Home

Trimmer-2 manual

1. 10X reaction buffer e Encyclo PCR Kit Evrogen Cat PKOO1 or analogues e QlAquick PCR Purification Kit Qiagen e Sterile molecular biology grade water sterile RNase free water e Agarose gel electrophoresis reagents e DNA size markers 1 kb DNA ladder Amplification of ds cDNA Note The following protocol describes second PCR amplification of nor malized cDNA in a single reaction with total volume of 100 UL The resulting amount of ds cDNA per reaction is anticipated to be in a range of 1 5 2 ug 15 ng uL In order to obtain higher amounts of the product the reaction volume or number of reactions can be increased accordingly www evrogen com 39 Appendix F 1 Combine 2 uL of normalized cDNA from step 42 of the Normaliza tion protocol and 20 uL of sterile RNAse free water in a newsterile 1 5 mL tube mix well by vortexing and spin the tubes briefly in a microcentrifuge Note If the normalized cDNA samples were stored at 20 C pre heat them at 65 C for 1 min and mix by gently flicking the tubes before taking aliquots Store the remaining cDNA at 20 C For each cDNA sample from step 1 above prepare a PCR mixture by combining the following reagents in the order shown 160 UL Sterile RNase free water 20uL 10X Encyclo buffer 4 uL 50X dNTP mix LOmM each 8 UL PCR primer M1 10 uM 4 uL Diluted normalized cDNA from step 1 above 4 uL 50X Encyclo polymerase mix 200 uL Total volume Mix the c
2. Optimize the PCR parameters and repeat the PCR using a fresh aliquot of first strand cDNA Optimization of PCR parameters may include a decreasing the annealing temperature in in crements of 2 4 C b optimizing the denaturation temperature by decreasing or increasing it in 1 C increments and or c increasing the extension time in 1 min increments If experimental RNA samples were isolated from non mammalian species the seemingly trun cated PCR product may actually have the size distribution normal for that species For exam ple for insects the normal RNA size distribution may be less than 2 3 kb Gel analysis reveals that the concentration of the PCR product is low but the quality is good Possible cause Solution PCR undercycling may have resulted in a low yield of PCR product Subject the samples to two or three additional PCR cycles plus one extra final extension cycle and recheck the products If a low yield of PCR product is still observed this could indicate a low yield of first strand cDNA continued on next page Trimmer 2 cDNA normalization kit XI Troubleshooting Possible cause Solution Repeat the experiment using more RNA Note samples obtained after more than 25 PCR cycles We do not recommend that you use cDNA because these samples may be not representative The starting RNA concentration may have been low Even if the total RNA concentration a
3. Optionally 0 5 pL of RNase inhibitor 20 U uL can be added to the reaction to prevent RNA degradation during cDNA synthesis Gently pipette the RT master mix and spin the tube briefly in a mic rocentrifuge Add 5 uL RT master mix to each reaction tube from step 5 Gently pipette the reaction mix and spin the tubes briefly in a microcentri fuge to deposit contents at the bottom Note Do not remove the reaction tubes from the thermal cycler ex cept for the time necessary to add the RT master mix Incubate the tubes at 42 C for 1 5 h After incubation place the tubes on ice to terminate the first strand cDNA synthesis Trimmer 2 cDNA normalization kit Appendix A First strand cDNA can be stored at 20 C for up to one month and used for ds cDNA amplification cDNA amplification 11 For each first strand cDNA sample from step 10 above prepare a PCR mixture by combining the following reagents in the order shown 80 UL 10 UL 2 uL 4 uL 2 uL 2 uL Sterile RNase free water 10X Encyclo PCR buffer dNTP mix 10mM each PCR primer M1 10 uM First strand cDNA from step 10 50X Encyclo polymerase mix 100 uL Total volume The component is provided in the Encyclo PCR kit Note If the first strand cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining first strand cDNA at 20 C 12 Mix t
4. PCR Normalized cDNA can then be used for library cloning or sequencing cDNA suitable for normalization can be prepared on the basis of total or poly A RNA and should contain known adapter sequences at both ends for PCR amplification The quality of the RNA is crucial especially phage A DNA phage M13 DNA lall ii Fig 2 Action of DSN on ss DNA of phage M13 and ds DNA of phage A Lanes 1 2 negative controls incubation without nuclease 1 phage M13 DNA alone 2 mixture containing phage M13 and lambda DNA Lanes 3 4 digestion of phage M13 and lambda DNA mixture by DSN at 70 C for 1 5 min 3 and 5 min 4 www evrogen com a Il Method overview La o o Digestion efficiency 3 T T T T T 20 40 60 80 100 Temperature C Activity e o o 507 incubated at 60 C e incubated at 70 C incubated at 80 C i ee a re E incubated at 90 C 10 20 30 40 50 Time min Fig 3 Dependence of the DSN activity and stability on temperature A Effect of tem perature on the DSN activity Activity of DNAse on ds DNA substrate was measured using modified Kunitz assay 7 at different temperatures B Effect of temperature on the DSN stability DSN was incubated at different temperatures for 30 min Activity of DNAse on ds DNA substrate was measured at 65 C using modified Kunitz assay when construction of full length enriched cDNA library is a goal The flankin
5. at 20 C 2 For each cDNA sample from step 1 above prepare PCR mixture combining the following reagents in the order shown 160 uL Sterile RNase free water 20uL 10X Encyclo buffer 4 uL 50X dNTP mix LOmM each 8 uL PCR primer M1 10 uM 4 uL Diluted normalized cDNA from step 1 above 4 uL 50X Encyclo polymerase mix 200 uL Total volume 3 Mix the contents by gently flicking the tube Spin the tube briefly in a microcentrifuge 4 Aliquot 100 uL of PCR mixture into two sterile 0 2 ml PCR tubes 5 If the thermal cycler used is not equipped with a heated lid overlay each reaction with two drops of mineral oil Close the tubes and place them into a thermal cycler www evrogen com a Appendix D 6 Subject the tubes to PCR cycling using the following program Initial denaturation 95 C 1 min Cycling 12 cycles 95 C 15 sec 66 C 20 sec 72 C 3 min 7 When cycling is complete analyze 5 ul aliquots of each ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration 8 If electrophoresis indicates poor yield of PCR products subject the tubes to two more PCR cycles and repeat the electrophoresis Note If low molecular weight poor yield or no PCR product is ob served in the samples after PCR amplification see Troubleshooting Section XI G 9 Pool the reaction mixtures from two identical tubes with amplified
6. cDNA step 10 of this appendix 5 UL 10X Reaction buffer 2 uL Gsul restriction endonuclease 10 U 50 uL Total volume 10 Incubate the tubes for 3 h at 30 C 11 After digestion purify ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 LI of sterile RNase free water The resulting ds cDNA is suitable for Roche 454 sequencing Please con tact your sequencing facility for further instruction on ds cDNA processing www evrogen com AL XI Troubleshooting XI A DSN activity testing step 9 Section VI B Gel analysis shows that DNA in C tube is fully or partially degraded Possible cause Solution DSN control template is fully or partially degraded during storage or delivery Your working area equipment or solutions are contaminated by nucleases Analyze 1 pL of DSN control template along side 0 1 ug of 1 kb DNA ladder on a 1 5 agarose EtBr gel in 1X TAE buffer If DSN Con trol template is fully or partially degraded use another DNA to test DSN activity You can use any purified plasmid DNA with a concentration of approximately 100 ng uL If the DSN control template is not degraded but the DNA in C tube is fully or partially degraded it indicates that your working area equipment or solutions are contaminated by nucleases Check that your work area equipment and solutions are free from nuclease contamination Gel analysis shows that DNA in E tube is not completely degr
7. electrophoresis result indicating an optimal number of PCR cycles should appear as a moderately strong cDNA smear of the expected size distribution with several bright bands corre sponding to abundant transcripts For cDNA prepared from most mammalian RNAs the overall signal intensity relative to that of 0 1 ug of 1 kb DNA size marker run on the same gel should be roughly similar to that shown in lane 2 of Fig 6 If the cDNA smear appears in the high molecular weight region of the gel e g as shown in lane 4 of Fig 6 especially if no bright bands are distinguishable your PCR parameters may be subopti mal If the smear is faint such as that shown in lane 1 of Fig 6 this indicates that too few PCR cycles were used for amplification see Troubleshooting subsection XI B gt Note The optimal number of PCR cycles must be determined indi vidually for each experimental sample Using the optimal number of PCR cycles ensures that the ds cDNA remains in the exponential phase of amplification PCR overcycling is extremely undesirable as it yields nonspecific PCR products Therefore it is better to use fewer cycles than too many www evrogen com Eid VII Normalization protocol 37 38 39 40 Retrieve the seven cycle experimental tubes from ice return them to the thermal cycler and if necessary subject them to additional PCR cycles to reach the optimal number indicated in the control cDNA experiment Next im
8. min at 65 C Reactions were stopped by DSN stop solution and digestion prod ucts were analyzed on a 1 5 agarose EtBr gel in 1X TAE buffer Lane 1 control DNA incubation without DSN Lane 2 DNA incubated with partially inactive DSN Lane 3 successful digestion of DNA by DSN Lane M 1 kb DNA size markers www evrogen com g VII Normalization protocol PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING VII A cDNA precipitation Note Do not use any co precipitants in the following cDNA precipitation procedure 1 Aliquot ds cDNA solution containing about 0 7 1 3 ug of purified ds cDNA to a fresh sterile tube Note If the purified ds cDNA samples were stored at 20 C pre heat them at 65 C for 1 min and mix by gently flicking the tubes before taking aliquots Store the remaining purified ds cDNA at 20 C Add 0 1 volume of 3M sodium acetate pH 4 8 and 2 5 volumes of 98 v v ethanol Vortex the mixture thoroughly Centrifuge the tube for 15 min at maximum speed in a microcentri fuge at room temperature Carefully remove and discard the supernatant 5 Gently overlay the pellets with 100 uL of 80 ethanol Centrifuge the tubes for 5 min at maximum speed in a microcentri fuge at room temperature Carefully remove and discard the supernatant 8 Repeat steps 5 7 9 Air dry the pellet for 10 15 min at room temperature Be sure that 10 11 pellet is complete
