Home

Catch a Predator Kit I

image

Contents

1. source temperature incorrect 37 degrees Celsius Shorter times should work but if you re having trouble Incubation time too short increase the incubation times Weak bands faint signal Light sensitive dyes should be kept in the dark during gel DNA Dye degradation during preparation Prepare in dark room or place a box over the preparaugn electrophoresis apparatus during gelation and electrophoresis Expired contaminated or degraded vemyanat ine PNA Ge Mas net degraded in storage been DNA dye contaminated or expired Animal Identification Catch a Predator Kit GenoSensor Corp Technical Service For more information or technical assistance please call write fax or email GenoSensor Corporation 4665 S Ash Avenue Suite G 18 Tempe Arizona 85282 Tel 1 480 598 5378 Fax 1 480 755 3319 Email tech serviceGenoSensorcorp com Web www GenoSensorcorp com Limited Warranty GenoSensor is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 10096 satisfied with our products and our service If you should have any questions or concerns about a GenoSensor product or service please contact our Technical Service at tech service GenoSensorcorp com GenoSensor warrants that all of its products will perform according to the specifications stated on the certificate of analysis This warranty limits GenoSensor Corporation s liabilit
2. A to break within the recognition site and the DNA molecule becomes fractured into two pieces These molecular scissors or cutting enzymes are restriction endonucleases The two endonucleases you are going to use today are called EcoRI and Sspl The following figure depicts the recognition site of Animal Identification Catch a Predator Kit GenoSensor Corp these endonucleases Since each individual s DNA is unique the fragmented DNA profile created by these two enzymes will be different for each person much like cutting out a paper snowflake EcoRI 5 GAATTC 3 REI C AATTC 3 3 CTTAAG 5 3 CTTAA Gina EcoRI Sspl T 5 AATATT 3 i 5 AAT ATT 3 3 TTATAA 5 J ind d TAA 23 Sspl In order to compare each of the possible predators with the Unknown sample responsible for the disappearance of the rancher s livestock we have to be able to separate out these DNA fragments and take a look at them This can be accomplished through agarose gel electrophoresis which uses a matrix within an electric field to separate the various segments of DNA Since DNA is negatively charged when it is placed in an electric field it will migrate from the cathode to the anode negative side to positive side The smaller fragments will migrate faster than the larger fragments By staining the DNA with a special chemical and viewing it under a UV light the DNA fragments which are seen as bands
3. G GenoSensor Corporation eee GenoSensor Animal Identification Catch a Predator Kit Catalog 7005 Version B July 2015 User s Manual GenoSensor Animal Identification Catch a Predator Kit Manual Table of Contents Notes for INStruClors mc C 2 Shipping Storage and Safety ccce 3 GenoSensor Animal Identification Catch a Predator Kit Overview 4 Kit Components and Storage Conditions ccccccccccessssssssecececessesecnsaeeeeeceseeesaeaeeeescesseseaaeaeeeeseesseseaeaeeeesens 4 Additional Required Materials eret eter rere ed ae ee edere gg 4 graue 5 F ll Proto COU e 8 Preparation 5 ere ek veces eee RAG Wohi Ree RAK Ro et E 8 Reagent Preparation Aiki kw bikes dine i a eu ds Maa ee nes 8 Restriction Digest Protocol b eee reve xe eon oa ed savcnnnetadssddvuaveetueGeisdesvuavensctantsderes 8 Agarose Gel Electrophoresis snan ith e rei te ER ER Rea eee e rede Re ue 9 Results and DISCUSSION 5 eile Torte eee t THERE P Un pea e ER e PaL Fete aer E n ts 12 Troubleshooting ee 14 iizegdpcibadj e cn 15 Literature Citation When describing a procedure for publication using these products please refer to them as the GenoSensor Animal Identification Catch a Predator Kit I Animal Identification Catch a Predator Kit GenoSensor Corp Notes for Instructors Kit Components and Storage Condition
4. become visible This allows us to analyze the differences and or the similarities between the band s for each suspected predator Remember that the DNA profile for each predator will have different sizes and numbers of DNA fragments that are cut by the same restriction endonucleases Therefore the differences between each of them will be characterized by the separation patterns of the bands seen in the gel Animal Identification Catch a Predator Kit GenoSensor Corp Pre lab questions 1 Describe how digesting DNA with enzymes allows scientists to differentiate organisms using their DNA 2 Inthis lab we will use small pieces of DNA instead of complete chromosomal DNA to simplify the DNA profile of each organism If all of the chromosomal DNA in one cell 3 billion base pairs bp is cut into 4000 bp pieces how many DNA pieces will be created 3 Below is an example of a gel electrophoresis of 6 different DNA profiles Which profiles seem to come from the same organism Justify your answer 5 9 uou ze 2d A lt lt Z Z anon DNA Profile 2 DNA Profile 3 DNA Profile 4 DNA Profile 5 DNA Profile 6 4 Predict several problems that could occur and explain how they would interfere with the production of an accurate DNA profile digestion and gel Animal Identification Catch a Predator Kit GenoSensor Corp Full Protocol Lab Setting Materials are enough for 6 groups Reagent Preparation Refer to Notes for Ins
