Home

U6 RNAi Entry Vector (BLOCKiT)

1. GTTAGAGAGA TAATTAGAAT TAATTTGACT GTAAACACAA AGATATTAGT ACAAAATACG TGACGTAGAA U6 forward priming site AGTAATAATT TCTJ TGGGTAG a TIGCAGTTT TAAAATTATG TTTTAAAATG GACTATCATA TGCTTACCGT AACTTGAAAG Transcriptional start Pol Ill terminator EATTTCEGATE ATAAAGCTAA TCT1 GGCTTT ATATATCTTG TGGAAAGGAC GARMISCH TTTTTTCTAG ACCCAGCTTT AGAACCGAAA TATATAGAAC ACCTTTCCTG CTTTGTGG S BANA AAGATC TGGGTCGAAA r 1 r attL2 CTTGTACAAA GAACATGTTT TCATTATTTG GTTGGCATTA TAAGAAAGCA TTGCTTATCA ATTTGTTGCA ACGAACAGGT CACTATCAGT CAAAATAAAA CAACCGTAAT M13 reverse priming site r 1 CCATCCAGCT GATATCCCCT ATAGTGAGTC GTATTACATG GTCATAGCTG TTTCCTGGCA GCGGCAGCTC 13 Generating the Double Stranded Oligo ds oligo Introduction Single Stranded Oligos Amount of DNA Oligo to Anneal Resuspending the Oligos Re annealing LacZ ds Control Oligo 14 Once you have synthesized the appropriate complementary single stranded DNA oligos you will anneal equal amounts of each single stranded oligo to generate a double stranded oligo ds oligo Guidelines and instructions are provided in this section Before beginning make sure that you have synthesized the single stranded oligos with the appropriate sequences required for cloning into the pENTR U6 vector and for annealing See the figure below for an illustration e Top strand oligo Make s
2. 5 overhangs Allows ligase mediated directional cloning of the double stranded oligonucleotide of interest Pol III terminator Allows efficient termination of RNA Polymerase III dependent transcription M13 reverse priming site Allows sequencing of the insert Kanamycin resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori Permits high copy replication and maintenance in E coli Map of pcDNA 1 2 V5 GW lacZ Description pcDNA 1 2 V5 GW lacZ 6498 bp is a control vector expressing a C terminally tagged B galactosidase fusion protein under the control of the human cytomegalovirus CMV promoter Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 and was generated using the MultiSite Gateway Three Fragment Vector Construction Kit available from Invitrogen Catalog no 12537 023 Briefly a MultiSite Gateway LR recombination reaction was performed with pDEST R4 R3 and entry clones containing the CMV promoter lacZ gene and V5 epitope and TK polyadenylation signal Cole and Stacy 1985 to generate the pcDNA 1 2 V5 GW lacZ vector B galactosidase is expressed as a C terminal V5 fusion protein with a molecular weight of approximately 119 kDa The complete sequence of pcDNA 1 2 V5 GW lacZ is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 38 pcDNA 1 2 V5 GW lacZ C
3. e Guidelines to transfect your PENTR U6 construct into mammalian cells e Guidelines to perform an LR recombination reaction with a suitable Gateway destination vector to generate an expression clone For detailed instructions to perform the LR recombination reaction refer to the manual supplied with the destination vector that you are using The BLOCK iT U6 RNAi Entry Vector Kit is designed to help you generate a U6 promoter based vector to express shRNA in mammalian cell lines for RNAi analysis Although the kit has been designed to help you express shRNA representing a particular target sequence in the simplest most direct fashion use of the kit for RNAi analysis assumes that users are familiar with the principles of gene silencing vector based production of shRNA and transfection in mammalian systems We highly recommend that users possess a working knowledge of the RNAi pathway and lipid mediated transfection For more information about the RNAi pathway and expression of shRNA in mammalian cells refer to published references Brummelkamp et al 2002 McManus and Sharp 2002 Paddison et al 2002 Paul et al 2002 Sui et al 2002 Yu et al 2002 TM A large variety of BLOCK iT RNAi products are available from Invitrogen to facilitate your RNAi analysis If you want to express an shRNA in mammalian cell lines in a regulated manner use the BLOCK iT Inducible H1 RNAi Entry Vector Kit Catalog no K4920 00 If
4. W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Bernstein E Caudy A A Hammond S M and Hannon G J 2001 Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference Nature 409 363 366 Bogenhagen D F and Brown D D 1981 Nucleotide Sequences in Xenopus 55 DNA Required for Transcription Termination Cell 24 261 270 Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Bosher J M and Labouesse M 2000 RNA Interference Genetic Wand and Genetic Watchdog Nature Cell Biol 2 E31 E36 Brummelkamp T R Bernards R and Agami R 2002 A System for Stable Expression of Short Interfering RNAs in Mammalian Cells Science 296 550 553 Carrington J C and Ambros V 2003 Role of MicroRNAs in Plant and Animal Development Science 301 336 338 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H a
5. discard the ds oligo solution and prepare new diluted stocks using the procedure on the previous page Note If the 50 uM ds oligo solution undiluted stock becomes heated the oligos are sufficiently concentrated and may be re annealed following the annealing procedure on page 15 You may verify the integrity of your annealed ds oligo using agarose gel electrophoresis if desired We suggest running an aliquot of the annealed ds oligo 5 ul of the 500 nM stock and comparing it to an aliquot of each starting single stranded oligo dilute the 200 uM stock 400 fold to 500 nM use 5 ul for gel analysis Be sure to include an appropriate molecular weight standard We generally use the following gel and molecular weight standard e Agarose gel 4 E Gel Invitrogen Catalog no G5000 04 e Molecular weight standard 10 bp DNA Ladder Invitrogen Catalog no 10821 015 When analyzing an aliquot of the annealed ds oligo reaction by agarose gel electrophoresis we generally see the following e lt A detectable higher molecular weight band representing annealed ds oligo e lt A detectable lower molecular weight band representing unannealed single stranded oligos Note that this band is detected since a significant amount of the single stranded oligo remains unannealed For an example of expected results obtained from agarose gel analysis see the next page If the band representing ds oligo is weak or if you do not see a band see
6. pENTR U6 Incorrect vector insert ratio used Dilute the 50 uM ds oligo mixture as in ligation reaction instructed on page 16 to generate a 5 nM stock e Forgot to dilute annealed ds Use the 5 nM ds oligo stock for cloning oligo or LacZ ds Control Oligo 1 10 000 before use e Annealed ds oligo diluted incorrectly Ligation reaction not adequately e Mix the ligation reaction well by pipetting mixed or incorrectly mixed up and down prior to incubation Note Flicking the tube is not adequate to mix the reagents e Do not vortex the ligation reaction Did not use the 5X Ligation Use the T4 DNA Ligase and 5X Ligation Buffer supplied with the kit Buffer supplied with the kit for ligation as these reagents have been optimized to facilitate 5 minute ligation at room temperature Important Other T4 DNA Ligase and ligation buffers may not support 5 minute room temperature ligation Ligation reaction not incubated Extend the incubation time of the ligation for long enough reaction up to 2 hours at room temperature Ligation reaction incubated The ligation conditions used to clone the ds overnight at 16 C oligo into pENTR U6 differ from traditional ligation conditions Incubate the ligation reaction at room temperature for 5 minutes continued on next page 31 Troubleshooting continued Ligation and Transformation Reactions continued Problem Reason Solution Few
7. 3 385 pmoles The sequences of the lacZ control oligos are listed below The lacZ control DNA Sequences oligos are annealed and are supplied in the kit as a 50 uM double stranded oligo The lacZ ds control oligo needs to be re annealed and diluted 10 000 fold to 5 nM see page 15 before use in the ligation reaction page 19 LacZ DNA Oligo Sequence Top strand 5 CACCGCTACACAAATCAGCGATTTCGAAAAATCGCTGATTTGTGTAG 3 Bottom strand 5 AAAACTACACAAATCAGCGATTTTTCGAAATCGCTGATTTGTGTAGC 3 One Shot TOP10 Reagents Genotype of TOP10 Cells The following reagents are included in the One Shot TOP10 Chemically Competent E coli kit Box 2 Transformation efficiency is 2 1 x 10 cfu ug plasmid DNA Store Box 2 at 80 C Reagent Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at 4 C or 0 596 Yeast Extract room temperature 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 21 x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 0 5 mM 50 ul EDTA pH 8 F mer A A mrr hsdRMS mcrBC 680lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG continued on next page Kit Contents and Storage continued BLOCK iT Lentiviral RNAi Expression Reagents In addition to the BLOCK iT U6 RNAi Entry Vector Kit the BLOCK iT Lentiviral RNAi Expression System Catalog no K4944 00 also includes the f
