Instrukcja obsługi konwertera USB na RS-232 ADA
Contents
1. Computer DTE interface ADA I9111 RS232 RS232 DB 9M DB 9M connector connector USB cable Se psi 1 DCD Te A type connector connector RX 2 2 RX TX 3 a 3 TX t USB RS 232 koua DTR 4 4 DTR DSR 6 e W60 DSR RTS 7 7 RTS CTS 84 DW 8 CTS RI 9 9 RI GND 5 5 GND Transmission direction Fig 3 Converter connection to DTE type device e g PC with RS 232 interface Modem with RS 232 Computer DCE interface ADA I19111 RS232 RS232 DB 9M DB 9M connector connector USB cable RS 232 cable DCD 1 e 1 DCD nee A type connector connecter RX 2 a 2 RX connector USB RS 232 DNS ai type A DTR 4 gt 4 DTR DSR 6 q 6 DSR RTS 7 p gt 7 RTS CTS 8 eq 8 CTS RI 9 q 9 RI GND 5 5 GND Transmission direction Fig 4 Converter connection to DCE type device e g modem with RS 232 interface 4 2 CONNECTION CONVERTER TO COMPUTER USB INTERFACE ADA 9111 converter connection to computer should be done by use USB cable with A type connector 4 3 POWER SUPPLY ADA I9111 converter is fed from USB port of PC 5 DRIVERS INSTALLATION IN SYSTEM WINDOWS Converter ADA I9111 is purchased with the driver package Installer for Windows systems on CD ROM For installation follow the steps below a2. 921600 PROFIBUS baud rate bps 300 bps 600 bps 1200 bps 2400 bps 4800 bps 9600 bps 19200 bps 93750 230400 bps 187500 460800 bps 500000 921600 bps Transparent for all protocols MODBUS DNP PROFIBUS and other Any format of byte defined with the specification of RS232 interface Automatic data flow control RTS TOGGLE function Power supply from the USB port Interface casing RS 232 interface cable with DSUB 9M male connector USB interface cable with USB connector type A Casing dimensions W x D x H 55mm x 24 5mm x 31mm ADA 19111 CEL MAR Zaktad Informatyki i Elektroniki 2 2 DESCRIPTION ADA I9111converts USB standard to RS 232 without interfering in the format of transmitted data Converter to communicate with RS 232 interface devices uses transmission lines as Rx Tx RTS CTS DTR DSR DCD RI and GND ground and it is automatically detect by the computer system after connecting to USB socket Plug amp Play device This converter doesn t required external power supply it is powered from USB bus and it uses asynchronism baud rate up to 921 3 kbps Purchasing the converter you will also receive drivers for Windows 98 ME NT 2000 XP Vista 7 Linux Installing this software on Operating System it add the additional COM port about the next free number witch can be used as standard COM port It is virtual COM port therefore some software use DOS can work improperly 3 CONFIGURATION Convert
3. device Please wait while the drivers install This may take some time to complete Ki Windows Security ka Windows can t verify the publisher of this driver software Don t install this driver software You should check your manufacturer s website for updated driver software for your device Install this driver software anyway Only install driver software obtained from your manufacturer s website or disc Unsigned software from other sources may harm your computer or steal information iw See details Press Install this driver software anyway Installation of drivers for USB Bus will start ADA 19111 CEL MAR Zak ad Informatyki i Elektroniki VCP Driver Installer installing the software for your ADA USB device Please wait while the drivers install This may take some time to complete i E poe n Don t install this driver software You should check your manufacturers website for updated driver software for your device gt Install this Only install driver software obtained from your manufacturer s website or disc Unsigned software from other sources may harm your computer or steal information w See details Press Install this driver software anyway Installation of drivers for Virtual Port will start ADA 19111 Press Finish Press Finish VCP Driver Installer CEL MAR Zak ad Informatyki i Elektroniki Congratulations You are finished installing y