9. of sterile RNAse free water to the tube mix well by vortexing and spin the tubes briefly in a microcentrifuge Note If the control cDNA sample was stored at 20 C pre heat it at 65 C for 1 min and mix by gently flicking the tubes before taking aliquots Store the remaining cDNA at 20 C www evrogen com E Vill Analysis of normalization efficiency 4 Prepare qPCR reactions with primers specific for high abundance transcripts in the experimental cDNA samples and 1 uL aliquots of the diluted cDNA from steps 2 and 3 5 Perform PCR cycling as described in the instructions or instruction booklet provided with the ready to use qPCR Master Mix Three step cycling protocol is recommended Note Appropriate annealing temperature for the GAPD primer mix provided in the Trimmer 2 kit is 60 C 6 When cycling is completed use thermal cycler software to identify Ct for each PCR reaction Calculate mean value Ct for each cDNA sample Mean Ct for the control cDNA should be less than 20 Note If mean Ct for the control cDNA is 21 or more this indicates that the transcript tested is not in high abundance in the cDNA sample Thus its concentration may remain unchanged during normalization In this case repeat gPCR with primer pair specific to another high abundance transcript Note GAPD is expressed at high levels in most human and mouse tissues and cell lines however there could be some exceptions In some samples GA
10. products that are not flanked by M1 primer sequence Small amounts of such fragments might be present in the samples after the first amplification 1 For each normalized cDNA sample combine 2 uL aliquot of normal ized cDNA from step 42 of the Normalization protocol and 20 uL of sterile RNAse free water in a new sterile tube mix well by vortexing and spin the tubes briefly in a microcentrifuge gt Note If the normalized cDNA samples were stored at 20 C pre heat 30 Trimmer 2 cDNA normalization kit Appendix B them at 65 C for 1 min and mix by gently flicking the tubes before taking aliquots Store the remaining cDNA at 20 C 2 For each normalized cDNA sample prepare a PCR mixture by com bining the following reagents in the order shown 80 UL Sterile RNase free water 10 UL 10X Encyclo buffer 2 UL 50X dNTP mix LOmM each 4 uL PCR primer M1 10 uM 2 uL Diluted normalized cDNA from step 1 above 2 uL 50X Encyclo polymerase mix 100 uL Total volume 3 Mix contents by gently flicking the tubes Spin the tubes briefly in a microcentrifuge 4 Ifthe thermal cycler used is not equipped with a heated lid overlay each reaction mixture with two drops of mineral oil Close the tubes and place them into a thermal cycler 5 Subject the tubes to PCR cycling using the following program Initial denaturation 95 C 1 min Cycling 12 cycles 95 C 15 sec 66 C 20 sec 72 C 3 min 6 Analyze 5 uL aliquots of eac
11. rather than 0 5 ml ones PCR cycling parameters in the protocol are optimized for an MJ Research PTC 200 DNA Machine Please note that the optimal pa rameters may vary when different thermal cyclers and templates are used www evrogen com E VI DSN preparation and activity testing VI A Preparation of DSN stock solution 1 Add 25 uL of DSN storage buffer to the lyophilized DSN enzyme Mix contents by gently flicking the tube Spin the tube briefly in a micro centrifuge Avoid foaming of the mixture 2 Incubate the tube at room temperature for 5 min 3 Add 25 uL of glycerol to the tube Mix contents by gently flicking the tube Spin the tube briefly in a microcentrifuge Avoid foaming of the mixture 4 Store the DSN stock solution at 20 C DSN stock solution can be stored at 20 C up to three months VI B DSN activity testing Note We strongly recommend that you check DSN activity every time before you begin normalization 1 Combine the following reagents in a sterile 1 5 mL tube 4 uL Sterile RNAse free water 4 uL DSN control template 10uL DSN master buffer 18 UL Total volume 2 Mix contents and spin the tube briefly in a microcentrifuge 3 Aliquot 9 uL of the reaction mixture into two sterile PCR tubes la beled C control and E experimental 4 Add 1 UL of DSN storage buffer into C tube Add 1 UL of DSN stock solution into E tube Mix contents and spin the tubes briefly in a microcentri
12. signal intensity of the experimental PCR products is much stronger than the control especially if there are distinct bright bands present the normalization process might have been unsuccessful See Troubleshooting subsection XI C Trimmer 2 cDNA normalization kit VII Normalization protocol 41 Select the tube s showing efficient normalization For comparison 42 Fig 7 shows a characteristic gel profile of normalized human cDNA A typical result indicative of efficient normalization should have the following characteristics e PCR products from experimental tube s containing efficiently normalized cDNA appear as a smear without clear bands whereas those from the non normalized controls usually present a number of distinct bands e The average length of the efficiently normalized cDNA is congru ous with the average length of cDNA from the non normalized control tube gt Note The upper boundary of the normalized cDNA smear usu ally does not exceed 5 kb If the normalized cDNA appears as a uniform smear stretching from the input well to the low molecu lar weight region or bands are visible in the normalized cDNA sample see Troubleshooting subsection XI D If CDNA from two or more Experimental tubes step 41 appears well normalized combine contents of these tubes in one sterile 1 5 mL tube mix well by vortexing and spin the tube briefly in a microcent rifuge Now you have obtained normalized ds
13. the protocol and repeat the first strand synthesis and PCR One typical mis take is not mixing the RNA samples thoroughly after defrosting We recommend that you heat the RNA samples 65 C for 2 3 min prior to aliquotting The optimal number of PCR cycles may vary with different PCR machines and RNA templates Op timize the PCR parameters and repeat the PCR using a fresh aliquot of first strand cDNA Opti mization of PCR parameters may include continued on next page Trimmer 2 cDNA normalization kit XI Troubleshooting Possible cause Solution a decreasing the annealing temperature in in crements of 2 4 C b optimizing the denaturation temperature by decreasing or increasing it in 1 C increments and or c increasing the extension time in 1 min increments Some reagents are not Perform control cDNA preparation using working properly the reagents and protocol provided in the SMART based kit If cDNA synthesis using Clontech reagents is successful it indicates that 3 end adapter pro vided in the Trimmer 2 kit is degraded Please contact Evrogen technical support customer support evrogen com If cDNA synthesis using Clontech reagents is not successful it indicates that SMART based kit used for cDNA preparation must be replaced Gel analysis of PCR products obtained from experimental RNA reveals low molecular weight products poor yield or no products while high quality PCR product is g
14. this is the case repeat the cDNA synthesis using modified PCR parameters in which the 72 C elongation step is decreased by up to 2 min XI E Testing the normalization efficiency Section VIII Quantitative PCR or Virtual Northern blot show that the transcript abundance remains unchanged after the normalization procedure but the cDNA sample seems to have been efficiently normalized Possible cause Solution The concentrations of non normalized and normalized cDNA used for comparison may not be equal The transcripts selected for testing may not be abundant in the samples of interest The normalization process was unsuccessful Equalize the concentrations of these cDNAs and repeat the test Make sure that the transcripts selected for test ing are in high abundance In non normalized cDNA high abundance transcripts should yield PCR products after 18 23 cycles However the representation levels of intermediate and rare transcripts may not change during the norma lization procedure In some cases a slight increase in the representation level of such tran scripts may occur Microscopic drops of the initial cDNA may have remained on the experimental tube walls or in the oil layer during hybridization or DSN treat ment thereby escaping DSN treatment and sub sequently contaminating the experimental continued on next page Trimmer 2 cDNA normalization kit XI Troubleshooting Possible c
15. to PCR cycling using the following program Initial denaturation 95 C 1 min Cycling 3 cycles 95 C 15 sec 50 C 20 sec 72 C 3 min 11 cycles 95 C 15 sec 63 C 20 sec 72 C 3 min 7 Analyze 4 uL aliquots of each PCR product alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration If necessary add 1 3 PCR cycles and repeat elctrophoresis Use the following PCR pro gram for additional cycles Cycling 1 3 cycles 95 C 15 sec 63 C 20 sec 12 C 3 min 38 Trimmer 2 cDNA normalization kit Appendix E Note If low molecular weight poor yield or no PCR product is ob served in the samples after PCR amplification see Troubleshooting Section XI G 8 Pool the reaction mixtures from two identical tubes with amplified normalized cDNA into a new sterile tube 9 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water The resulting ds cDNA is suitable for Roche 454 sequencing Please con tact your sequencing facility for further instruction on ds cDNA processing Appendix F Processing of normalized cDNA flanked at 3 end with CDS Gsu adapter before Roche 454 sequencing Reagents required e Normalized ds cDNA from step 42 of the Normalization protocol flanked at 3 end with an adapter sequence containing a Gsul site e Gsul restriction endonuclease supplied with