8. 30 50 GC content is suggested e Donot choose a target sequence that is a known site for RNA protein interaction Homology Make sure that the target sequence does not contain significant homology to other genes as this can increase off target RNAi effects Orientation You may choose a target sequence encoding the sense sequence of the target mRNA or the antisense sequence Thus you can generate an shRNA in two possible orientations sense sequence loop antisense sequence or antisense sequence loop sense sequence siRNA If you have identified a synthetic siRNA that is active in knocking down your target gene try generating an shRNA using this same target sequence continued on next page Designing the Single Stranded DNA Oligos continued Loop Sequence Transcription Initiation Note You may use a loop sequence of any length ranging from 4 to 11 nucleotides although short loops i e 4 7 nucleotides are generally preferred Avoid using a loop sequence containing thymidines T s as they may cause early termination This is particularly true if the target sequence see the previous page ends in a T residue Note We have included the following loop sequences in active shRNA molecules e 5 CGAA 3 e 5 AACG 3 e 5 GAGA 3 Transcription of the shRNA initiates at the first base following the end of the U6 promoter sequence In the top strand oligo the transcription initiation site corresponds to the f
9. AAAA continued on next page Analyzing Transformants continued v N MENO Oo O E NOU N Long Term Storage What to Do Next In some cases you may have difficulty sequencing the ds oligo insert in your pENTR U6 construct This is because the hairpin sequence is an inverted repeat that can form secondary structure during sequencing resulting in a drop in the sequencing signal when entering the hairpin If you have difficulty sequencing your entry constructs we suggest trying the following to improve your sequencing results e Use high quality purified plasmid DNA for sequencing We recommend preparing DNA using Invitrogen s PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 or S N A P MidiPrep Kit Catalog no K1910 01 e Add DMSO to the sequencing reaction to a final concentration of 5 e Increase the amount of template used in the reaction up to twice the normal concentration e Standard sequencing kits typically use dITP in place of dGTP to reduce G C compression Other kits containing dGTP are available for sequencing G rich and GT rich templates If you are using a standard commercial sequencing kit containing dITP obtain a sequencing kit containing dGTP e g dGTP BigDye Terminator v3 0 Cycle Sequencing Ready Reaction Kit Applied Biosystems Catalog no 4390229 and use a 7 1 molar ratio of dITP dGTP in your sequencing reaction Once you have identified the correct en
10. Chemically Competent E coli 20x 50 ul C4040 03 40 x 50 ul C4040 06 One Shot Stbl3 Chemically Competent E coli 20 x 50 pl C7373 03 continued on next page Guidelines to Perform the LR Recombination Reaction continued Important Materials Needed Performing the LR Recombination Reaction We recommend performing the LR recombination reaction using a TM Supercoiled attL containing pENTR U6 entry clone Supercoiled attR containing destination vector You will need the following reagents to perform the LR recombination reaction Purified plasmid DNA of your pENTR U6 entry clone 50 150 ng yl in TE Buffer pH 8 0 Destination vector of choice 150 ng ul in TE Buffer pH 8 0 LR Clonase II enzyme mix Invitrogen Catalog no 11791 020 TE Buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA 2 ug ul Proteinase K solution supplied with the LR Clonase II enzyme mix Appropriate chemically competent E coli host and growth media for expression S O C Medium Appropriate selective plates For detailed guidelines and instructions to perform the LR recombination reaction with an appropriate destination vector and transform competent F coli refer to the manual for the destination vector you are using 29 Troubleshooting Introduction Use the information in this section to troubleshoot the annealing cloning transformation and transfection procedures Anneal
11. Quickly screen for an RNAi response in your mammalian cell line Once you have tested various shRNA target sequences using transient transfection you may transfer the optimal shRNA cassettes into suitable destination vectors for use in other RNAi applications e g stable expression in mammalian cells You may express the shRNA and assay for knockdown of the target gene by transfecting your PENTR U6 construct directly into any mammalian cell line of choice However because the pENTR U6 vector does not contain a selection marker only transient RNAi analysis may be performed If you wish to generate stable cell lines see page 28 A number of factors can influence the degree to which expression of your gene of interest is reduced i e gene knockdown in an RNAi experiment including e Transfection efficiency e Transcription rate of the target gene of interest e Stability of the target protein e Growth characteristics of your mammalian cell line e Efficacy of the shRNA of interest Take these factors into account when designing your RNAi experiments Once you have obtained your entry clone you must isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol or sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the P
12. Troubleshooting page 30 for tips to troubleshoot your annealing reaction continued on next page 17 Generating the Double Stranded Oligo ds oligo continued Example of Expected Results 18 bp 100 50 40 30 20 Bin T In this experiment the lacZ control oligos see page ix for the sequence of each DNA oligo were annealed 50 uM final concentration using the reagents supplied in the kit and following the procedure on page 15 to generate the lacZ ds control oligo The annealing reaction was diluted 100 fold in water to a concentration of 500 nM Aliquots of the diluted ds oligo 5 ul and each corresponding single stranded oligo 5 ul of a 500 nM stock were analyzed on a 4 E Gel Results The lacZ oligo annealing reaction shows a clearly detectable higher molecular weight band that differs in size from each component single stranded oligo Remaining unannealed ss oligo is also detectable Note The agarose gel is non denaturing therefore the single stranded oligos do not resolve at the expected size due to formation of secondary structure Lane 1 10 bp DNA Ladder Lane 2 lacZ top strand oligo my Lane 3 lacZ bottom strand oligo lt ds oligo Lane 4 lacZ ds oligo annealing reaction Lane 5 10 bp DNA Ladder ss oligo Performing the Ligation Reaction Introduction Important Amount of ds Oligo to Use Positive Control Important Once you have generated your
13. sequencing results Loss of sequencing signal in the hairpin region due to secondary structure formation e Use high quality purified plasmid DNA for sequencing e Add DMSO to the sequencing reaction to a final concentration of 5 e Increase the amount of template used for sequencing up to twice the normal amount e Usea7 1 molar ratio of dITP dGTP in your sequencing reaction No colonies obtained on the selective plate Used the wrong antibiotic for selection Select for transformants on LB agar plates containing 50 ug ml kanamycin 32 continued on next page Troubleshooting continued Transfection and RNAi Analysis The table below lists some potential problems and possible solutions that may help you troubleshoot your transfection and knockdown experiment Problem Reason Solution Low levels of gene knockdown observed Low transfection efficiency if using Lipofectamine 2000 Reagent e Antibiotics added to the media during transfection e Cells too sparse at the time of transfection e Not enough plasmid DNA transfected e Not enough Lipofectamine 2000 used Do not add antibiotics to the media during transfection Plate cells such that they will be 90 95 confluent at the time of transfection Increase the amount of plasmid DNA transfected Optimize the transfection conditions for your cell line by varying the amount of Lipofectamine 20
