Home

GenTarget`s EcoTMPlasmid DNA Miniprep Kit User Manual

image

Contents

1. 1 Transfer 2ul of the ligation reaction into a vial of DH5a chemically competent E Coli cells mix gently Note chemically competent cells are not included in this kit 2 Place cells on ice for 5 minutes and then transfer cells into 42 C water bath incubate for 30 seconds without shaking Immediately transfer cells to ice 3 Add 250 ul of SOC medium incubate at 37 C for 1 hour with shaking pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 10 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com 4 Spread all 250 ul of cultured cells onto a pre warmed LB plate containing 100 ug ml ampicillin and incubate overnight at 37 o C Note In general 30 100 colonies will be produced from your reaction and 0 to 5 colonies from the no insert control reaction 3 Confirm positive clones Pick 1 2 colonies grow in LB ampicillin medium isolate plasmid DNAs by miniprep column and sequence using the sequencing primer provided Note The provided primer is at a ready to use concentration of 25 ng ul simply use 1ul per reaction Sequencing of the stem hairpin structure may require a special solution for best results Purified positive plasmid DNAs are ready for transfection into cells for knockdown analysis or for use in producing lentiviral particles in packaging cell lines The generated lentiviral
2. functional studies in both animal and cell line models Variety RNAi vectors are commercially available now in the market shRNA expression lentivectors GenTarget provides cloning kits for making shRNA lentiviral expression vectors with different selection markers blasticidin puromycin GFP pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 5 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com blasticidin GFP puromycin RFP blasticidin and RFP puromycin The shRNA expression may be driven by the RNA polymerase III promoter the optional inducible Hi promoter or the constitutive U6 promoter These promoters are positioned to ensure the production of precise shRNA transcripts About promoter selection U6 and H1 are poly III promoters and are best suited for transcription of short RNA molecules Both are active in the majority of mammalian cell types but one could be stronger than the other in some cell types Unless you already knew or have validated the better promoter for your cells you can select either promoter for shRNA expression The H1 promoter is also an optional inducible promoter which means it can be used for regular constitutive expression like the U6 promoter or optionally used for tetracycline inducible expression when the repressor protein TetR is present in advance With inducible ex
3. amounts for 10 shRNA cloning reactions Upon received stored at 20 C Products stable for 6 months pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 2 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Quick protocol outlines for experienced users Design two DNA oligonucleotides hairpin structure encoding shRNA sequence Anneal the two oligo to generate a duplex Clone the duplex into provided linear pEco shRNA vector by T4 ligation reaction transform into competent cells and grow in LB ampicillin plate Pick 1 2 colonies mini prep the plasmid DNAs confirm positive clone by sequencing Knockdown analysis after transfect shRNA plasmids into mammalian cells Produce shRNA lentivirus and transduced into desired cells for knockdown analysis or generate shRNA stable cells Note to produce the shRNA knockdown lentivirus you require the virus production cell line CAT TLV C and virus packaging plasmid mixture CAT HT Pack which are not included in this cloning kit but available for purchase from GenTaget other vendors Cloning Scheme Overhang Sense 19 21 loop Antisense 19 21 AGCG NNNN NNNNCGAGNNNN NNNN NNNN NNNNGCTC NNNN NNNNAAAA H1 U6 Pro TCGC pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 3 of 16 793
4. kit Blasticidin selection marker pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 1 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 er aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com LTSH U6 pEco Lenti U6 l kit Make shRNA expression RP shRNA RFP puro lentivector with RFP cloning kit Puromycin selection marker LTSH U6 pEco Lenti U6 l kit Make shRNA expression Puro shRNA puro cloning lentivector with kit selection marker LTSH U6 pEco Lenti U6 1 kit Make shRNA expression Bsd shRNA Bsd cloning lentivector with Blasticidin kit selection marker Each Kit Contents Amount One of the pre cut Iniear vector pEco Lenti H1 U6 Marker linear vector 10ul dependent upon the each product catalog the 10rxn Marker is different 10x shRNA oligo annealing solution 50ul 5X ligation buffer 25 ul T4 DNA ligase enzyme 10ul 10rxn Cloning positive control insert annealed shRNA duplex 1x 10ul 10rxn Sequencing primer 5 ggatccaatatttgcatgtcgctatg for H1 promoter Or 5 ggactatcatatgcttaccg for U6 promoter 1 tube 10ul x 25ng ul 10 rxn Note Chemical competent cells are required for the cloning but not included in this kit You can use any common chemical competent cells like DH5a NovaBlue or others Storage shRNA Cloning Kit is shipped on dry ice Each kit contains sufficient