16. to normalize amplified full length enriched cDNA prepared using Evrogen Mint cDNA synthesis kits The resulting cDNA contains equalized abundance of different transcripts and can be used for construction of cDNA libraries and for direct sequencing including high throughput sequencing on the next generation sequenc ing platforms Roche 454 ABI SOLID or IIlumina Solexa The kit also includes special adapters allowing use of Clontech SMART based kits for construction of cDNA intended for Trimmer 2 normalization www evrogen com E Intended use mRNA NPA AAAAA PADI AAAAA AAAAA cDNA preparation 5 end adapter __GGGGG 3 end adapter __BTTTTT ds cDNA kat AAAAA 7 aH ALI CR LH A EE AAAAAT C AAAAA ET CR R co denaturation ka AAAAAT aH AAAAAT n E p U DEAD LE AAAAA ET DE R LB To hybridization Low AAAAAT aw AAAAAT 5 A LI Ce m Bl Ge aaa CE AAAAA EI E kta DI C ma 2 ds cDNA hybrids generated by equalized ss DNA fraction abundant and intermediate transcripts a e DSN treatment EE AA AAT DEAL I m a LES O I E AAAI LE AAAAA ET m LE LB DI degradation of ds cDNA hybrids DEAL I TIE equalized cDNA equalized ss DNA fraction first PCR amplification with PCR primer MID LH AAAAALD LH Tho second PCR amplification f
17. 2 Setting up DSN treatment Experimental tubes Control tube TUBE4 TUBE1 TUBE2 TUBES Component S1 DSN1 S1 DSN1 2 S1 DSN1 4 S1 Control DSN solution 1 UL 1 2 DSN dilution 1 UL 1 4 DSN dilution 1 UL DSN storage 1 UL buffer S lt NUMBER gt specifies the cDNA sample DSN solution is from step 4 of section VI A Preparation of DSN stock solution page 10 VII 16 17 VI 18 19 20 21 22 Normalization protocol Incubate the tubes in a thermal cycler at 98 C for 2 min Incubate the tubes at 68 C for 5 h then proceed immediately to step 18 Do not remove the samples from the thermal cycler before DSN treatment Note Samples may be hybridized for as little as 4 h or as long as 7 h Do not allow the incubation to proceed for more than 7 h C DSN treatment Shortly before the end of the hybridization procedure prepare two DSN dilutions in two sterile tubes to final DSN concentrations of 0 5 U pL and 0 25 U LL as follows a Combine 1 uL of DSN storage buffer and 1 uL of DSN stock solu tion from step 4 of VI A section to the first tube Mix by gently pipetting the reaction mixture up and down Label the tube 1 2 DSN b Combine 3 uL of DSN storage buffer and 1 uL of DSN stock so lution to the second tube Mix by gently pipetting the reaction mixture up and down Label the tube 1 4 DSN c Place the t
18. 29 30 D Amplification of normalized cDNA Prepare a PCR master mix by combining the following reagents in the order shown 162 uL Sterile RNAse free water 20uL 10X Encyclo buffer 4 uL 50X dNTP mix 10 mM each 6 uL PCR primer M1 10 uM 4 uL 50X Encyclo polymerase mix 196 uL Total volume Note If you normalize several cDNA samples increase the volume of PCR master mix accordingly Mix the contents by gently flicking the tubes Spin the tubes briefly in a microcentrifuge Aliquot 1 uL of each sample from step 26 into an appropriately la beled sterile 0 2 mL PCR tubes Add 49 uL of the PCR master mix into the tubes www evrogen com E VII Normalization protocol 31 32 33 34 35 36 Mix contents by gently flicking the tubes Spin the tubes briefly in a microcentrifuge If the thermal cycler used is not equipped with a heated lid overlay each reaction with a drop of mineral oil Close the tubes and place them into a thermal cycler Subject the tubes to PCR cycling using the following program Initial denaturation 95 C 1 min Cycling T cycles 95 C 15 sec 66 C 20 sec 72 C 3 min Put the Experimental tubes on ice Use the Control tube to deter mine the optimal number of PCR cycles as follows a Aliquot 12 uL from the seven cycle control tube into a clean mic rocentrifuge tube for agarose EtBr gel analysis b Run two additional cycles for a total of nine cycles with th
19. N treatment may have been insufficient The concentration of the DSN enzyme may be unacceptably low Check whether the DSN enzyme was thoroughly mixed with the storage buffer if not repeat the normalization using fresh ds cDNA and well di luted DSN enzyme If the DSN enzyme was diluted sufficiently test the DSN activity using the procedure described in Section VI B If the DSN activity is acceptable it is possible that microscopic drops of the initial cDNA re mained on the experimental tube walls or in the oil layer during hybridization or DSN treat ment and were therefore not exposed to the DSN treatment After dilution of the exper imental samples this untreated non normal ized cDNA could have contaminated the exper imental samples and been amplified during the subsequent PCR step Repeat the normalization more carefully Repeat the normalization using 2 ul of the stock DSN solution instead of the 1 4 DSN dilution and 1 5 ul of the stock DSN solution instead of the 1 2 DSN dilution see Normalization proto col step 22 www evrogen com XI Troubleshooting The normalized cDNA appears on a gel as a uniform smear stretching from the wells to the low molecular weight region Fig 11 Possible cause Solution The 72 C elongation step may be too long An extended elongation may promote concatemerization of the cDNA adapter sequences Concatemers may be confirmed by cDNA se quencing If
20. Once the successful results for ds cDNA synthesis are achieved pu rify amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50uL of sterile RNAse free water For normalization pro cedure please refer to Normalization protocol Section VII www evrogen com a Appendix A Fig 10 Agarose gel elec trophoresis of amplified cDNA from different sour ces 1 mouse liver 5 0kb EE 2 mouse skeletal 3 0 kb _ Mn muscle 3 mouse brain e 4 human leucocytes 1 5 kb _ 5 human lung 6 1 0 kb human skeletal muscle 7 mosquito grub 8 copepod Pontella sp 9 tomato Lycopersicon esculentum M 1 kb DNA ladder SibEnzyme Appendix B Processing of normalized cDNA before non directional cDNA library cloning Reagents required e Normalized cDNA from step 42 of the Normalization protocol e Encyclo PCR kit Evrogen Cat PKOO1 or analogues e QlAquick PCR Purification Kit Qiagen e Sterile molecular biology grade water sterile RNase free water Amplification of ds cDNA Note The normalized ds cDNA from step 42 of the Normalization pro tocol can be used for non directional cloning into appropriate TA cloning vector just after purification step 8 of this Appendix However we rec ommend performing additional dilution and re amplification of normalized cDNA with M1 primer as described in steps 1 7 of this Appendix The re amplification allows to get rid from non specific PCR
21. PD transcripts belong to intermediate or low abundance groups and unchanged or slightly increased concentration of these tran scripts in normalized cDNA is observed In this case please select other marker genes that are abundant in samples of interest to test normali zation efficiency 7 Calculate ACt as follows ACt Cte Cty where Ctc is the mean Ct for the control cDNA sample and Cty is the mean Ct for the normalized cDNA sample ACt gt 5 indicates effective normalization ACt lt 4 indicates un successful normalization 22 Trimmer 2 cDNA normalization kit Vill Analysis of normalization efficiency 0 1 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 Cycle Number Fig 8 Analysis of cDNA normalization results by qPCR Efficiency of normalization of human and mouse brain cDNA was tested using quantitative PCR with GAPD primer mix ACt 9 indicates successful normalization in both cases IX Recommendations for further processing of normalized cDNA Adapter pair used for ds cDNA Intended application Recommendations preparation PlugOligo 1 and CDS 1 adapters Non directional cDNA see Appendix B OR library cloning and SMARTer II A Oligonucleotide and Sanger sequencing 3 SMART CDS Primer II A PlugOligo 3M and CDS 4M Directional cDNA see Appendix C adapters library cloning an SOLID or Illumina see Appendix D SMART IV Oligonucleotide and se
22. aded Possible cause Solution DSN enzyme is fully or partially inactive Use another DSN enzyme package XI B Amplification of the control cDNA step 36 Section VII Gel analysis of PCR products from the Control tube reveals low molecular weight products poor yield or no products Possible cause Solution cDNA was synthesized with inappropriate 5 end and or 3 end adapters Please refer to the subsection IV cDNA prepa ration to choose adapters suitable for cDNA synthesis continued on next page Trimmer 2 cDNA normalization kit XI Troubleshooting Possible cause Solution cDNAs may have degraded during storage and or hybridization procedure You may have made an error during the procedures such as using a suboptimal incubation temperature or omitting an essential component The concentration of starting cDNA is low but the quality is good PCR conditions and parameters might have been suboptimal Some reaction components may have degraded during storage and or delivery Check that your work area equipment and solu tions are free from DNase contamination Check the quality of starting cDNA on agarose gel elec trophoresis Repeat ethanol precipitation of cDNA after column purification see Subsection VII A of Normalization protocol and normaliza tion using a fresh cDNA aliquot Carefully check the protocol and perform con trol normaliza
23. amples for normali zation Repeat cDNA amplification using larger amounts of first strand cDNA When cycling is complete place the tubes on ice Analyze 5 uL of the PCR product alongside 0 1 ug of 1 kb DNA size marker on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration A typical electrophoresis result indicating successful cDNA syn thesis should appear as a moderately strong cDNA smear of the expected size distribution with several bright bands corresponding to abundant transcripts Compare the intensity of the banding pat tern of the PCR product with the 1 kb DNA ladder 0 1 ug run on the same gel For cDNA from mammalian RNA sources the overall sig nal intensity relative to the DNA ladder should be roughly similar to that shown in Fig 9 e If the cDNA smear appears in the high molecular weight region of the gel and especially if no bright bands are distinguish able PCR overcycling may be an issue see Troubleshooting subsection XI F Additional indication of PCR overcycling is pre ponderance of material in the lower part of the gel i e O 1 kb e If the smear is faint and the size distribution of PCR product is Trimmer 2 cDNA normalization kit Appendix A less than expected this indicates PCR undercycling too few PCR cycles were used for amplification Subject the tubes to two more PCR cycles and repeat the electrophoresis If there is still a strong differenc