14. 00 complexes can be added directly to cells in culture medium in the presence of serum e Removal of complexes medium change or medium addition following transfection are not required although complexes can be removed after 4 6 hours without loss of activity For more information on Lipofectamine 2000 Reagent refer to our Web site www invitrogen com or call Technical Service see page 38 If you have performed the positive control reaction and have cloned the lacZ ds oligo supplied with the kit into pPENTR U6 we recommend using the resulting pENTR U6 GW lacZ entry construct as a positive control to assess the RNAi response in your cell line Simply co transfect the pPENTR U6 GW lacZ NA entry construct and the pcDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into your mammalian cells and assay for knockdown of p galactosidase expression 24 48 hours post transfection using Western blot analysis or activity assay For more information about the pcDNA 1 2 V5 GW lacZ reporter plasmid recommendations for transfection and methods to assay for B galactosidase activity see the next page continued on next page 25 Transfecting Cells continued pcDNA 1 2 V5 GW lacZ Reporter Plasmid Transfecting the LacZ Containing Reagents Assaying for p galactosidase Expression 26 The pcDNA 1 2 V5 GW lacZ reporter plasmid is supplied with the kit for use as a positive control to assay for
15. 00 used Didn t wait long enough after transfection before assaying for gene knockdown Repeat the transfection and wait for a longer period of time after transfection before assaying for gene knockdown Perform a time course of expression to determine the point at which the highest degree of gene knockdown occurs ds oligo insert in your pENTR U6 construct contains mutations When analyzing kanamycin resistant transformants sequence the ds oligo insert to verify its sequence Select constructs containing the correct ds oligo insert for use in RNAi analysis shRNA sequence not optimal due to e Target region selected e Length of the shRNA sequence i e stem length e Loop sequence e Orientation of shRNA sequence Verify that the shRNA sequence does not contain gt 3 tandem T s which can cause premature transcription termination Select a different target region Vary the length of the shRNA sequence e g if the target sequence is 19 bp try increasing the stem length 3 nucleotides Select a different loop sequence Vary the length of the loop Reverse the orientation of the shRNA hairpin sequence e 2 change oligo sequence from sense loop antisense to antisense loop sense orientation continued on next page 33 Troubleshooting continued Transfection and RNAi Analysis continued Problem Reason Solution Cytotoxic effects Too much Lipofectamine 2000 Opt
16. 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 813 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech serviceQinvitrogen com jpinfo invitrogen com eurotech invitrogen com Certificate of Product qualification is described in the Certificate of Analysis CofA available Analysis on our website by product lot number at www invitrogen com cofa Material Data MSDSs are available on our Web site at www invitrogen com On the home Safety Sheets page click on Technical Resources and follow instructions on the page to MSDSs download the MSDS for your product continued on next page 38 Technical Service continued Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instr
17. 90 Flavonoid Genes in Petunia Addition of a Limited Number of Gene Copies May Lead to a Suppression of Gene Expression Plant Cell 2 291 299 continued on next page 45 References continued Voinnet O Pinto Y M and Baulcombe D C 1999 Suppression of Gene Silencing A General Strategy Used by Diverse DNA and RNA Viruses of Plants Proc Natl Acad Sci USA 96 14147 14152 Weiss B Jacquemin Sablon A Live T R Fareed G C and Richardson C C 1968 Enzymatic Breakage and Joining of Deoxyribonucleic Acid VI Further Purification and Properties of Polynucleotide Ligase from Escherichia coli Infected with Bacteriophage T4 J Biol Chem 243 4543 4555 White R J 1998 RNA Polymerase III Transcription New York NY Springer Verlag Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 Yu J Y DeRuiter S L and Turner D L 2002 RNA Interference by Expression of Short interfering RNAs and Hairpin RNAs in Mammalian Cells Proc Natl Acad Sci USA 99 6047 6052 Zamore P D 2001 RNA Interference Listening to the Sound of Silence Nat Struct Biol 8 746 750 2003 2007 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 46 invitrogen Corporate Head
18. GripTite 293 MSR cells Invitrogen Catalog no R795 07 were grown to 90 confluence Individual wells in a 24 well plate were transfected using Lipofectamine 2000 Reagent with 700 ng of plasmid DNA 100 ng of the pcDNA 1 2 V5 GW lacZ reporter plasmid and 600 ng of non specific plasmid DNA In some wells the reporter plasmid was co transfected with 600 ng of the pENTR U6 GW lacZ or pENTR U6 GW luc 4 constructs Cell lysates were prepared 48 hours after transfection and assayed for galactosidase activity Results Potent and specific inhibition of B galactosidase activity is evident from the lacZ derived shRNA and not from the luciferase derived shRNA Untransfected Reporter only pENTR U6 GW lacZshRNA pENTR U6 GW lucshRNA Transfection Condition 27 Guidelines to Perform the LR Recombination Reaction Introduction Appropriate Destination Vectors E coli Host 28 TM The pENTR U6 vector contains attL sites to facilitate transfer of your U6 RNAi cassette U6 promoter ds oligo of interest Pol III terminator into an appropriate Gateway destination vector to generate an expression clone We recommend generating an expression clone if you wish to perform RNAi applications including e Delivery of the shRNA of interest to hard to transfect or non dividing mammalian cells e Generation of stable cell lines for long term RNAi studies To transfer your U6 RNAi cassette into the destinati
19. Invitrogen BLOCK iT U6 RNAi Entry Vector Kit A Gateway adapted entry vector for the expression of short hairpin RNA shRNA in mammalian cells under the control of a human U6 promoter Catalog nos K4944 00 and K4945 00 Version E 22 June 2007 25 0663 Table of Contents Tableof Contents nsnsi anann 2 2 2222ER eap laces de aa ea e euer iii U6 Entry Clone Generation Procedure for Experienced Users ssssssssssssssseeeet V Kit Contents and Storage iu 22 2a mia e an eie ae d ee RE ERG RII S RS vii Accessory Products bosse eee eese ndi ied e ge ea PI RR ORE e ORE SOART aAa dears xi Introduction anne M 1 OVervie Waren an e A STEPPER ESET a e ote TER TET dee Gao m dede bd d de 1 BEOCK 11 U6 RNAi Entry Vector Ippica est tutela t ta ev NEN DU UE 3 Using shRNA for RNAi Analysis sse a A ST ESE eeren a APEE tenete tenere 5 Experimental Outline nasse aee e hebetes tee de te dat tete ins 8 Meihods este een M 9 Designing the Single Stranded DNA Oligo sse tenete tenente 9 Generating the Double Stranded Oligo ds oligo sss 14 Performing the Ligation Reaction tarere een en RE eA E e E e E TE 19 Transforming One Shot TOP10 Competent E coli aan ea eee ie ene 21 Analyzing Transformants seene iei ee eR ee e Ea Eea ree tese aaea NEE eE SEERE EE e eaei ie 22 Transtechng Celsus t ea eue mend anal btt ec 24 Guidelines to Perform the LR
20. Ligase viii The following reagents are included with the U6 RNAi Entry Vector Box 1 Store the reagents at 20 C control plasmid Reagent Composition Amount pENTR U6 vector 0 5 ng l in 4x10 ul linearized 10 mM Tris HCl pH 8 0 1mM EDTA pH 8 0 10X Oligo Annealing Buffer 100 mM Tris HCl pH 8 0 250 pl 10 mM EDTA pH 8 0 1M NaCl DNase RNase Free Water 3x15 ml 5X Ligation Buffer 250 mM Tris HCl pH 7 6 80 ul 50 mM MgCl 5mM ATP 5 mM DIT 25 w v polyethylene glycol 8000 T4 DNA Ligase 1 Weiss U l in 20 ul 10 mM Tris HCl pH 75 50 mM KCl 1mM DTT 50 v v glycerol U6 Forward Sequencing 100 ng ul in TE Buffer pH 8 0 20 ul Primer M13 Reverse Primer 100 ng ul in TE Buffer pH 8 0 20 ul LacZ double stranded ds 50 uM in 1X Oligo Annealing Buffer 4 ul Control Oligo pcDNA 1 2 V5 GW lacZ 500 ng ul in TE Buffer pH 8 0 20 ul One Weiss unit of T4 DNA Ligase catalyzes the exchange of 1 nmol P labeled pyrophosphate into y p P ATP in 20 minutes at 37 C Weiss et al 1968 One unit is equal to approximately 300 cohesive end ligation units continued on next page Kit Contents and Storage continued Primer Sequences LacZ Control Oligo The table below provides the sequence and the amount supplied of the primers included in the kit Primer Sequence Amount U6 Forward 5 GGACTATCATATGCTTACCG 3 329 pmoles M13 Reverse 5 CAGGAAACAGCTATGAC
