biosystems web site Note For information on obtaining technical documents such as Applied Biosystems user documents
94. ard and reverse primers that pass the initial tests Consider the primer selection process as a series of filters and only those candidate primer sequences that pass the first test are subjected to the second test only those that pass the second are subjected to the third and so on The primer pair search effort takes place in three stages Stage Action 1 Acceptable forward primers are found 2 Acceptable reverse primers are found 3 Forward and reverse primers are tested in all possible combinations to find acceptable primer pairs The number of sequences subjected to a later test is always less than or equal to the number subjected to an earlier test Therefore the tests have been ordered so that the least computationally intensive are performed early in the series and the most computationally intensive are performed late in the series The results of these tests that is the number of primers that pass each test are shown in the Interim Results window see Appendix A Interim Results Window Stages for Calculating Individual Primers Calculating Primer Express software uses the following process to find Individual Primers acceptable individual forward and reverse primers The associated parameters on the Parameters page are listed for each step in the process Table E 1 Stages for calculating individual primers Stage Description 1
95. ated Sample Prep Systema or 1 800 831 6844 then press 5a 1 800 899 5858 1 508 383 7855 press 1 then press 3 Telephone Fax 1 800 899 5858 1 508 383 7855 press 1 then press 4 1 800 899 5858 1 508 383 7855 press 1 then press 5 1 800 899 5858 1 508 383 7855 press 1 then press 5 1 800 899 5858 1 508 383 7855 press 1 then press 5 Introducing Primer Express Software 1 5 Product Product Area FMAT 2 8100 HTS System CytoFluor 4000 Fluorescence Plate Reader Telephone 1 800 899 5858 press 1 then press 69 Fax 1 508 383 7855 1 800 542 2369 U S only or 1 781 271 0045 1 800 952 4716 Chemiluminescence Tropix 1 781 275 8581 LC MS Applied Biosystems MDS SCIEX 1 508 383 7899 a 5 30 AM to 5 00 PM Pacific time b 8 00 AM to 6 00 PM Eastern time c 9 00 AM to 5 00 PM Eastern time By Telephone or Outside North America Fax To contact Applied Biosystems Technical Support or Field Service outside North America use the telephone or fax numbers below Region Fax Telephone Eastern Asia China Oceania 61 3 9730 8600 Australia Scoresby Victoria 61 3 9730 8799 China Beijing 86 10 64106608 or 86 10 64106617 86 800 8100497 Hong Kong 852 2756 6928 852 2756 6968 India New Delhi 91 11 653 91 11 653 3138 3743 3744 Korea Seoul 82 2 593 6470 6471 822593 6472 Malaysia Petaling Jaya
96. ating additional file 3 4 arrow colored 5 17 cursor 5 14 6 4 outline 5 17 ASCII test file type 2 Assay Design Guidelines 4 7 Avoid Excludes test 5 B bases creating junction annotation 6 24 to 6 25 invalid bases F 1 modified F 1 Batch Processing document number of sequences imported 4 61 selecting doc type 4 65 using the document 4 64 to 4 66 viewing associated documents 4 66 bibliographical references 1 to H 2 buffer stock Results page 5 48 Sequencing Primer page 5 49 C Clamp test 2 Clear Clear All Annotation command 7 8 cloning site annotation adding 6 26 to 6 27 Index 1 Close command 7 5 color arrows displaying primer set 5 17 concentrations primer 5 31 setting 5 51 stock solutions 5 48 5 49 Copy Complement command 7 8 Copy Page to Window command 7 17 copying sequence text 5 14 cursor arrow when selecting text 5 14 6 4 l beam 5 14 6 4 blue 6 12 6 14 6 16 6 18 green 6 6 6 9 magenta 6 22 red 6 10 junction 6 24 open arrow 6 20 site arrow 6 26 transparent open hand 6 4 6 27 customer support See technical support 1 3 Cycle Sequencing document 4 57 applications 4 58 to 4 59 parameters page 5 29 Recipe page 5 47 to 5 48 mes D Data List exported file defaults factory defaults Standard Parameters page 5 22 reset button set to preferences 5 22 resetting the Rxn Cond page 5 31 Define Penalty Score command 7 13
97. ations For more information see Standard Parameters Page on page 5 19 Type the value you wish to enter into the data field Select Find Primers Now from the Options menu On the Primers page or Map page view the new selection of primer pairs generated by your parameter change Repeat this procedure until you get the selection of primer pairs you desire Primer Express Pages Primers Page About the Page The Primers page displays the results of a primer calculation using the data contained in the Parameters and Reaction Conditions pages Primers Page The following is an example of the Primers pages showing calculated Example primers Sort headings toggle switches DNA PCR 6 pe TGTGCTGAGATGGGASACCC GTGCTGAGATGGGAASCCCA 3 Display ABGCTGCCATTGTTGCTGTTG B pane GCTGCCEATTGTTGCTGTTGT TGTTGCTGTTGTTCCATTTGC TGCTGTTIGTICCATTTGCAAC GTGACAGCAAGAACCAGGATCA TGCTGAGATGGGASACCCA GCACTAAGGCCATTOTCTCACC CACTASGGCCATTGTCTCACCA AGCTGCCATTOTTGCTGTTGT GCTGCCATTGTTGCTGTIGTT TTGTTGCTGTTIGTICCATTTGC TGCTGTTGTTCCATTTGCAACT GCTGTTGTTCCATTTGCAACTTC GTGACAGCAAGAASCCAGGATCAT Scroll bar CACTASGGCCATTGTCTCACCAT TGTCTCACCATGGCASCCC CATTGTTGCTGTTGTTCCATTITG Primer Data Primer Data window Primer Express Pages 5 33 Features The following table lists the features of the Primers page Feature Description Primer Scrolling pane that contains the S
98. au opt pea M ae 7 8 About the Edit MENU ia hoe a ie SS A 7 8 Copy Complement iere EN 7 8 Clear All Amnotal lon iu s ae wa we S0 RS wate Ms 7 8 Pind Sequence aque tanec wd a tae aes beatae ews 7 9 Find Target Command 7 11 Find and Exclude 7 11 Show Hide Page Breaks Command 7 12 Preterences Command e osi nete ed eaten Bes 7 13 Denne Penalty Scones 254435426 d eT Sd 7 13 ope Mudo MT TTL 7 14 About the VIC Du WOLLE RO AG Te ERA 7 14 Turn AutoFind 7 14 Find Primers NOW e gs 7 14 Show Hide Annotation 7 15 Show Hide Primet Dal Reo ee lt 7 15 Show Hide Interim 7 15 Show Hide Primer Secondary 5 7 16 Show Hide Status Bab i xd EEG Eu ERES 7 16 Copy Pace TO WIDONW oa at Ep e 7 Y7 Windows Vl Cnt 2 8 seid debe ne ES Ses e dE redes 7 17 About the Windows 7 17 Making a Document 7 17 A Interim Results Window Miodu Oe ey deter gm
99. ault is PXArchive to save the Primer Express software Archive file You can store the file anywhere on the hard drive Note Itis recommended that you store the Archive file in the Primer Express folder Getting Started 3 3 To create the Primer Express software Archive file continued Step Action 5 Click Save to save the new Primer Express software Archive For information about See creating additional Primer Creating Additional Archive Express software Archive files Files the different types of Primer Chapter 4 Primer Express Express documents and pages Documents Chapter 5 Primer Express Pages Creating Why Create Additional Archive Files Additional Archive single archive file is all the Primer Express software needs to store Files primer data for any number of users on the same computer You can create a different archive file at any time Archive files are used for saving data and your personal or organization s preferences for data and file management may require you to create several archive files How to Create Additional Archive Files To create an additional Primer Express software Archive file Step Action 1 Quit the Primer Express software 2 Double click the Primer Express software icon to start the program 3 Immediately after the splash screen first appears hold down the Alt key until the dialog box for creating the archiv
100. backup copy if the need arises but you shall not have operational SOFTWARE on more than one computer or network per original copy of the SOFTWARE at any time PE Corporation NY shall own the title to the backup copy 3 Registration codes for multiple users are available as follows Access to the number of copies of SOFTWARE is provided by a registration code For example if you have a registration code that enables you to use three copies of SOFTWARE simultaneously you cannot install the SOFTWARE in more than three separate computers 4 You agree not to transfer the SOFTWARE license to another party Any such transfer terminates your license 1 You agree not copy transfer rent modify use or merge the SOFTWARE or the associated documentation in whole or in part except as expressly permitted in this Agreement 2 You agree not to reverse assemble decompile or otherwise reverse engineer the SOFTWARE For a period of 90 days after purchase of the SOFTWARE PE Corporation NY warrants that the SOFTWARE will function substantially as described in the documentation supplied by PE Corporation NY with the SOFTWARE If you discover an error which causes substantial deviation from that documentation send a written notification to PE Corporation NY Upon receiving such notification if PE Corporation NY is able to reproduce that error at its facility then PE Corporation NY will do one of the following at its sole option i
101. begin with G More Params Defaults Factory Defaults IMPORTANT Do not change the default settings as these values follow the TagMan Probe and Primer design guidelines 4 12 Primer Express Documents To generate a list of potential primers and probes continued Step Action 4 Choose Find Primers amp Probe Now from the Options menu The software generates a table of forward primers reverse primers and probes 5 To examine the list of candidate primers and probes click the Primers tab at the top of the Sequence Tab dialog box Primer Express Documents 4 13 Selecting Primers To select primers and probe and Probes Step Action 1 Scroll to the right of the forward primers to the list of TagMan probes Choose the probe that has more Cs than Gs Note Primer Express software only selects probes on the sense strand It is acceptable to choose a probe on the antisense strand if both of the following conditions are met a The antisense probe has more Cs than Gs b The antisense probe does not have G on the 5 end TagMan Probe 1 iol Cond Primers Map Recipe Results Forward Primer Start Length Tm Primer Start Length Tm TTGTTCCATTTGCAACTTCTC ABT 270 24 58 38 TTGTTCCATTTGCAACTTCTCADGT 245 31 na 42 270 24 58 38 TTGTTCCATTTGCAACTTCTCADGT 245 32 na 41 270 24 59 38 TTGTTCCATTTGCAACTTCTCADGT 298 31 na 45 2 35 TTGTTCCA
102. d ES are the enthalpy and entropy for helix formation respectively R is the molar gas constant 1 987 cal K mol is the total strand primer concentration and X is the salt concentration Formula Used in Primer Express Bibliography References List of References Applied Biosystems 1995 DNA Sequencing Chemistry Guide Foster City Applied Biosystems Breslauer K J Frank R Blocker H and Marky L A 1986 Predicting DNA duplex stability from the base sequence Proceedings of the National Academy of Sciences 83 3746 3750 Chandrasekharan U M Sanker S Glynias M G Karnik S S and Husain A 1996 Angiotensin Il Forming Activity in a Reconstructed Ancestral Chymase Science 271 502 505 Dieffenbach C W Lowe T M J and Dveksler G S 1993 General Concepts for PCR Primer Design PCR Methods and Applications 3 530 537 Livak K J Marmaro J and Todd J A 1995a Towards fully automated genome wide polymorphism screening Nature Genetics 9 341 342 Livak K J Marmaro J and Flood S 1995b Guidelines for Designing TaqMan Fluorogenic Probes for 5 Nuclease Assays Research News 790701 Foster City Applied Biosystems Mullis K B and Faloona F A 1987 Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction Methods in Enzymology 155 335 350 Plikaytis B B Gelber R H and Shinnick T M 1990 Rapid and Sensitive Detection of Mycobacterium leprae
103. ded Limit 3 G C ppt TCNAGCHNGG CTGCAACATA LG AGTGGCACTA AACAGCAGTC ACAGAACATA GOAGCTGCCA ACAGTCTAGG TICCTCCTTA TIGITGCTGT GAACCAGGAT AACCTATGCA ATCTATGGNG GATGIGCTGA AGGCOATTGT TCTTTCCAGA CAGCACTATA TAGTCTTAGC GATGGGAAAC CTCACCATGG ATGCTGGAGA GCAACTTCTC GTGGTCCTAA CACAAAGAGT TNNTTTGAT CAACCCAAAA AGAGCECCTG AGTGTCTGCT AGTCTCAAAG TTGACAAGGC GCCTAAAATT NAATGTTAA G N Nested Primer Data External Forward Primer AAATCAGAGTGGCACTAAGGCC Tm 58 TGC 50 Internal Forward Primer ATTGICTCACCATGGCAACCC Tm B1 TGC 52 Internal Revers Primer GCAGCAGACACTTICTCCAGCAT Tm TGC 55 External Rewerse Primer ag SLIBE 50 External Amplicon Tm yu YGC 47 Internal Amplicon Tm vee YGC 45 Amplicon Sense strand P1 P3 Anti sense PA Pd strand 4 46 Primer Express Documents Starting the Document Nested PCR Applications To start a new Nested PCR document choose New from the File menu and select Nested PCR Document from the submenu For more information about the pages contained in the Nested PCR document see Chapter 5 Primer Express Pages Nested is
104. different measures of similarity examined are Maximum number of consecutive residues that match Percentage match over the entire subsequence Number of consecutive residues matching at the 3 end The maximum acceptable values for these criteria are specified in Primer Site Uniqueness Requirements If the sequence being examined by the Primer Express software is the entire template sequence that is if the PCR is being performed on cloned DNA the entire sequence of which has been entered in the program this test should prevent mispriming To increase the number of primer pairs found increase any or all of the following parameter values Max Consec Match Max 3 Consec Match Amplicon Length The Amplicon Length calculates the length of the amplified sequence Test generated by the primer pair If this length is greater than or equal to the Amplicon Min Length and less than or equal to the Amplicon Max Length the primer pair passes this test To increase the number of primer pairs found increase the Amplicon Max Length parameter value and or decrease the Amplicon Min Length parameter value A 4 Interim Results Window Avoid Excludes Test T Match Test Amplicon T Test Target Test The Avoid Excludes Test checks each primer pair to determine if any excluded region is amplified If the amplified region avoids all excluded regions the primer pair passes this test You can import excluded
105. document in the Primer Express software Archive Primer Express Software Menus 7 7 Edit Menu About the Edit Menu Copy Complement Clear Annotation The Edit menu contains menu options for editing and searching for sequence text Egi a eb Use this command to write sequence text to the clipboard that is complementary to the highlighted text as well as in the reverse direction For example if the highlighted text is AAAG the Copy Complement option puts the text CTTT onto the clipboard After you have used the Copy Complement menu option you can paste the complementary text into a Primer Test document or use it in a Find Sequence command For information see Primer Test Document on page 4 67 or Find Sequence on page 7 9 Use this command to simultaneously erase all annotations currently on the Sequence page To erase annotations individually use the Eraser tool For information about the Eraser tool see How to Delete Annotations on page 6 5 7 8 Primer Express Software Menus Find Sequence General Information Use this command to locate specific patterns or restriction enzyme sites on the Sequence page The Find Sequence dialog box appears Find Sequence Sites pop up menu E Fields The following table describes the fields in the Find Sequence dialog box Field Description Find the next Enter the sequence data
106. e 2 Probe Designing the Allele 2 Probe To design the probe for Allele 2 Step Action 1 In the TaqMan Probe document for Allele 2 click the Sequence tab Primer Express Documents 4 23 To design the probe for Allele 2 continued Step Action 2 Select a region containing potential probe sequences a Highlight the polymorphic sequence and approximately 10 nucleotides in both the 5 and directions b Copy the sequence for the Allele 2 probe If the Allele 1 probe is Then go to the Edit on the menu and select sense strand Copy antisense Copy Complement complementary strand IMPORTANT Both probe sequences in the allelic discrimination assay must come from same strand otherwise the two probes will hybridize to each other c Open new Primer Test document from the File menu and click the empty Primer text box d From the Edit menu select Paste Primer Express copies the appropriate sequence into the test document and calculates the of the oligonucleotide IMPORTANT Do not change the primer and salt concentration default values 3 For easier identification label the polymorphism within the Allele 2 probe sequence a Select the polymorphism within the Allele 2 sequence in the Primer text box b Press the key corresponding to the letter of the polymorphic base Primer Express replaces the uppercase letter of the base with
107. e T horizontal scale changes along with the scale of the primer pair graphics in the Primer pane at the bottom of the Map page maximal T minimal T plot line shows a running graphic display of the primer T using a calculation window defined by the value entered for optimal primer length default 20 Plot checkbox T scale Figure 5 3 Features of the Plot Number of nucleotides in Annotation bar sequence plot line T min max lines Primer Express Pages 5 39 Feature Description GC Plot The GC plot displays in green at the top of the Map page feature map Click the GC Plot checkbox to toggle the GC plot on or off The GC plot is composed of four components Figure 5 4 GC scale shows the values that the GC min max lines and GC plot lines have at any point in the display The GC horizontal scale changes along with the scale of the primer pair graphics in the Primer pane at the bottom of the Map page GC maximal minimal GC plot line shows running graphic display of the sequence GC percentage GC min max lines Number of nucleotides in C Plot checkbox sequence GC scale GC plot line Figure 5 4 Features of the GC Plot Annotation Bar The annotation bar is the black horizontal line located at the bottom of the Feature Map upon which representations of the sequence annotations are displayed