24. ause Solution samples to generate non normalized cDNA dur ing the PCR step Repeat normalization more carefully Perform control cDNA normalization using con trol cDNA template provided in the Trimmer 2 kit and test normalization efficancy If control nor malization is unsuccessful too please contact Evrogen technical support customer support evrogen com Sequencing of the normalized cDNA reveals large concatamers of cDNA adapters Possible cause Solution The 72 C elongation step may be too long An extended elongation may promote concatemerization of the cDNA adapter sequences Repeat the cDNA synthesis and normalization using PCR parameters that have been modified as follows in all amplification steps shorten the 72 C step by up to 2 min Sequencing of the normalized cDNA reveals that certain sequences are highly prevalent even though they do not represent genes that are known to be highly expressed This issue complicates effective gene discovery Possible cause Solution Ineffective hybridization of some sequences e g due to high TA contents and or the formation of secondary structures may have negatively impacted normalization Clone fragments 100 bp of the undesirably prevalent genes re amplify them from purified plasmid DNA purify the PCR products using a PCR purification kit and mix the amplified fragments together to a final concentrations of 10 n
25. by qPCR Important notes Trimmer 2 kit provides GAPD primer mix allowing qPCR testing of nor malization efficacy in human and mouse cDNA samples on the example of glyceraldehyde 3 phosphate dehydrogenase GAPD that is expressed at high levels in most mammalian tissues and cell lines For cDNA from other sources non human and non mouse please select and design primers specific for source specific high abundance transcripts Reagents required e Ready to use qPCR Master Mix containing SYBR Green dye and ROX reference dye qPCR protocol 1 Make sure that the difference between concentrations of normal ized cDNA from step 42 of the Normalization protocol and control cDNA from step 39 of the Normalization protocol does not exceed 2 times If necessary equalize cDNA concentrations Note cDNA concentration should be estimated using agarose gel elec trophoresis or spectrophotometric analysis 2 Aliquot 1 uL of normalized cDNA from step 42 of the Normalization protocol into a sterile 1 5 mL tube add 39 uL of sterile RNAse free water to the tube mix well by vortexing and spin the tubes briefly in a microcentrifuge gt Note If the normalized cDNA sample was stored at 20 C pre heat it at 65 C for 1 min and mix by gently flicking the tubes before taking aliquots Store the remaining cDNA at 20 C 3 Aliquot 1 uL of control cDNA from step 39 of the Normalization protocol into another sterile 1 5 mL tube add 39 uL
26. cDNA The resulting amount of ds cDNA per reaction with total volume of 50 UL is anticipated to be in a range of 0 75 1 35 ug This normalized cDNA can be stored at 20 C up to one month and used afterwards to prepare more normalized cDNA 43 Please refer to Section IX Recommendations for further process ing of normalized cDNA to choose the protocol for further pro cessing of amplified ds cDNA before use in intended downstream applications Note Before cDNA processing you can estimate normalization effi ciency using quantitative PCR or Virtual Northern blot with marker genes of known abundance Please refer to the Section VIII Analysis of normalization efficiency www evrogen com 8 VII Normalization protocol Fig 7 Analysis of cDNA normalization results 5 ul aliquots of the PCR products were loaded on a 1 5 agarose EtBr gel Lane M 1 kb DNA size mark ers 0 1 ug loaded Lane 1 cDNA from the Control tube Lane 2 cDNA from the S1_DSN1 4 tube Lane 3 cDNA from the S1_DSN1 2 tube Lane 4 cDNA from the S1_DSN1 tube In this experiment efficient normalization was achieved in the S1_DSN1 2 tube lane 3 In the S1_DSN1 4 tube lane 1 normaliza tion was not completed in the S1_DSN1 tube lane 4 DSN treatment was excessive resulting in partial cDNA degradation VII Analysis of normalization efficiency cDNA normalization considerably decreases the concentrations of highly abundant transcripts in a cDNA pop
27. d as the amount of DSN added to 50 ug ml calf thymus DNA that causes an increase of 0 001 absorbance units per min Activity assay was performed at 25 C in 50 nM Tris HCl buffer pH 7 15 containing 5 mM MgClo Shipping amp Storage All components of the kit can be shipped at ambient temperature Upon arrival all kit components must be stored at 20 C II B Reagents required but not included e One of the following cDNA synthesis kits Mint 2 cDNA synthesis kit Evrogen Cat SKOO5 recommended SMART cDNA library construction kit Clontech Cat 634901 SMARTer PCR cDNA synthesis kit Clontech Cat 634925 or 634926 e Encyclo PCR kit Cat PKOO1 included in the Mint 2 cDNA synthesis kit or analogues e Biology grade mineral oil e Agarose gel electrophoresis reagents SfilA site a SfilB site a 5 GGCCATTACGGCC 3 5 GGCCGCCTCGGCC 3 3 CCGGTAATGCCGG 5 3 CCGGCGGAGCCGG 5 Gsul site V 5 CTGGAG N 16 3 gre GACCTC N 14 5 Fig 4 Sfil and Gsul recognition sites 6 Trimmer 2 cDNA normalization kit III Kit components and storage conditions e DNA size markers 1 kb DNA ladder 98 and 80 ethanol e 3M sodium acetate NaAc pH 4 8 e QlAquick PCR purification kit Qiagen Inc Cat 28104 or 28106 e Sterile molecular biology grade water sterile RNAse free water IV cDNA preparation Trimmer 2 protocol is optimized for normal
28. directional cloning into appropriate vector just after Sfil restriction endonuclease treatment steps 8 12 of this Appendix Re am plification of the normalized cDNA steps 1 7 of this Appendix is optional it is required only if higher amounts of product are needed for downstream applications 1 Combine 2 uL of normalized cDNA from step 42 of the Normaliza tion protocol and 20 uL of sterile RNAse free water in a newsterile 1 5 mL tube mix well by vortexing and spin the tubes briefly in a microcentrifuge gt Note If the normalized cDNA samples were stored at 20 C pre heat A Trimmer 2 cDNA normalization kit Appendix C them at 65 C for 1 min and mix by gently flicking the tubes before taking aliquots Store the remaining cDNA at 20 C 2 For each cDNA sample from step 1 above prepare a PCR mixture by combining the following reagents in the order shown 80 UL Sterile RNase free water 10 UL 10X Encyclo buffer 2 UL 50X dNTP mix LOmM each 4 uL PCR primer M1 10 uM 2 uL Diluted normalized cDNA from step 1 above 2 uL 50X Encyclo polymerase mix 100 uL Total volume 3 Mix contents by gently flicking the tubes Spin the tubes briefly in a microcentrifuge 4 Ifthe thermal cycler used is not equipped with a heated lid overlay each reaction mixture with two drops of mineral oil Close the tubes and place them into a thermal cycler 5 Subject the tubes to PCR cycling using the following program Initial de
29. e between the overall signal intensity of the PCR prod ucts obtained relative to 0 1 ug of DNA ladder and PCR product shown in Fig 9 see Troubleshooting subsection XI F M dscDNA 5 0 kb _ 3 0 kb _ 2 0 kb W 1 5 kb _ 1 0 kb _ Fig 9 ds cDNA synthesized from poly A placenta RNA us ing SMART kit 1 ug of poly A RNA was used as starting material in a first strand cDNA synthesis 2 ul of the first strand cDNA was then used as template for SMART cDNA amplification in 100 ul re action volume 16 PCR cycles were performed 5 ul of the PCR product was analyzed on a 1 5 agarose EtBr gel Lane M 1 kb DNA ladder 0 1 ug loaded The arrow indicates a strong band at 900 bp typically seen for human placenta cDNA Note In general for most mammalian tissues a visible smear of full length enriched cDNA should be within the range of 0 5 7 kb while normal cDNA size for many non mammalian species is less than 3 kb Fig 10 cDNA prepared from some mammalian tissue sources e g human brain spleen and thymus may not display bright bands due to a very high complexity of poly A RNA Note cDNA with low molecular weight may not represent full length transcripts Such cDNA will not become full length during the norma lization procedure and is not suitable for full length library preparation However such cDNA is suitable for DSN normalization and preparation of cDNA library comprising non full length cDNA fragments 17
30. e re maining 38 uL of the control PCR mixture c Aliquot 12 uL from the nine cycle control tube into a clean mic rocentrifuge tube d Run two additional cycles for a total of 11 with the remaining 26 uL of the control PCR mixture e Aliquot 12 uL from the 11 cycle control tube into a clean micro centrifuge tube f Run two additional cycles for a total of 13 with the remaining 14 uL of the control PCR mixture Analyze 5 uL aliquots of each control PCR reaction seven nine eleven and thirteen cycles from step 34 alongside 0 1 ug of 1 kb DNA size marker on a 1 5 w v agarose EtBr gel run in 1X TAE buffer Store the remaining materials on ice Determine the optimal number of cycles required for amplification of the control cDNA as follows Trimmer 2 cDNA normalization kit VII Normalization protocol 3 0 kb _ 1 5 kb Tokos Fig 6 Analysis for optimizing PCR parameters 5 ul of each aliquot from the Control tube from step 34 was electrophoresed on a 1 5 agarose EtBr gel in 1X TAE buffer following the indicated number of PCR cycles The optimal number of cycles determined in this experiment 7 9 11 43 was 9 Lane M 1 kb DNA ladder size markers PCR cycles 0 1 ug loaded When the PCR product yield stops increasing with an additional cy cle the reaction has reached a plateau The optimal number of cycles should be one or two cycles less than that needed to reach the plateau A typical
31. een too excessive mixed with the storage buffer Granules of non diluted enzyme may dramatically change the DSN concentration in the experimental sam ples If this is the issue repeat the normaliza tion using fresh ds cDNA and well diluted DSN enzyme Otherwise repeat the normalization using fresh ds cDNA and the following modifications Normalization Protocol steps 18a 18b In three sterile tubes prepare the following dilu tions of DSN enzyme Combine 3 uL of DSN storage buffer and 1 uL of DSN stock solution Mix by gently pipetting the reaction mixture up and down Mark the tube as 1 4 DSN Combine 5 uL of DSN storage buffer and 1 uL of DSN stock solution Mix by gently pipetting the reaction mixture up and down Mark the tube as 1 6 DSN Combine 7 UL of the DSN storage buffer and 1 UL of DSN stock solution Mix by gently pipetting the reaction mixture up and down Mark the tube as 1 8 DSN continued on next page Era Trimmer 2 cDNA normalization kit XI Troubleshooting Possible cause Solution Normalization Protocol step 22 Treat the cDNA with DSN that has been diluted four six and eight fold instead of the one two and four fold dilutions specified in the Nor malization Protocol XI D Selection of well normalized cDNA step 41 Section VII The PCR products from all experimental tubes appear to be over amplified or non normalized Possible cause Solution The DS