21. Recombination Reaction ueeeennnnnennnnnnnn 28 Troubleshooting ene he RSS ee Rep ede Ue et pa art E era t RO RIS 30 PAD DOIN oec one e ede iex 35 Map and Features of pENTR 7U6 eek 35 Map of poDNA 1 2 V5 GW lacZ ep HE TT TUN 37 Technical Service ate as acne nern seele seen 38 Purchaser Notification x ete eee p eee Rin BR Ben sl 40 Gateway Clone Distributtote Poly ee Ei Be 42 Ii E NE een eb Dede NEST EEE Der Ne 43 U6 Entry Clone Generation Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced users of the U6 entry clone generation procedure If you are performing the annealing cloning or transformation procedures for the first time follow the detailed protocols provided in the manual Step Action Design single stranded DNA Follow the guidelines on pages 9 13 to design single stranded DNA oligos oligos encoding the shRNA of interest Anneal the single stranded 1 Setup the following annealing reaction oligos to generate a ds oligo 200 uM top strand oligo 5 ul 200 uM bottom strand oligo 5 ul 10X Oligo Annealing Buffer 2 ul DNase RNase free water 8 ul Total volume 20 ul 2 Heatthe reaction mixture to 95 C for 4 minutes 3 Remove the sample and set on the laboratory bench Allow the reaction to cool to room temperature for 5 10 minutes 4 Spin down the sample in a microcentrifuge for 5 seconds Mix gently Dilute the ds oligo mixture 10 000
22. aling mixture and dilute the ds oligo as directed in Diluting the ds Oligo next page Store the remainder of the 50 uM ds oligo mixture at 20 C continued on next page 15 Generating the Double Stranded Oligo ds oligo continued Diluting the ds Oligo Important Storing the ds Oligo 16 To clone your ds oligo or lacZ ds control oligo into pENTR U6 you must dilute the 50 uM stock to a final concentration of 5 nM i e 10 000 fold dilution We generally perform two 100 fold serial dilutions the first into DNase RNase free water and the second into the 1X Oligo Annealing Buffer supplied with the kit Follow the procedure below to dilute the ds oligo 1 Dilute the 50 uM ds oligo mixture from Annealing Procedure Step 5 previous page 100 fold into DNase RNase free water to obtain a final concentration of 500 nM Vortex to mix thoroughly 50 uM ds oligo 1 ul DNase RNase free water 99 ul Total volume 100 ul 2 Dilute the 500 nM ds oligo mixture from Step 1 100 fold into 1X Oligo Annealing Buffer as follows to obtain a final concentration of 5 nM Vortex to mix thoroughly Store the remaining 500 nM ds oligo stock at 20 C 500 nM ds oligo lul 10X Oligo Annealing Buffer 10 ul DNase RNase free water 89 ul Total volume 100 ul 3 Aliquot the 5 nM ds oligo stock and store at 20 C The undiluted ds oligos are 10 000 fold more concentrated than the working concentration When performing the dilutio
23. any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Invitrogen under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufactur
24. c Liposome Mediated Transfection Nature 337 387 388 Grishok A Pasquinelli A E Conte D Li N Parrish S Ha I Baillie D L Fire A Ruvkun G and Mello C C 2001 Genes and Mechanisms Related to RNA Interference Regulate Expression of the Small Temporal RNAs That Control C elegans Developmental Timing Cell 106 23 34 Hammond S M Bernstein E Beach D and Hannon G J 2000 An RNA Directed Nuclease Mediates Genetic Interference in Caenorhabditis elegans Nature 404 293 296 Hannon G J 2002 RNA Interference Nature 418 244 251 Hutvagner G McLachlan J Pasquinelli A E Balint E Tuschl T and Zamore P D 2001 A Cellular Function for the RNA Interference Enzyme Dicer in the Maturation of the let 7 Small Temporal RNA Science 293 811 813 Jones A L Thomas C L and Maule A J 1998 De novo Methylation and Co Suppression Induced by a Cytoplasmically Replicating Plant RNA Virus EMBO J 17 6385 6393 Ketting R F Fischer S E Bernstein E Sijen T Hannon G J and Plasterk R H 2001 Dicer Functions in RNA Interference and in Synthesis of Small RNA Involved in Developmental Timing in C elegans Genes Dev 15 2654 2659 Kunkel G R Maser R L Calvet J P and Pederson T 1986 U6 Small Nuclear RNA is Transcribed by RNA Polymerase III Proc Natl Acad Sci USA 83 8575 8579 Kunkel G R and Pederson T 1988 Upstream Elements Required
25. d the ligation reaction you will transform your ligation mixture into competent E coli One Shot TOP10 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation Follow the guidelines and instructions provided in this section Note One Shot TOP10 E coli possess a transformation efficiency of 1 x 10 cfu ug DNA You will need to have the following materials on hand before beginning e Ligation reaction from Step 3 previous page e OneShot TOP10 Chemically Competent E coli supplied with the kit Box 2 one vial per transformation thaw on ice immediately before use e S OC Medium supplied with the kit Box 2 warm to room temperature e pUC19 positive control supplied with the kit Box 2 if desired e 42 C water bath e LB plates containing 50 ug ml kanamycin two for each transformation warm at 37 C for 30 minutes before use e LB plates containing 100 ug ml ampicillin if transforming pUC19 control e 37 C shaking and non shaking incubator Use this procedure to transform your ligation reaction into One Shot TOP10 Chemically Competent E coli For a positive control transform 10 pg 1 ul of pUC19 plasmid into a vial of One Shot TOP10 chemically competent E coli 1 Add 2 ul of the ligation reaction from Step 3 previous page into a vial of One Shot TOP10 chemically competent E coli and mix gently Do not mix by pipetting up and down 2 Incubate on ice for 5 to 30 minu
26. ds oligo and have diluted it to the appropriate concentration you will clone the ds oligo into the pENTR U6 vector and transform your ligation reaction into competent TOP10 E coli It is important to have everything you need set up and ready to use to ensure that you obtain the best results We suggest that you read the sections entitled Performing the Ligation Reaction pages 19 20 and Transforming One Shot TOP10 Competent E coli page 21 before beginning You will use T4 DNA Ligase and a 5X Ligation Buffer supplied with the kit to facilitate ligation of your ds oligo with the linearized pENTR U6 vector When performing the ligation reaction note the following e The T4 DNA Ligase and the 5X Ligation Buffer supplied with the kit have been optimized to permit ligation of the ds oligo into the pENTR U6 vector in 5 minutes at room temperature T4 DNA Ligase preparations and reaction buffers available from other manufacturers may not be appropriate for use in this application Note The T4 DNA Ligase and reaction buffer supplied in the BLOCK iT U6 RNAi Entry Vector Kit is available separately from Invitrogen Catalog no 15224 017 e Traditional ligation reactions are performed at 16 C overnight This is not recommended for this application Follow the ligation procedure on page 20 For optimal results use a 10 1 molar ratio of ds oligo insert vector for ligation Note that if you follow the recommended ligation procedure
27. e lists the sequences of top and bottom strand oligos encoding a shRNA targeting the lacZ gene These particular ss oligos were annealed to generate the lacZ ds control oligo supplied in the kit sense target sequence loop antisense target sequence Ir 1 Top strand oligo 5 CACCGCTACACAAATCAGCGATTTCGAAAAATCGCTGATTTGTGTAG 3 sequence required for cloning reverse complement of top strand oligo sequence Bottom strand oligo 5 AAAACTACACAAATCAGCGATTTTTCGAAATCGCTGATTTGTGTAGC 3 sequence required for cloning Annealing ds oligo 5 CACCGCTACACAAATCAGCGATTTCGAAAAATCGCTGATTTGTGTAG 3 3 CGATGTGTTTAGTCGCTAAAGCTTTTTAGCGACTAAACACATCAAAA 5 1 We generally order unpurified desalted single stranded oligos using Invitrogen s S d custom primer synthesis service see www invitrogen com for more information 2 JS The ss oligos obtained anneal efficiently and provide optimal cloning results Note however that depending on which supplier you use the purity and quality of the ss oligos may vary If you obtain variable annealing and cloning results using unpurified desalted oligos you may want to order oligos that are HPLC or PAGE purified continued on next page 12 Designing the Single Stranded DNA Oligos continued Cloning Site and Recombination Region of pENTR U6 521 601 761 921 1069 TCCCAGTCAC Use the diagram below to help you design suitable DNA oligonucleot
28. e a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy page 42 continued on next page Purchaser Notification continued Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 28 CMV Promoter Limited Use Label License No 173 Inhibition of Gene Expression by Double Stranded RNA Limited Use Label License No 177 In vivo Oligonuc leotide Generator Limited Use Label License No 179 Gateway RNAi Vectors The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its com