4. 0 XP 2003 VISTA 7 2008 SYSTEMS In this system driver uninstallation have to be done according follow steps a disconnect converter from computer b login as the Administrator c select menu Start gt Setting gt Control Panel gt Add gt Remove Programs d select from the list Windows Driver Package CEL MAR ADA Virtual USB Serial Port e press Change Remove Virtual USB Serial Port driver will be uninstalled f select from the list Windows Driver Package CEL MAR ADA USB Serial Converter g press Change Remove driver converter of USB Bus will be uninstalled h after uninstallation reboot the computer 6 2 1 EXAMPLE DRIVER UNINSTALLATION IN WINDOWS 7 SYSTEMS Windows 7 system driver uninstallation have to be done according follow steps a disconnect converter from computer b login the Administrator account c select menu Start gt Control Panel gt Programs gt Uninstall d select from Windows Driver Package CEL MAR ADA Virtual USB Serial Port mi mE Control Panel Programs H Programs and Features TA a No ko Control Panel Home Uninstall or change a program View installed updates To uninstall a program select it from the list and then click Uninstall Change or Repair a Turn Windows features on or si Te vo Uninstall Change w Publisher AB Windows Driver Package CEL MAR ADA USB Serial Converter 10 22 2008 2 06 00 CEL MAR A Windows Driver Packa
5. 00 460800 187500 921600 500000 7 2 SELECTION OF COM PORT GREATER THEN COM9 lf virtual port COM of converter will install in Windows OS as COM10 or greater then in application using this port you should type COM port address as COM10 8 RS232 INTERFACE PIN DESCRIPTION OF D SUB9 MALE SOCKET Pin SIGNAL DESCRIPTION ADA I9111 DB 9 connector Data Carrier Detect Transmitted Data RI Rna Ret 13 Ten 8 E on ADA 19111 9 SPECIFICATION CEL MAR Zaktad Informatyki i Elektroniki TRANSITION PARAMETERS USB RS 232 Connector USB A type DSUB 9M male Line length up to5m up to 15 m Maximum number of connected devices 1 1 Transmission line DB9F DB9M multi wire cable 9x0 34 shielded up to 15m or twisted cable 9 pairs UTP 9x2x0 5 24AWG e shield inside large interferences STP 9x2x0 5 24AWG Standard USB cable Standards USB1 1 USB2 0 EIA 232 CCITT V 24 Maximum baud rate up to 921 6 kbps Standard up to 500 kbps Profibus Transmission type Asynchronism half duplex or full duplex Optical Signalization e RX red LED received data e TX yellow LED transmitted data NOMINAL OPERATING CONDITIONS Power requirements from USB of Computer Power lt 0 5 W Galvanic Isolation No Operating temperature 0 23 50 C Humidity 5 95 non condensing Location during work Free Electromagnetic c
6. CEL MAR Zak ad Informatyki i Elektroniki ADA 19111 User Manual ADA 19111 USB to RS 232 Converter without galvanic isolation Copyright 2001 2009 CEL MAR sp j 1 lo ada i9111 en v3 22 ADA 19111 CEL MAR Zaktad Informatyki i Elektroniki Contents 1 GENERAL INEORMATI gO re 3 11 4 AKE ANTED INFORMA ON ee eae e ee nner ee a 3 1 2 GENERAL CONDITIONS FOR SAFE USE wn ccc ccccc ccc ccccccccccccccccccccccucccuccucacceuaueuucueaeuuecuuauaueueunecuuausuenesuuaeuneauuausueceeuuaueeusuenennnnnnns 3 1 3 CE iN 1 l 3 1 4 ENVIRONMENTAL PRESERNATION kri ktiwa sti aw attrib a data mta e al l al n ka a an a e a a e a ak a ken l a A lk laa 3 1 5 SERVICE AND MAINTENANCE 2 c cccccccccccccsceccaccacacccceceaceauacucuacuscanananuacuaeuauaneauanuauauusceauaneauauuaeuauacecuacuauatuseaanacaauacscenuusceccenes 3 PRODUCT INFORMATION c ccccccccccccccccccccecccccccceccccaucueuecuuceueuaueuusueaecueaucuuaueneuuuaueuuauuausueaeuuucusuususnenueaeeuususausueneuuecuentausunsunennenunetennns 3 AE ROPE ce eS eC tt ak E E ce E Se ee ee E aa a tie a 3 BND YO RI PW IN iv ii aceon ce arctic eae ted cnc detect ev cet ed a E cess ve et EE EE E bua ne onc occa esd oad dw Daz n 4 GON re ON E neces vs ein de eect en av O nn wsdl e e ee cea nr say bak aero as ba ie sco cmc ak a a a a an Et ete 4 AN SAL AN ONE iii it at a nae EAE nae ee ea S 4 4 1 CONVERTER CONNECTION TO RS 232 INTERFACE OF DEVICE cccc ccc cc ccc cccc