32. enerated from the control RNA Possible cause Solution The experimental RNA may Use gel electrophoresis to estimate the concen be degraded e g due to tration and quality of the RNA Then check the RNase contamination or stability of the RNA by incubating a small aliquot too diluted in water for 1 hr at 42 C and running it on a dena turing formaldehyde agarose gel alongside an unincubated aliquot If the RNA is degraded during the incubation repeat the experiment using a fresh lot or prepa ration of RNA Perform several rounds of phe nol chloroform extraction as this can consider ably increase RNA stability continued on next page www evrogen com a XI Troubleshooting Possible cause Solution The RNA may contain impurities that inhibit cDNA synthesis If the PCR reaches its plateau after 25 or more cycles the PCR conditions may not be optimal The optimal number of PCR cycles may vary with different PCR machines and RNA templates RNA samples are from non mammalian species with specific size distribution of RNA If RNA degradation during cDNA synthesis is sus pected add 0 5 uL RNase inhibitor 20 U uL Ambion to the first strand synthesis reaction Check that your work area equipment and so lutions are free from RNase contamination In some cases ethanol or LiCl precipitation of RNA can remove impurities If this does not help re isolate the RNA using another method
33. f the applicable Limited Use Label License 002 see www evrogen com support License statements shtml MSDS information is available at http www evrogen com MSDS shtml ver August 27 2013 www evrogen com ea Evrogen JSC Miklukho Maklaya str 16 10 117997 Moscow Russia Tel 7 495 988 4084 Fax 7 495 988 4085 www evrogen com
34. fe evrogen Trimmer 2 cDNA normalization kit Cat NKOO3 User manual PLEASE READ THE ENTIRE MANUAL BEFORE STARTING Contents l Intended USE te tes tap ate are RR RR ape E MN So we E Il Method overview ps aki eee BE a ee ee ee ee E ee Ill Kit components and storage conditions III A Listofkitcomponents HI B Reagents required but notincluded IV cDNA preparation 2 0 0 0 eee a V GeneralconsideratiONS so VI DSN preparation and activity testing VI A Preparation of DSN stock solution VI B DSN activity testing o VI Normalization protocol o VII A cDNA precipitation 0 00 2 2 eee ee es VII B cDNA denaturation and hybridization VIG DSN treatment 43 4 eb ee ee eee KER Cae oH VII D Amplification of normalized cDNA Vill Analysis of normalization efficiency IX Recommendations for further processing of normalized cDNA X Appendixes ad ms ds Boke eee ee ee eK OR we Ee Appendix A cDNA synthesis and amplification using SMART based kit Clontech ass a be oO vi ao sie OLS Bom ES Appendix B Processing of normalized cDNA before non directional cDNA library cloning 20054 ae Appendix C Processing of normalized cDNA before directional cDNA library cloning o o Appendix D Processing
35. fuge 5 Overlay the reaction mixture in each tube with a drop of mineral oil and spin the tubes briefly in a microcentrifuge 10 Trimmer 2 cDNA normalization kit VI DSN preparation and activity testing 6 Incubate the tubes in a thermal cycler at 65 C for 10 min 7 Add 5 uL of DSN stop solution to each tube mix contents and spin the tubes briefly in a microcentrifuge Place the tubes at room tem perature 8 Analyze 5 uL aliquots of each reaction mixture alongside 0 1 ug of 1 kb DNA ladder on a 1 5 agarose EtBr gel in 1X TAE buffer 9 Using electrophoresis data estimate the activity of the utilized DSN For comparison Fig 5 shows the typical gel profile of DSN con trol template digested with acceptably active and partially inactive DSN A typical result should have the following characteristics a Two strong DNA bands should be present in the DNA pattern from the C tube as in lane 1 Fig 5 b Low molecular weight DNA should be detected in the E tube as in lane 3 Fig 5 gt Note If a strong difference between the patterns of DNA from the C tube and that shown in Fig 5 lane 1 occurs or the pattern of DNA from the E tube looks like smears of various intensities with or without clear bands as in lane 2 Fig 5 see Troubleshooting subsection XI A Fig 5 DSN activity testing Samples containing 100 ng of DSN control tem plate were incubated with or without DSN in 1x DSN Master buffer for 10
36. g sequences can be introduced to the cDNA ends during cDNA synthesis by the template switching approach See Section IV cDNA preparation Trimmer 2 cDNA normalization kit Ill Kit components and storage conditions HI A List of kit components Trimmer 2 CDNA normalization kit provides components for 10 norma lization reactions Component Amount DSN enzyme lyophilized 50 Units DSN storage buffer 50 mM Tris HCl pH 8 0 120 UL 4x Hybridization buffer 200 mM Hepes pH 7 5 2M NaCl TO uL 2x DSN master buffer 500 UL 100 mM Tris HCl pH 8 0 10 mM MgCls 2 mM DTT DSN stop solution LO mM EDTA 1000 UL DSN control template 100 ng uL 20 UL Control cDNA template mouse 50 70 ng uL 20 UL GAPD primer mix 10 uM each 25 UL Direct primer 5 TTAGCACCCCTGGCCAAGG 3 Reverse primer 5 CTTACTCCTTGGAGGCCATG 3 Primers PCR Primer M1 10 uM 150 UL 5 AAGCAGTGGTATCAACGCAGAGT 3 454 PCR Primer mix 10 uM each 100 UL 5 CAACGCAGAGTGGCCATTAC 3 5 ACGCAGAGTGGCCGAGGCGGCCTTTTIGTCTTTTCTTCTGTTTCTTTT 3 3 end adapters CDS Gsu adapter 10 uM 25 uL 5 AAGCAGTGGTATCAACGCAGAGTACTGGAG T 29VN 3 continued on next page www evrogen com E III Kit components and storage conditions Component Amount CDS 4M adapter 10 uM 25 UL 5 AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCC T 4G T 6 C T 13VN 3 DNAse activity was measured using modified Kunitz assay 7 where unit was define
37. g uL each Add 1 uL of this driver to the hybridization mixture Normalization Protocol www evrogen com continued on next page XI Troubleshooting Possible cause Solution step 12 and repeat the normalization The addition of this driver leads to subtraction of undesired transcripts during normalization 11 XI F cDNA synthesis and amplification using a SMART based kit Clontech step 16 Appendix A Gel analysis of PCR products obtained from both control and experimental RNA samples reveals low molecular weight products poor yield or no products Possible cause Solution RNA may have degraded during storage and or first strand cDNA synthesis Electrophoresis data might be incorrect because amplified cDNA was frozen before electrophoresis You may have made an error during the procedure such as omitting an essential component If the PCR reaches its plateau after 25 or more cycles the PCR conditions may not be optimal Use gel electrophoresis to estimate the concen tration and quality of the RNA If RNA degradation during cDNA synthesis is sus pected add 0 5 uL RNase inhibitor 20 U uL Ambion to the first strand synthesis reaction Check that your work area equipment and solu tions are free from RNase contamination If amplified samples are frozen before elec trophoresis heat them at 72 C for 2 min and mix before loading onto the agarose gel Carefully check
38. h ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration 7 If electrophoresis indicates poor yield of PCR products subject the tubes to two more PCR cycles and repeat the electrophoresis Note If low molecular weight poor yield or no PCR product is ob served in the samples after PCR amplification see Troubleshooting Section XI G www evrogen com E Appendix B 8 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water The resulting normalized ds cDNA can be used for non directional cloning of cDNA library into appropriate TA cloning vectors Appendix C Processing of normalized cDNA before directional cDNA library cloning Reagents required e Normalized cDNA from step 42 of the Normalization protocol flanked by adapter sequences containing asymmetric Sfil A and Sfil B sites e Sfil restriction endonuclease supplied with 10X reaction buffer Encyclo PCR kit Evrogen Cat PKOO1 or analogues QlAquick PCR Purification Kit Qiagen Sterile molecular biology grade water sterile RNase free water e CHROMASPIN Y 1000 columns Clontech or analogues optional e Agarose gel electrophoresis reagents e DNA size markers 1 kb DNA ladder Amplification of ds cDNA Note The normalized ds cDNA from step 42 of the Normalization proto col can be used for
39. he contents by gently flicking the tube Spin the tube briefly in a microcentrifuge 13 If the thermal cycler used is not equipped with a heated lid overlay each reaction mixture with a drop of mineral oil Close the tubes and place them into a thermal cycler 14 Subject the tubes to PCR cycling using the following program Initial denaturation 95 C Cycling Xcycles 95 C 66 C 72 C 1 min 15 sec 20 sec 3 min X is the optimal number of PCR cycles for a given amount of total or poly A RNA used for the first strand cDNA synthesis according to the Table 3 below www evrogen com Appendix A 15 16 Table 3 PCR cycling parameters Total RNA ug polyA RNA ug Number of PCR cycles 1 0 1 5 0 5 1 0 13 15 0 5 1 0 0 25 0 5 15 18 0 25 0 5 0 1 0 25 18 21 The recommended parameters were tested using placenta and skeletal muscle total and poly A RNA and an MJ Research PTC 200 Thermal Cycler Optimal pa rameters may vary with different thermal cyclers polymerase mixes and templates Use the minimal possible number of cycles possible since overcycling may yield a nonspecific PCR product If necessary undercycling can be easily rectified by plac ing the reaction tube back into the thermal cycler for a few more cycles see also Troubleshooting Guide Section B Please note cDNA samples that require more than 25 PCR cycles to be amplified may not be representative We do not recommend using such s