5. cation Catch a Predator Kit introduces common techniques used in DNA research and in forensic analysis The kit creates a scenario in which a cattle rancher is losing his calves to an unknown predator and needs help identifying it so that he can stop his livestock from going missing During his investigation he found a bit of hair caught on a fence near his cattle enclosure The hair sample collected from the suspected predator is labeled Unknown Sample and it is represented by a plasmid A wildlife manager has narrowed the hair specimen down to three likely predators that are known to attack cattle They are labeled Sample A B and C and are represented by three different plasmids One of the samples will match the unknown predator sample The goal of the experiment is to identify which of the samples matches the unknown This is achieved by performing restriction digests with two restriction enzymes EcoRI and Sspl on the four samples After completing the experiment students will understand the concepts behind restriction digestion gel electrophoresis and the genetic concepts driving the experiment Kit Components and Storage Conditions For 6 teams Component Amount 24 rxns Storage 2X Res Dig Master Mix 240 uL 20 C Sample A 60 uL 6 rxns 20 C Sample B 60 uL 6 rxns 20 C Sample C 60 uL 6 rxns 20 C Unknown DNA 60 uL 6 rxns 20 C DNA ladder 30 uL 20 C Additional Required Material
6. e agarose gel If gel well volume will accommodate more than 10 uL a higher volume is preferred Sample Gel Loading Setup Digested DNA Samples Loading Mix Total Volume Unknown DNA D 20 uL 5 uL 25 uL Sample A A 20 uL 5 uL 25 uL Sample A B 20 pL 5 uL 25 uL Sample A C 20 uL 5 uL 25 uL DNA Ladder 10uL 5 Load samples with loading dye into the gel Record which wells hold which samples Recommended Gel isis Load two teams gel TTT Animal Identification Catch a Predator Kit GenoSensor Corp TT Run at 120V for 30 minutes and stop before loading dye runs off of gel Depending on the DNA dye used caution may need to be taken to reduce exposure of gel to light 7 Visualize under UV light exposure and record the results manually or by photography 8 Compare the bands The DNA ladder can be used as a band size reference Part 2 Questions While waiting for your samples to electrophorese answer these questions with your group members 1 The electrophoresis apparatus creates an electrical field with positive and negative poles at the ends of the gel DNA molecules are negatively charged To which electrode pole of the electrophoresis field would you expect DNA to migrate 2 After the DNA samples are loaded into the sample wells they are forced to move through the gel matrix at different speeds What size fragments large vs small would you expect to move toward the opposite end of
7. e to continue store samples 4 C until following lab period Part 1 Questions While waiting for the samples to be digested by the endonucleases answer the following questions 1 After combining the 2x Res Dig mix with the DNA samples was there any visible change or any sign of reactivity 2 Was there any evidence indicating that your samples of DNA were fragmented or altered in any way by the addition of the endonuclease mix Explain Animal Identification Catch a Predator Kit GenoSensor Corp 3 In the absence of any visible evidence of change is it still possible that the DNA samples were fragmented Explain 4 After the incubation period are there any visible clues that restriction enzymes altered the DNA in any of the tubes Explain Part 2 Agarose Gel Electrophoresis Protocol General Procedure detailed directions given by instructor 1 Prepare 196 agarose 2 For staining use a DNA dye which is added directly to the molten agarose For light sensitive dyes keep the gel in the dark during gelation This can be done by performing in a dark room or placing a box over the gel 3 Set up electrophoresis apparatus and pour in the 196 molten agarose with DNA dye for gelation 4 Mix sample with loading dye according to instructor directions to ensure that the sample will sink to the bottom of the well and properly enter the agarose gel Use at least 10 uL of digested DNA product to visualize results on th