108. e file displays Note You must use a different name for the new archive file if you want to keep the old file Click New to create a new Primer Express software Archive Name the new Archive file and choose a location to save it 6 Click Save 3 4 Getting Started How to Use the Primer Express Software About the Interface Viewing a Page Process of Using the Primer Express Software The Primer Express software is easy to use even for the newcomer The steps you use to design oligos with the Primer Express software are for the most part the same steps you use when designing oligos on paper The Primer Express software user interface is divided into seven functional pages each with its own tab at the top as shown below Params RwnCond Primers Recipe Results To view page click its associated tab Note Primer Express software displays sense strand DNA sequences using the convention left to right 5 to 3 and anti sense sequence data using the convention right to left 5 to 3 After completing the steps in the following table Table 3 1 lists the process of how to use the Primer Express software To complete this step See Entering your registration How to Start the Primer Express information Software the First Time on page 3 2 Creating the Primer Express How to Create the Primer Express software Archive file Software Archive File on page 3
109. e number of repeated test further Primer bases meets the Composition Requirements specifications Max G Repeat 4 Calculate all possible hairpins within the primer For each possible hairpin determine both the maximum number of consecutive residues that could base pair in such a structure and the total number of base pairs formed IF the hairpin THEN exceeds the specified reject the primer parameters meets the specified test further Primer parameters Secondary Structure Requirements E 4 Theory of Operations Table E 1 Stages for calculating individual primers continued Stage Description 5 Determine if the candidate primer has significant sequence similarity to any other region of the sequence IF the primer THEN exceeds any one of the similarity parameters reject the primer meets the similarity parameters the primer is acceptable Primer Site Uniqueness Requirements Theory of Operations E 5 Stages for Calculating Primer Pairs Calculating Primer Express software forms candidate primer pairs by matching Primer Pairs each calculated forward primer with each reverse primer then tests each candidate primer pair using the following steps to determine ultimate acceptability E 6 Theory of Operations For information on calculating primer pairs see Appendix B Calculating Penalty Score Table E
110. ed when you started the Primer Express software for the first time defaultZPXArchive When this Page is Useful For example the Results page is useful if a number of different people in the lab are working on the same gene sequence The data from the Results page tells you whether someone else has already made primer set to amplify a region of interest and how well their primers worked The following is an example of the Results page DNA PCR 8 test film TA 5 50 Express Pages Features The Results page contains a number of data fields some of which contain data generated by the Primer Express software the remainder are available for user input The following table lists the features of the Results page Feature Description Sequence Displays the name of the sequence imported into the Primer Express software If you have not imported a sequence file the message No File Loaded appears User Displays the name of the registered user whose PC computer is being used to run the Primer Express software Forward Primer Displays the sequence of bases that make up the forward primer Reverse Primer Displays the sequence of bases that make up the reverse primer Hybridizing At Displays the numerical locations indicating the primer 5 and 3 end bases T These two fields display the 5 of their associated m primers Cycle Params This secti
111. ent can process sequences using all Primer Express document types except for Allele Specific PCR and Primer Test Note Unlike most other Primer Express documents the Batch Processing document does not contain pages or tabs The following is an example of a Batch Processing document Batch 1 PCR Done Nested PCR Done TaqMan Calculating Cycle Sequencing Waiting You can import up to 48 sequences into a Batch Processing document However the more sequences being processed the greater the chance that the speed of the program will be degraded Remember that the speed at which the Primer Express software finds primers is limited by the power of your PC computer Primer Express Documents 4 61 4 62 Starting start a new Batch Processing document choose New from the File Document menu and select Batch Processing Document from the submenu Features The Batch Processing document has the following features Item Description Add Button The Primer Express software Drag and Drop feature allows you to drag individual sequence files or an entire folder of sequence files onto a Batch Processing document For more information see Importing a Sequence on page 5 11 Displays a dialog box that allows you to select sequence files to add to the Batch Processing document You can add files one at a time or in a group Delete Button Removes the highlighted sequence file from the Batch
112. equence and excludes residues outside the selected region from the calculation Forward Primer TTCCACACAACATACGAGCCG Note Look at potential probes from the complementary sequence IMPORTANT Add remove nucleotides evenly to from both ends of the probe so that the polymorphic site remains within the center From the Edit menu select Trim The software eliminates all but the selected nucleotide sequence from the Probe Test document 4 22 Primer Express Documents To design the probe for Allele 1 continued Step Action 7 Count the number of nucleotides in the probe sequence If the probe is Then gt 30 nucleotides design an MGB probe as explained in TaqMan MGB Probe Design Guidelines on page 30 30 nucleotides a Identify the nucleotide strand sense or antisense with more cytosine than guanine residues This strand is the probe sequence of interest IMPORTANT The 5 end of the probe must not be a guanine residue b Copy and paste the final sequence for the Allele 1 probe into a text document for ordering c Go to the next step 8 To select the probe sequence in the Sequence tab a Go to the TaqMan Probe document for allele 1 b From the Primer Express Tools palette click the probe tool c Select the edited probe sequence on the Sequence tab Primer Express highlights the probe sequence in green d Go to the next step Designing the Allel
113. er pairs the Primer Express software assigns Score How the Penalty Score is Calculated each primer amplicon set a Penalty Score that indicates its relative value A lower Penalty Score is better and indicates a primer amplicon set that satisfies a greater percentage of the parameters contained in the Parameters page Penalty score is not absolute that is the numbers assigned do not directly correlate to any physical measurement Penalty scores are calculated during amplicon assembly and are used to dynamically select the best 200 amplicons from among all possible amplicons Penalty Score is displayed on the Primers page in the column at the far right you must scroll to the right to view the penalty score The Primer Express software calculates the Penalty Score using the formula shown in the Penalty Definition dialog box Figure B 1 which contains values the user can modify Calculating Penalty Score B 1 Displaying Penalty To display the Penalty Score dialog box choose Define Penalty Score Score Dialog Box from the Edit menu Document type pop up menu Penalty Score DNA Figure B 1 Penalty Definition dialog box Weightings of the n the default Penalty Definition values Difference between Primer Ts Values is weighted quite heavily while two of the criteria are not weighted at all Number Ambiguous Residues and Max Length Amplicon Length You can change the weighting of the criteria by modifyi
114. ers page of a DNA PCR document except that the 5 Tail criteria are replaced with TaqMan probe criteria The following is an example of the Parameters page for the TaqMan Probe document MED LL ET Probe H Features TagMan Probe parameters page features Feature Description TaqMan Probe A data entry field allows you to select the temperature Criteria spread between primer and probe The default value is ten degrees A checkbox allows you to select whether the TaqMan probe begins with a G Other Params For descriptions of the remaining parameters see Standard Sequence Page on page 5 4 5 28 Primer Express Pages Parameters Page for Sequencing About the Page Parameters Page for Sequencing Documents Example Features The Parameters page for Cycle Sequencing and Sequencing Primer documents contains several parameters unique to the sequencing applications Unlike most other Primer Express documents the Parameters page for Sequencing documents does not have a Fewer Params option because of the many parameters that are required to set up a Sequencing document The following is an example of the Parameters page for Sequencing documents 5 Sequencing Primer 1 The Primer Position Requirements field allows you to set the primer position relative to the end of the sequence For a description of the complete set of parameters available see Standard Sequence Page on
115. es contain Assays Work different fluorescent reporter dyes FAM and VIC to differentiate the amplification of each allele During PCR each probe anneals specifically to complementary sequences between the forward and reverse primer sites AmpliTaq Gold DNA polymerase can cleave only probes that hybridize to the allele Cleavage separates the reporter dye from the quencher dye which results in increased fluorescence by the reporter dye Thus the fluorescence signal s generated by PCR amplification indicate s the alleles that are present in the sample Mismatches Between Probe and Allele Sequences Mismatches between a probe and allele reduce the efficiency of probe hybridization Furthermore AmpliTaq Gold DNA polymerase is more likely to displace the mismatched probe rather than cleave it to release reporter dye The figure below illustrates results from matches and mismatches between allele and probe sequences in allelic discrimination assays Livak et al 1995 et al 1999 Match Mismatch AmpliTaq Polymerase Match Mismatch GR1556 4 16 Primer Express Documents TaqMan Probe and Primer Document Example The table below summarizes the possible results of the example allelic discrimination assay shown above A substantial increase in Indicates VIC fluorescence only homozygosity for Allele 1 FAM fluorescence only homozygosity for Allele 2 both fluorescent signa
116. ex PCR document Using the Drag and Drop Feature To import a sequence file using the drag and drop feature Step Action 1 Position the Primer Express document window on the screen so that the Sequence page is visible when you return to the Finder Locate the sequence s you wish to import into the Primer Express document Drag a sequence or folder icon directly onto the Primer Express software Sequence page Primer Express Pages 5 11 5 12 Entering Sequence General Information If you prefer to enter a sequence using the keyboard type the sequence letters or paste from the clipboard except in the Allele Specific document see paragraph below You can enter any IUPAC standard characters into the Sequence page See Appendix F IUPAC Codes for a complete listing of the IUPAC character set Note You cannot type modified bases for example methylated C into the Sequence page Allele Specific PCR Document You cannot type a sequence into the Allele Specific PCR Sequence page However the Primer Express software recognizes Sequence Navigator files which is a standard interchange format for DNA sequence alignments Multiplex PCR Document You cannot type multiple sequences directly into a Multiplex PCR document To enter more than one sequence in a Multiplex PCR document create separate text files using a word processor then import the text files into the Sequence page of t
117. from Probe Design both strands Guidelines the guidelines in the table below for designing TaqMan MGB probes Priority Guideline 1 Avoid probes with a guanine residue at the 5 end of the probe A guanine residue adjacent to the reporter dye will quench the reporter fluorescence even after cleavage Select probes with a Primer Express software estimated of 65 67 C Make TaqMan MGB probes as short as possible without being shorter than 13 nucleotides 4 Avoid runs of an identical nucleotide This is especially true for guanine where runs of four or more should be avoided 5 Position the polymorphic site in the central third of the probe Note The polymorphic site can be shifted toward the 3 end to meet the above guidelines however the site must be located more than two nucleotides upstream from the 3 terminus The following figure illustrates the placement of a polymorphism in an example probe N Nucleotide Polymorphism If necessary place the polymorphism here N N N N N NN NNN N N NIN N NN NINN First try to position the polymorphic Do not place the site in the central third of the probe polymorphism here 4 30 Primer Express Documents Loading the Sequence IMPORTANT Because of the asymmetric placement of the minor groove binder at the 3 end complementary TaqMan MGB probes do not necessarily have the same To load
118. g About the Page Use the Recipe page for Cycle Sequencing with the ABI PRISM Taq Terminator Ready Reaction Kit This page functions like the Standard Recipe page Standard Recipe Page on page 5 45 but contains recipe components for the Cycle Sequencing application Results Page The following is an example of the Recipe page for Cycle Sequencing Example Recipe ow fuser2 You need a DNA sequence for primers ta be found Retum to the Sequence page to enter Primer Express Pages 5 47 Features The following table lists the features of the Results page Feature Description Stock Concentrations column Contains the concentrations of the stock solutions used to create the PCR mixture for cycle sequencing The last two components on the page are user definable This feature lets you add something extra to your protocol These extra additions are typically enzymes or proteins such as BSA UNG dUTP or gelatin Template pop up Menu Lets you select from single stranded ss double stranded ds or PCR product template Each template specifies its own concentration for the cycle sequencing reaction Reaction Volume Volume required for the cycle sequencing reaction default 20 uL 5 48 Primer Express Pages Recipe Page for Sequencing Primer About the Page The Recipe page for Sequencing Primer func
119. ge More Params Fewer Params button Toggles the Parameters page between the Fewer Params display and the More Params display For more information see More Parameters on page 5 22 THEN only the primary parameters are displayed IF you are in Fewer Params mode More Params mode all primary and secondary parameters are displayed Figure 5 2 Because more text and data fields must fit into the same space the text is smaller and has less space For more information see Figure 5 2 Primer Express Pages 5 21 Description Figure 5 2 Params page with More Params displayed Defaults Resets the numbers in the data fields to the user selected button default values set in the Preferences window For more information Preferences Command on page 7 13 Factory Resets the numbers in the data fields to the original factory Defaults default values button More Parameters On all PCR document types except Multiplex PCR and Allele Specific PCR you can toggle the Parameters page between two displays using the More Params Fewer Params button see More Params Fewer Params button on page 5 21 The features described in this section are available only when More Params are displayed The following table lists the additional parameters that are displayed when you click the More Params button see Figure 5 2 on page 5 22
120. hapter include the following Topic See page About the Documents 4 3 How to Use the Document Window 4 5 TagMan Assay Design Guidelines 4 7 About TaqMan Probes 4 8 Amplifying Custom Target Sequences for Quantitation 4 9 Using Conventional TaqMan Probes for Amplifying Target 4 16 Sequences for Allelic Discrimination Using TaqMan MGB Probes for Amplifying Target Sequences 4 27 for Allelic Discrimination TaqMan Assay Design Guidelines 4 39 Primer Design Considerations for PCR Application 4 40 RT PCR Document 4 43 Nested PCR Document 4 46 Allele Specific PCR Document 4 48 About Allele Specific PCR Applications 4 50 Multiplex PCR Document 4 52 How to Calculate Multiplex Primers 4 54 DNA PCR Document 4 57 Cycle Sequencing Applications 4 58 Sequencing Primer Document 4 60 Primer Express Documents 4 1 Topics in this chapter include the following continued Topic See page Batch Processing Document 4 61 How to Use a Batch Processing Document 4 64 Primer Test Document 4 67 4 2 Primer Express Documents About the Documents What Are the Documents Each Document Type List of Documents Notebook Concept The Primer Express software lets you choose from ten different application specific vehicles called documents for designing calculating and investigating primers and probes Each document type Supports a specific application Fo
121. he Multiplex PCR document Alternatively you can use the PRIMER format for designating multiple sequences in a single text file For more information see Imported Sequence Files on page C 2 How to Enter and Name a Sequence To enter and name a sequence Step Action 1 Type or paste the sequence text 2 Press the Tab key to select the file name data field 3 Type the name under which you wish to save the Primer Express document 4 Press Ctrl S to save the document or select Save from the File menu Primer Express Pages Locking General Information Unlocking when you import a sequence into the Sequence page the sequence Sequence text is locked to prevent you from accidentally modifying or deleting sequence text If you wish to make changes to the sequence text or to drag a portion of the sequence text into a clipping file unlock the sequence data before proceeding How to Unlock the Sequence Text To unlock the sequence text click the lock icon ig in the upper left corner of the sequence page When the sequence text is unlocked the icon turns into the unlock icon Note If you delete all the text of an imported sequence you cannot import another sequence file You must open a new document in order to import another sequence Editing a Sequence General Information Standard Windows Cut Copy and Paste commands are available for working with Sequence data Note You cannot m