40. ization of ds cDNA flanked by Mi primer sequence at both ends Such cDNA can be prepared using Mint 2 cDNA synthesis kit Cat SKOO5 Alternatively cDNA compatible with Trimmer 2 protocol can be prepared using Clontech SMART cDNA Library Construction Kit Cat 634901 or SMARTer PCR cDNA Synthesis Kit Cat 634925 634926 However in this case the original protocol of cDNA synthesis requires special modifications The modified SMART cDNA synthesis protocol is given in Appendix A of this manual Depending on the intended downstream application you should use dif ferent 5 and 3 end adapters for cDNA synthesis Importantly if you plan to synthesize cDNA using Clontech SMART based kits it might be necessary to substitute the original 3 end adapter with an alternative adapter included in the Trimmer 2 kit Please refer to the Table 1 below to find the appropriate adapter pair suitable for your needs Table 1 5 and 3 adapters for cDNA synthesis Intended application Adapter pair 5 end adapter Source kit 3 end adapter source kit Non directional PlugOligo 1 CDS 1 cDNA library cloning Mint 2 kit Evrogen Mint 2 kit Evrogen and Sanger sequencing SMARTer II A Oligonucleotide 3 SMART CDS Primer Il A SMARTer kit Clontech SMARTer kit Clontech continued on next page www evrogen com IV cDNA preparation Intended application Adapter pair 5 end adapter sou
41. lution The gel running parameters may alter band visibility Attempt to improve your electrophoretic results by testing the use of the following 1X TAE buffer instead of 1X TBE 1 1 1 5 agarose concen tration and a running voltage up to 10 V cm 10 V per each cm of space between the elec trodes in the electrophoretic chamber If ampli fied samples were frozen before electrophoresis heat them at 72 C for 2 min and mix before load ing onto the agarose gel Gel analysis shows high content of low molecular weight lt 0 1 kb materials Possible cause Solution A preponderance of low molecular weight O 1 kb materials inthe raw PCR product could indicate PCR overcycling Repeat the PCR step with a fresh sample of first strand cDNA using 2 3 fewer cycles Note Theraw PCR product usually contains mi nor low molecular weight fraction including unin corporated primers adapters and very short PCR products These small fragments are generally re moved from the ds cDNA preparation in the pu rification step XI G Second amplification of normalized cDNA Appendixes B F A low molecular weight product a poor yield or no PCR product is obtained after the second PCR amplification Possible cause Solution The cDNA or reagents may have degraded during storage Check that your work area equipment and solu tions are free of nuclease contamination Check the quali
42. ly dry before moving to the next step Resuspend the cDNA pellet in sterile RNAse free water to a final cDNA concentration of about 50 150 ng uL To check the ds cDNA quality and concentration analyze 1 uL of cDNA solution alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel in 1X TAE buffer ds cDNA from step 10 can be stored at 20 C up to three months and used for normalization afterwards Trimmer 2 cDNA normalization kit VII Normalization protocol VII B cDNA denaturation and hybridization Note Before you start hybridization make sure that 4X Hybridization buffer has been allowed to stay at room temperature for at least 15 20 min Be sure that there is no visible pellet or precipitate in the buffer before use If necessary warm the buffer at 37 C for about 10 min to dissolve any precipitate 12 For each cDNA sample to be normalized combine the following reagents in a sterile 0 5 mL tube 4 12 uL ds cDNA from step 10 about 0 6 1 2 ug of cDNA 4 uL 4X Hybridization buffer X uL Sterile RNAse free water 16uL Total volume 13 Mix contents and spin the tube briefly in a microcentrifuge 14 Aliquot 4 uL of the reaction mixture into each of the four appropri ately labeled see Table 2 sterile PCR tubes 15 Overlay the reaction mixture in each tube with a drop of mineral oil www evrogen com and centrifuge the tubes for 2 min at maximum speed in a micro centrifuge Table
43. mediately subject the tubes to an addi tional nine cycles of PCR Note In total the experimental tubes should be subjected to X 9 PCR cycles where X is the optimal number of PCR cycles determined for the control tube In the example shown in Fig 6 the optimal num ber of PCR cycles determined using the control tube is nine Thus in this example X 9 and the seven cycle experimental tubes should be subjected to 2 9 additional PCR cycles Analyze 5 uL of each experimental PCR reaction alongside 5 uL of the control PCR reaction representing the optimal number of PCR cycles and 0 1 ug of 1 kb DNA size marker on a 1 5 w v agarose EtBr gel run in 1X TAE buffer Store remaining control cDNA representing the optimal number of PCR cycles at 20 C Compare the banding pattern intensity of the PCR products from the experimental and control tubes as follows e If the overall signal intensity of PCR products from the experimen tal tubes is similar to that of the control proceed to step 41 If the smear from the experimental tubes is much fainter than that of the control PCR undercycling may be an issue Sub ject the experimental tubes to two or three more PCR cycles and repeat the electrophoresis If there is still a strong difference between the overall signal intensity of all experimental PCR prod ucts and the control the normalization process might have been too strong see Troubleshooting subsection XI C If the overall
44. n selective suppression of polymerase chain reaction cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12 myristate 13 acetate Anal Biochem 240 1 90 97 pmid 8811883 Trimmer 2 cDNA normalization kit XII References 7 T H Liao 1974 Bovine pancreatic deoxyribonuclease D J Biol Chem 249 8 2354 6 pmid 4856650 8 O Franz Bruchhaus and T Roeder 1999 Verification of differ ential gene transcription using virtual northern blotting Nucleic Acids Res 27 11 e3 pmid 10325436 9 M V Matz 2002 Amplification of representative cDNA samples from microscopic amounts of invertebrate tissue to search for new genes Methods Mol Biol 183 3 18 pmid 12136765 10 J Sambrook E F Fritsch and T Maniatis Molecular Cloning A Laboratory Manual 2nd edition Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 1989 11 E A Bogdanova I A Shagina E Mudrik Ivanov P Amon L L Vagner S A Lukyanov and D A Shagin 2009 DSN depletion is a simple method to remove selected transcripts from cDNA popu lations Mol Biotechnol 41 3 247 253 pmid 19127453 www evrogen com A For notes se Trimmer 2 cDNA normalization kit Endnotes Notice to Purchaser The Product is intended for research use only The Product is covered by U S Patents No 7 435 794 and 7 803 922 By use of this Product you accept the terms and conditions o
45. naturation 95 C 1 min Cycling 12 cycles 95 C 15 sec 66 C 20 sec 72 C 3 min 6 Analyze 5 uL aliquots of each ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration 7 If electrophoresis indicates poor yield of PCR products subject the tubes to two more PCR cycles and repeat the electrophoresis Note If low molecular weight poor yield or no PCR product is ob served in the samples after PCR amplification see Troubleshooting Section XI G www evrogen com A Appendix C 8 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water Digestion of the normalized cDNA with Sfil restriction endonuclease 9 For each cDNA sample from step 8 above combine the following reagents in a sterile 0 5 mL tube 44uL Amplified ds cDNA from step 8 above 5 UL 10X Reaction buffer 1 uL Sfil restriction endonuclease 10 20 U 50 uL Total volume 10 Incubate the tubes for 3 h at 50 C 11 After digestion purify cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water 12 To enrich the cDNA samples with full length sequences per form size selection of large cDNA molecules gt 1350 bp using CHROMASPIN Y 1000 The resulting ds cDNA can be used for directional cloning into vectors con taining Sfil A and Sfil B sites for e
46. needs Encyclo PCR Kit Evrogen Cat PKOO1 or analogues QlAquick PCR Purification Kit Qiagen Sterile molecular biology grade water sterile RNase free water Agarose gel electrophoresis reagents DNA size markers 1 kb DNA ladder 24 Trimmer 2 cDNA normalization kit Appendix A First strand cDNA synthesis Important notes The following protocol describes the use of reagents provided in SMART based kits Clontech and additional 3 end adapters included in Trimmer 2 kit for synthesis of first strand CDNA suitable for normaliza tion procedure and allowing various downstream application of normalized cDNA Please refer to the Section IV cDNA preparation to choose the adapter pair suitable for your needs The sequence complexity and average length of the normalized cDNA library strongly depend on the quality and amount of the starting RNA material used to prepare the cDNA For best results at least 1 2 ug of total RNA or 0 5 1 ug of polyA RNA should be used at the beginning of first strand cDNA synthesis The minimum amount of starting RNA for cDNA synthesis is 250 ng of total RNA or 100 ng of polyA RNA We strongly recommend that you perform a positive control cDNA synthesis with control RNA provided in the cDNA synthesis kit that you use simul taneously with experimental cDNA synthesis This control is performed to verify that all reagents are working properly 1 Immediately before taking the aliquot for the cDNA synthesi
47. normalized cDNA into a new sterile tube 10 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water Digestion of the normalized cDNA with Sfil restriction endonuclease 11 For each cDNA sample from step 10 above combine the following reagents in a sterile 0 5 mL tube 44uL Amplified ds cDNA from step 10 above 5 UL 10X Reaction buffer 1 UL Sfil restriction endonuclease 10 20 U 5OuL Total volume 12 Incubate the tubes for 3 h at 50 C 13 After digestion purify cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 ul of sterile RNase free water 36 Trimmer 2 cDNA normalization kit Appendix D The resulting ds cDNA can be applied for ABI SOLIiD or Illumina Solexa sequencing Please contact your sequencing facility for further instruction on ds cDNA processing Appendix E Processing of normalized cDNA flanked at 3 end with CDS 4M adapter before Roche 454 sequencing Reagents required e Amplified ds cDNA from step 42 of the Normalization protocol flanked by Plug Oligo 3M and CDS 4M adapter sequences e Encyclo PCR Kit Evrogen Cat PKOO1 or analogues e QlAquick PCR Purification Kit Qiagen e Sterile molecular biology grade water sterile RNase free water e Agarose gel electrophoresis reagents e DNA size markers 1 kb DNA ladder cDNA amplification with 454 PCR Primer mix Note In order to obtain sufficient amount of n