8. lts from your team with those of other teams Describe similarities and differences Summarize the process of DNA digestion using restriction enzymes and DNA gel electrophoresis using the correct terminology Describe a new experiment you could perform using the DNA restriction enzyme digestion method and agarose gel electrophoresis Final Conclusions 1 Is there evidence that the hair sample matches a known predator species 2 Describe the evidence that supports your accusation 3 Is it possible that the identified predator is not killing the calves Justify your explanation 4 What further tests could be performed to support your claim Animal Identification Catch a Predator Kit GenoSensor Corp 12 What are some other ways ranchers may use digestion in the identification of animals What are some common predators of livestock in your state In the US Cite your sources What are some methods of legally reducing the effects of predators on livestock Cite your sources Animal Identification Catch a Predator Kit GenoSensor Corp Troubleshooting Problem Possible causes Solutions Incomplete or no digestion of DNA It s vital that the Master Mix be properly thawed spun down PARS DNE Moret QGHDHOp Orr and vortexed before use to Bee ensure the enzyme and all components are properly mixed i Be sure the heat source used Heat block Water bath Heating ix for incubation has stabilized at
9. nucleotides purines and pyrimidines Adenine A and Guanine G are both purines because they have two rings in their structures Meanwhile Thymine T and Cytosine C are pyrimidines because they have only a single ring in each of their structures These nucleotides form a bond with their complementary base pair on the other strand of DNA This is how the double helix structure is formed that resembles a spiral staircase In a DNA molecule A is paired with T and G is paired with C to form the double helix structure Each individual will have different sequences of A T G and C in their DNA There are highly similar and yet unique sequences of DNA that are used to identify humans by looking at the minute differences in their DNA In this exercise you will use several techniques to figure out if the DNA in any of the three samples matches up with the DNA of the unknown sample Due to the vast size of the human genome scientists have had to find several ways to fragment the DNA into smaller pieces so that they can work with it more easily One of these techniques is to use restriction enzymes In 1968 Dr Werner Arber at the University of Basel Switzerland and Dr Hamilton Smith at the Johns Hopkins University Baltimore discovered a group of enzymes in bacteria that when added to any DNA will break the sugar phosphate backbone bond within a specific sequence of nucleotide bases called a recognition site These enzymes cause the double strand of DN
10. s Component Storage 2X Res Dig Master Mix 20 C Sample A 20 C Sample B 20 C Sample C 20 C Unknown DNA 20 C DNA ladder 20 C Preparation for Restriction Digest for 6 teams 1 4 5 Set heat block or water bath to 37 C For a heat block it is recommended to add water or sand to ensure proper heat transfer For a water bath be sure tubes are tightly sealed and not fully submerged to avoid contamination Thaw 2x Res Dig Master Mix on ice Before opening tube spin 10 sec at 6 000 rpm or greater in a microcentrifuge Vortex 10 seconds then spin again for 10 seconds Label 6 tubes MM and aliquot 40uL of 2X Res Dig Master Mix into each tube store on ice Label 6 tubes each 24 total A B C U and aliquot 10uL of each DNA sample store on ice In class distribute 1 each MM A B C U tube team Each package contains enough 2X Res Dig Master Mix for 24 digest reactions sufficient to cover all of the samples provided in the kit Students will use 10 uL of 2X Res Dig Master Mix with 10 uL sample DNA for a total reaction volume of 20 uL Electrophoresis Electrophoresis reagents are not provided in the kit Please refer to the Additional Required Materials list on page 4 Best results are obtained by adding DNA dye i e Gel Red or Sybr Safe to molten agarose For light sensitive DNA dyes avoid exposing the agarose gel to light It is best to store and run
11. s e Heat Block or heat plate Beaker with de ionized water water bath Tube floater Thermometer Microcentrifuge Microcentrifuge tubes 30 Vortexer Micropipettes p10 p100 Pipette tips Tube Racks Electrophoresis equipment gel box amp power source Electrophoresis supplies agarose TBE DNA loading buffer running buffer gel dye e g SYBR safe Gel Red UV light box or Gel Doc equipment and program e Permanent marker Animal Identification Catch a Predator Kit GenoSensor Corp Student Guide Objective overview 1 Understand how DNA is responsible for genotypic differences between the predacious animals of interest 2 Investigate techniques used in DNA technology DNA sequence diversity and uniqueness DNA digests restriction enzymes and gel electrophoresis 3 Investigate and understand the process for gel electrophoresis including analyzing data In this lab you will examine an abridged version of a DNA digestion process During the exercise you will learn to analyze and compare a number of DNA fragments to determine whether or not they are from the same predacious animal These fragments can be visualized through a process known as gel electrophoresis DNA is a long double helix polymer that uses deoxyribose rings sugars and phosphate molecules as support in its backbone Attached to the backbone are unique sequences of nucleotides which are often referred to as base pairs There are two different types of