7. cccccccccccceucueucceuaccuuaueuucueceuucueuusuececueeueunansnneas 4 4 2 CONNECTION CONVERTER TO COMPUTER USB INTERFACE cc ccccccccccccccceccaccccacsacenuacenuacacacuacanuatancaueanaeuacnuansuaceuaass 5 4 3 POWER SUPPLY ccc ccc cece cece cccccccccccccccccuucucacuuucucuuceuauceuusuucucuucucaunuuausuusuuauauuceuuuausuuducaeauecusuudueuusuuceauuausuuseeueuuucuauuausuunuuueunneunenuuneas 5 DRIVERS INSTALLATION IN SYSTEM WINDOWS uu ccc ccccccccccccccccccccccucccccccuccueuuccuuecuucuuuucucuusuuaucuuausuusueueuuucusuuausnusucuecuucusuuaueuusuecesueauens 5 5 1 EXAMPLE DRIVER INSTALLATION IN WINDOWS 7 SYSTEM c ccccccccccccccccccccccccucucuucccuucuucusuuausuuaucavauvausuucueueaueeuueeuuuuaunnenens 5 DRIVER UNINSTALLATION c ccccccccccccccccccccccuccccccuuuucuccuuuceuauuuucuuuucueaenuususuuceeuecuuauaueauauusucauauusuauusecuecuucusuuausnuseuuunucusuuseeuuuuecesunansnnas 11 6 1 DRIVER UNINSTALLATION IN WINDOWS 98 ME SYSTEMS ccccccccccccccccccccccccuceucuucccuucucccuuuaucuuauceuuvausuvseeuuenunuunsunenuueneunss 11 6 2 DRIVER UNINSTALLATION IN WINDOWS 2000 XP 2003 VISTA 7 2008 SYSTEMS cccccccccccecccccccecccccuccucccuuauecuueucueuuunenaes 12 6 2 1 EXAMPLE DRIVER UNINSTALLATION IN WINDOWS 7 SYSTEMS cc ccccc cece cc ccccccccccccccccccccucuucccuucuecuuuucusuuseucuneunenuunnas 12 6 3 EMERGENCY DRIVER UNINSTALLATION 2cccccccccsccccacsacecccccceaccauaccccacusceceaneauacuacacuacanuacucuacuscesanuauacucu
8. ecuaceaueteauacuscusauness 13 6 3 1 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS 98 ME 2000 ccccccccccccccccccccuccccccuccucuucccuueuueusueuccuneunenuuneas 13 6 3 2 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS XP 2003 Vista 7 2008 c ccccccccccccccccccccceucuucccuueucauenuenuuueas 13 e IN ea it a ie ta e EEE Tet On PO eae a a a e a ea Ree ke a a e te a 13 7 1 BAUD RATE SELECTION FOR PROFIBUS COM PORT el eletteeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeseaeeeeoseseoeueeoeeaeooeenasenseene 13 7 2 SELECTION OF COM PORT GREATER THEN COM tet etetteeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeaeeoeeeeeeaeeeeeoeoeeeeeeeoeeoeoeaaeeoeaenaeenaeeen 13 RS232 INTERFACE PIN DESCRIPTION OF D SUB9 MALE SOCKET c ccccccccccc ccc cccccccccccececcuaccuucueuucuceuuucusuusueuecuvauenucunecunenans 13 SEEGIFICA TIC rite r t pv seer soca dessa is lab k1 st aka a utente beans atest nts et a n e tan a it a ered n a an tn dined ok alte ead tag ates auc re 14 ADA 19111 CEL MAR Zaktad Informatyki i Elektroniki 1 GENERAL INFORMATION Thank you for your purchase of CEL MAR Company product This product has been completely tested and is covered by a two year warranty on parts and operation from date of sale If any questions or problems arise during installation or use of this product please do not hesitate to contact Technical Support at 48 41 362 12 46 or e mail supportQcel mar pl 1 1 WARRANTED INFORMATION The ADA I9111 conve
9. ent eeeeree sales cel mar pl Technical information support cel mar pl 14
10. er can be configured by the use TOG switch Fig 1 to operation with automatic data flow control RTS TOGGLE type or without control Using the control RTS TOGGLE type to ADA I9111 can be connected RS232 to RS485 RS422 converter which doesn t have the data flow control circuit It s allows correct operating on 2 wires RS 485 bus control operation of the 485 transmitter using the RTS signal from ADA 19111 Options TOG Switch are described in the Table bellow TOG Switch Description ON Operating of RTS line in RTS TOGGLE mode of RS232 interface of ADA 19110 OFF Standard operating of RTS line RS232 interface of ADA 19110 A ADA I9111 ADA E 5 x oa RX a l M vy Vv m E 2250 mm A a ADA I9111 ADA x RX e OFF ON Fig 1 ADA I9111 view 4 INSTALLATION This chapter will show you correctly connection of the ADA I9111 to USB and RS 232 interface 4 1 CONVERTER CONNECTION TO RS 232 INTERFACE OF DEVICE Connection should be done in use of shielded cable RS232 extender ended DB 9M male plug max lengths up to 15m DTR 6 non CIS7 me RIS 8 mo 5GND lt ww Fig 2 Signal configuration of RS 232 interface in converter DB 9M mail connector CEL MAR Zaktad Informatyki i Elektroniki ADA 19111 Device with RS 232