122. he Vae ac A Eg aede 5 16 When the Primer Express Software Finds a Primer 5 16 When a Primer Set is Displayed 5 17 When the Primer Express Software Does Not Find Primers 5 18 Standard Parameters sues ad SEE E p LP 5 19 About lie Pages CER e ed utes A Vite dotes 5 19 DNA PCR Parameters Page Example 5 19 SIND S ER C E RE a 5 20 More Paramete Esc duodccim eb ari ache de oup dos eed 5 22 Set Paramete S dex e cts 5 24 Primer Desten Sale Sye id decur bor Rr EE Deo Ro RT 5 24 Seine 5 252 i seq 5 24 Parameters Page Multiplex PCR 5 25 PROOUC the s usen bete debe wt oa uei 5 25 Multiplex PCR Parameters Page Example 5 25 lav Irc TIT TEM 5 26 Parameters Page Allele Specific PCR 5 27 INDOut the Pd9e REDE 5 27 Allele Specific Document Parameters Page Example 5 27 ECaluleStaquece ado ese PAN Ae Ita ede 5 27 Parameters Page for the TaqMan 5 28 ek attuale ce bs 5 28 TaqMan Probe Document Parameters Page Example 5 28 PC AUT ora uias ates es
123. he stock solutions used to create the PCR mixture The last two components on the page are user definable This feature lets you add something extra to your protocol These extra additions are typically enzymes or proteins such as BSA UNG dUTP or gelatin Volume column Shows the volume of each component to add to the reaction to achieve the final concentration Final Concentration column Contains the desired final concentrations for the Reaction Volume Volume required for the reaction default 100 pL Number Tubes Number of reaction tubes you use for the PCR default 1 Pipeting Excess Quantity of extra mixture you want to create in order to have some to spare This quantity is also known as slop factor The number entered is a percentage of the reaction volume default 20 Protocol pop up Menu Lets you select the correct protocol for your PCR Amplification Magnesium Titration or Polymerase Titration Creating the create the reaction protocol Reaction Protocol Step Action 1 Verify or modify the data contained in the data fields on any Recipe page to reflect the correct proportions of reaction components Select the protocol type from the Protocol pop up menu Click the Create Protocol button to display the protocol text file 4 Print the protocol for your records 5 46 Primer Express Pages Recipe Page for Cycle Sequencin
124. icates the size of the grouping You can group sequence data into sections ranging in size from 1 120 bp or set for no grouping To change the base grouping a Position the cursor over the slider control When in position the cursor changes to the slider control cursor b Click and drag to change the grouping Increase group size drag to the right Decrease group size drag to the left Eliminate grouping drag all the way to the left Primer Express Pages 5 7 Sequence Page Allele Specific PCR About the Page The Allele Specific PCR document uses sequence alignments rather than individual sequence files For this reason the Allele Specific PCR Sequence page has a number of features different from the Standard Sequence page Allele Specific The following is an example of the Allele Specific PCR Sequence page PCR Sequence With imported sequence Page Example g p 3 O Allele Specific PCR 1 DJBaboon EJDog DJHuman DJMouse DJHouse LES RT IT DJHouse DJRat 1 DJRat 2 To load a alignment file click the Import Aignment File button 5 8 Primer Express Pages Features The following table describes the call outs in the above figure Call Out Feature Description 1 Consensus Shows the degeneracy of any base position Degenerate residues are colored white and conform to IUPAC base composition conventions For a full descrip
125. id strings of four or more identical bases and mismatches within the primer sequence Secondary structures in the primer particularly at the 3 end can lead to formation of hairpin loops The Cycle Sequencing document in the Primer Express software is specifically designed to accommodate the above parameters 4 58 Primer Express Documents For More Information For more information on cycle sequencing applications refer to Applied Biosystems 1995 and Sanger et al 1977 the pages contained in the Cycle Sequencing document see Chapter 5 Primer Express Pages Primer Express Documents 4 59 Sequencing Primer Document When to Use the Document Sequencing Primer Document How the Document Works Starting the Document The Sequencing Primer document is used to find primers in Sanger dideoxy nucleotide sequencing reactions which use a nonthermostable polymerase The following is an example of a Sequencing Primer document showing the Sequence page Sequencing Primer 1 LIBE x Sequence File Name ox208 131 ab1 Import WHS Bile Length 47 1bp Selection 321 to 321 Double Stranded Limit G C ppt AGAAAGAAAG CTGCAACATA ACCTATGAAT GATGTGCTGA GATGGGAAAC CCAAAATMAT GGTAAATCAG AGTGGCACTA AGGCCATTGI CTCACCATGG CAACCCAAAA ACAGTCTAGG
126. identical nucleotide This is especially true for guanine where runs of four or more Gs should be avoided The T should be 58 60 The five nucleotides at the 3 end should have no more than two and or C bases 4 10 Primer Express Documents Generating List of Candidate Primers and Probes Use the software s default values shown on the Params tab to generate a list of candidate primers and probes To generate a list of potential primers and probes Step Action 1 Import a DNA sequence for designing probes and primers To select a probe from Then a DNA file a From the File menu scroll to New submenu and select TaqMan Probe amp Primer Design A TaqMan Probe document appears b Click Import DNA File C Locate and select a DNA file in the browser d Click Open The software loads the sequence and displays it in the Sequence tab an existing a From the File menu select Open TaqMan The Document Archive dialog box appears Probe b Double click the document to load or select the SOC Ment sequence and click O located in pn the The software loads the sequence and displays it in Document the Sequence tab Archive a text a Select the sequence from the text document or the document navigator window or GenBank From the Edit menu select Copy sequence q c From the File menu scroll to the New submenu and select TaqMan Probe amp Primer Design A Taq
127. ile You can use this file as an attachment in your electronic mail program Print the document and fax it Primer Express Pages 5 37 Map Page About the Page The Map page displays a graphical view of all primer pairs found along with graphs for Tm GC and all sequence annotations For a description of the Map page for Nested PCR see Map Page for Nested on page 5 44 Map Page The following is an example of the Map page with a number of Example annotations displayed DNA PCR 6 Feature Map Primer pane 1 Ta and GC plots 6 Reverse Primer 3 End 2 Exclude Region annotation annotation 3 Site annotation 7 ORF annotation 4 Forward Primer annotation 8 Scale Control 5 Target Region annotation 9 Scroll bars 5 38 Primer Express Pages Features The following table lists the Map page features Feature Description Feature Map The Feature Map is located at the top of the Map page and shows a capsule view of the sequence features including plot GC plot and the Annotation Bar Plot The plot displays in magenta at the top of the Map page Feature Map It is displayed by default when you view the Map page for the first time To toggle the T plot on or off click the T Plot checkbox The T plot is composed of four components Figure 5 3 T scale shows the values that the min max lines and plot lines have at any point in the display Th
128. imer selection Use the Interim Results window to guide you For more information see Show Hide Interim Results on page 7 15 Setting Parameters set parameters Step Action 1 Highlight the data entry field you wish to change or press the Tab key to move from field to field The Reaction Conditions page also contains values that affect primer calculations For more information see Features on page 5 31 2 Type the value you wish to enter into the data field Note You cannot enter a minimal or optimal parameter value greater than the current maximal parameter value Similarly you cannot enter a maximal or optimal parameter value less than the current minimal parameter value To change parameters this drastically you must change them in the correct order Select Find Parameters Now from the Options menu 4 On the Primers page or Map page view the new selection of primer pairs generated by your parameter change 5 On the Primers page view the Interim Results pull down the Options menu and select Show Interim Results to help you determine the reason for the number of primers found For a description of the tests that produce the Interim Results see Appendix A Interim Results Window 6 Repeat this procedure until you get the selection of primer pairs you desire 5 24 Primer Express Pages Parameters Page Multiplex PCR About the Page The Parameters page for the Multiplex
129. imer pair in a Multiplex PCR document Ti Primer Length Opt Primer Length Considers the absolute value of the difference between the primer length and optimal primer length parameter for each primer in a Multiplex PCR document T Number Ambiguous Residues Considers the sum of the number of ambiguous residues found in all primers in a Multiplex PCR document Max Difference Between Primer Tas Considers the largest value of the difference between two primer in a Multiplex PCR document 0 X Amplicon Size Spacing Penalizes too small a spacing between amplicons in a Multiplex PCR document The spacing between each pair of adjacent amplicons in a Multiplex PCR document is measured This number is subtracted from the user definable amplicon spacing parameter X default 20 If the result is a positive number then the number is used in the Penalty score calculation Distance Between Primer and TaqMan Probe Considers the distance between forward primer and the TaqMan probe in a TaqMan Probe document Calculating Penalty Score B 3 Feature Description Start Min Penalizes primers that do not comply with the Min Distance From End distance from end specified in the Parameters page of the Cycle Sequencing or Sequencing Primer document Max Distance From Penalizes primers that are farther away from the End Start sequence end in a C
130. increase the number of primer pairs found decrease the GC Clamp parameter value For most DNA sequences a GC Clamp setting of greater than two causes no primer pairs to be found The GC Test calculates the GC content of the primer If the GC content is greater than or equal to the Min GC parameter value and less than or equal to the Max GC value then the primer passes this test Because of the variable GC content of DNA sequences you may need to change this parameter often so that the Primer Express software can find primer pairs To increase the number of primer pairs found increase the Max GC parameter value and or decrease the Min GC parameter value A 2 Interim Results Window T lest Repeat Test Secondary Struc Test The T Test determines the T of the primer using the nearest neighbor algorithm For more information about this algorithm see Appendix G Formula Used in Primer Express If the calculated primer is greater than or equal to the Min T value and less than or equal to the Max T value the primer passes this test Because of the variable GC content of DNA sequences and the dependence of calculated on GC content you may need to change the Min Max GC parameters often so that the Primer Express software can find primer pairs In addition because primer length affects primer you may need to change the primer length parameters to obtain the desired Tm To increase the number of primer pai
131. inition Glossary 2 Standard Recipe page 5 46 Preferences command 7 13 primer adding a forward primer annotation 6 12 to 6 13 adding a forward primer end annotation 6 14 to 6 15 adding a reverse primer annotation 6 16 to 6 17 adding reverse primer end annotation 6 18 to 6 19 concentrations 5 31 design considerations for PCR applications 4 40 to 4 42 design strategy when setting parameters 5 24 length parameters 5 20 setting the concentration 5 51 Primer Concentration Primer Test document 4 68 Primer Data file 3 primer dimer definition Glossary 2 Primer End Composition 5 26 Primer Express about 1 2 and PCR D 1 to D 3 Archive file creating 3 3 to 3 4 creating additional file 3 4 bibliographical references 1 to H 2 how to learn more 3 7 notebook concept 4 3 starting the first time 3 2 theory of operations 1 to E 7 how Primer Express finds primers 2 stages for calculating primer pairs 6 stages for calculating primers E 3 to E 5 Primer Express Applications Tutorial 3 7 Primer Express documents about 4 3 to 4 6 Allele Specific PCR document 4 48 to 4 51 parameters page 5 2 sequence page 5 8 to 5 10 Batch Processing document 4 61 to 4 63 using the document 4 64 to 4 66 Cycle Sequencing document 4 57 applications 4 58 to 4 59 parameters page 5 29 Recipe page 5 47 to 5 48 DNA PCR document 4 39 Multiplex PCR document 4 52 to 4 53 calculating primers 4 54 to 4 56 parameters page 5 25 to 5 26 Nested PCR document 4
132. is an example of a TaqMan MGB Probe and Primer document showing primers and probe graphics HGE Probe 1 Iofs File 208 131 Impar EJ Eon Kile Length 47 1bp Selection 254 to 312 Double Stranded Sequence TCHMAGCWNGG TACCCTTTCA AGAAAGAAAG 50 CTGCAACATA GATGTGCTGA GGTASATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG AACAGCAGTC TCTITCCAGA AGAGCCCCTG ATGCTGGA GA AGTGTCTGCT EMSGUCTGCCA TTGTTGCTGT TGPICCATTIT GTGACAGCAA CATASAGGNG GTGGICCTAA AACCTATGCA TAGTCTTAGC CACAAAGAGT AAGTGGCTTC ATCTATGGNG THNTTTGATA ANCATGAATG NMAATGITA A G M TagMan amp MGB Probe Primer Data Forward Primer GCTGCCATTGTTGCTGTITGT Tm 58 YGC 50 Start 254 Length Reverse Primer TCTTGCTGTCACCTTITGAGACTG Tm 58 qa Probe CCATTTGCAACTTC Tm 88 G0 43 Start 312 Length Start 274 Length Atotal of 200 primer pairs found To examine primer pairs click the Primers tab 7 Primer Express Documents 4 29 TaqMan MGB IMPORTANT When designing probes it is important to consider probes
133. lect a region containing potential probe sequences a Highlight the polymorphic sequence and approximately 10 nucleotides in both the 5 and directions b Copy the sequence for the Allele 2 probe If the Allele 1 probe is Then go to the Edit menu on the and select sense strand Copy antisense Copy Complement complementary strand IMPORTANT Both probe sequences in the allelic discrimination assay must come from same strand otherwise the two probes will hybridize to each other c Return to the TaqMan MGB Probe Test document which contains the Allele 1 probe sequence Click the empty Probe text box d From the Edit menu select Paste MGB Probe Test 1 Mie x Probe 1 Paste here Tm GC Length Probe Z CEGLCTCETATGTTCT p NE Allele 1 m Hun GC 533 Length 15 Probe for reference only 4 7 Primer Express copies the appropriate sequence into the test document and calculates the of the oligonucleotide 4 36 Primer Express Documents To design the probe for Allele 2 continued Step Action 3 For easier identification label the polymorphism within the Allele 2 probe sequence a Select the polymorphism within the Allele 2 sequence b Press the key corresponding to the letter of the polymorphic base Primer Express replaces the uppercase letter of the base with a lowercase letter 4 Highlight po
134. lectne Sequence T6XD us ee e o SP p AE edn 6 4 Modifying an 6 4 Removing an Annotation 6 5 How to Delete 6 5 Deleting ANNON sastrea T E A ied Rated 6 5 Removing All 6 5 How to Specify a Sequence 6 6 Inttodi Oll 9 ax bite ba dob det tede D nudi dts 6 6 Adding a Target 6 6 Modifying a Target 6 7 How to Specify Where the Probe Must 6 8 Inttodac tois awed te ete d a 6 8 Adding Probe Annotation 6 9 Modifying a Probe 6 9 How to Exclude a Sequence 6 10 Lr 6 10 Adding an Exclude 6 10 Modifying an Exclude 6 11 How to Select a Forward Primer 6 12 IntrOdUe HO sa 24 4 toe des 6 12 Adding a Forward Primer 6 12 Modifying a Forward Primer Annotation 6 13 How t
135. lick the Junction tool to select it Junction The cursor changes to the junction cursor 6 24 Using the Annotation Tools Modifying Junction Annotation Removing a Junction Annotation To create a junction annotation continued Step Action 2 Position the junction cursor over the first sequence base in the junction and click the mouse button to insert the Junction annotation 2 TaqMan Probe 3 ox208 131 Bip POTIUS TCNAGCNNGG CTGCAACAT GATGTGCTGA GATGGGAAAC CCAAAATNAT 100 GGTAAATCAG AGTGGCACTA AGGCCATTGI CTCACCATGG CAACCCAAAA 150 AACAGCAGTC ACAGTCTAGG AGAGCCCCTG 200 ATGCTGGAGA AGTGTCTGCT 250 GCAGCTGCCA TTGTTGCTGT TGTTCCATTT GCAACTTCTC AGTCTCAAAG 300 GTGACAGCAA GAACCAGGAT CATAAAGGNG GTGGTCCT amp A TTGACAAGGC 350 TGCTATGGAS AACCTATGCA NAAAGGTCAA 400 AAGTGGCTTC ATCTATGGNG TNNTTTGATA GCCTAAAATT ANCATGAATG NAATGTTAAG M Ready to Calculate To find primers select Find Primers under Options menu Junction annotation inserted blue You can use the Select tool to move a Junction annotation For instructions on moving Junction annotations see Modifying
136. ls heterozygosity The TaqMan Probe and Primer document is used for designing PCR primers and their associated fluorogenic probe The following is an example of a TaqMan Probe and Primer document showing primers and probe graphics Probe 1 Pile ES Sequence Params RxnCond Primers Map Recipe Results File Name ox208 131 2b1 mpor DHA Fen Length 4 1bp Selection 185 to 185 AAAAAGAAAT XGNTESNNCC ATGGGAAAGT TCTTTCTTTC CTGCAACAT GATGTGCTGA GATGGGAAAC CCAAAATNAT GACGTTGTAT TGGATACTTA CTACACGACT CTACCCTTTG GGTTTTANTA GGTAAATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG CAACCCAAAA CCATTTAGTC TCACCGTGAT TCCGGTAACA GAGTGGTACC GTTGGGTTTT AACAGCAGTC ACAGTCTAGG TCTTTCCAGA AAGTAAATGT AGAGCCCCTG TTGTCGTCAG TGTCAGATCC TCTCGGGGAC CAGCACTATA ATGCTGGAGA AGTGTCTGCT TGTCTTGTGT GTCGTGATAT TACGACCTCT GCAGCTGCCA TTGTTGCTGT TGTTCCATIT GCAACTTCTC AGTCTCAAAG CGTCGACGGT ACAAGGTAAA CGTTGAAGAG TCAGAGTTTC CACTGTCGTT CTTGGTCCTA GTATTTCCNC GTGACAGCAA GAACCAGGAT CATAAAGGNG cacca e TAA TTGACAAGGC CTATGGAA AACCTATGCA TAGTCTTAGC CACAAAGAGT NAAAGGTCAA ACGATACC TIGGATACGT ATCAGAATCG GTGTTTCTCA NTTTCCAGTT Atotal of 200