5. knockdown analysis after transfecting the shRNA plasmids into mammalian cells 14 Produce shRNA lentivirus and transduce into the desired cells for knockdown analysis or generation of shRNA stable cells Note to produce shRNA knockdown lentivirus you will need the virus production cell line CAT TLV C and virus packaging plasmid mixture CAT HT Pack which are not included in this cloning kit but available for purchase from GenTarget Full Protocol Design single stranded DNA oligonucleotides Email Orders gentarget com Design two DNA oligonucleotides a top strand and a bottom strand according to the following structure The top strand requires a AGCG overhang at its 5 end followed by the selected target sequence sense sequence of 19 21 nucleotides a CGAG loop or use your own loop and the reverse complementary sequence of the target sequence antisense The bottom strand requires an AAAA overhang at its 5 end with the remainder complementary to the top strand page 8 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Loop length has little or no effect on knockdown Four nucleotides CGAG have been determined to be the minimal length for effective RNAi knockdown You may design your own loop sequence such as a restriction enzyme RE recognition sequence however most RE sequences are palindromes which for
6. 0 Arjons Drive Suite B San Diego CA 92126 Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com GenlTarset inc human H1 promoter GGATCCAATA TTTGCATGTC GCTATGTGTT CTGGGAAATC ACCATAAACG CCTAGGTTAT AAACGTACAG CGATACACAA GACCCTTTAG TGGTATTTGC TGAAATCCCT ATCAGTGATA GAGACTTATA AGTTCCCTAT CAGTGATAGA ACTTTAGGGA TAGTCACTAT CTCTGAATAT TCAAGGGATA GTCACTATCT Transcription start GA ciag Tetracycline Repressor Binding Site TTTTTGGCCGGCC ACCGGTTAGT AATGATCGAC AATCAACCTC AACCGGCCGG TGGCCAATCA TTACTAGCTG TTAGTTGGAG human U6 promoter GGATCCAAGG TCGGGCAGGA CCTAGGTTCC AGCCCGTCCT TTTGCATATA CGATACAAGG AAACGTATAT GCTATGTTCC CTGTAAACAC AAAGATATTA GACATTTGTG TITTCTATAAT TTTCTTGGGT AGTTTGCAGT AAAGAACCCA TCAAACGTCA TATGCTTACC GTAACTTGAA ATACGAATGG CATTGAACTT AGAGGGCCTA TCTCCCGGAT CTGTTAGAGA GACAATCTCT GTACAAAATA CATGTTTTAT TTTAAAATTA AAATTTTAAT AGTATTTCGA TCATAAAGCT TTTCCCATGA AAAGGGTACT GATAATTAGA CTATTAATCT CGTGACGTAG GCACTGCATC TGTTTTAAAA ACAAAATTTT TTTCTTGGCT AAAGAACCGA TTCCTTCATA AAGGAAGTAT ATTAATTTGA TAATTAAACT AAAGTAATAA TTTCATTATT TGGACTATCA ACCTGATAGT TTATATATCT AATATATAGA Transcription start TGTGGAAAGG ACGAAA ACACCTTTCC TGCTTTHGGe MOMTTTGGCC GGCCACCGGT TAGTAATGAT AACCGG CCGGTGGCCA ATCATTACTA pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 4 of 16 G 7930 Arjons Drive Suite B San Diego CA 9
7. 2126 er aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Vector Schematic maps Schematic representation of shRNA lentivectors O RFP Bsd RFP Puro LRS GFP Bsd WPRE GFP Puro Puro Bsd Note The vector s full sequences can be downloaded from our website To make the final clone s map simply paste shRNA hairpin insert sequence not include the 4bp overhangs at both ends at position between 106 and 107 for H1 promoter vector or between 270 and 271 for U6 promoter vector Introduction RNA interference RNAi technology is a powerful tool for loss of function knockdown silencing research in mammalian cells Originally observed to inhibit gene expression in vivo through short double stranded RNAs RNAi works through a series of enzymatic reactions mediated by short RNAs having sequences complementary to those of the silenced target These reactions result in target mRNA degradation or translational repression RNAi knockdown can be introduced by synthetic short double strand RNA siRNA or by vector expressed stem hairpin RNA shRNA which is further processed by the Dicer enzyme to produce double stranded short RNAs Chemically synthesized double stranded RNA siRNA has a transient silencing effect only in contrast selection of clones for stable vector expression of RNAi can provide long term silencing Vector expressed RNAi for gene silencing provides a convenient method to