11. ge CEL MAR ADA Virtual USB Serial Port AF7MNA2ARAM CEL MAR enn knn Uninstal Change DE ADi CEL MAR Product version 10 22 2009 2 06 00 e press Uninstall Change Virtual USB Serial Port driver will be uninstalled f select from the list Windows Driver Package CEL MAR ADA USB Serial Converter Control Panel Home ae Uninstall or change a program View installed updates To uninstall a program select it from the list and then click Uninstall Change or Repair E Turn Windows features on or si Organize Uninstall Change hd e m Name Publisher Ew Windows Live Essentials 2011 Uninstall Change 4 Th Fa a i ADA CEL MAR Product version 10 27 7009 2 06 00 g press Uninstall Change driver converter of USB Bus will be uninstalled h after uninstallation reboot the computer 12 ADA 19111 CEL MAR Zaktad Informatyki i Elektroniki 6 3 EMERGENCY DRIVER UNINSTALLATION lf there are problems with correct operation of drivers or converter and or on computer was installed driver other devices this type you can use special software form delivered CD ROM to clean the system form files and entries in the system registry This can be done after uninstallation descried in point 6 1 and 6 2 6 3 1 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS 98 ME 2000 Emergency driver uninstallation in Windows 98 ME 2000 system have to be done according follow steps a disconnect converter from co
12. he details press the Tooltip and will appear information window where you can see which COM port was assigned to converter Driver Software Installation Your device is ready to use ADA USB Serial Converter wf Ready to use ADA USB Serial Port COMMS A Ready to use After this installation RS232 port of ADA 19111 converter is available in the system as normal COM port You have to remember about specified baud rate for communication lf during installation you selected driver for Standard baud rates you would be able to use 300 bps 600 bps 1200 bps 2400 bps 4800 bps 9600 bps 19200 bps 38400 bps 57600 bps 115200 bps 230400 bps 460800 bps 921600 bps lf during installation you selected driver for Profibus baud rates you would be able to use 300 bps 600 bps 1200 bps 2400 bps 4800 bps 9600 bps 19200 bps 9375 Obps if you select 230400bps 187500 bps if you select 460800bps 500000 bps if you select 921600bps 6 DRIVER UNINSTALLATION 6 1 DRIVER UNINSTALLATION IN WINDOWS 98 ME SYSTEMS In this system driver uninstallation have to be done according follow steps a disconnect converter from computer b select menu Start gt Setting gt Control Panel gt Add gt Remove Programs c select from the list ADA USB Serial Converter Driver and press Change Remove e reboot the computer 11 ADA I9111 CEL MA R Zak ad Informatyki i Elektroniki 6 2 DRIVER UNINSTALLATION IN WINDOWS 200
13. insert the CD ROM to optical driver of the computer b the installation wizard will run automatically if not double click ADAUSBDRV exe c following the steps of installation wizard will be installed the Drivers and Uninstaller for the Windows systems 98 ME 2000 XP 2003 Vista Win7 2008 d connect the convert to USB port of computer and follow the steps of installation wizard 5 1 EXAMPLE DRIVER INSTALLATION IN WINDOWS 7 SYSTEM Together With ADA I9111 converter is delivered CD ROM with drivers for the system Windows 98 ME 2000 XP Vista 7 2008 for the baud rates al Standard b Profibus Driver installation have to be done from the account with Administrator permissions For the Drivers installation in Windows 7 system follow the steps bellow a insert the CD ROM to optical driver of computer b the installation wizard will run automatically if not double click ADAUSBDRV exe form the CD ROM After running the installer the wizard installation window will appear ADA 19111 CEL MAR Zak ad Informatyki i Elektroniki Welcome to the ADA USB Package Virtual Serial Ports Drivers for Windows Setup Wizard This will install ADA USB Package Virtual Serial Ports Drivers for Windows version 2 06 00 on your computer Itis recommended that you close all other applications before continuing Click Next to continue or Cancel to exit Setup Press Next FE Setup ADA USB Package Virtual Serial Ports Drivers for Wind