137. ltiplex PCR document 2 Set Parameters on the Params page 3 Annotate the target region for each imported sequence For more information see Adding a Target Annotation on page 6 6 4 From the Options menu select Find Primers Now to calculate primers 4 54 Primer Express Documents Calculating Multiple Targets in a Sequence There are two methods for calculating multiple targets in a single sequence file Both methods are equally effective Using Method 1 To calculate primers for multiple targets in a single sequence Step Action 1 Open a new Multiplex PCR document 2 On the Params page significantly relax the stringency of the following parameters Primer minimal Tm Primer minimal and maximal length Primer GC content Amplicon minimal Amplicon minimal and maximal length On the Sequence page import a DNA sequence From the Options menu select Find Primers Now The Primer Express software calculates primers for this sequence 5 On the Sequence page use the Line tool to underline the target regions you are interested in amplifying 6 On the Map page do the following a Compare the locations of your underline annotations and any primer pairs You may need to scroll down or change the magnification to make comparisons Find existing primer pairs that amplify your underlined regions b Select a primer pair click it that amplifies a region you have underlined 7
138. mers tab Exclude annotation inserted strike through 6 10 Using the Annotation Tools Modifying an You can use the Select tool to move lengthen or shorten any Exclude Exclude annotation For instructions on modifying or removing Exclude Annotation annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 11 How to Select a Forward Primer Region Introduction Use the Forward Primer tool for setting a particular sequence region as the forward primer A primer specified using this tool does not need to meet the criteria specified in the Params page Note Only one Forward Primer annotation is allowed for each set of Primers allowed by the Primer Express document except for Multiplex PCR and Nested PCR which allow more than one set of primers Creating a new Forward Primer annotation automatically deletes any existing one as well as deletes any Forward Primer End annotations and incompatible Target annotations Adding a Forward The following procedure describes how to add a Forward Primer Primer Annotation annotation To add a Forward Primer Annotation Step Action 1 Click the forward primer tool to select it The cursor changes to the blue l beam cursor 1 Position the cursor over the sequence base where you wish to begin the Forward Primer annotation 6 12 Using the Annotation Tools Modifying Forward Primer Annotation To add a For
139. minimal target regions limiting the target annotations to 10 20 bases 6 From the Options menu select Find Primers Now The Primer Express software calculates primers for this sequence This process could take several minutes or more depending on the power of your computer and the values of the new parameters 7 After the Primer Express software calculates primers note how many are found 8 Change to the Params page In the Last four positions contain pop up menu select the second option From the Options menu select Find Primers Now 10 Repeat step 7 through step 9 until you have tried all four primer end composition options and found which option gives you the most primers 4 56 Primer Express Documents Cycle Sequencing Document When to Use the Document Cycle Sequencing Document Example What to Use The Document For Starting the Document The Cycle Sequencing document is designed for finding primers to use in DNA sequencing using a thermostable polymerase The following is an example of the Cycle Sequencing Document showing the Sequence page Sequencing Primer 1 B x1 Sequence File Name ox208 131 ab1 Impar Length Selection 321 to 321 Double Stranded G C ppt Lira pa ra ra Y za pra gag pa uaa ga gra ga daa aga gau gag uaa aga uaa Tasso Lugo AGAAAGAAAG
140. n Esa 4 43 RI PCR Document Example 5 RS 4 43 How the Document 4 43 Starine the DOCUMEND d uc oq pr deu Sor gr ers 4 44 How GenBank File Are 4 44 Iniportne DIaSratic ouod ade e Saar aris 4 45 Nested PC RADOSUIDeDE uto her C POET Spa 4 46 When to Use the Documebt vt AES NOR 4 46 Nested PCR Document 4 46 star ne the DOCUMENT ue uw ERE ERE 4 47 Nested PCR Applications se eas 4 47 Allele Specific PCR Document 4 48 When to Use the 4 48 Allele Specific PCR Document Example 4 48 How to Use the 4 48 Starting the Document EN SEM 4 49 About Allele Specific PCR 4 50 Whatis Allele Specitic PER cti t pU REEL 4 50 esten petes Rave ova Se adiecta ena 4 50 Select Mismatch Nucleotide 4 5 Reducing Mismatch Extension 4 5 Reducing False Positives iue sd a qu pU Seda dese 4 5 For More Information 4 5 Multiplex PC
141. n and 5096 are single stranded Also the temperature at which 5096 of a long DNA fragment for example an amplicon is in double stranded conformation Glossary 2 Index Symbols definition Glossary 1 Numerics 373 377 310 sequence files C 2 5 tail glossary definition Glossary 1 primer parameters 5 21 A adding exclude annotation 6 10 Forward Primer annotation 6 12 to 6 13 Forward Primer End annotation 6 14 to 6 15 line annotation 6 22 probe annotation 6 9 Reverse Primer annotation 6 16 Reverse Primer End annotation 6 18 site annotations 6 26 target annotation 6 6 translation annotation 6 20 to 6 21 algorithm for calculations G 1 alignment file imported C 2 name listing 5 9 Allele Specific PCR document 4 48 to 4 51 parameters page 5 27 sequence page 5 8 to 5 10 allelic discrimination amplifying target sequences 4 16 4 27 using TaqMan Conventional Probes for 4 16 using TaqMan MGB Probes for 4 27 Ambiguity test A 2 ambiguous residue definition Glossary 1 amplicon definition Glossary 1 Length Test A 4 parameters 5 21 test 5 amplified region data 5 36 AmpliTaq See PCR enzyme annotating adding target annotation 6 6 to 6 7 deleting annotation 7 8 deleting using Eraser tool 6 5 Results Nested PCR document 5 52 sequence 5 15 annotation tools 6 3 applications Allele Specific PCR 4 50 to 4 51 Cycle Sequencing 4 58 DNA PCR 4 40 Multiplex PCR 4 56 Archive file creating 3 3 to 3 4 cre
142. n software IMPORTANT The person logged onto the computer must have system administrator privileges To install the Primer Express software Step Action 1 If you have not yet done so disable any virus protection software on your hard disk 2 Insert the Primer Express software Install disk Navigate to the CD drive on your computer 3 You will see several files Click on the Setup file Installing the Primer Express Software 2 3 To install the Primer Express software continued Step Action 4 Click Next and navigate to add the program to your computer 5 Select the program folder where you want Primer Express to load 5 elect Program Folder Administrative Tools Common Adobe Adobe Acrobat 4 0 Java 2 Runtime Environment Kensington Mouse orks Microsoft Office Small Business Tools Microsoft Office Tools Netscape 5 Click Next to install the Primer Express software into the designated Program Folder The software is automatically installed IMPORTANT If the setup program does not automatically run then double click the setup exe icon to launch the installer Take the following action a Click Finish b Eject the Primer Express software disk c Re enable your virus protection d Restart your PC computer Note You do not need to restart in order to use the Primer Express software Restarting reinstates your virus protection and cleans
143. nM Salt Allows you to change the salt concentration value default 50 mM Forward amp Reverse Primer Type or paste into these data fields the sequence text of the forward and reverse primers that you wish to test Each primer data field can hold sequence text containing up to 40 bases Secondary Structure Graphic Shows all potential complementarity among bases internal to each primer Primer Dimer Graphic Shows all potential complementarity between the two primers A T bonds are shown as a thin line and C G bonds are shown as a thick line 4 68 Primer Express Documents Primer Express Pages Introduction In This Chapter This chapter contains descriptions and procedures for the following Topic See page About the Primer Express Software Pages 5 2 Standard Sequence Page 5 4 Sequence Page Allele Specific PCR 5 8 Working With Sequences 5 11 How to Find Primers 5 16 Standard Parameters Page 5 19 How to Set Parameters 5 24 Parameters Page Multiplex PCR 5 25 Parameters Page Allele Specific PCR 5 27 Parameters Page for the TagMan Probe 5 28 Parameters Page for Sequencing 5 29 Reaction Conditions Page 5 30 Primers Page 5 33 How to Order Primers 5 37 5 38 Map Page for Nested 5 44 Standard Recipe Page 5 45 Recipe Page for Cycle Sequencing 5 45 Recipe Page for Sequencing Primer 5 49 Res
144. nalty scores of all possible primer pairs see Appendix B Penalty Score Theory of Operations 7 IUPAC Codes Table of IUPAC Codes IUPAC Codes The following table shows the meanings of the IUPAC characters you may encounter or use when working with a sequence on the Sequence page of a Primer Express software Several invalid characters are listed at the end of the table below Note You cannot type modified bases for example methylated C into the Sequence page Code Meaning Code Meaning A adenine B all except A C cytosine D all except C G guanine H all except G T thymine V all except T S strong G or C N AorCorGorT W weak base pair inosine invalid e A or T methyl A or C X asterisk invalid ketone G or T purine A or G lt DAZ pyrimidine C or T a Inosine is considered by the Primer Express software an invalid base because its effect on T calculations is not completely known You are not allowed to enter an I in the Sequence page In addition when the Primer Express software imports a DNA sequence file it deletes all instances of Inosine IUPAC Codes F 1 Formula Used in Primer Express Nearest Neighbor Algorithm for T Calculations Algorithm Tm expressed in C is calculated as follows using the nearest neighbor algorithm developed by Breslauer et al 1986 2 9 159 16 6 log X In BS Rx In EL where EH an
145. ncorporates a user interface that gives you an on screen notebook to use for designing oligos Although most of the functions of the Primer Express software are contained in the seven pages of the notebook there are a number of important functions that you can perform only from a menu option or its keyboard shortcut The following sections describe the options available in each Primer Express software menu Topics in this chapter include the following Topic See page File Menu 7 2 Edit Menu 7 8 Options Menu 7 14 Windows Menu 7 17 Primer Express Software Menus 7 1 File Menu About the File The File menu contains menu options for creating opening closing Menu saving importing exporting and printing files 12 Beep Exit New Command About the Command This command displays a submenu that allows you to create a new Primer Express document for DNA PCR RT PCR Nested PCR Allele Specific PCR Multiplex PCR TagMan Probe amp Primer Design Cycle Sequencing Sequencing Primer Batch Processing Primer Test TaqMan MGB Probe amp Primer Design or MGB Probe Test The Primer Express software supports up to 99 simultaneous documents but keeping more than ten documents open at any one time can slow performance to an unacceptable level 121 7 2 Primer Express Software Menus How to Open a New Document To open a new document Step Action
146. nctions Turn AutoFind When to Turn this Command ON ON OFF Use this command to automatically calculate primers immediately after a sequence is Imported into a document or Anannotation is made to the sequence data on the Sequence page For many applications AutoFind is a useful and time saving feature to have turned on When to Turn this Command OFF Leave AutoFind OFF if you Are making many annotations to the sequence data and don t want the Primer Express software to calculate primers between the making of each annotation or you Wantto make a number of parameter changes AutoFind is turned OFF by default When you are through importing sequences then select Find Primers Now to calculate the primers based on all the imported sequences Find Primers Now If the AutoFind feature is selected ON and you have made a change to the sequence text annotations or parameters you must newly select one of the following pages to direct the Primer Express software to calculate primers Sequence page 7 14 Primer Express Software Menus Show Hide Annotation Tools Show Hide Primer Data Show Hide Interim Results Primers page Map page Note To calculate primers one of the pages above must be active The Find Primers Now command does not function when AutoFind is selected Note This menu option appears as Find Primers Probes Now if you are
147. ndix include the following Topic See page How to View the Window A 1 About the Tests A 2 How to View the Window Viewing the The Interim Results window when selected displays whenever the Window Sequence page Params page Primers page or Map page is active You can reposition the Interim Results window anywhere on the desktop by dragging to a new location To view the Interim Results window select Show Interim Results from the Options menu Interim Results Window 1 About the Tests Introduction Ambig Test Clamp Test GC Test The Interim Results window contains a listing of all the tests the Primer Express software uses to eliminate primers from consideration Each test uses a formula that considers one or more parameters in order to eliminate primers If a particular test causes a significant elimination of primers you should consider changing the associated parameters if you want the Primer Express software to find more primers The Ambig Ambiguity Test counts the number of ambiguous residues in each primer residues that are not A C G or T If the number of ambiguous residues exceeds the Max Num Ambigs parameter value the primer is rejected To increase the number of primer pairs found increase the Max Num Ambigs parameter value The Clamp Test determines whether the number of G or C residues at the primer s end is greater than or equal to the GC Clamp parameter value To
148. ng the values contained in the Penalty Definition dialog box Features The following tables lists the features of the Penalty Score dialog box Feature Description Document Type Allows you to select the document type about which pop up Menu you wish to set the Penalty formula Opt Thl Considers the absolute value of the difference between the primer and optimal parameter Primer Length Considers the absolute value of the difference Opt Primer Length between the primer length and optimal primer length parameter B 2 Calculating Penalty Score Feature Description Number Considers the number of ambiguous residues found Ambiguous in each primer Residues Difference Considers the absolute value of the difference Between Primer Tas between the two primer 5 Amplicon Length Min Amplicon Length Considers the value of the difference between the amplicon length and minimal amplicon length parameter Max Amplicon Length Amplicon Length Considers the value of the difference between the maximal amplicon length parameter and amplicon length If Only One Primer Discriminates Adds 10 to the Penalty score if only one primer in an Allele Specific document discriminates between included and excluded sequences T T Opt Thl Considers the absolute value of the difference between the primer and optimal primer Tm parameter for each pr
149. nt 5 52 to 5 53 annotating the results 5 52 saving 5 52 viewing modifying saved results 5 53 stock concentrations 5 48 Reverse Primer End tool using 6 18 to 6 19 Reverse Primer tool using 6 16 to 6 17 reverse primer definition Glossary 2 RT PCR document 4 43 to 4 44 rTth See PCR enzyme Rxn Cond page concentration 5 31 See Reaction Conditions page S salt concentration D 1 Primer Test document 4 68 setting the concentration 5 51 Save As command 7 5 Save List button 5 34 Save Results button 5 51 saving list of primers 5 37 primer list data 5 34 Results page contents of 5 52 using the Results page 5 50 to 5 51 scale changing on Map page 5 43 scroll bar Primers page 5 33 Secondary Structure Graphic Primer Test document 4 68 Secondary Structure test 3 secondary structure definition Glossary 2 Select tool using 6 4 to 6 5 modifying an annotation 6 4 removing sequence text 6 5 sequence annotating 6 2 excluding a region 6 10 to 6 11 importing multiple sequences 5 11 specifying a sequence region 6 6 to 6 7 specifying region where probe anneals 6 8 to 6 9 sequence files imported types C 2 Sequence Navigator file format 2 Sequence page Allele Specific PCR document 5 8 to 5 10 sequence text 6 4 to 6 5 highlighting sections 6 22 to 6 23 modifying an annotation 6 4 removing sequence text 6 5 sequences 5 11 to 5 15 annotating a sequence 5 15 editing a sequence 5 13 to 5 15 entering a sequence 5 12 file formats 5 5
150. ntent of a primer expressed as a percentage of the whole GC content affects the Tm of the primer ambiguous residue Any IUPAC designation other than C G or T For more information see Appendix F IUPAC Codes amplicon The entire sequence amplified by the PCR process including primer sequence s discriminatory residue Allele Specific PCR a residue present in one or both primer pairs that selectively discriminates one set of sequences from the other excluded region region that is not considered by the Primer Express software when calculating primers Excluded regions may be contained in sequence files processed by outside agencies such as GenBank database or Factura software Excluded regions may also be entered in the Primer Express software on the Sequence page using the Exclude Region tool or the Find and Exclude menu option forward primer oligonucleotide that primes in the forward direction either for PCR or sequencing A Nested PCR document calculates two forward primers in every primer set GC Clamp The number of G or C residues required at the 3 end of the primers In the Primer Express software the GC Clamp can be set to any value including zero default most cases GC Clamp greater than three will cause no primers to be calculated concentration The concentration of magnesium ion used in a reaction buffer optimal Having length and T that are within some specified range ORF Open Re