8. G 7930 Arjons Drive Suite B San Diego CA 92126 el aruet ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Lentiviral shRNA Expression Cloning Kit for making shRNA expression knockdown lentivectors Cat Product Name Amount Application LTSH H1 pEco Lenti H1 1 kit Make shRNA expression GB shRNA GFP Bsd lentivector with GFP cloning kit Blasticidin selection marker LTSH H1 pEco Lenti H1 1 kit Make shRNA expression GP shRNA GFP Puro lentivector with GFP cloning kit Puromycin selection marker LTSH H1 pEco Lenti H1 1 kit Make shRNA expression RB shRNA RFP Bsd lentivector with RFP cloning kit Blasticidin selection marker LTSH H1 pEco Lenti H1 1 kit Make shRNA expression RP shRNA RFP puro lentivector with RFP cloning kit Puromycin selection marker LTSH H1 pEco Lenti H1 1 kit Make shRNA expression Puro shRNA puro cloning lentivector with kit selection marker LTSH H1 pEco Lenti H1 1 kit Make shRNA expression Bsd shRNA Bsd cloning lentivector with kit selection marker Cat Product Name Amount Application LTSH U6 pEco Lenti U6 1 kit Make shRNA expression GB shRNA GFP Bsd lentivector with GFP cloning kit Blasticidin selection marker LTSH U6 pEco Lenti U6 1 kit Make shRNA expression GP shRNA GFP Puro lentivector with GFP cloning kit Puromycin selection marker LTSH U6 pEco Lenti U6 1 kit Make shRNA expression RB shRNA RFP Bsd lentivector with RFP cloning
9. Our service has the fastest turnaround time and lowest costs available Please contact us for quote or email us References 1 Lee R C et al The C elegans Heterochronic Gene lin 4 Encodes small RNAs with antisense complementarily to lin 14 Cell 75 843 854 1993 Hannon G J RNA interference Nature 418 6894 p 244 51 2002 3 Bosher M et al RNA interference Nature Cell Biol 2 E31 E36 2000 4 Meister G and T Tuschl Mechanisms of gene silencing by double stranded RNA Nature 2004 431 7006 p 343 9 5 Paddison P J A A Caudy and G J Hannon Stable suppression of gene expression by RNAi in mammalian cells Proc Natl Acad Sci U S A 2002 99 3 p 1443 8 Related products GenTarget s Pre made lentivirus Products Product Product Description Category please click category name to see product s pages Human Premade lentivirus expressin a human mouse or rat gene with mouse or rat RFP Blastididin fusion dual markers ORFs Fluorescent Preamde lentivirus express human codon optimized fluorescent markers protein GFP RFP CFP BFP YFP Luciferase Premade lentivirus for all kinds of luciferase protein expression expression firefly and Renilla with different antibiotic selection markers CRE Premade lentivirus for expressing nuclear permeant CRE recombinase recombinase with different flurescent and antibiotic markers LoxP Premade lentivirus expressing LoxP GFP Stop L
10. Premade lentivirus expression human or mouse precursor and anti miRNA And anti miRNA lentivector and virus for human and microRNA mouse miRNA lentivirus Negative Premade negative control lentivirus with different markers control serves as the negative control of lentivurs treatment for lentiviruses validation of the specificity of any lentivirus target expression effects Other Ready to use lentivirus expressing specific enzymes with Enzyme different selection markers expression pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 16 of 16
11. arget com Copyrights 2015 page 6 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Key Features 1 Ready to use linearized vector no need for tedious preparation of vector backbone 2 Precisely directional cloning of your DNA duplex encoded shRNA structure 3 Rapid highly efficient cloning with low background Cloning can be done at room temperature for 30 60 min Clones are gt 90 positive 4 Internal fluorescent reference the vector encodes a fluorescent protein GFP or RFP allowing real time monitoring of transfection or virus transduction efficiency 5 Long term stable silencing effect the vector encodes an antibiotic marker or a dual marker a fluorescent antibiotic fusion marker allowing generation of stable cell lines for long term knockdown 6 Generated lentiviral shRNA particles can be transduced into your cells of interest The lentivector can produce lentivirus for transduction into hard to transfect cells for long term knockdown studies Or the lentivector can be transfected into cells for gene expression knockdown 7 Optional inducible knockdown The shRNA lentivector with the Hi promoter can be used for constitutive high expression of shRNA without the need for induction Optionally the vector s human H1 promoter allows inducible expression of shRNA when the tetracycline repressor protein TetR in present in advan