48. of normalized cDNA before SOLID or Illu mina sequencing 2s AppendixE Processing of normalized cDNA flanked at 3 end with CDS 4M adapter before Roche 454 sequencing Appendix F Processing of normalized cDNA flanked at 3 end with CDS Gsu adapter before Roche 454 sequencing XI Troubleshooting voi eck ab skh ee a ek de Re ir cd ae Ww e de cade to XII References 2 4 4 2 suis ad we Boe SORE ES oH Ge oe BEES Endnotes ee ek a ek nou Intended use In an eukaryotic cell the mRNA population constitutes approximately 1 of total RNA with the number of transcripts varying from several thousand to several tens of thousands Normally the high abundance transcripts several thousand MRNA copies per cell of as few as 5 10 genes account for 20 of the cellular MRNA The intermediate abun dance transcripts Several hundred copies per cell of 500 2000 genes constitute about 40 60 of the cellular mRNA The remaining 20 40 of MRNA is represented by rare transcripts from one to several dozen mRNA copies per cell 1 Such an enormous difference in abundance complicates large scale transcriptome analysis which results in recur rent sequencing of more abundant cDNAs cDNA normalization decreases the prevalence of high abundance tran scripts and equalizes transcript concentrations in a cDNA sample thereby dramatically increasing the efficiency of sequencing and rare gene discovery Trimmer 2 kit is designed
49. ontents by gently flicking the tube Spin the tube briefly in a microcentrifuge Aliquot 100 uL of PCR mixture into two sterile 0 2 ml PCR tubes If the thermal cycler used is not equipped with a heated lid overlay each reaction with two drops of mineral oil Close the tubes and place them into a thermal cycler Subject the tubes to PCR cycling using the following program Initial denaturation 95 C 1 min Cycling 12 cycles 95 C 15 sec 66 C 20 sec 72 C 3 min When cycling is complete analyze 5 ul aliquots of each ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v Trimmer 2 cDNA normalization kit Appendix F agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration 8 If electrophoresis indicates poor yield of PCR products subject the tubes to two more PCR cycles and repeat the electrophoresis gt Note If low molecular weight poor yield or no PCR product is ob served in the samples after PCR amplification see Troubleshooting Section XI G 9 Pool the reaction mixtures from two identical tubes with amplified normalized cDNA into a new sterile tube 10 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water Digestion of the ds cDNA with Gsul restriction endonuclease 9 For each cDNA sample from step 10 above combine the following reagents in a sterile 0 5 mL tube 43uL Amplified ds
50. or intended application aH AAAAALL_ LH AAAAALD ma n LH TITTT Fig 1 DSN normalization scheme Black lines represent abundant transcripts blue lines rare transcripts Rectangles represent adapter sequences and their comple ments Trimmer 2 cDNA normalization kit Il Method overview Trimmer 2 kit utilizes a duplex specific nuclease based cDNA normali zation method 2 3 The method is based on nucleic acid hybridization kinetics 4 and unique properties of the duplex specific nuclease DSN specific to the double stranded ds DNA 5 Normalization procedure is illustrated in Fig 1 After denaturation of ds cDNA flanked with known adapters it is Subjected to renaturation During renaturation abundant transcripts convert to the ds form more effectively than those that are less frequent 4 6 Thus two fractions are formed specifically a ds fraction of abundant cDNA and a normal ized single stranded ss cDNA The ds cDNA fraction is then degraded by DSN DSN is an enzyme from Kamchatka crab that displays a strong prefer ence for cleaving ds DNA compared to ss DNA and RNA irrespective of the sequence length Fig 2 Owing to DSN thermostability Fig 3 ds DNA degradation is performed under conditions of cDNA renaturation that prevent the formation of Secondary structures and non specific hy bridization involving adapter sequences within the ss cDNA fraction The remaining normalized ss DNA is amplified by
51. ormalized ds cDNA for di rect application in high throughput sequencing we recommend setting up PCR amplification with 454 PCR primer mix in two identical 100 UL reac tions The total amount of ds cDNA after amplification is anticipated to be in a range of 3 4 ug 15 ng uL 1 Combine 2 uL of the normalized cDNA from step 42 of the Norma lization protocol with 38 uL of sterile RNase free water in a new sterile 1 5 mL tube Mix the contents by gently flicking the tube Spin the tube briefly in a microcentrifuge gt Note If the normalized cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining ds cDNA at 20 C 2 For each cDNA sample from step 1 above prepare PCR mixture combining the following reagents in the order shown www evrogen com EM Appendix E 160 UL Sterile RNase free water 20uL 10X Encyclo buffer 4 uL 50X dNTP mix 10mM each 8 uL 454 PCR Primer mix 10 uM each 4 uL Diluted normalized cDNA from step 1 above 4 uL 50X Encyclo polymerase mix 200 uL Total volume 3 Mix the contents by gently flicking the tube Spin the tube briefly in a microcentrifuge 4 Aliquot 100 uL of PCR mixture into two sterile PCR tubes 5 If the thermal cycler used is not equipped with a heated lid overlay each reaction with two drops of mineral oil Close the tubes and place them into a thermal cycler 6 Subject the tubes
52. ppears ac ceptable based on spectrophotometric analysis a high content of tRNA may result in the mis es timation of the mRNA concentration If you have not already done so use denaturing formalde hyde agarose gel electrophoresis to estimate the concentration and quality of your RNA If there is a high tRNA content remove the low molecular weight RNA fraction using RNA purifi cation columns The PCR product is visualized as a very intense smear none of the expected bright bands are distinguishable see Fig 11 and or the smear appears in the high molecular weight region of the gel Possible cause Solution If bands are expected but not visible and the background smear is very intense PCR overcycling may be an issue The 72 C elongation step may be too long An extended elongation may promote concatemerization of the cDNA adapter sequences Repeat PCR amplification with a fresh first strand cDNA sample using two or three fewer PCR cycles Please note that cDNA prepared from some mammalian tissues e g human brain spleen and thymus may not show bright bands due to the very high complexity of the starting RNA Concatemers may be confirmed by cDNA se quencing If this is the case repeat the cDNA synthesis using modified PCR parameters in which the 72 C elongation step is decreased by up to 2 min www evrogen com continued on next page XI Troubleshooting Possible cause So
53. quencing CDS 4M adapter Roche 454 see Appendix E sequencing PlugOligo 1 and CDS Gsu adapters Roche 454 see Appendix F OR sequencing SMARTer II A Oligonucleotide and CDS Gsu adapter www evrogen com a X Appendixes Appendix A cDNA synthesis and amplification using SMART based kit Clontech Reagents required e Purified RNA for cDNA synthesis at least 1 2 ug of total RNA or gt 0 5 1 ug of polyA RNA The RNA may be isolated using a number of suitable methods that yield stable RNA preparations from most biological sources two examples are the TRIzol method Gibco Life Technologies and the RNeasy kit Qia gen Total RNA can also be isolated as described in 9 Following RNA isolation RNA quality should be estimated using dena turing formaldehyde agarose gel electrophoresis as described by Sam brook 10 The RNA length generally depends on the RNA source however if experimental RNA is not larger than 1 5 kb we suggest you prepare fresh RNA after checking the quality of the RNA purification reagents If problems persist you may need to find another source of tissue cells In general genomic DNA contamination does not affect cDNA synthesis meaning that DNase treatment is not required When necessary excess genomic DNA can be removed by LiCl precipitation or phenol chloroform extraction SMART based kit Clontech Please refer to the section IV cDNA preparation to choose the kit suit able for your
54. ray J Lewis M Raff K Roberts and J D Watson Molecular Biology of the Cell 3rd ed Garland Publishing New York 1994 PA Zhulidov E A Bogdanova A S Shcheglov L L Vagner G L Khaspekov V B Kozhemyako M V Matz E Meleshkevitch L L Moroz S A Lukyanov and D A Shagin 2004 Simple cDNA normalization using kamchatka crab duplex specific nuclease Nucleic Acids Res 32 3 e37 pmid 14973331 PA Zhulidov E A Bogdanova A S Shcheglov I A Shagina L L Wagner G L Khazpekov V V Kozhemyako S A Lukyanov and D A Shagin 2005 A method for the preparation of normalized cDNA libraries enriched with full length sequences Bioorg Khim 31 2 186 194 pmid 15889793 B D Young and M L M Anderson Quantitative analysis of so lution hybridisation In Nucleic Acid Hybridisation a practical approach Ed by B D Hames and S J Higgins IRL Press Ox ford Washington DC 1985 pp 47 71 D A Shagin D V Rebrikov V B Kozhemyako I M Altshuler A S Shcheglov PA Zhulidov E A Bogdanova D B Staroverov V A Rasskazov and S Lukyanov 2002 A novel method for SNP detection using a new duplex specific nuclease from crab hepatopancreas Genome Res 12 12 1935 1942 pmid 12466298 N G Gurskaya L Diatchenko A Chenchik PD Siebert G L Khaspekov K A Lukyanov L L Wagner O D Ermolaeva S A Lukyanov and E D Sverdlov 1996 Equalizing cDNA subtrac tion based o
55. rce kit 3 end adapter Source kit Roche 454 PlugOligo 3M CDS 4M sequencing Mint 2 kit Evrogen Mint 2 kit Evrogen SMART IV Oligonucleotide CDS 4M SMART cDNA Library Trimmer 2 kit Evrogen Construction Kit Clontech PlugOligo 1 CDS Gsu Mint 2 kit Evrogen Mint 2 kit Evrogen SMARTer II A Oligonucleotide CDS Gsu SMARTer kit Clontech Trimmer 2 kit Evrogen SOLID and Ilumina PlugOligo 3M CDS 4M sequencing Mint 2 kit Evrogen Mint 2 kit Evrogen directional cDNA library cloning SMART IV Oligonucleotide CDS 4M SMART cDNA Library Trimmer 2 kit Evrogen Construction Kit Clontech The presence of long poly A T tails in cDNA may result in sequencing reads of low quality when using Roche 454 sequencing platform Two special 3 end adapters are designed to overcome this problem CDS 4M adapter with a poly T part built of thymidines interspersed with other nu cleotides CDS Gsu adapter containing a Gsul recognition site Fig 4 just upstream of the poly T sequence Restriction enzyme Gsul cuts cDNA within the poly A tail reducing its length so that all subsequent sequences start with a shorter run of thymidines Both CDS 4M and CDS Gsu adapters allow synthesis of cDNA suitable for Roche 454 sequencing The choice of a particular adapter should be made by the end user Use of CDS 4M adapter does not require an additional digestion step before cDNA sequenc ing howe