151. o Set a Sequence Residue as the Forward Primer 6 14 sd usu xb eR kd E 6 14 Adding a Forward Primer End Annotation 6 14 Modifying a Forward Primer End Annotation 6 15 How to Set a Sequence Region as the Reverse Primer 6 16 InftOOD OLD eo ate Oe ees we edd d ua 6 16 Adding a Reverse Primer Annotation 6 16 Modifying a Reverse Primer 6 17 How to Select a Sequence Region as Reverse Primer 6 18 voee irit oe 6 18 Adding Reverse Primer End 6 18 Modifying a Reverse Primer End 6 19 How to Translate DNA to Amino Acid Sequence 6 20 Intt OGOUC TOU ec iir a ipo ee berti osea ee eed 6 20 Adding a Translation 6 20 Modifying a Translation Annotation 6 21 How to Highlight Sections of Sequence 6 22 oduc UOTE s eR 6 22 Adding a Line 6 22 Modifying Line Annotation 6 23 How to Create a Junction 6 24 InttOOD LIOH sette dob den a uut unt
152. obes 4 8 Amplifying Custom Target Sequences for Quantitation 4 9 Using Conventional TaqMan Probes for Amplifying Target 4 16 Sequences for Allelic Discrimination Using TaqMan MGB Probes for Amplifying Target Sequences 4 27 for Allelic Discrimination Primer Express Documents 4 7 About TaqMan Probes Two Types of Applied Biosystems offers two different types of probes for TaqMan TaqMan Probes assays Available TaqMan probes conventional TaqMan MGB probes Probes Used The conventional TaqMan probes and the TaqMan MGB probes Quantitation and both be used for Allelic Allelic Discrimination Assays Discrimination Quantitation Assays IMPORTANT Applied Biosystems recommends TaqMan MGB probes for allelic discrimination especially when conventional TaqMan probes exceed 30 nucleotides How the Probes The 5 nuclease assay is a probe based PCR detection chemistry Work 4 A TaqMan probe is an oligonucleotide with a reporter fluorescent dye attached to the 5 end and a quencher fluorescent dye attached to the 3 end A TaqMan MGB probe is an oligonucleotide with a reporter fluorescent dye attached to the 5 end and a non fluorescent quencher attached to the 3 end The probe is coupled with a minor groove binder which enhances the The fluorescent signal increases when the probe is cleaved by the AmpliTaq Gold DNA polymerase during the PCR reaction thereby separating the reporter dye fr
153. odify or remove an alignment file imported into an Allele Specific document To use a different alignment file you must create a new Allele Specific document Primer Express Pages 5 13 How to Copy Sequence Text Step Action 1 Click anywhere in the sequence text to remove any text highlighting 2 Click and drag over the area you want to copy so that the data is highlighted From the Edit menu select Copy 4 The sequence data is copied onto the clipboard and is ready for pasting How to Add Data to a Sequence Step Action 1 Unlock the sequence data For more information on unlocking the sequence data see Locking and Unlocking a Sequence on page 5 13 2 Place the mouse pointer over the location you would like to make the addition When you move the cursor over the text in the Sequence page the arrow cursor k changes to an I beam cursor similar to that used in many word processing programs Click the mouse button to fix the cursor in that location Type or paste the sequence data you wish to add How to Remove Data from a Sequence Step Action 1 Unlock the sequence data For more information on unlocking the sequence data see Locking and Unlocking a Sequence on page 5 13 2 Click anywhere in the sequence text to remove any text highlighting 3 Click and drag over the area you want to remove so that the data is highlighted 4 From the
154. of G or C residues required at the end of the primers Although you can set the GC Clamp value to any value using a value greater than 3 generally causes no primers to be calculated Primer Length Requirements Parameters that control primer length are contained in this pane of the Parameters page The Optimal length parameter default 20 is used along with the Optimal parameter to determine whether a primer pair is considered optimal Optimal primer pairs are those whose T and length are within 1 unit of the value entered on the Parameters page 5 20 Primer Express Pages Feature Description 5 Tail Forward Reverse Primers The 5 Tail fields allow you to specify 5 tail on either primer Type the desired sequence in the data entry field up to a maximum of 255 IUPAC characters to activate this feature If a 5 tail is entered two 5 are calculated for that primer one T for the sequence specific primer and one T for the tailed primer The 5 calculated are displayed in three locations In the Primer Data window see Show Hide Primer Data on page 7 15 In the Primer Display pane of the Primers page On the Map page In all locations T data is displayed as a double number separated by a virgule forward slash for example 60 76 Amplicon Requirements Parameters that control amplicon T and length are contained in this pane of the Parameters pa
155. om the quencher Probe Features TaqMan Probe 5 Label 3 Label Features TaqMan 6 FAM VIC TAMRA None or TET TaqMan MGB 6 FAM VIC or Nonfluorescent Minor groove TET quencher binder 4 8 Primer Express Documents Amplifying Custom Target Sequences for Quantitation TaqMan Probe and Primer Document Example The TaqMan Probe and Primer document is used for designing PCR primers and their associated conventional TaqMan probe The following is an example of a TaqMan Probe and Primer document showing primers and probe graphics Probe 1 Sequence Ex fs File Name 208 131 Impar Bile Length 4 1 bp Selection 230 to 304 Double Stranded Limit 3 G C ppt TCNAGCMNGG AGAAAGAAA ACCTATGAAT GATGTGCTGA GATGGGAAAC CCAAAATMAT GGTAASTCAG AGTGGCACTA AGGCCATTGT CTCACCATGG ACAGTCTAGG TCTTTCCAGA AGAGCCCCT TICCTCCTTA MME lg Ee TE NE es TIGITGCTGT TGTTCCATTT AGTCTCAAAG GAACCAGGAT CATAAAGGNG GTGGTCCTAA TTGACAAGGC TGCTATGGAA AACCTATGCA TAGTCTTAGC CACAAAGAGT NAAAGGTCAA AAGTGGCTIC ATCTATGGNG TNNTITGATA GCCTAAAATT ANCATGAATG Tagan Prabe Primer Data Forward Primer AATGCTGGAGAAGTGTCTGCTG 58 GC 50 Start
156. on of the Results page contains nine parameters that describe the PCR cycles The pop up menu allows you to choose from two step or three step The data fields let you enter time temperature and concentration parameters The checkbox indicates that you used a hot start Concentrations This section of the Results page contains four data fields that allow you to set the Template DNA Primer Salt and Mg concentrations Save Results button Saves the data on the Results page in the Results Archive For more information see Open Results Command on page 7 4 Primer Express Pages 5 51 Results Page for Nested PCR About the Page Results Page Example Annotating Your Results Saving Your Results The Nested PCR document generates two pairs of primers an external pair and an internal pair The Results page for a Nested PCR document contains data fields for both pairs of primers but otherwise conforms to the standard Results page layout The following is an example of the Results page for the Nested PCR document 55 Nested PCR 2 To examine primer pairs click the Primers tab If your PCR is more complicated than the Results page allows you to describe add your specific data in the Comments box To enter data click the mouse in the Comments data field then type your comments The Comments box holds up to four lines of text You can save the contents of the Re
157. or 5 1 2 Batch PROCESSING iue eda b E be bua ERE LR 1 2 Eyval dtine POME EE d Sd edt d eed d 2 1 2 Contacting Technical 1 3 weet Ceo Co hare artt Cart eden MES 1 3 iab bsc uer bend d 1 3 By Telephone Dax bet qr dera doses 1 4 By Telephone or Fak eureen Fh EE antes 1 6 Through the Applied Biosystems Web 1 8 To Obtain Technical 1 9 To Obtain Customer Training Information 1 10 2 Installing the Primer Express Software InttOdUe TION 13 3 RS racemes edu Dar SOC EACUS TCU eee ae 2 In his Guard e a e el td ed sa edd 2 Hardware and Software Requirements 2 2 Hardware 2 2 Software 2 2 How to Install the Primer Express 2 3 Supplied with the Primer Express 2 3 Installing the 2 3 3 Getting Started WU ERU DESDE GN PE ot torn dire Ge ae 3 In This C us
158. page 5 4 Primer Express Pages 5 29 Reaction Conditions Page About the Page The Reaction Conditions page allows you to set the concentrations of the template DNA primers salt and magnesium in the PCR reaction You can also select from four different PCR enzymes The salt and magnesium values affect the T s of primers calculated Reaction The following is an example of the Reaction Conditions page with Conditions Page default values Example Pop up menus Sequencing Primer 1 You need a ON A sequence for primers to found Retum to the Sequence page to enter 5 30 Primer Express Pages Features The following table lists the features of the Reaction Conditions page Feature Description Enzyme You can select from four PCR enzymes that affect the pop up Menu quality primarily in terms of of the PCR primers Each PCR enzyme has specific salt and MgCl magnesium chloride requirements and is used for a different type of PCR application Selecting a PCR enzyme option changes the values displayed in the Salt and Mg data fields For a more detailed discussion of each enzyme see Appendix D PCR Enzymes and Primer Express Template DNA Concentration The molecular weight pop up menu is a quick way to specify one of several common template DNA types This pop up menu has six options As entered from sequence data default Phage Lambda 3 2 X 10 Daltons E Coli 3 1 X 10
159. per fax request Introducing Primer Express Software 1 9 Obtaining Documents Through the Web Site To view download or order documents through the Applied Biosystems web site Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page then click Documents on Demand 3 In the search form enter and select search criteria then click Search at the bottom of the page 4 In the results screen do any of the following Click the pdf icon to view a PDF version of the document Right click the pdf icon then select Save Target As to download a copy of the PDF file Select the Fax check box then click Deliver Selected Documents Now to have the document faxed to you Select the Email check box then click Deliver Selected Documents Now to have the document PDF format e mailed to you Note There is a limit of five documents per fax request but no limit on the number of documents per e mail request To Obtain To obtain Applied Biosystems training information Customer Training Information Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page then click Training Installing the Primer Express Software Introduction In This Chapter Topics in this chapter include the following Topic See page Hardware and Software Requirements 2
160. phics 5 44 stages for calculating primer pairs 6 stages for calculating primers 3 to E 5 tests to eliminate primers A 2 to 5 Ambig test 2 Amplicon Length test 4 Amplicon test 5 Avoid Excludes test 5 Clamp test 2 GC test 2 Primer Site Unique test 4 Repeat test 3 Secondary Struc test Target test A 5 T m test 3 Tm Match test A 5 Primers page 5 33 to 5 37 about 5 33 features 5 34 Primer Data window 5 35 to 5 36 saving list of primers 5 37 scroll bar 5 33 viewing parameters 5 36 printer compatible models 2 2 printing settings 7 6 Probe tool using 6 8 to 6 9 Protocol pop up menu 5 46 protocol definition Glossary 2 0 Quit command 7 7 R Reaction Conditions page 5 30 to 5 32 about 5 30 diagram D 2 features 5 31 setting reaction condition values 5 32 Recipe page Cycle Sequencing document 5 47 to 5 48 Sequencing Primer page 5 49 references bibliographical 1 to H 2 removing all annotations 6 5 junction annotation 6 25 sequence text using Select tool 6 5 site annotations 6 27 Repeat test 3 requirements hardware and software 2 2 residue consecutive 4 definition Glossary 2 resizing documents 4 6 restriction enzyme site creating site 6 26 to 6 27 locating site 7 9 results listing in Results Archive window 7 4 to 7 5 optimal primer 5 36 Results Archive window listing results 7 4 to 7 5 Results page 5 50 to 5 51 about 5 50 features 5 51 Nested PCR docume
161. play the Results Archive window Figure 7 2 The window contains a listing of all the Primer Express software results saved using the Save Results button on the Results page For more information about saving results see Saving Your Results on page 5 52 The heading currently used to sort is underlined 2 Results Archive xi Date Amplicon Yield Type 8rzi 95 oxz S ls 25 55 mverege DMA PCR Ctto Fshben 5 21 98 LengRead Taq Stc on 10 72 136 Tagan Probe Bel 11 2 95 DROGMEFS z 1 27 227 erg Bo RT Underlined heading indicates results are sorted by User name Figure 7 2 Results Archive window 7 4 Primer Express Software Menus Close Command Save Save As Command About the Buttons The following table describes the buttons Button Description Open button Opens the selected highlighted document listed in the Results Archive Delete button Deletes the selected highlighted document from the Results Archive How to Open the Document that Generated the Results Window Click the Open Related Document button to open the document that generated the currently active Results window Note To access this feature you must have saved the related document using the Save or Save As command Use this command to close the active Primer Express document If you haven t saved the changes to the doc
162. primer pairs found To examine primer pairs click the Primers tab v Double Stranded v Limit3 G C ppT Primer Express Documents 4 17 Loading the import a DNA file for generating a list of potential primers and Sequence probes Step Action 1 Launch the Primer Express software 2 Import a DNA sequence for designing probes and primers To select a probe from Then a DNA file a From the File menu scroll to New submenu and select TaqMan Probe amp Primer Design A TaqMan Probe document appears b Click Import DNA File c Locate and select a DNA file in the browser d Click Open The software loads the sequence and displays it in the Sequence tab an a From the File menu select Open The Document Archive dialog box appears aqMan E b Double click the document to load or select the d sequence and click Open ocument located The software loads the sequence and displays it in the in the Sequence tab Document Archive a text a Select the sequence from the text document or document the navigator window Eum b From the Edit menu select Copy nBan n c From the File menu scroll to the New submenu sequence and select TaqMan Probe amp Primer Design A TaqMan Probe document appears d From the Edit menu select Paste The software pastes the nucleotide sequence into the Sequence tab 4 18 Primer Express Documents
163. ption is necessarily better than the others base the option you choose on the DNA template sequence and the parameters Try all four options to determine which works best in each case Amplicon Min Spacing Sets the minimal amount of difference between the lengths of any two amplicons This ensures that the amplicon lengths are different enough so they are distinguishable by electrophoresis default 2 8 bases 5 26 Primer Express Pages Parameters Page Allele Specific PCR About the Page Allele Specific Document Parameters Page Example Features The Parameters page for the Allele Specific document is identical to the More Params page for a DNA PCR document Unlike most other Primer Express documents the Allele Specific PCR Parameters page does not have a Fewer Params option because of the many parameters that are required to set up an Allele Specific PCR document The following is an example of the Parameters page for the Allele Specific document 2 Allele Specific PCR 2 You need a ON A sequence for primers ta found Retum to the Sequence page to enter For a description of the complete set of parameters available see Standard Sequence Page on page 5 4 Primer Express Pages 5 27 Parameters Page for the TaqMan Probe About the Page TaqMan Probe Document Parameters Page Example The Parameters page for the TaqMan Probe document is similar to the Paramet
164. quencing primers and hybridization probes see Primer Design Considerations for PCR Application on page 4 40 The balance of this manual is devoted to describing the functions and features of the Primer Express software Each oligo design application uses its own special Primer Express software file called a document containing parameters used to calculate primers Getting Started 3 7 List of Document f you want to skip the tutorials the next best way to start is to read the Types information describing the type of Primer Express document for your intended application The following table lists the Primer Express document types Document Type See page TaqMan Probe and Primer Design Document 4 9 TaqMan Probe and Primer Design Document 4 27 TaqMan MGB Probe Test Document 4 27 DNA PCR Document 4 39 RT PCR Document 4 43 Nested PCR Document 4 46 Allele Specific PCR Document 4 48 Multiplex PCR Document 4 52 Cycle Sequencing Document 4 57 Sequencing Primer Document 4 60 Batch Processing Document 4 61 Primer Test Document 4 67 3 8 Getting Started Primer Express Documents Introduction In This Chapter This section contains descriptions of each the Primer Express document types For step by step instructions on designing oligos using the Primer Express software refer to the accompanying manual Primer Express Software Applications Tutorials Topics in this c