12. arget com Copyrights 2015 page 9 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el aruel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Incubate the reaction mixture at 95 C for 5 minutes can be done in PCR machine Leave the mixture on the PCR machine to gradually cool down for 30 minutes The put tube on ice Make 1 1000 dilution add iul annealed mixture in 99 ul Cold DNase free water and then take 2 ul added into 18ul of 1x annealing solution on ice Final diluted annealed duplex is ready for ligation Save undiluted duplex at 200C for long term storage Note always put diluted annealed duplex on ice to avoid double strand DNA melt Ligate the two single stranded DNA oligonucleotides into the vector Set up the ligation reaction as follows pEco Lenti H1 shRNA linear vector 1 ul Annealed duplex 1 1000 dilution 1 ul 5X T4 ligase buffer 2 ul DNase free water 5 ul T4 ligase 1 ul Total volume 10 ul Mix reaction well and incubate for 30 60 minutes at room temperature incubate for a longer time to generate more colonies Place reaction on ice and ready for transformation Set up a cloning positive control reaction by using 1 ul of annealed control sARNA duplex provided and thaw on ice The positive clone generated from the control shRNA duplex is capable of silencing the firefly luciferase gene see Example of knockdown below in this manual Transform Cells
13. ce see inducible expression link for its mechanism 8 Insert compatible the same annealed shRNA duplex can be readily cloned into all other linear shRNA lentivectors with different promoters or different selection markers Protocols Note Chemically competent cells are required for cloning but not included in this kit You can use any common chemical competent cells such as DH5a NovaBlue or others e Quick protocol for experienced users 8 Design two DNA oligonucleotides with hairpin structures encoding the shRNA sequence Note The vector s full sequence may be downloaded from our website To make the final clone map pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 7 of 16 pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 G 7930 Arjons Drive Suite B San Diego CA 92126 Gentorzotine Prone se 67eee Fax 800 3804198 simply paste the shRNA hairpin insert sequence not including the 4bp overhangs at both ends between positions 106 and 107 for the H1 promoter vector or between 270 and 271 for the U6 promoter vector 9 Anneal the two oligos to generate a duplex 10 Clone the duplex into the provided linear pEco shRNA vector by T4 ligation 11 Transform into competent cells and grow in LB ampicillin plate 12 Pick 1 2 colonies perform mini prep isolation of the plasmid DNAs confirm positive clone by sequencing 13 Perform
14. hRNA GFP Bsd plasmid P53 shRNA duplex was cloned into the pEco H1 shRNA GFP Bsd vector transfected into A549 cells and grown in medium containing 10 ug ml Blasticidin Cells were harvested at 3 days post transfection P53 levels were assayed from extracted total RNAs by real time Q PCR Data were normalized to internal levels of GAPDH The Null shRNA plasmid served as the negative control Conclusion RNAi gene silencing can be effectively carried out via pEco H1i shRNA GFP Bsd vectors Trouble shooting Problems Solution 1 Make freshly annealed duplex and dilute for ligation reaction 2 Extend ligation time or leave at 4 C overnight 3 Use more duplex add 5ul diluted duplex in ligation reaction 4 Use different competent cells Few or no colonies pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 14 of 16 7930 Arjons Drive Suite B San Diego CA 92126 Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com GenTaruet inc Lentiviral shRNA cloning service GenTarget offers a cost effective shRNA cloning services Simply tell us the target you want to knock down or provide us with your own sequences and we will design the shRNA for your target and clone its sequence into our shRNA expression vectors with the promoter and marker of your choice We will deliver sequence verified shRNA plasmids and the pre made lentiviral shRNA particles