12. the gel and travel a longer distance most quickly Explain 3 What do you see moving through the gel Tricky question 4 The sequence of a DNA fragment is shown below Use it to answer the following questions 5 GTGAATTAATATTAAATATTGGGAATCCTTGGGAATTCGTACA 3 3 CACTTAATTATAATTTATAACCCTTAGGAACCCTTAAGCATGA 5 a How many EcoRI and Sspl restriction sites are there in the sequence b How many pieces of DNA would result from cutting this DNA fragment with EcoRI alone Sspl alone Both EcoRI and Sspl together Animal Identification Catch a Predator Kit GenoSensor Corp 10 c Write out the sequences of the possible DNA fragments from an EcoRI cut alone and indicate their sizes Draw them on a gel to indicate where you expect them to be after electrophoresis Animal Identification Catch a Predator Kit GenoSensor Corp Base Pairs Mass ng 1 517 45 1 200 35 1 000 95 900 27 800 24 700 600 18 500 517 Fig 1 100 bp DNA Ladder DNA Ladder reference Results and Discussion Take a look at the bands visible from your samples on the gel Refer to your gel map to identify which lanes contained the samples and which contained the unknown DNA sample Do any of the samples match with the unknown DNA sample on the gel Looking at the bands in relation to one another is quick and useful but what would be a more accurate way to infer band size the distance traveled Hint DNA ladder Compare the resu
13. the gel in a dark room or cover the gel with a box during gel polymerization and the whole electrophoresis process DNA ladder supplied is enough to load 3 lanes with 10 uL each Animal Identification Catch a Predator Kit GenoSensor Corp Shipping Storage and Safety Shipping and Storage GenoSensor Animal Identification Catch a Predator kits are shipped on dry ice Components should be stored at temperatures shown in the table above At proper storage conditions components are stable for 1 year from the date received Expiration dates are also noted on product labels Safety Warnings and Precautions This product is intended for research use only It is not recommended or intended for the diagnosis of disease in humans or animals Do not use internally or externally in humans or animals Consider all chemicals as potentially hazardous Only persons who are trained in laboratory techniques and familiar with the principles of good laboratory practice should handle these products Wear suitable protective clothing such as laboratory coats safety glasses and gloves Exercise caution to avoid contact with skin or eyes if contact should occur wash immediately with water and follow your laboratory safety protocols Safety Data Sheets for products are available upon request Animal Identification Catch a Predator Kit GenoSensor Corp GenoSensor Animal Identification Catch a Predator Kit Overview The GenoSensor Animal Identifi
14. tructors Preparation for Restriction Digest on Page 2 Pre Experiment Observations 1 Describe the DNA samples physical properties color viscosity etc Can you see the DNA 2 ls there any observable difference between the samples of DNA 3 Describe the appearance of the 2X Res Dig Master Mix Can you see the enzymes Part 1 Restriction Digest Protocol Keep the master mix all samples and reaction mixtures on ice when not in use 1 Using a NEW pipette tip for each sample pipette 10 pL of the 2X Res Dig Master Mix which contains the restriction enzymes Sspl and EcoRI along with the restriction digest buffer into each of the four DNA sample tubes labeled A B C and U already containing 10 uL of each DNA Restriction Digest Reaction Mixtures DNA Samples 2X Res Dig Master Mix Total Reaction Volume Unknown DNA U 10 uL 10 uL 20 uL Sample A A 10 uL 10 uL 20 uL Sample B B 10 uL 10 uL 20 uL Sample C C 10 uL 10 uL 20 uL 2 Carefully pipette the mixture up and down to mix thoroughly Tightly cap each tube Alternatively mix the components by gently flicking the tubes with your finger Arrange the tubes in a microcentrifuge machine and spin for 5 seconds to force all liquid to the bottom of the tubes Be sure the tubes are in a BALANCED arrangement in the rotor 3 Incubate the tubes at 37 C for 45 minutes in a water bath or heat block 4 STOPPING POINT If there is no tim
15. y only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions GenoSensor reserves the right to select the method s used to analyze a product unless GenoSensor agrees to a specified method in writing prior to acceptance of the order GenoSensor makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore GenoSensor makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service GenoSensor assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Animal Identification Catch a Predator Kit GenoSensor Corp 15

Download Pdf Manuals

image

Related Search

Related Contents

Smart Phone Monitor Software User`s Manual  

Copyright © All rights reserved.
Failed to retrieve file