29. e below and microRNA miRNA Ambros 2001 Carrington and Ambros 2003 have been identified and shown to be capable of triggering gene silencing For more information about the RNAi pathway and the mechanism of gene silencing refer to recent reviews Bosher and Labouesse 2000 Dykxhoorn et al 2003 Hannon 2002 Plasterk and Ketting 2000 Zamore 2001 Small temporal RNA stRNA a subclass of micro RNA miRNA were originally identified and shown to be endogenous triggers of gene silencing in C elegans Grishok et al 2001 Lee et al 1993 Short temporal RNA including let 7 Grishok et al 2001 and lin 4 Lee et al 1993 encode hairpin precursors that are processed by the Dicer enzyme into 21 23 nucleotide siRNA duplexes Hutvagner et al 2001 Ketting et al 2001 that then enter the RNAi pathway and result in gene silencing by blocking translation Short hairpin RNA shRNA are an artificially designed class of RNA molecules that can trigger gene silencing through interaction with cellular components common to the RNAi and miRNA pathways Although shRNA are a structurally simplified form of miRNA these RNA molecules behave similarly to siRNA in that they trigger the RNAi response by inducing cleavage and degradation of target transcripts Brummelkamp et al 2002 Paddison et al 2002 Paul et al 2002 Sui et al 2002 Yu et al 2002 continued on next page Using shRNA for RNAi Analysis continued Structu
30. ector Kit as well as the pLenti6 BLOCK iT DEST destination vector and other reagents required to generate a lentiviral RNAi construct For more information about the pLenti6 BLOCK iT DEST vector and how to generate lentivirus refer to the BLOCK iT Lentiviral RNAi Expression System manual This manual is supplied with the BLOCK iT Lentiviral RNAi Expression System but is also available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 38 Using the BLOCK iT U6 RNAi Entry Vector Kit for vector based expression of shRNA provides the following advantages e Provides a rapid and efficient way to clone double stranded oligonucleotide ds oligo duplexes encoding a desired shRNA target sequence into an entry vector containing an RNA Polymerase III Pol IN driven expression cassette i e U6 RNAi cassette for use in RNAi analysis e The entry construct containing the U6 RNAi expression cassette may be directly transfected into mammalian cells to enable rapid screening of shRNA target sequences e The vector is Gateway adapted to allow easy transfer of the U6 RNAi cassette into any appropriate expression system e g lentiviral system for stable delivery of shRNA into dividing or non dividing mammalian cells The Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a
31. ed In order to obtain a license to use this product for these commercial purposes contact The Regents of the University of California This product or the use of this product is covered by U S Patent No 5 624 803 owned by The Regents of the University of California Use of this product in conjunction with methods for the introduction of RNA molecules into cells may require licenses to one or more patents or patent applications Users of these products should determine if any licenses are required 41 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 42 The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purp
32. ell free lysates Miller 1972 Invitrogen offers the B gal Antiserum Catalog no R901 25 and the p Gal Assay Kit Catalog no K1455 01 for fast and easy detection of B galactosidase expression For an example of results obtained from a B galactosidase knockdown experiment see the next page Note The B galactosidase protein expressed from the pcDNA 1 2 V5 GW lacZ control plasmid is fused to a V5 epitope and is approximately 119 kDa in size If you are performing Western blot analysis you may also use the Anti V5 Antibodies available from Invitrogen e g Anti V5 HRP Antibody Catalog no R961 25 or Anti V5 AP Antibody Catalog no R962 25 for detection For more information refer to our Web site www invitrogen com or call Technical Service see page 38 continued on next page Transfecting Cells continued Example of Expected Results Knockdown of a Reporter Gene Beta gal Activity RLU 450000 400000 4 350000 300000 250000 200000 150000 100000 50000 In this experiment PENTR U6 entry constructs containing ds oligo encoding shRNA targeting the lacZ i e PENTR U6 GW lacZ or luciferase i e pENTR U6 GW luc 4 reporter genes were generated following the recommended protocols and using the reagents supplied in the BLOCK iT U6 Entry Vector Kit Note that the lacZ ds oligo used in this experiment is the same as the lacZ ds control oligo supplied with the kit
33. ering knockdown of your target gene the RNAi Designer will convert the siRNA into a suitable shRNA To use the RNAi Designer see www invitrogen com rnai When designing the top and bottom strand single stranded oligos consider the following factors Top strand oligo e Sequences required to facilitate directional cloning e Transcription initiation site e Sequences encoding the shRNA of interest i e stem and loop sequences Bottom strand oligo e Sequences required to facilitate directional cloning e Sequences complementary to the top strand oligo For more information about the sequence requirements for directional cloning see below For guidelines to choose the target loop and transcription initiation sequences see pages 10 11 For an example of ss oligo design see page 12 continued on next page Designing the Single Stranded DNA Oligos continued Sequences Required for Directional Cloning Structural Features of the shRNA Choosing the Target Sequence 10 TM To enable directional cloning of the ds oligo into pENTR U6 you must add the following 4 nucleotides to the 5 end of the corresponding ss oligo See the diagram of the cloning site on page 13 to help you design your ss oligos e Top strand oligo Add CACC to the 5 end of the oligo The CACC is complementary to the overhang sequence GTGG in the pENTR U6 vector and constitutes the last 4 bases of the U6 promoter e Bottom strand o
34. esistant colonies obtained on the selective plate Single stranded oligos designed incorrectly Make sure that each single stranded oligo contains the 4 nucleotides on the 5 end TM required for cloning into pENTR U6 e Top strand oligo include CACC on the 5 end e Bottom strand oligo include AAAA on the 5 end ds oligos were degraded e Store the 5 nM ds oligo stock in 1X Oligo Annealing Buffer e Avoid repeated freeze thaw cycles Aliquot the 5 nM ds oligo stock and store at 20 C 30 continued on next page Troubleshooting continued Ligation and Transformation Reactions continued Problem Reason Solution Few kanamycin ds oligos stored incorrectly Store the ds oligo stocks at 20 C resistant colonies obtained on the selective plate continued 500 nM ds oligo stock solution To dilute the 50 uM ds oligo reaction diated into water instead of TX Dilute the 50 uM stock 100 fold into ONUS AS DNase RNase free water to generate a 500 nM stock 2 Dilute the 500 nM stock 100 fold into 1X Oligo Annealing Buffer to generate a 5 nM stock Use the 5 nM stock for cloning 5 nM ds oligo stock solution Thaw ds oligo stock solution on ice or at 4 C heated above room temperature prior to use prior to use Important Dilute ds oligos will melt and form intramolecular hairpins if heated above room temperature These hairpins will not clone into
35. fold by performing two serial 100 fold dilutions the first into DNase RNase free water and the second into 1X Oligo Annealing Buffer Final concentration is 5 nM Clone the ds oligo into 1 Set up the following ligation reaction pENIR U6 5X Ligation Buffer 4 ul pENTR U6 0 5 ng ul 2 ul ds oligo 5 nM 1 10 000 dilution 1 ul DNase RNase Free water 12 ul T4 DNA Ligase 1 U ul 1 ul Total volume 20 ul Mix reaction well and incubate for 5 minutes at room temperature Place reaction on ice and proceed to transform E coli below Transform One Shot TOP10 1 Add 2 pl of the ligation reaction into a vial of One Shot TOP10 Chemically Competent E coli chemically competent E coli and mix gently 2 Incubate on ice for 5 to 30 minutes 3 Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tube to ice 4 Add 250 ul of room temperature S O C Medium Incubate at 37 C for 1 hour with shaking 6 Spread 20 100 ul of bacterial culture on a pre warmed LB agar plate containing 50 ug ml kanamycin and incubate overnight at 37 C vi Kit Contents and Storage Types of Kits Kit Components Shipping Storage This manual is supplied with the products listed below Note The BLOCK iT Lentiviral RNAi Expression System is also supplied with the BLOCK iT Lentiviral RNAi Expression System components and the BLOCK iT Lentiviral RNAi Expression System manual Product Catalo