15. lls at 10 20 confluence and culture at 37 C overnight Note For inducible shRNA expression the host cells must be a Tet repressor stable cell line GenTarget provides a Tet repressor expression cell line with Blasticidin selection Cat SCOO5 On the 2 day thaw the lentiviral stock Change medium to complete medium containing 6 ug ml polybrene and add the appropriate amount of lentiviral particles to achieve an MOI range of 1 to 10 Incubate overnight at 37 C At 24 hours after transduction remove the viral containing medium and replace with complete medium Incubate overnight at 37 C At 72 hours after transduction remove the medium and replace with complete medium containing the appropriate amount of antibiotic to select for stably transduced cells Note the amount of antibiotic added is dependent upon cell type A kill curve must be made to determine the correct amount of antibiotic In general 0 5 10 ug ml of blasticidin and 10 100 ug ml puromycin is used Change medium containing puromycin every 3 4 days As soon as the mock well has no live cells trypsinize the antibiotic resistant colonies and make a series of dilutions and seed into each well of a 24 well plate continue to grow cells Inspect cells under a fluorescence microscope select the wells that exhibit GFP signal from all cells and grow up in a large flask Collect cells and freeze in cryogenic vial pEco shRNA lentivec
16. m a continuous hairpin structure with the RNAi sequence which may not be processed correctly into RNAi by Dicer Two overhangs ensure the directional cloning of the annealed double stranded oligonucleotide into the linear vector provided The transcription start site is at the first nucleotide of the target sequence sense on the top strand Native H1 RNA initiates at an A so A is recommended as the first base in the sense target sequence shRNA target sequence sense selection There are some general guidelines for selecting an shRNA sequence but the effectiveness of an RNAi target sequence must be verified empirically To avoid off target effects design a scrambled sequence from the selected shRNA sequence or a universal Null sequence as a negative control for knockdown analysis Many online tools or designers can help your selecting your shRNA sequence Please see the following links e Promega s siRNA Target Designer Clontech s RNAi Target Sequence Selector e Gene Link shRNA designer e Invitrogen s BLOCK iT RNAi Designer e katahdin RNAi Central e WI siRNA selection program 2 Clone shRNA expression plasmids Anneal the two single stranded DNA oligonucleotides Set up the annealing reaction as follows 100 uM Top strand oligo 10 ul 100 uM Top strand oligo 10 ul 10X oligo annealing buffer 3 ul DNase free water 7 ul Total volume 30 ul pEco shRNA lentivector cloning kit User manual www gent
17. oxP RFP ColorSwitch cassette used to monitor the CRE recombination event in vivo CRISPR hu Preamde lentivirus express humanzied wild type Cas9 CAS9 endonuclease for genomic editing with CRISPR TetR Premade lentivirus expressin TetR tetracycline regulator protein inducible the repressor protein for the inducible expression system expression repressor Premde lentivirus for human and mouse iPS Myc NANOG iPS factors OCT4 SOX2 FLF4 factors with different fluorescent and antibitoic markers pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 15 of 16 GenTarget inc 7930 Arjons Drive Suite B San Diego CA 92126 Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com T antigen Express SV40 large T antigen with different selection markers Expression Cell Premade lentivirus for cell organelle imaging The fluorescent Organelle marker GFP RFP CFP was sub cellular localized in different imaging cell organelle for living cell imaging Lacz Express different full length B galactosidase lacZ with different expression selection markers Anti miNA Pre made lentivirus expression a specific anti miRNA cassette lentivirus Fluorescent Pre made lentivirus expression a GFP RFP CFP ORF fusion ORF fusion target Pre made Premade shRNA lentivirus for knockdown a specific genes P53 shRNA LacZ Luciferase and more lentivirus microRNA
18. particles can be used to transduce a cell line 4 Production of shRNA lentiviral particles Note GenTarget s pEco Lenti shRNA vectors are fully compatible with most commercially available lentiviral systems including ViraPower Block it Invitrogen MissionShRNA Sigma Lent X Clontech GIPZ Lentiviral SHRNAmir Open Biosystems etc The following protocol is recommended for the highest virus titer using GenTarget s lentiviral reagents Cells seed 293T packaging cells cat TLV C in plate or flask according virus production scale incubate overnight in 5 CO2 Transfection at the time for transfection cells should grow to 90 confluence Use your favorite transfection protocol according to the transfection reagent manual to co transfection of shRNA lentivector and packaging plasmid mixture The next day remove the medium and replace it with complete culture medium Harvest viral supernatants at 48 72 hours after transfection pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 11 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el arei ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Centrifuge virus particles at 3000 rpm x 15 minutes at 4 C to pellet cellular debris Filter through a sterile 0 45 um filter Store virus at 80 C 5 Transduction of shRNA lentivirus and selection of stable clones Cells Plate the host ce