56. s heat the RNA samples at 65 C for 1 2 min mix the contents by gently flicking the tube to prevent RNA aggregation and then spin the tube briefly in a microcentrifuge 2 For each RNA sample combine the following reagents in a sterile PCR tube 1 3 uL RNA solution in sterile RNase free water 1 2ug of total RNA or 0 5 1 ug of polyA RNA For the control reaction use 1 uL 1 ug of the control RNA 1 uL 5 end adapter 1 UL 3 end adapter X UL Sterile RNAse free water 5 UL Total volume Refer to Section IV cDNA preparation to choose the adapter pair that can be used with the SMART based cDNA synthesis kit www evrogen com A Appendix A 3 10 Gently pipette the reaction mixtures and spin the tubes briefly in a microcentrifuge If the thermal cycler used is not equipped with a heated lid overlay each reaction with a drop of molecular biology grade mineral oil to prevent the loss of volume due to evaporation Incubate the mixture in a thermal cycler at 70 C for 2 min use heated lid Decrease the incubation temperature to 42 C Keep the tubes in the thermal cycler at 42 C while preparing the RT master mix 1 to 3 min While steps 4 and 5 are ongoing prepare an RT master mix for each reaction tube by combining the following reagents in the or der shown 2 uL 5X First strand buffer 1 uL DTT 20 mM 1 uL 50X dNTP 1 uL SMARTScribe MMLV Reverse Transcriptase 5 UL Total volume Note
57. tion using control cDNA template provided in the Trimmer 2 kit Repeat the nor malization using fresh aliquots of experimental cDNA Repeat normalization using more cDNA The optimal number of PCR cycles may vary with different PCR machines polymerase mixes or cDNA samples Try optimizing PCR cycling pa rameters After PCR parameter optimization repeat PCR using fresh aliquots of cDNA from step 26 of the Normalization protocol Optimization of PCR parameters may include a decreasing the annealing temperature in in crements of 2 4 C b optimizing the denaturation temperature by decreasing or increasing it in 1 C increments and or c increasing the extension time in 1 min increments To test that all components work properly per form control normalization using control cDNA template provided in the Trimmer 2 kit www evrogen com XI Troubleshooting PCR products from the Control tube are overamplified after 7 PCR cycles Possible cause Solution The concentration of Repeat normalization using less cDNA starting cDNA is too high XI C Amplification of normalized cDNA step 40 Section VII A low molecular weight product a poor yield or no PCR products is obtained from tubes containing normalized DSN treated cDNA but a high quality PCR product is obtained from the control tube Possible cause Solution The DSN treatment may Make sure that the DSN enzyme was thoroughly have b
58. ty of the starting cDNA using agarose gel electrophoresis continued on next page Trimmer 2 cDNA normalization kit XI Troubleshooting Possible cause Solution If the concentration of PCR product is low but the quality is good the concentration of starting cDNA may be too low Perform control cDNA amplification using con trol cDNA sample provided in the Trimmer 2 kit instead of experimental normalized cDNA Repeat the amplification using a fresh aliquot of normalized cDNA from step 42 Repeat the PCR amplification using more cDNA The PCR conditions may have not been opti mal The optimal number of PCR cycles may vary when different PCR machines polymerases and RNA templates are used Optimization of PCR parameters may include a decreasing the annealing temperature in in crements of 2 4 C b optimizing the denaturation temperature by decreasing or increasing it in 1 C increments and or c increasing the extension time in 1 min increments 3 0 kb _ 0 5 kb _ www evrogen com Fig 11 Agarose gel electrophoresis of non normal ized lane 1 and normalized cDNA lanes 2 4 that has been PCR amplified using a too long extension step 6 min No bright bands are visible and the normalized cDNA appears as a smear starting from the high molecular weight region of the gel Lane M shows a 1 kb DNA size marker XII 1 2 4 5 6 References B Alberts D B
59. ubes on ice Preheat the DSN master buffer at 68 C for 3 5 min Add 5 uL of the hot DSN master buffer to each tube containing hy bridized cDNA step 17 spin the tube briefly in a microcentrifuge and return it quickly to the thermal cycler Note Do not remove the tubes from the thermal cycler except for the time necessary to add preheated DSN master buffer Incubate the tubes at 68 C for 10 min Add DSN enzyme as specified in Table 2 After the addition of DSN return the tube immediately to the thermal cycler Note Do not remove the tubes from the thermal cycler except for the time needed for addition of the DSN enzyme If the tube is left at room temperature after the addition of DSN non specific digestion 14 Trimmer 2 cDNA normalization kit 25 24 25 26 VII Normalization protocol of secondary structures formed by ss DNA may occur decreasing the efficiency of the normalization Incubate the tubes in the thermal cycler at 68 C for 25 min Add 5 uL of DSN stop solution mix contents and spin the tubes briefly in a microcentrifuge Incubate the tubes in the thermal cycler at 68 C for 5 min Then place the tubes on ice Add 25 uL of sterile RNAse free water to each tube Mix contents and spin the tubes briefly in a microcentrifuge Place the tubes on ice The samples obtained can be stored at 20 C up to two weeks and used afterwards to prepare more normalized cDNA Vil 27 28
60. ulation by about 1000 fold for the most abundant transcripts but typically doesn t change the concentrations of medium abundance transcripts The concentrations of rare molecules may slightly increase or they may remain the same As a result the normalized cDNA is enriched for rare transcripts but also includes medium and high abundance transcripts Either quantitative PCR qPCR or virtual Northern blot 8 can be used to estimate the efficiency of normalization prior to cDNA cloning or sequencing Comparing the abundance levels of already studied tran scripts before and after normalization one can see a relative reduction in the representation level of abundant transcripts in a normalized cDNA sample in comparison with a non normalized one Alternatively clones may be randomly picked and sequenced from nor malized and non normalized cDNA libraries and the gene discovery rates may be compared between the libraries A successfully nor malized cDNA library will have a higher gene discovery rate than a non normalized library however the particular characteristics of a given library will depend on the initial CDNA redundancy the cDNA GC content the number of clones tested etc Some problems that may occur during an analysis of normalization efficiency are discussed in the Troubleshooting subsection XI E 20 Trimmer 2 cDNA normalization kit VIII Analysis of normalization efficiency Analysis of normalization efficiency
61. ver even modified poly A T tails of cDNA may affect the sequence quality on some Roche 454 platforms cDNA prepared with CDS Gsu adapter and digested by Gsul enzyme contains shorter poly A T tails that do not harm sequencing However cDNAs containing intrinsic Gsul recognition sites will be digested as well potentially resulting in difficulties with contig assembly 8 Trimmer 2 cDNA normalization kit V General considerations AVOID getting drops of the reaction mixture on the walls of the reac tion tubes or inside the mineral oil fraction Even a small aliquot of nonDSN treated cDNA will corrupt normalization results Wear gloves to protect RNA and cDNA samples from degradation by nucleases Use PCR pipette tips containing hydrophobic filters to minimize con tamination After the solution is just thawed we strongly recommend that you mix it by gently flicking the tube then spin the tube briefly in a microcent rifuge to deposit contents at the bottom before use Add enzyme to the reaction mixture last and thoroughly mix it by gen tly pipetting the reaction mixture up and down Do not increase the amount of enzymes added or concentration of RNA and cDNA in the reactions The amounts and concentrations have been carefully opti mized Thin wall PCR tubes are recommended These PCR tubes are opti mized to ensure more efficient heat transfer and to maximize ther mal cycling performance We recommend that you use 0 2 ml PCR tubes
62. xample pDNR LIB or p TriplEx2 vectors from Clontech linearized using Sfil restriction endonuclease Appendix D Processing of normalized cDNA before SOLiD or Illumina sequencing Reagents required e Normalized ds cDNA from step 42 of the Normalization protocol flanked by adapter sequences containing asymmetric Sfil A and Sfil B sites e Sfil restriction endonuclease supplied with 10X reaction buffer e Encyclo PCR Kit Evrogen Cat PKOO1 or analogues e QlAquick PCR Purification Kit Qiagen 34 Trimmer 2 cDNA normalization kit Appendix D e Sterile molecular biology grade water sterile RNase free water e Agarose gel electrophoresis reagents e DNA size markers 1 kb DNA ladder Amplification of ds cDNA Note In order to obtain sufficient amount of normalized ds cDNA for di rect application in high throughput sequencing we recommend setting up PCR amplification with M1 primer in two identical 100 UL reactions The total amount of ds cDNA after amplification is anticipated to be in a range of 3 4 ug w 15 ng uL 1 Aliquot 2 uL of normalized cDNA from step 42 of the Normalization protocol into a sterile 1 5 mL tube add 20 uL of sterile RNAse free water to the tube mix well by vortexing and spin the tubes briefly in a microcentrifuge gt Note If the normalized cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining ds cDNA

Trimmer-2 manual

Contents

Download Pdf Manuals

Related Search

Related Contents