36. for Efficient Transcription of a Human U6 RNA Gene Resemble Those of U1 and U2 Genes Even Though a Different Polymerase is Used Genes Dev 2 196 204 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Lee R C Feinbaum R L and Ambros V 1993 The C elegans Heterochronic Gene lin 4 Encodes Small RNAs with Antisense Complementarity to lin 14 Cell 75 843 854 continued on next page 44 References continued Li W X and Ding S W 2001 Viral Suppressors of RNA Silencing Curr Opin Biotechnol 12 150 154 McManus M T and Sharp P A 2002 Gene Silencing in Mammals by Small Interfering RNAs Nature Rev Genet 3 737 747 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory Napoli C Lemieux C and Jorgensen R 1990 Introduction of a Chalcone Synthase Gene into Petunia Results in Reversible Co Suppression of Homologous Genes in trans Plant Cell 2 279 289 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Nykanen A Haley B and Zamore P D 2001 ATP Requirements and Small Interfering RNA Structure in the RNA Interference Pathway Cell 107 309 321 Paddiso
37. g no BLOCK iT U6 RNAi Entry Vector Kit K4945 00 BLOCK iT Lentiviral RNAi Expression System K4944 00 The BLOCK iT U6 RNAi Entry Vector Kit and the BLOCK iT Lentiviral RNAi Expression System include the following components For a detailed description of the contents of the BLOCK iT U6 RNAi Entry Vector Kit see pages viii ix For a detailed description of the contents of the BLOCK iT Lentiviral RNAi Expression reagents see the BLOCK iT Lentiviral RNAi Expression System manual Component Catalog no K4945 00 K4944 00 BLOCK iT U6 RNAi Entry Vector Kit y V BLOCK iT Lentiviral RNAi Expression Y Reagents The BLOCK iT U6 RNAi Entry Vector Kit and the BLOCK iT Lentiviral RNAi Expression System are shipped as described below Upon receipt store each item as detailed below For more detailed information about the BLOCK iT Lentiviral RNAi Expression reagents supplied with the kit refer to the BLOCK TM iT Lentiviral RNAi Expression System manual Box Component Shipping Storage 1 U6 RNAi Entry Vector Reagents Dry ice 20 C 2 One Shot TOP10 Chemically Dry ice 80 C Competent E coli 3 7 BLOCK iT Lentiviral RNAi Various Various refer to the BLOCK iT Expression Reagents Lentiviral RNAi Expression System manual for details continued on next page vii Kit Contents and Storage continued U6 RNAi Entry Vector Reagents Unit Definition of T4 DNA
38. h a suitable Gateway destination vector to generate an expression clone continued on next page BLOCK iT U6 RNAi Entry Vector Kit continued Features of the pENTR U6 Vector Important TM The pENTR U6 vector contains the following features e U6 cassette containing elements required to allow RNA Polymerase III Pol IID controlled expression of the shRNA of interest in mammalian cells see page 7 for more information e Cloning site containing 4 nucleotide 5 overhangs on each DNA strand for directional cloning of the ds oligo encoding the shRNA of interest Note The 4 nucleotide 5 overhangs on each DNA strand encode the last 4 nucleotides of the U6 promoter and the first 4 nucleotides of the Pol III terminator Transcription initiates at the first duplexed nucleotide after the promoter overhang see the diagram on page 13 for more information e Two recombination sites attL1 and attL2 sites flanking the U6 RNAi cassette for recombinational cloning of the U6 RNAi cassette into a Gateway destination vector Landy 1989 e Kanamycin resistance gene for selection in E coli e pUC origin for high copy maintenance of the plasmid in E coli If you have previously used other Gateway entry vectors note that not all entry vectors may be used to generate entry clones for use in RNAi applications You must use an entry vector e g pENTR U6 that contains elements necessary for RNA Polymerase III dependent expression of
39. he product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Invitrogen Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Invitrogen Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding
40. ides to clone into pENTR U6 after annealing Note the following features in the diagram below The pENTR U6 vector is supplied linearized between nucleotides 968 and 969 The linearized vector contains 4 nucleotide overhangs on each strand encoding the last 4 nucleotides of the U6 promoter and the first 4 nucleotides of the Pol III terminator Note that the annealed double stranded ds oligo must contain specific 4 nucleotide 5 overhangs on each strand as indicated The shaded region corresponds to those DNA sequences that will be transferred from the entry clone into the Gateway destination vector e g pLenti6 BLOCK iT DEST following recombination Note Following recombination with a Gateway destination vector the resulting expression clone will contain an RNAi cassette consisting of the U6 promoter shRNA sequence and the Pol III terminator The sequence of pENTR U6 is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 38 For a map of pENTR U6 see the Appendix page 35 M13 forward 20 priming site 1 r r GACGTTGTAA AACGACGGCC AGTCTTAAGC TCGGGCCCCA AATAATGATT TTATTTTGAC TGATAGTGAC attL1 CTGTTCGTTG ATTCAGTCGA CAACAAATTG ATGAGCAATG CTTTTTTATA ATGCCAACTT TGTACAAAAA AGCAGGCTTT AAAGGAACCA ACATGTTTTT TCGTCCGAAA TTTCCTTGGT U6 promoter r CTGGATCCGG TACCAAGGTC GGGCAGGAAG AGGGCCTATT TCCCATGATT CCTTCATATT TGCATATACG ATACAAGGCT
41. imize the transfection conditions for your observed after Reagent used cell line by varying the amount of transfection Lipofectamine 2000 Reagent used Plasmid DNA not pure Prepare purified plasmid DNA for transfection We recommend using the S N A P MidiPrep Kit Catalog no K1910 01 to prepare purified plasmid DNA Targeted an essential gene Make sure that your target gene is not essential for cell viability or growth observed No gene knockdown shRNA with no activity chosen e Verify that the shRNA sequence does not contain gt 3 tandem T s which can cause premature transcription termination e Select a different target region Hairpin designed incorrectly Follow the guidelines on pages 9 13 to select the target sequence and design the single stranded oligos Non specific off knockdown observed Target sequence contains strong target gene homology to other genes Select a new target sequence 34 Appendix Map and Features of pENTR U6 pENTR U6 Map The figure below shows the features of the pPENTR U6 vector The vector is supplied linearized between nucleotides 968 and 969 with 4 base pair 5 overhangs on each strand as indicated The complete sequence of pENTR U6 is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 38 TTTT U6 promoter GTGG Pol Ill term Comments for pENTR U6 2854 nucleo
42. ing The table below lists some potential problems and possible solutions that may Reaction help you troubleshoot the annealing reaction Problem Reason Solution Weak band Single stranded oligos designed Verify that the sequence of the bottom strand representing ds oligo observed on an agarose gel incorrectly oligo is complementary to the sequence of the top strand oligo If not re synthesize the bottom strand oligo Allowed oligos to cool at 4 C instead of room temperature during annealing procedure After heating to 95 C anneal the oligos by setting the microcentrifuge tube at room temperature for 5 10 minutes see the procedure on page 15 Did not anneal equal amounts of top and bottom strand oligo Anneal equal amounts of the top and bottom strand oligo using the procedure on page 15 No band representing ds oligo observed on an agarose gel Single stranded oligos designed incorrectly Verify that the sequence of the bottom strand oligo is complementary to the sequence of the top strand oligo If not re synthesize the bottom strand oligo Used the wrong single stranded oligos Make sure that you mix single stranded oligos with complementary sequence Ligation and The table below lists some potential problems and possible solutions that may Transformation help you troubleshoot the ligation and transformation procedures Reactions Problem Reason Solution Few kanamycin r