165. quires a template that is single stranded An easy and efficient method of generating single stranded DNA from double stranded molecules is to heat denature the samples in solution in order to disrupt the hydrogen bonds between the complementary bases of the two strands Primer annealing can occur when the temperature is brought down to a level below its You can then use a DNA polymerase to extend the DNA chain from the annealed primer By using AmpliTaq DNA polymerase FS you can perform this process of denaturation primer annealing and extension over and over again using a limited amount of starting template and primer This process is called cycle sequencing Although it resembles PCR cycle sequencing involves amplification from a single strand of DNA and a single primer and is therefore also referred to as linear amplification sequencing PCR amplification on the other hand is exponential because two strands of DNA are synthesized from two strands of template and two primers Cycle Sequencing Requirements Cycle sequencing with AmpliTaq DNA polymerase FS has certain unique requirements consequently Good primer design is crucial for achieving optimal results Primers for cycle sequencing should be 18 24 bases long 22 bases being optimal with a GC content of 50 55 and a of approximately 55 60 C Avoid low T 40 45 C and low GC content If the GC content is low compensate with a longer primer Avo
166. r 1 Position the cursor over the sequence base where you wish to begin the Target annotation Click and drag to highlight the desired data When you release the mouse button the highlighted sequence text is annotated in green lower case text as the target region DNA PCR 8 208 131 port TCNAGCNNGG GATGTGCTGA GATGGGAAAC ACAGTCTAGG TCTTTCCAGA AAGTAAATGT AGAGCCCCTG ACAGAACACA ATGCTGGAGA AGTGTCTGCT GCAGCTGCCA TTGTTGCTQT TGTTCCATTT GCAACTTCTC AGTCTCAAAG GTGACAGCAA GAACCAGGAT CATAAAGGNG GTGGTCCTAA TTGACAAGGC TGCTATGGAA TAGTCTTAGC CACAAAGAGT Atotal of 200 primer pairs found To examine primer pairs click the Primers tab Target annotation inserted green lower case 6 6 Using the Annotation Tools Modifying a Target You use the Select tool to move lengthen or shorten any existing Annotation Target annotation For instructions on modifying Target annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 7 How to Specify Where the Probe Must Anneal Introduction Use the Probe tool for specifying a particular region in the sequence where the probe must anneal The Probe tool is
167. r example if you want to calculate primers for Nested PCR use the Nested PCR document Has a number of features to support oligo design Most of the documents have many features in common for example all documents have the same Sequence page except Allele Specific PCR Batch Processing and Primer Test The following is a list of the documents For this document type See TaqMan Probe and Primer Design Document 4 9 TaqMan MGB Probe and Primer Design Document 4 27 TagMan MGB Probe Test Document 4 27 TagMan Assay Design Guidelines 4 39 RT PCR Document 4 43 Nested PCR Document 4 46 Allele Specific PCR Document 4 48 Multiplex PCR Document 4 52 DNA PCR Document 4 57 Sequencing Primer Document 4 60 Batch Processing Document 4 61 Primer Test Document 4 67 The Primer Express software uses the concept of a notebook that contains seven pages each with its own associated tab Primer Express Documents 4 3 Document Limitations Using the Multiplex PCR Document The Primer Express software has no artificial limitations on the number of documents you can have open at any one time Because of the complex calculations involved it is recommended that you use only one Multiplex PCR document at a time If you need to find new primers close the first Multiplex PCR document and open a new one 4 4 Primer Express Documents How to Use the Document Window Document The following i
168. rimer Also referred to as T4 4 Ta of a primer is usually 2 to 5 C lower than the Ta is dependent upon the length and V6 GC of the fragment target region region that is specifically included by the Primer Express software when calculating primers Target regions are entered in the Primer Express software on the sequence page using the Target tool The Multiplex PCR document is the only document that allows more than one target region TaqMan Probe short oligonucleotide that has been labeled with a Reporter dye and a Quencher dye The TaqMan probe is designed to hybridize to a specific sequence of interest located between the forward and reverse PCR primers During PCR the probe hybridizes anneals to the target template and is later cleaved by AmpliTaq DNA polymerase This cleavage separates the Reporter from the Quencher resulting in an increase of Reporter dye fluorescence TaqMan MGB Probe short oligonucleotide with a reporter dye attached to the 5 end and non fluorescent quencher attached to the 3 end The probe is coupled with a minor groove binder which increases the melting temperature T of the probes TaqMan MGB probes exhibit greater differences T values between matched and mismatched probes which provides more accurate allelic discrimination T The melting temperature of PCR or sequencing primers T is the temperature at which 50 of the oligonucleotides are in double stranded conformatio
169. risk functions as a discriminatory residue A base position is considered a discriminatory residue if all the included sequences checkbox is selected have the same residue in this position and if none of the excluded sequences checkbox is deselected have the residue in this position 5 10 Primer Express Pages Working With Sequences Introduction This section describes how to import enter lock and unlock edit and annotate a sequence Importing General Information Sequence You can import a sequence into the Primer Express software using the PC dialog box file navigation Using the Traditional Dialog Box File Navigation To import a sequence file using the traditional dialog box file navigation Step Action 1 Click the button labeled Import DNA File for DNA files or Import Alignment File for Allele Specific PCR documents Navigate to the Primer Express software Sample Sequences folder or any other folder containing sequence or alignment files For a list of compatible file types see File Types Supported on page C 1 Highlight the name of the sequence file to select it then click Open to import the sequence into the Sequence page or double click the file name If you are working in a Multiplex PCR document you can create a multiplex set by importing multiple sequences into the same document Repeat the procedure above to import multiple sequences into a Multipl
170. robe tool The probe should appear in green To design primers for the allelic discrimination assay Step Action 1 Click the Sequence tab from the TaqMan MGB Probe document for Allele 1 The Sequence tab comes to the front of the dialog box Ensure that the Limit G C checkbox from the Sequence tab is checked Select Find Primers Probes Now from the Options menu If the software Then finds acceptable primers a Click the Primers tab b Select a primer sequence from the list that satisfies all requirements listed above cannot find acceptable design the forward and reverse primers primers manually according to the guidelines listed above Select a set of primers from the list that will produce the shortest amplicon while satisfying the guidelines above Copy and paste the final primer sequences into a text document for ordering Select Save from the File menu and assign a name to the file to save the results The file will be saved in the Primer Express Document Archive folder IMPORTANT It is not necessary to design primers for the Allele 2 probe as the same primer pair will be used for both Allele 1 and Allele 2 Note The reaction conditions recipe and results pages should not be used when designing a TaqMan probe assay 4 38 Primer Express Documents DNA PCR Document When to Use the Document DNA PCR Document Example Sta
171. rs found increase the Max parameter value and or decrease the Min T parameter value The Repeat Test is customized in the TagMan Primer and Probe document to reflect a unique sensitivity of these assays to repeat G sequences For this document the repeat exclusion is only applied to G sequence All other repeats are tolerated in the selection criteria Nucleotide repeats other than G must be assessed manually in this document The Secondary Struc Secondary Structure Test checks for significant internal secondary structure It does this by attempting to form all possible hairpins with the sequence and determining for each possible hairpin both the maximum number of consecutive residues that could base pair in such a structure and the total number of base pairs formed The highest scores for each of these parameters over all the structures is retained and tested against the Max Consec Base Pair and Max Total Base Pair parameter values If the test score is less than or equal to both of these parameters the primer passes this test To increase the number of primer pairs found increase the Max Consec Base Pair and or Max Total Base Pair parameter values Interim Results Window 3 Primer Site The Primer Site Unique Primer Site Uniqueness Test determines if the Unique Test primer has significant sequence similarity to any other region of the DNA sequence If such sequence similarity exists mispriming could result The three
172. rting the Document Use the DNA PCR document when designing primers for PCR using a DNA template The following is an example of a DNA PCR document show the Sequence page amp DNA PCR 1 208 131 par Wise Tae FEHAGEHHGE TACCCTTTCA RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCRRCRTR RCCTRTGRRT GRTGTGCTGR GRTGGGRRRC CCRRRRTHRT GGTRRRTCRG RGTGGCRCTR RGGCCRTTGT CTCRCCRTGG CRRCCCRRRR RRCRGCRGTC RCRGTCTRGG TCTTTCCRGR RRGTRRRTGT RGRGCCCCTG D RTGGRR RRCCTRTGCR TRGTCTTRGC CRCRRRGRGT NRRRGGTCRR RRGTGGCTTC RTCTRTGGHE EERH FFRRE HHH T FSPHFR SEE FRRRRHHE Ready to Calculate To start a new DNA PCR document choose New from the file menu and select DNA PCR Document from the submenu For more information about the pages contained in the DNA PCR document see Chapter 5 Primer Express Pages Primer Express Documents 4 39 Primer Design Considerations for PCR Application Design Criteria Primer design for standard PCR applications depends on a number of criteria The basic and most crucial requirements are Two primers must be present and complementary to the opposite strands of the target DNA template Primers must flank the region of interest ends of the primers must be oriented towards each other Primers should not have significant self complementarity that is primers must not anneal to themselves 3 endcomplementarit
173. s an example of a Primer Express document Window Example DNA PCR 1 NoFileLoaded Inport DNA Fi To load a DNA file click the Import DNA File button Te load DNA file click the Import File button To enter data from the keyboard begin typing Actions You Can The following table lists the actions you can take Take Call Out Then 1 move a document Click and hold the title bar and drag the window document to a different location on the desktop 2 view a page Click the associated tab You can copy pages so that you can see more than one page at a time Three different pages of a DNA PCR document are shown in Figure 4 1 on page 4 6 For more information see Copy Page To Window on page 7 17 Primer Express Documents 4 5 Out Figure 4 1 Viewing more than one document at a time 3 zoom the window Click the Zoom window icon to view all of the contents of the window resize the window Click the Resize box 5 view instructions on Use the Status bar what actions you can You can disable this bar if desired For more information see Show Hide Status Bar on page 7 16 4 6 Primer Express Documents TaqMan Assay Design Guidelines Choose from These Choose from the following topics to learn how to design primers and Topics probes for your TaqMane assays Topic See Page About TaqMan Pr
174. s found for the sequence 11 2 46 Forward Primers Best Forward Primer TGAAGTGAAGATAACGCGTATG 2140 21613 Tm 54 GC 41 Length 22 nt Figure 4 3 Batch Processing summary window Order Button Displays an electronic form for ordering primers electronically For more information see How to Order Primers on page 5 37 Primer Express Documents 4 63 How to Use a Batch Processing Document Introduction The Batch Processing document is designed to take much less time than you would spend finding primers for many individual documents The following procedure contains the steps you must follow to use the Batch Processing document Note You cannot save Batch Processing documents but the individual documents within a Batch are automatically saved to the Primer Express software Archive file immediately after processing Using a Batch following procedure describes how to use a Batch Process Processing document Document To use a Batch Processing document Step Action 1 Open a Batch Processing document 2 Click the Prefs button to display the Primer Express software parameter preferences Set the Preferences for each document type Note Changing the parameter preferences does not change the parameters in documents already imported into a Batch Processing document For more information see Preferences Command on page 7 13 Import one or more sequences into
175. sa dla eain ard aei chen ere BO In DS Appendix Imported Sequence Piles rot bet bea tee MES Table of Imported File Types Imported Alrenment Piles ax 2222 9 2 e REG eb ore Ey as Exported Piles se dont de os RA CR te epe Table Pese i ooo E octo demo dos a odd D PCR Enzymes and Primer Express Designating the PCR epo ea me a er RR re ERN RE das Each Enzyme For PCR Reaction Conditions Page Diagram Pops p Meno Mes d ooo ee E Theory of Operations HON S o sca pk e aderit eee As REA URS enn RUE Fe ee Roo dq Ti Vitis Appendix V Web a hes How the Primer Express Software Finds Wu d d fade abt d UE Ade er dra ug e ate Primer Parr Searching eod aid aw at ga ELO ED Order Or TOEI peru PT Stages for Calculating Individual Calculating Individual Stages for Calculating Primer Calculating Primer Pals ous ea IS ees F IUPAC Codes Table of IUPAC
176. se this option if you print one of these pages Page breaks are shown as zig zag lines and can occur horizontally or vertically if the available data won t fit onto one page as determined by the Page Setup 7 1 Primer Express Software Menus Preferences Command Define Penalty Score Use the Primer Express Preferences dialog box Figure 7 3 to set the default parameter values for each document type as well as the default quantities of stocks specified on the Recipe page To select a document type or stock solutions select from the pop up menu at the top of the dialog box IMPORTANT The parameters contained in the Preferences dialog box do not affect already open documents including Batch Processing Select the Params page of each open document to change parameters on already open documents Users should set preferences based on the needs of the PCR application The factory default preference values are place holders until modified by the user Pop up menu for selecting mum Preferences Set parameter preferences for Figure 7 3 Primer Express Preferences dialog box The Primer Express software calculates the Penalty Score using the formula shown in the Penalty Definition dialog box For more information see Appendix B Calculating Penalty Score Primer Express Software Menus 7 13 Options Menu About the Menu The Options menu contains a number of display and other fu
177. selecting the probe with the probe tool The probe should appear in green To design primers for the allelic discrimination assay Step Action 1 Click the Sequence tab from the TaqMan Probe document for Allele 1 The Sequence tab comes to the front of the dialog box Primer Express Documents 4 25 To design primers for the allelic discrimination assay continued Step Action 2 Ensure that the Limit 3 GC checkbox from the Sequence tab is checked Must be checked Probe 1 Mel Sequence Params RxnCond Primers Results File Name ox208 131 ab1 Import Bile Length 47 1bp Selection 185 to 185 Double Stranded v Limit 3 ppT Lira ga ra ra Y 2g ra gag pa Dua ga pag ga aga annn Select Find Primers Probes Now from the Options menu If the software Then finds a Click the Primers tab acceptable b Select a primer sequence from the list Primers that satisfies all requirements listed above cannot find design the forward and reverse primers acceptable manually according to the guidelines listed primers above Select a set of primers from the list that will produce the shortest amplicon while satisfying the guidelines above Copy and paste the final primer sequences into a text document for ordering Select Save from the File menu and assign a name to
178. sequence displayed in the Sequence page is shorter than the original sequence because the intron data is spliced out For example the imported sequence DROGNBPSA3 gb shown in RT PCR Document Example on page 4 43 was originally 1380 bp long Splicing out the introns results in a sequence length of 804 bp The Primer Express software calculates only those primer pairs in which at least one primer spans at least one intron exon junction 4 44 Primer Express Documents Importing The following diagram shows the DNA sequence before and after being Diagram imported into an RT PCR document Bank file sequence data Cm 77 NERA a dies Sequence length 32 bp GenBank fil data after bei 7 i ed AAAAAAUUUUUUUUUU replaced with U s sequence length 17 bp Junction annotation inserted on Sequence page where intron was removed see RT PCR Document Example on page 4 43 Primer Express Documents 4 45 Nested PCR Document When to Use the Document the specificity of the internal primer pair Nested PCR Document Example Nested PCR 1 The Nested PCR document generates two pairs of primers one pair nested inside the other Nested PCR provides a means of increasing The following is a nested PCR document showing the Sequence page for the DNA file Sequence File Name ox208 131 Length 471 bp Selection 104 to 272 Double Stran