14. mputer b from CD ROM delivered with converter copy to hard disk the folder Windows Win 98ME_1 09 06 FTClean for Windows 98 ME or Windows Win 2000 FTClean for Windows 2000 c from FTClean folder run the application FTClean exe and follow the Tooltip d after finishing reboot the computer 6 3 2 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS XP 2003 Vista 7 2008 Emergency driver uninstallation in Windows XP 2003 Vista 7 2008 system have to be done according follow steps a disconnect converter from computer b login the Administrator account c from CD ROM delivered with converter copy to hard disk the folder Windows Win XP 2003 Vista 7 2008_2 06 CDMUninstaller d from CDMUninstaller folder run the application uninstall bat e after finishing reboot the computer 7 USING After property connection according to section above you can start using the converter During the data transmission LEDs should blink they indicate appropriately Tx yellow Transmitted Data form the ADA I9111 via RS 232 port to the RS 232 Device Received Data from the RS 232 Device connected to RS232 converter port LED ON status signal equal 1 logical LED OFF status signal equal 0 logical 7 1 BAUD RATE SELECTION FOR PROFIBUS COM PORT For setting correct Profibus baud rate after installation Virtual Port driver for Profibus in application using virtual port COM follow table below Set baud rate bps Actual ea bps 230400 9375
15. n or make holes in casings of the device Do not immerse device in water or no other liquid Do not put the fire opened on device sources candles an oil lamps and the like Complete disable from the supply network is only after disconnecting the power supply circuit voltage Do not carry out the assembly or disassembly of the device if it is enabled This may result to short circuit and damage the device 1 3 CE LABEL The CE symbol on the device CEL MAR means compatibility with electromagnetic compatibility Electromagnetic Compatibility Directive EMC 2004 108 WE Declaration of Conformity is available by contact with Technical Service email support cel mar pl phone 48 41 362 12 46 1 4 ENVIRONMENTAL PRESERVATION This sign on the device inform about putting expended device with other waste materials Device should send to the recycling In accordance with the act about the Electronic Appliance Expended from day 29 of July 2005 1 5 SERVICE AND MAINTENANCE The ADA I9111 converter does not require the servicing and maintenance Technical support is available at number 48 41 362 12 46 in 8 00 16 00 from Monday to Friday or e mail supportQcel mar pl 2 PRODUCT INFORMATION Converter is delivered with user manual CD ROM with software 2 1 PROPERTIES Conversion of USB to RS 232 standard Compliant with USB1 1 and USB 2 0 standard Baud rate bps 300 600 1200 2400 4800 9600 19200 38400 57600 115200 230400 460800
16. ompatibility Resistance to disruptions according to the standard PN EN 55024 Emission of disruptions according to the standard PN EN 55022 Safety requiring According to the PN EN60950 norm Environment Commercial and light industrial CASING Dimensions W x D x H 55 x 24 5 x 31 mm Material ABS Degree of casing protection IP20 Weight 0 05 kg CONDITIONS OF STORING AND TRANSPORTATION Storage temperature 20 70 C Humidity 5 95 non condensing Dear Customer Thank you for purchasing CEL MAR Company product We hope that the ADA 19111 converter and this user manual help simplify your network of 1 Wire sensor for industrial applications We also wish to remind you that CEL MAR Company are a manufacturer of the widest selections of data communications products in the world in applications such as data transmission converters in RS232 RS485 RS422 USB Current Loop Fibre Optic and Ethernet Converters and many others We welcome your feedback so please contact us to tell how you like our products and how we can satisfy you present and future needs CEL MAR spj Zak ad Informatyki i Elektroniki str ciegiennego 219C 25 116 Kielce POLSKA JE SEEE EE EEE 48 41 362 12 46 TEAK eni as bk n 48 41 361 07 70 VA CO raat anne tl e kat por ei tite po pis ate http www cel mar pl en Office cece ceeecesseesssseessseessseeesseee OffiCe e cCel mar pl Sales departm