19. pression transcription of shRNA is repressed in the presence of TetR alone and induced by the addition of tetracycline The presence of TetR can be achieved by using the Tet repressor stable cell line Cat SCOO5 by using GenTarget s pre made Tet repressor lentiviral particles or by co transfection with TetR expression vectors The Lentiviral shRNA vector allows generation of shRNA lentiviral particles that can be transduced into cell lines The resulting shRNA stable expressing cells can then be selected by antibiotic resistance or if one of the fluorescent antibiotic fusion markers is used sorted by fluorescent signal Note to produce the shRNA knockdown lentivirus you will need the virus production cell line CAT TLV C and virus packaging plasmid mixture CAT HT Pack which are not included in this cloning kit but are available for purchase from GenTarget Each kit contains a pre cut ready to use linear vector for ligation of shRNA duplex sequence The linear vector was designed for cloning of double strand DNA encoding a short hairpin RNA Once transcribed the shRNA is processed into short RNA in vivo for RNAi analysis To make a shRNA expressing vector two synthetic oligonucleotides are first annealed to form the DNA duplex which is then cloned into the ready to use linear vector via T4 enzyme ligation Each kit provides enough material for 10 cloning reactions pEco shRNA lentivector cloning kit User manual www gent
20. se by Luc shRNA 140000 gt o 420000 ai 107 54 100000 amp 80000 S 2 60000 S 40000 26 67 al 20000 0 T T Untransfected Luc shRNA 700ng Neg Ctr Knockdown of co transfected luciferase expression in 293 HEK cells by pEco H1 luc shRNA GFP Bsd plasmid The Luc shRNA duplex was cloned into the pEco Hi shRNA GFP Bsd vector then the Luc shRNA plasmid 700ng was co transfected along with the pcDNA3 1 luciferase firefly plasmid 100ng into 293HEK cells in a 24 pEco shRNA lentivector cloning kit User manual www gentarget com Copyrights 2015 page 13 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el arei ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com well plate Cells were harvested at 3 days post transfection Luciferase activity was measured from cell lysate 10 wul ea using GenTarget s luciferase reporter assay kit on an LMax microplate luminometer Null shRNA plasmid served as the Neg Ctr plasmid Example B P53 shRNA Measure the mRNA level by real time qPCR P53 shRNA top strand 5 AGCGccactacaactacatgtgtaaCGAGttacacatgtagttgtagtgg P53 shRNA knockdown of hP53 in A549 cells normalized to GAPDH 1 4 1 2 1 0 0 8 0 6 0 4 0 2 i 0 0 cycle P53 shRNA Neg Ctr Detector hu p53 z PlotifARn vs Cycle z Threshokkj 0 19733958 p53 GAPDH Knockdown of endogenous human P53 in A549 cells by pEco H1 p53 s
21. tor cloning kit User manual www gentarget com Copyrights 2015 page 12 of 16 G 7930 Arjons Drive Suite B San Diego CA 92126 el arei ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Validation of shRNA knockdown In general most RNAi designers can obtain a greater than 50 success rate with a greater than 75 knockdown level However there is no holy grail for an ultimate RNAi design the effectiveness of an RNAi sequence must be empirically determined Different approaches including Q PCR and western blot are used to validate shRNAs by measuring mRNA levels or protein products Alternatively reporter assays can be used to screen shRNAs In order to screen for the so called off target effect we have designed a negative shRNA sequence for use as a universal negative control In order to minimize non specific knockdown this sequence was designed against the entire human and mouse transcripts with minimal sequence homology to any human or mouse ORF sequences The negative control shRNA lentiviral particles containing this sequence may be purchased from GenTarget or you can design and clone your own negative control shRNA using this kit Examples of knockdown using pEco H1 shRNA GFP Bsd vectors Example A Luc shRNA measure the luciferase activity by luciferase assay kit Luc shRNA top strand 5 AGCGatgaaacgatatgggctgaatacCGAGgtattcagcccatatcgtttca Knockdown of co transfected lucifera

Download Pdf Manuals

image

Related Search

Related Contents

Bixolon SRP-350  Blaupunkt BREMEN MP76 User's Manual    N° 22 - L`Edifice  Panamax MAX 5510 User's Manual  ≪清水総合運動場≫ ①保安警備業務仕様書  

Copyright © All rights reserved.
Failed to retrieve file