179. sing a specialized algorithm for TaqMan MGB probes 3 Test potential probe sequences in the complementary strand a Return to the Sequence tab in the TaqMan MGB Probe document for Allele 1 The polymorphic sequence and surrounding nucleotides should still be selected b From the Edit menu select Copy Complement c Return to the TaqMan MGB Probe Test document and click the Probe 2 text box d From the Edit menu select Paste Primer Express copies the complementary sequence into the test document and calculates the of the oligonucleotide Primer Express Documents 4 33 To design the probe for Allele 1 continued Step Action 4 For easier identification label the polymorphism within each probe sequence a Select the polymorphism within the sequence in the Probe 1 text box 1 TTCCACACAACATACGAGCCG b Press the key corresponding to the letter of the polymorphic base Primer Express replaces the uppercase letter of the base witha lowercase letter Probe 1 TTCCACACAACATACGAGCCG c Repeat steps a and b for the sequence in the Probe 2 text box Highlight potential probe sequences until you identify a probe that meets the guidelines in TaqMan MGB Probe Design Guidelines on page 4 30 Note Look at potential probes from the complementary sequence IMPORTANT Primer Express calculates the T for only the highlighted nucleotide sequence and excludes
180. sm within the sequence using the Line tool a From the Tools palette click the Line tool b Select the polymorphic sequence Polymorphism TATCCGCTCA CAATTCCACA CAACATACGA GCCGGAAGCA ATAGGCGAGT GTTAAGGTGT GTTGTATGCT CGGCCTTCGT The software automatically underlines the polymorphism Following steps 1 4 import the sequence for the other allele into a separate TaqMan MGB Probe document Designing the Allele 1 Probe To design the probe for Allele 1 Step Action 1 From the TaqMan MGB Probe document for Allele 1 click the Sequence tab The Sequence tab comes to the front of the dialog box 4 32 Primer Express Documents To design the probe for Allele 1 continued Step Action 2 Select a region containing potential probe sequences a Highlight the polymorphism and approximately 10 nucleotides in both the 5 and 3 directions Polymorphism TATCCGCTCA CAATTCCACA CAACATACGA GCCGGAAGCA ATAGGCGAGT GTTAAGGTGT GTTGTATGCT CGGCCTTCGT us 10 nucleotides in both AGCCTGGGGT GCCTAATGAG TGAGCTAACT the 5 and directions b From the Edit menu select Copy c From the File menu scroll to New and select TaqMan MGB Probe Test Document A TaqMan MGB Probe Test document appears d Click the Probe 1 text box e From the Edit menu select Paste Primer Express copies the sequence into the TaqMan Probe Test document and calculates the T u
181. sociated Primer Processing document you can view each sequence file in its own Express Document Primer Express document To do this double click the sequence name to open a corresponding Primer Express document of the type selected IMPORTANT Do not double click the sequence name until after you have selected the correct document type Opening the corresponding Primer Express document locks the document type 4 66 Primer Express Documents Primer Test Document When to Use the Document Primer Test Document Example The Primer Test document allows you to enter two primer sequences and immediately observe their and GC as well as any potential secondary structure and primer dimer formation You can enter primer sequence data either directly from the keyboard or by pasting from another document the Primer Express document text file and so on The following is an example of a Primer Test Document Primer Test 1 80 Primer data CGGCTTAATATATCGCGATC Potential secondary structure Primer dimer Primer Express Documents 4 67 Starting the To start a new Primer Test document choose New from the File menu Document select Primer Test Document from the submenu Features The following table lists the features of the Primer Test document Feature Description Primer Concentration Allows you to change the primer concentration value default 2 50
182. sults page for future reference by clicking the Save Results button All the Primer Express software data including saved results information is stored in the Primer Express software Archive file default name PXArchive 5 52 Primer Express Pages Viewing and To view or modify saved results choose Open Results from the File Modifying Saved Menu For more information see Open Results Command on Results Page 7 4 Other Primer Express Software Views Batch Processing For a description of the Batch Processing document features see Batch Processing Document on page 4 61 Primer Test For a description of the Primer Test document features see Primer Test Document on page 4 67 Primer Express Pages 5 53 Using the Annotation Tools Introduction In This Chapter Topics in this chapter include the following Topic See page About the Annotation Tools 6 2 Selecting and Moving Sequence Text 6 4 How to Delete Annotations 6 5 How to Specify a Sequence Region 6 6 How to Specify Where the Probe Must Anneal 6 8 How to Exclude a Sequence Region 6 10 How to Select a Forward Primer Region 6 12 How to Set a Sequence Residue as the Forward Primer End 6 14 How to Set a Sequence Region as the Reverse Primer 6 16 How to Select a Sequence Region as Reverse Primer End 6 18 How to Translate DNA to Amino Acid Sequence 6 20 How to Highlight Sections of Sequence Text 6 22 How to Create a
183. t to distinguish them all by electrophoresis Because of the complex and memory intensive calculations involved it is recommended that you use only one Multiplex PCR document at a time If you need to find new primers close the first Multiplex PCR document and open a new one The Multiplex PCR document contains three unique options on the Params page For information see Features on page 5 5 The default parameters in the Primer Express software are set at values that generate a useful number of primer pairs for most the Primer Express document types In general Multiplex PCR documents require parameters with relaxed stringency because of the inherent difficulty in finding primer pairs It is advisable to set the parameters to more relaxed values in the Preferences dialog box so that any Multiplex PCR documents you open automatically have the correct parameters for you For more information see Preferences Command on page 7 13 Primer Express Documents 4 53 How to Calculate Multiplex Primers Introduction You can use the Multiplex PCR document to calculate Multiple sequences each amplified by a single primer pair large sequence and specify a number of different targets For information on importing sequence files see Importing a Sequence on page 5 11 Calculating To calculate primers for multiple sequence files Multiple Sequences Step Action 1 Import each DNA sequence file into the Mu
184. tart Length Tm GC and Display primer sequence data for both primers and amplicon P A separate heading at the right of the Primer Display pane shows the Penalty score For more information see Appendix B Calculating Penalty Score You can sort the data in this pane by any of the headings see How to View the Window on page 5 36 Order Displays an electronic form for ordering primers button electronically For more information see How to Order Primers on page 5 37 Save List Saves the primer numerical and sequence data in a text file button on your hard disk For more information see Table of Exports Files on page C 3 Display Allows you to show or hide the display of one or more data button fields on the Primers page Click the button to display the Primers Page Display Controls window Click any heading to toggle the display between visible and hidden ET Primers Page Display Controls Forward Primer Start orward Primer Length orward Primer Tm Hidden data orward Primer 6GC orward Primer Primer fields Reverse Primer Start Reverse Primer Length Reverse Primer Tm Reverse Primer GC Reverse Primer Primer Amplicon Length Amplicon Tm Amplicon GC Amplicon Penalty Score LOO 5 34 Primer Express Pages Primer Data General Information Window The Primer Data Window is a small window that contains the primer sequence and attrib
185. tential probe sequences until you identify a probe that meets the guidelines outlined in TaqMan MGB Probe Design Guidelines on page 4 30 5 With the desired probe sequence highlighted select Trim from the Edit menu The software eliminates all but the selected nucleotide sequence from the probe test document 6 Copy and paste the final sequence for the Allele 2 probe into a text document for ordering Primer Design After selecting probes for the assay choose primers based on the Guidelines guidelines below Amplicons should be 50 150 bp in length By limiting the parameters for amplicon design such as amplicon size it is possible to run all reactions with a single reaction buffer such as the TaqMan Universal PCR Master Mix P N 4304437 and a single thermal cycling protocol Guidelines for Designing Primers Avoid runs of an identical nucleotide This is especially true for guanine where runs of four or more should be avoided The T of the primers should be 58 60 Keep the C content within 30 80 Make sure the last five nucleotides at the 3 end contain no more than two C residues Place the forward and reverse primers as close as possible to the probe without overlapping it Note default values on the Params page follow the above guidelines Primer Express Documents 4 37 Steps for Designing Primers IMPORTANT Design primers after selecting the probe with the p
186. the Batch Processing document For more information see Importing a Sequence on page 5 11 Assign each document a Doc Type a For the entire batch of documents from the heading pop up menu or b Individually from the pop up menu for each individual document For more information see Changing Document Type for an Individual Sequence on page 4 65 Click the Go button to process the Batch Processing document If any sequences generated zero primers double click the individual document name to open it Change parameters on the Params page For more information see How to Set Parameters on page 5 24 4 64 Primer Express Documents Changing Document Type for an Individual Sequence To use a Batch Processing document continued Step Action 8 Make the Batch Processing document the active document by Clicking it to bring it to the foreground or Selecting the Batch Processing document name from the Windows menu 9 Click the Go button to process the Batch Processing document Note Primer Express software calculates primers only after you click the Go button in the active Batch document 10 If any sequences generate zero primers go back to step 6 of this procedure When you add a sequence file to the Batch Processing document it is assigned a DNA PCR document type by default You can change the document type for each sequence file individuall
187. the Primer Express software registration card Store your portion of the card in a safe location 4 Click OK After the registration code is accepted the Primer Express software prompts you to create an archive file for storing primer design information To create the Primer Express software Archive file see How to Create the Primer Express Software Archive File on page 3 3 How to Create the Primer Express Software Archive File About the Archive The Primer Express software Archive file allows you to store information about your oligo designs Only the Primer Express software can read the Primer Express software Archive file When you save a Primer Express document all the information contained in the document is stored in the Archive file File Creating the Archive File The Primer Express software Archive file is created the first time you launch the Primer Express software The following procedure describes how to create the Primer Express software Archive file To create the Primer Express software Archive file Step Action 1 Launch the Primer Express software 2 When launching the Primer Express software for the first time the following dialog box appears Look in Primer Express Sample Sequences Files of type PxArchive per Mew Click New to create a new Primer Express software Archive Use any name that is convenient the def
188. the sequence Step Action 1 Launch the Primer Express software 2 Import a DNA sequence for designing probes and primers To select a probe from Then a DNA file a From the File menu scroll to New and select TaqMan MGB Probe amp Primer Design A TaqMan MGB Probe document appears b Click Import DNA File Locate and select a DNA file in the browser d Click Open The software loads the sequence and displays it in the Sequence tab an existing a From the File menu select Open e a The Document Archive dialog box appears ocumen i b Double click the document to load or select located in the D the sequence and click Open ocument Archive The software loads the sequence and displays it in the Sequence tab a text a Select the sequence from the text document document or or the navigator window GenBank b From the Edit menu select Copy sequence From the File menu scroll to the New submenu and select TaqMan MGB Probe amp Primer Design A TaqMan MGB Probe document appears From the Edit menu select Paste The software pastes the nucleotide sequence into the Sequence tab Primer Express Documents 4 31 To load the sequence continued Step Action 3 Select the following checkboxes for primer selection Double Stranded Limit 3 G C The sense and antisense sequences appear on the Sequence tab Label the polymorphi
189. tion of IUPAC codes see Appendix F IUPAC Codes All nondegenerate residues use standard base colors generated by ABI PRISM automated sequencers and genetic analyzers see table below Code Color A green C blue G yellow red The consensus sequence shows the IUPAC composition of each base position the linear sequence numbering asterisks that indicate discriminatory residues primer graphics and any annotations made to the sequence data 2 Total Shows the number of sequences in the imported alignment file Sequences 3 File Name Shows the name of the alignment imported into the document If no sequence file has been imported this display is blank 4 Included Shows the number of sequences that are included checkbox is selected in the current alignment All primers calculated amplify the included sequences and do not amplify the excluded sequences 5 Excluded Shows the number of sequences that are excluded checkbox is deselected from the current alignment All primers calculated amplify the included sequences and do not amplify the excluded sequences 6 Import Allows you to import an alignment file through a standard PC file navigation Alignment File button dialog box Primer Express Pages 5 9 Call Out Feature Description 7 Discrim Res Shows the number of bases marked by an asterisk over the consensus discriminatory sequence data residues A base position marked by an aste
190. tions Translation annotation inserted red Probe 3 ox208 131 TS As TCNAGCNNGG AA AAAAAAAA GATGTGCTGA GATGGGAAAC CCAAAATNAT GGTAAATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG HisCys LeuThrMet laThrGlnLy AACAGCAGTC ACAGTCTAGG AAGTAAATGT AGAGCCCCTG sThrAlaVal ThrValTerV alPheProGl uSerLysCys ArgAlaProA ATGCTGGAGA AGTGTCTGCT sp rgThrHi sSerSerLeu GlnHisTyrA sn laGlyGl u alSerAla GCAGCTGCCA TTGTTGCTGT TGTTCCATTT GCAACTTCTC AGTCTCAAAG AladladlaI leValAlaVa lValPro GTGACAGCAA GAACCAGGAT CATAAAGGNG GTGGTCCTAA TTGACAAGGC TGCTATGGAA AACCTATGCA TAGTCTTAGC CACAAAGAGT NAAAGGTCAA AAGTGGCTTC ATCTATGGNG CCATTTTAAG GCCTAAAATT Ready to Calculate To find primers select Find Primers Now under Options menu 6 20 Using the Annotation Tools To add a translation annotation continued Step Action 4 Any sequence data that does not specify individual bases A C G or T does not translate into amino acid abbreviations but is annotated with dots beneath the sequence data Translation annotation 25 Probe 3 TRCGRTCTTR TyrAspleus TOCTHGYAGH GGCTTCYAGC GlyFhe A OGTTYASGTS Ual Wal GTCGAYCGCY 23 323 TUKHUTRHTE GCTCGATCGT LeuRspRrq GATCG
191. tions like the Standard Recipe page Standard Recipe Page on page 5 45 but contains recipe components for the Sequencing Primer application Recipe Page The following is an example of the Recipe page for Sequencing Primer Example Sequencing Primer 3 BEA w fue You need a DNA sequence for primers ta be found Retum to the Sequence page to enter one Features Sequencing Primer Recipe page features Feature Description Stock Contains the concentrations of the stock solutions used to Concentrations create the PCR mixture for sequencing primers column Change these concentrations to match the requirements of whatever kit you are using for sequencing The last two components on the page are user definable This feature lets you add something extra to your protocol These extra additions are typically enzymes or proteins such as BSA UNG dUTP or gelatin Reaction Volume Volume required for the cycle sequencing reaction default 2 10 pL Primer Express Pages 5 49 Results Page About the Page Results Page Example General Information The Results page gives you a way to save the results of your actual PCR experiment After you design and select primers using the Primer Express software then use the primers in the PCR experiment return to the Results page to enter the results of the PCR The information in the Results page is saved in the archive file you creat
192. tus bar at the bottom of the Primer Express software window displays the progress of the calculations After the Primer Express software performs the calculations one of two events occurs either the software Finds primers Does not find any primers When the Primer When the Primer Express software finds primers the highest ranking Express Software primer set is displayed on the Sequence page Figure 5 1 The ranking Finds a Primer 5 determined by Penalty score For more information about Penalty Score see Appendix B Calculating Penalty Score 25 Cycle Sequencing Primer 1 T datrercons RRCCTRTGCR TAGTCTTAGC CRCRRRGRGT NAAAGGTCAA RRGTGGCTTC ATCTATG Figure 5 1 Sequence page showing primer set 5 16 Primer Express Pages RCRGRRCRCR TTCCTCCTTR CAGCACTATA ATGCTGGAGA AGTGTCTGCT TIT Terence GCRRETTCTC RGTCTCRRRG GRCRGCRR GRRCCRGGRT CRTRRRGGNG GTGGTCCTRR TTGACAAGG total of 105 primer pairs found To examine primer pairs click the Primers tab Forward primer Reverse primer When a Primer Set Colored Outline Arrows is Displayed When a primer set is displayed on the sequence page the entire amplified region is highlighted and the two primers are indicated by colored outline arrows Red arrows indicate that the primers are considered optimal For more information about Optimal Primers see How to Find Primers on page 5 16 Information Displayed in the Status Bar The status bar