43. irst nucleotide following the four base pair CACC sequence added to permit directional cloning We recommend initiating the shRNA sequence at a guanosine G because transcription of the native U6 snRNA initiates at a G Note the following e If Gis part of the target sequence then incorporate the G into the stem sequence in the top strand oligo and add a complementary C to the 3 end of the top strand oligo e If Gis not the first base of the target sequence we recommend adding a G to the 5 end of the top strand oligo directly following the CACC overhang sequence In this case do not add the complementary C to the 3 end of the top strand oligo For an example see the next page Note We have found that adding the complementary C in this situation can result in reduced activity of the shRNA Alternative If use of a G to initiate transcription is not desired use an adenosine A rather than C or T Note however that use of any nucleotide other than G may affect initiation efficiency and position Do not add 5 phosphates to your ss oligos during synthesis The phosphate groups necessary for ligation are present in the linearized pENTR U6 vector continued on next page 11 Designing the Single Stranded DNA Oligos continued Example of ss The diagram below illustrates the required features of the top strand and bottom Oligo Design strand single stranded oligos as discussed in this section This particular exampl
44. kanamycin resistant colonies obtained on the selective plate continued Not enough transformation mixture plated Increase the amount of the transformation mixture plated Selective plates contained too much kanamycin Use LB agar plates containing 50 ug ml kanamycin for selection Did not use the competent cells supplied with the kit Use the One Shot TOP10 Chemically Competent E coli supplied with the kit trans formation efficiency is gt 1 x 10 cfu ug DNA Not enough of the ligation reaction transformed Increase the amount of ligation reaction transformed Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the bacterial culture for 1 hour at 37 C with shaking before plating Many clones contain inserts with sequence mutations Poor quality single stranded oligos used e Oligo preparation contains mutated sequences e Oligo preparation contains contaminants e Use mass spectrometry to check for peaks of the wrong mass e Order HPLC or polyacrylamide gel PAGE purified oligos e Order oligos from Invitrogen s custom primer synthesis service see our Web site for more information Did not use the competent cells supplied with the kit Use the One Shot TOP10 Chemically Competent E coli supplied with the kit trans formation efficiency is gt 1 x 10 cfu ug DNA Poor
45. ligo Add AAAA to the 5 end of the oligo The AAAA is complementary to the overhang sequence TTTT in the pENTR U6 vector and constitutes the first 4 bases of the Pol III terminator Reminder When designing the top strand oligo encoding the shRNA remember that an shRNA generally contains the following structural features e A short nucleotide sequence derived from the target gene i e target sequence followed by e Ashortloop and e A short nucleotide sequence that is the reverse complement of the initial target sequence Upon transcription the target sequence and its complement base pair to form the stem of the shRNA For guidelines to choose the target and loop sequences see below and the next page When performing RNAi analysis on a particular gene your choice of target sequence can significantly affect the degree of gene knockdown observed We recommend following the guidelines below when choosing your target sequence These are general recommendations only exceptions may occur Length Choose a target sequence ranging from 19 to 29 nucleotides in length Longer sequences may induce non specific responses in mammalian cells Complexity e Make sure that the target sequence does not contain runs of more than three of the same nucleotide Specifically avoid choosing a target sequence with a run of four thymidines T s as this can lead to early transcription termination e Choose a sequence with low GC content
46. lly Competent 10 reactions C4040 10 Perai 20 reactions C4040 03 40 reactions C4040 06 S N A P MidiPrep Kit 20 reactions K1910 01 M13 Reverse Primer 2 ug N530 02 Lipofectamine 2000 Reagent 0 75 ml 11668 027 1 5 ml 11668 019 Lipofectamine LTX Reagent 1 0 ml 15338 100 Opti MEM I Reduced Serum Medium 100 ml 31985 062 500 ml 31985 070 Phosphate Buffered Saline PBS pH 7 4 500 ml 10010 023 4 E Gel Starter Pak 9 gels and Base G5000 04 10 bp DNA Ladder 50 ug 10821 015 BLOCK iT Lentiviral RNAi Gateway 20 constructions K4943 00 Vector Kit ViraPower Bsd Lentiviral Support Kit 20 reactions K4970 00 293FT Cell Line 3 x 106 cells frozen R700 07 Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 100 reactions 11791 100 xi xii Overview Introduction Advantages of the BLOCK iT U6 RNAi Entry Vector Kit Gateway Technology Introduction The BLOCK iT U6 RNAi Entry Vector Kit facilitates the generation of a vector to express short hairpin RNA shRNA for use in RNA interference RNAi analysis of a target gene in mammalian cells The kit provides a Gateway adapted entry vector designed to allow efficient transient expression of shRNA or stable expression of shRNA following recombination with a suitable destination vector For more information about the Gateway Technology see below Note The BLOCK iT Lentiviral RNAi Expression System includes the BLOCK iT U6 RNAi Entry V
47. lustration of the U6 RNAi cassette U6 promoter Pol Ill term TM Expression of the shRNA of interest from pENTR U6 or a suitable destination vector following LR recombination is controlled by the human U6 promoter The endogenous U6 promoter normally controls expression of the U6 RNA a small nuclear RNA snRNA involved in splicing and has been well characterized Kunkel et al 1986 Kunkel and Pederson 1988 Paule and White 2000 We and other groups have chosen this particular promoter to control vector based expression of shRNA molecules in mammalian cells Paddison et al 2002 Paul et al 2002 for the following reasons e The promoter is recognized by RNA Polymerase III and controls high level constitutive expression of shRNA e The promoter is active in most mammalian cell types e The promoter is a type III Pol III promoter in that all elements required to control expression of the shRNA are located upstream of the transcription start site Paule and White 2000 The shRNA molecule expressed from the U6 RNAi cassette in pENTR U6 or in a suitable destination vector forms an intramolecular stem loop structure similar to the structure of miRNA This hairpin is then processed by the endogenous Dicer enzyme into a 21 23 nt siRNA duplex Example The figure below illustrates the structure of the shRNA generated from the pENTR U6 GW lacZ construct You may generate this construct by cloning the lacZ ds co
48. m Invitrogen Catalog no K1910 01 TM 3 Sequence each pENTR following U6 entry construct see below to confirm the a The presence and correct orientation of the ds oligo insert b The sequence of the ds oligo insert Note Because of the small size of the ds oligo insert we do not recommend using restriction enzyme analysis to screen transformants We highly recommend sequencing positive transformants to confirm the sequence of the ds oligo insert When screening transformants we find that up to 2076 of the clones may contain mutated inserts generally 1 or 2 bp deletions within the ds oligo The reason for this is not known but may be due to triggering of repair mechanisms within E coli as a result of the inverted repeat sequence within the ds oligo insert Note Entry clones containing mutated ds oligo inserts generally elicit a poor RNAi response in mammalian cells Identify entry clones with the correct ds oligo sequence and use these clones for your RNAi analysis TM To facilitate sequencing of your pPENTR U6 entry clones use the U6 Forward and M13 Reverse Primers supplied with the kit Box 1 See the diagram on page 13 for the location of the priming sites TM If you download the sequence for pPENTR U6 from our Web site note that the overhang sequences will be shown already hybridized to their complementary sequences e g GTGG will be shown hybridized to CACC and TTTT will be shown hybridized to