17. our ADA device The divers were successfully installed on this computer You can now connect your device to this computer f your device came with instructions please read them first Driver Name Status sw CEL MAR ADA USB Seral Converter 1 Ready to use sw CEL MAR ADA Virtual USB Seral Fot Ready to use 4 1 Completing the ADA USB Package Virtual Serial Ports Drivers for Windows Setup Wizard Setup has finished installing ADA USB Package Virtual Serial Ports Drivers for Windows on your computer Click Finish to exit Setup The driver for ADA I9111 have been installed This can be checked in Uninstall or change a program 10 ADA 19111 CEL MAR Zak ad Informatyki i Elektroniki A ah ira Control Panel Programs Programs and Features Control Panel Home Uninstall or change a program View installed updates To uninstall a program select it from the list and then click Uninstall Change or Repair a Turn Windows features on or 4 Organize Uninstall Change Name Publisher A Windows Driver Package CEL MAR ADA USB Serial Converter 10 22 2009 2 06 00 CEL MAR 7 AB Windows Driver Package CEL MAR ADA Virtual USB Serial Port 10 22 2009 2 06 00 CEL MAR 4 a nm j 1 a i CEL MAR Product version 10 22 2009 7 06 00 Now you can connect ADA 19111 to computer port After connection will appear the Tool tip with Your device is ready to use To see t
18. ows Select Components Which components should be installed Select the components you want to install dear the components you do not want to install Click Next when you are ready to continue ro STANDARD Drivers for Windows XP 2003 Vista 7 2008 3 0 MB PROFIBUS Drivers for Windows XP 2003 Vista 7 2008 Current selection requires at least 5 4 ME of disk space Select STANDARD Drivers and press Next CEL MAR Zak ad Informatyki i Elektroniki ADA 19111 Ready to Install Setup is now ready to begin installing ADA USB Package Virtual Serial Ports Drivers for Windows on your computer Click Install to continue with the installation or dick Back if you want to review or change any settings setup type Instalation of Package ADA USB Virtual Serial Ports Drivers Selected components STANDARD Drivers for Windows XP 2003 Vista 7 2008 Press Install Ve Setup ADA USB Package Virtual Serial Ports Drivers for Windows he Please wait while Setup installs ADA USB Package Virtual Serial Ports Drivers for Windows on your computer Finishing installation a Welcome to the VCP Driver Installer This wizard will install VCP drivers for your ADA USB device girer Sar pe To continue click Next 2 Back Press Next will be installed Drivers for USB Bus ADA 19111 CEL MAR Zak ad Informatyki i Elektroniki VCP Driver Installer Installing the software for your ADA USB
19. rter is covered by a two year warranty from date of sale In case of being damaged it will be repair or the damaged component will be replace The warranty does not cover damage caused from improper use materials consumption or any unauthorized changes If the product does not function is damaged or not operate in accordance with the instructions will be repaired All warranty and no warranty repairs must be returned with paid transport and insuring to the CEL MAR Company CEL MAR Company under no circumstances won t be responsible for ensuing damage from improper using the product or as a result of random causes the lightning discharge the flood the fire and the like CEL MAR Company is not be held responsible for damages and loss including loss of profits loss of data pecuniary losses ensuing from using or the impossibility of using this product In specific cases CEL MAR Company discontinue all warranties and in particular do not follow the user manual and do not accept terms of warranty by the user 1 2 GENERAL CONDITIONS FOR SAFE USE The device should be installed in a safe and stable places eg electroinstallation cabinet the powering cable should be arranged so as not to be exposed to trampling attaching or pulling out of the circuit Do not put device on the wet surface Do not connect devices for nondescript powering sources Do not damage or crush powering wires Do not make connection with wet hands Do not adapt ope
Download Pdf Manuals
Related Search