193. ults The Primer Express software calculates and eliminates from consideration most of the primer pairs that are self complementary or possess strong primer dimer tendencies To produce the intended PCR product the primers used for PCR must be very specific that is they must form stable primer template duplexes only at the proper locations in the target region Primer specificity is generally increased by increasing either primer length or annealing temperature of the primer or both Primer length and T parameters are both set by the user on the Params page For more information on Parameters see Standard Parameters Page on page 5 19 DNA PCR refer to Dieffenbach et al 1993 Mullis et al 1987 Rychlik 1995 and Rychlik et a 1990 Primer Express Documents 4 41 4 42 Base Stacking What Are Base Stacking Interactions Interactions The Primer Express software uses the nearest neighbor analysis method to estimate the melting temperature T of PCR primers The helical structure of DNA causes adjacent bases to overlap one another The forces between these bases are called base stacking interactions The strength of such interactions depends upon the sequence of the base and its nearest neighbor Why Base Stacking Interaction is Important In short pieces of DNA less than 40 bases the sequence dependent nature of the base stacking interactions plays a significant role in estimating T Various PCR buffers ha
194. ults Page 5 50 Results Page for Nested PCR 5 52 Other Primer Express Software Views 5 53 Primer Express Pages 5 1 About the Primer Express Software Pages Pages and Tabs With the exception of Batch Processing and Primer Test and TaqMan MGB Probe Test each Primer Express document contains seven different pages Each page has its own tab as shown below Params RwnCond Primers Recipe Results oee Page Names and Tab Names for the name of each page along with its corresponding tab name Page Names and The following table lists the name of each page along with its Tab Names corresponding tab name Page Name Tab Name Purpose Sequence Sequence Enter and annotate sequence data Parameters Params Set specs for primer and length amplicon and length GC base repeat 5 tail Reaction Rxn Cond Set DNA salt and Mg concentrations Conditions select PCR enzyme Primers Primers View and sort primer pair results Map Map View and sort primer pair graphics and graphics Recipe Recipe Calculate PCR concentrations and print protocol Results Results Record results of PCR reaction using calculated primers Viewing a Page To view any Primer Express page click the tab associated with that page 5 2 Primer Express Pages Dynamically When you use the Primer Express software you make a number of Linking Pages changes to sequence data and annotations as
195. ument 4 60 How the Document Works 4 60 Starting the DOCUMENT 2 2 Sieh ot b eode Ber 4 60 Batch Processing Document 4 61 When to Use the DOCUMENT ee Eee 4 61 Batch Processing Document Example 4 61 How Much You Can Import 4 61 Startine qa DOCUMEN jut cu e ur a Eo Ea e x etus do yd 4 62 qat duros 4 62 How to Use a Batch Processing 4 64 Tritt oque HO 25 OR m eal a ele be N 4 64 Using a Batch Processing 4 64 Changing Document Type for an Individual Sequence 4 65 Changing Document Type for Sequence Files 4 66 Viewing the Associated Primer Express Document 4 66 Primer Test Document aee d act datae AIRE AVE URS ees bab 4 67 When to Use th Document ter ox E esent A eger ee 4 67 Primer Test Document 1 4 67 Startme the DOCUMENT 2 c bean ye EC ER edet 4 68 POAC S Ee d 4 68 5 Primer Express Pages TREE TERR ER 5 c 5 1 About the Primer Express Software 5 2 Pages
196. ument a dialog box appears to allow you to save the changes This menu option is equivalent to clicking the document s close box You can save Primer Express documents except Batch Processing and TaqMan MGB Probe Test in the Primer Express software Archive file for future reference When you select Save or Save As from the File menu a dialog box similar to the one below appears PrimerExpress 2 0 208 4134 Primers The Primer Express software automatically assigns a name to any document you choose to save You may change the name by highlighting the current name and typing the new name You cannot use the Save and Save As menu commands to create new files Use the Export menu option Primer Express Software Menus 7 5 Note You cannot save Batch Processing documents but the individual documents within a Batch are automatically saved to the Primer Express software Archive file immediately after processing Import Command Use this command to open a Primer Express software formatted file This function is the complement to Export and is useful when you want to transfer a Primer Express software file between computers using a disk or over a network Export Command Use this command to save a Primer Express document in the Primer Express software format on your computer s hard disk This function is the complement to Import and is useful when you want to transfer a Primer Express software file between computers using a disk or
197. up any temporary files created by the installation procedure 2 4 Installing the Primer Express Software Getting Started Introduction In This Chapter This chapter includes the following topics Topic See page How to Start the Primer Express Software the First Time 3 2 How to Create the Primer Express Software Archive File 3 3 How to Use the Primer Express Software 3 5 How to Learn More 3 7 Getting Started 3 1 How to Start the Primer Express Software the First Time Introduction Starting the Primer Express Software 3 2 Getting Started Each Primer Express software package contains a card with a unique registration code Note Your opening of the software package means that you accept the terms of the software licensing agreement in Appendix 1 Software License IMPORTANT You can not use the same registration code on more than one computer To start the Primer Express software for the first time Step Action 1 Navigate to the program folder for Applied Biosystem and Primer Express and double click the Primer Express software icon 2 The first time you use the Primer Express software the registration dialog box appears Note If you move or delete the Primer Express software Archive file or preferences file you must enter the registration code again 3 Enter your name your organization and your registration code The registration code is located on
198. using the Select Tool To remove a Target Exclude Forward Primer Forward Primer End Heverse Primer Reverse Primer End ORF or Line annotation drag one end of the annotation past the opposite end Note Select Clear All Annotations from the Edit menu to remove all existing annotations at the same time How to Delete Annotations Deleting Annotation e Erazer Removing Annotations Use the Eraser tool to delete annotations from Primer Express documents To delete an annotation click the bottom left corner of the Eraser cursor on the annotation you wish to delete Note You can also use the Select tool to delete many annotations For more information see Hemoving an Annotation on page 6 5 To remove all existing annotations at the same time select Clear Annotations from the Edit menu Using the Annotation Tools 6 5 How to Specify a Sequence Region Introduction Use the Target Region tool for specifying a particular sequence region that you want amplified by the PCR reaction Note one Target annotation is allowed in each Primer Express document except Multiplex PCR Creating a new Target annotation automatically deletes any existing one as well as deletes any incompatible forward or reverse primer annotations Adding a Target To add a target annotation Annotation Step Action 1 Click the Target tool to select it Target The cursor changes to the green l beam curso
199. utes for the primers selected highlighted in the Primers page You can view the Primer Data window when the Sequence Params Primers or Map page is active and the Primer Data Window varies according to which document type you are using Note The Batch Processing document the Primer Test document and the TaqMan MGB Test document do not have a Primer Data window Primer Data The following are examples of the Primer Data window Window Examples Primer Data Nested Primer Data DNA PCR RT PCR Allele Specific PCR TagMan MGB Probe Primer Data Nested PCR Sequencing Primer Data TaqMan PCR Cycle sequencing Sequencing Primer Sequencing Primer Data Primer Express Pages 5 35 How to View To view the Primer Data window select Show Primer Data from the Window Options menu Features of the Primer Data window features Primer Data Window Feature Description Forward Reverse This pane in the Primers page shows the Primer Sequence Data sequence of bases contained in the forward and reverse primers along with the Ta 76 GC starting location and primer length Amplicon Data This pane in the Primers page shows the Tp length and Ta of the amplicon Viewing Any primer pairs found as a result of a search are displayed in the Parameters Upper pane of the Primers page The primers displayed are sorted according to the heading that is underlined near the top of the page see
200. ving different salt concentrations also play a significant role in estimating Tm The desired of PCR primers is strongly dependent upon the PCR application and template sequence factors that narrow the choice of the primer binding sites Most PCR primer Ts fall within the 37 68 C range with higher T s favoring increased specificity Components that Affect the T of Primers In any PCR reaction the three most important components that affect the of the primers Concentration of the primers Salt KCI concentration GC Increasing one or more of these components increases the primer Tn Primer Express Documents RT PCR Document When to Use the Use the RT PCR document for two primer PCR starting from the RNA Document template also referred to as the RNA PCH RT PCR The following is an example of a RT PCR document showing the Document Sequence page for DNA file 0x208 131 Example xs HT PCR 1 EI Sequence File Name ox208 131 Import WHS Bile 52 Double Suanded mty aC ppt Lira ga ra ra Y ya ra gag pa ua ga paa nnn nnna UCNAGCNNGG UACCCUUUCA ARAAAAAAAA AGAAAGAAAG AAAAAGAAAU 50 a CUGCAACAUA ACCUAUGAAU GAUGUGCUGA GAUGGGAAAC CCAAAAUNAU 100 GGUAAAUCAG AGUGGCACUA AGGCCAUUGU CUCACCAUGG CAACCCAAAA 150 AACAGCAGUC ACAGUCUAGG UCUUUCCAGA AAGUAAAUGU AGAGCCCCUG 200 ACAGAACACA UUCCUCCUUA CAGCACUAUA AUGCUGGAGA AGUGUCUGCU 250 GdAGCUGCCA UUGUUGCUGU UEIUCCAUUU GCAACUUCUC AGUCUC
201. w allele specific PCR works Step Action 1 Two primers are designed as in standard DNA PCR but only one primer is specific to the mutant allele The 3 end nucleotide of the allele specific primer is complementary to the mutant nucleotide but not to the wild type 2 If the target DNA contains the mutation of interest then the allele specific primer binds and amplifies the product normally Only linear amplification from the other primer occurs on the wild type template because DNA polymerases including AmpliTaq9 DNA polymerase tend not to extend from a mismatched nucleotide This tendency produces a low level of linear amplification product that is not detected normally Therefore the presence of an amplified product in allele specific PCR acts as an indicator for the presence of the mutation 4 50 Primer Express Documents Select Mismatch Nucleotide Reducing Mismatch Extension Reducing False Positives For More Information All general rules for standard PCR primer design apply for allele specific PCR In addition it is very useful to select a mismatch nucleotide for the allele specific primer that has the lowest probability of mismatch extension by the polymerase Figure 4 2 replat TTT aee 5 Allele specific 3 Mismatched nucleotide yields no PCR product Figure 4 2 Allele specific primer with mismatched nucleotide Set the annealing
202. ward Primer Annotation continued Step Action 3 Click and drag to highlight the desired data When you release the mouse button the highlighted sequence text is annotated as the forward primer Forward Primer annotation inserted blue TCHAGCNNGG AAAAAJ AMAA AGAAAGAAAG AAAAAGAAAT CTGCAACATA GATGTECTGA 100 GGTASATCAG AGTGGCACTA AGGCCATTGT CTCACCATGG 150 ee AACAGCAGTC AGAGCCCCTG 200 ACAGAACACA TTCCTCCTTA ATGCTGGAGA AGTGTCTGCT 250 GCAGCTGCCA TTGTTGCTGT TGTICCATIT GCAACTTCTC AGTCTCAAAG 300 CATASAGGNG GTGGICCTAA 350 AACCTATGCA CACAAAGAGT 400 AAGTGGCTTC ATCTATGGNG GCCTAAAATT 450 ANCATGAATG NAATGTTAAG 471 You can use the Select tool to move lengthen or shorten any existing Forward Primer annotation For instructions on modifying or removing Forward Primer annotations see Modifying an Annotation on page 6 4 Using the Annotation Tools 6 13 How to Set a Sequence Residue as the Forward Primer End Introduction Use the Forward Primer End tool for setting a particular sequence residue as the
203. will quench the reporter fluorescence somewhat even after cleavage Select the probe strand that gives more Cs than Gs Position the polymorphic site approximately in the middle third of the sequence Designing the Allele 1 Probe To design the probe for Allele 1 Step Action 1 From the TaqMan Probe document for Allele 1 click the Sequence tab The Sequence tab comes to the front of the dialog box 4 20 Primer Express Documents To design the probe for Allele 1 continued Step Action 2 Select a region containing potential probe sequences a Highlight the polymorphism and approximately 10 nucleotides in both the 5 and 3 directions Polymorphism TATCCGCTCA CAATTCCACA CAACATACGA GCCGGAAGCA ATAGGCGAGT GTTAAGGTGT GTTGTATGCT CGGCCTTCGT us 10 nucleotides in both AGCCTGGGGT GCCTAATGAG TGAGCTAACT the 5 and directions b From the Edit menu select Copy From the File menu scroll to New and select Primer Test Document A Primer Test document appears d Click the Forward Primer text box e From the Edit menu select Paste Primer Express copies the sequence into the Primer Test document and calculates the T using the nearest neighbor algorithm IMPORTANT Do not change the primer and salt concentration default values Note software calculates the of the probe sequence even though the document is called a Primer Test document 3 Test potenti
204. y between primers must be avoided because it leads to primer dimer artifacts 3 complementarity between primers and nonspecific sequences present in the template must be avoided Additional considerations for primer design are the following Keep the of both primers close to each other so that an optimal annealing temperature can be easily achieved PCR primers should have a moderate GC content 40 60 Hairpin Loops If a DNA strand possesses a self complementary sequence it may form a secondary structure often called a hairpin loop Regions that tend to form secondary structure should be avoided when designing PCR primers If the potential for secondary structure is great primers must compete against the complementary strand for binding to the target sequence reducing PCR efficiency For more information on how the Primer Express software displays nonspecific product formation see Show Hide Primer Secondary otructure on page 7 16 4 40 Primer Express Documents Primer Dimer Increasing Primer Specificity Primers that anneal to nonspecific locations on the template may give rise to nonspecific amplified products Primers that possess 3 complementarity with themselves or another primer in the PCR reaction may form another type of nonspecific product often called primer dimer Avoid nonspecific product formation because it decreases the quantity of specific product produced and may add ambiguity to the PCR res
205. y or for all the sequence files in the Batch Processing document To change the document type for each individual sequence Step Action 1 Click the desired sequence file to select highlight it 2 Click the Doc Type of the selected sequence file to display a pop up menu Batch 1 Bl gt Delete o Prefs Sammay DROGNEPSAZ qb RT Waiting 1 5 276 DNA Waiting ong Read Tag Std on 310 OMA Waiting LR std 48 DNA DNA PCR RT PCR Nested PCR Probe Cycle Sequencing Sequencing Primer 3 Select the document type from the pop up menu The individual sequence file displays the selected document type Primer Express Documents 4 65 Changing Document Type change the document type for all sequence files in the document for All Sequence Step Action Files 1 Click the heading named Doc Type to display a pop up menu Click here to display pop up menu 1 PCR RT PCR Nested PCR TaqMan Probe Cycle Sequencing DROGNBPSA3 gb 1 5 276 Long Read Taq Std on 310 LR std 48 Sequencing Primer Select the document type from the pop up menu All sequence files in the Batch Processing document display the selected document type Viewing the After choosing the document type for each sequence in the Batch As
206. ycle Sequencing or Sequencing Primer document B 4 Calculating Penalty Score File Types Supported Introduction In This Appendix The Primer Express software is a member of the growing suite of Applied Biosystems software applications designed for DNA analysis The software recognizes a number of different file formats including files from Applied Biosystems software and instruments Topics in this appendix include the following Topic See page Imported Sequence Files C 2 Exported Files C 3 File Types Supported Imported Sequence Files Table of Imported You can import the following file types into a DNA PCR RT PCR File Types Nested PCR Multiplex PCR TagMan Probe Cycle Sequencing oequencing Primer or Batch Processing document File type Description 373 377 310 Sequence files created by ABI PRISM Automated Sequence Files Genetic Analyzers and DNA Sequencers Factura ABI PRISM batch processing software that cleans up and annotates sample files from DNA analyzers sequencers GenBank To import the sequence text from these applications save the file as an unformatted text file EMBL To import the sequence text from these applications save the file as an unformatted text file GCG To import the sequence text from these applications save the file as an unformatted text file FASTA To import the sequence text from these applications save the

Primer Express® Software v2.0

Contents

Download Pdf Manuals

Related Search

Related Contents

Primer Express&reg; Software v2.0

Contents

Download Pdf Manuals

Related Search

Related Contents

Primer Express® Software v2.0