49. mation about the features of the pENTR U6 vector see pages 4 and 35 For more information about the U6 RNAi cassette see page 7 e T4 DNA Ligase and an optimized ligation buffer to allow 5 minute room TM temperature ligation of the ds oligo insert into pENTR U6 e OneShot TOP10 Chemically Competent E coli for high efficiency transformation of the ligation reaction Note The kit also includes a lacZ ds control oligo that may be cloned into pENTR U6 to generate an entry construct expressing shRNA targeting the lacZ gene Co transfecting the entry clone and the pcDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into mammalian cells provide a means to assess the RNAi response in your cell line by assaying for knockdown of B galactosidase Using the reagents supplied in the BLOCK iT U6 RNAi Entry Vector Kit you will perform the following steps to generate an entry clone in pENTR U6 1 Design and synthesize two complementary single stranded DNA oligonucleotides with one encoding the shRNA of interest 2 Annealthe single stranded oligonucleotides to generate a double stranded oligo ds oligo 3 Clone the ds oligo into the linearized pENTR U6 vector Transform the ligation reaction into One Shot TOP10 chemically competent E coli and select for kanamycin resistant transformants 5 Use the pENTR U6 entry construct for transient RNAi analysis in mammalian cells or perform an LR recombination reaction wit
50. n P J Caudy A A Bernstein E Hannon G J and Conklin D S 2002 Short Hairpin RNAs shRNAs Induce Sequence Specific Silencing in Mammalian Cells Genes Dev 16 948 958 Paul C P Good P D Winer I and Engelke D R 2002 Effective Expression of Small Interfering RNA in Human Cells Nat Biotechnol 20 505 508 Paule M R and White R J 2000 Transcription by RNA Polymerases I and III Nuc Acids Res 28 1283 1298 Plasterk R H A and Ketting R F 2000 The Silence of the Genes Curr Opin Genet Dev 10 562 567 Romano N and Macino G 1992 Quelling Transient Inactivation of Gene Expression in Neurospora crassa by Transformation with Homologous Sequences Mol Microbiol 6 3343 3353 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Smith C J Watson C F Bird C R Ray J Schuch W and Grierson D 1990 Expression of a Truncated Tomato Polygalacturonase Gene Inhibits Expression of the Endogenous Gene in Transgenic Plants Mol Gen Genet 224 477 481 Sui G Soohoo C Affar E B Gay F Shi Y Forrester W C and Shi Y 2002 A DNA Vector Based RNAi Technology to Suppress Gene Expression in Mammalian Cells Proc Natl Acad Sci USA 99 5515 5520 van der Krol A R Mur L A Beld M Mol J N and Stuitje A R 19
51. nd Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Cogoni C and Macino G 1999 Gene Silencing in Neurospora crassa Requires a Protein Homologous to RNA Dependent RNA Polymerase Nature 399 166 169 Cogoni C and Macino G 1997 Isolation of Quelling Defective qde Mutants Impaired in Posttranscriptional Transgene Induced Gene Silencing in Neurospora crassa Proc Natl Acad Sci USA 94 10233 10238 continued on next page 43 References continued Cogoni C Romano N and Macino G 1994 Suppression of Gene Expression by Homologous Transgenes Antonie Van Leeuwenhoek 65 205 209 Cole C N and Stacy T P 1985 Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation Mol Cell Biol 5 2104 2113 Dykxhoorn D M Novina C D and Sharp P A 2003 Killing the Messenger Short RNAs that Silence Gene Expression Nat Rev Mol Cell Biol 4 457 467 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationi
52. nearized 0 5 ng ul supplied with the kit Box 1 thaw on ice before use 5X Ligation Buffer supplied with the kit Box 1 DNase RNase Free Water supplied with the kit Box 1 T4 DNA Ligase 1 U ul supplied with the kit Box 1 Follow the procedure below to perform the ligation reaction If you wish to include a negative control set up a separate ligation reaction but omit the ds oligo 1 Set up a 20 ul ligation reaction at room temperature using the following reagents in the order shown Reagent Amount 5X Ligation Buffer 4 ul pENTR U6 0 5 ng ul 2 ul ds oligo 5 nM i e 1 10 000 dilution lul DNase RNase Free Water 12 ul T4 DNA Ligase 1 U l 1 pl Total volume 20 ul Mix reaction well by pipetting up and down Note The presence of PEG and glycerol supplied by the Ligation Buffer and the T4 DNA Ligase will make the reaction mixture viscous Be sure to mix the reaction thoroughly by pipetting up and down Do not vortex Incubate for 5 minutes at room temperature Note The incubation time may be extended up to 2 hours and may result in a higher yield of colonies Place the reaction on ice and proceed to Transforming One Shot TOP10 Competent E coli next page Note You may store the ligation reaction at 20 C overnight Transforming One Shot TOP10 Competent E coli Introduction Materials to Have on Hand One Shot TOP10 Transformation Procedure Once you have performe
53. ns be careful not to cross contaminate the different ds oligo stocks Remember to wear gloves and change pipette tips after every manipulation Once you have diluted your ds oligo you should have three stocks of annealed ds oligo Use each stock as follows e 50 uM ds oligo undiluted Use this stock for long term storage and to prepare new diluted ds oligo stocks if existing stocks become denatured or cross contaminated e 500 nM ds oligo 100 fold dilution Use this stock for gel analysis see Checking the Integrity of the ds Oligo next page e 5nM ds oligo 10 000 fold dilution Use this stock for cloning see Ligation Procedure page 20 This stock is not suitable for long term storage Store the three ds oligo stocks at 20 C continued on next page Generating the Double Stranded Oligo ds oligo continued Important Checking the Integrity of the ds Oligo What You Should See When using the diluted ds oligo stock solutions i e 100 fold or 10 000 fold diluted stocks thaw the solutions on ice Do not heat or allow the ds oligo solutions to reach greater than room temperature as this causes the ds oligos to melt The concentration of the oligos in the diluted solutions is not high enough to permit re annealing and instead favors the formation of intramolecular hairpin structures These intramolecular hairpin structures will not clone into pENTR U6 If your diluted ds oligo stock solution s is heated
54. ntrol oligo supplied with the kit into PENTR U6 following the protocols in this manual The 19 bp lacZ target sequence is indicated in bold The underlined bases are derived from the Pol III terminator 5 GCUACACAAAUCAGCGAUUU s G 3 UUGAUGUGUUUAGUCGCUAAA a Note The length of the stem and loop may differ depending on how you design the oligonucleotides encoding your target sequence For guidelines to design the oligonucleotides refer to pages 9 13 Experimental Outline TM The figure below illustrates the major steps necessary to produce apENTR U6 1 Design and synthesize comple mentary DNA oligos with each containing 4 nucleotide overhangs necessary for directional cloning 2 Anneal DNA oligos to generate a ds oligo Flow Chart entry clone using the BLOCK iT U6 Entry Vector Kit CACCG AAAA C Annealing CACCG Cc AAAA Cloning Transformation TTIT U6 promoter GTGG Pol Ill term Transient transfection Recombination with destination vector 3 Clone the ds oligo into pENTR U6 using T4 DNA Ligase 4 Transform E coli and analyze colonies for the desired entry clone 5 Transfect the entry clone for transient RNAi analysis or recombine with a suitable destination vector to generate an expression clone Methods Designing the Single Stranded DNA Oligos Introduction Fact
55. ollowing components to facilitate production of a replication incompetent lentivirus that expresses your short hairpin RNA shRNA of interest e BLOCK iT Lentiviral RNAi Gateway Vector Kit TM e ViraPower Bsd Lentiviral Support Kit e Gateway LR Clonase II Enzyme Mix e 293FT Cell Line Refer to the BLOCK iT Lentiviral RNAi Expression System manual for a detailed description of the lentiviral expression reagents provided with the kit and instructions to produce lentivirus For instructions to grow and maintain the 293FT Cell Line refer to the 293FT Cell Line manual The BLOCK iT Lentiviral RNAi Expression System and the 293FT Cell Line manuals are supplied with Catalog no K4944 00 but are also available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 38 Accessory Products Introduction Accessory Products The products listed in this section may be used with the BLOCK iT U6 RNAi Entry Vector Kit For more information refer to our Web site www invitrogen com or call Technical Service see page 38 Some of the reagents supplied in the BLOCK iT U6 RNAi Entry Vector Kit as well as other products suitable for use with the kit are available separately from Invitrogen Ordering information is provided below Item Amount Catalog no T4 DNA Ligase 100 units 15224 017 500 units 15224 025 One Shot TOP10 Chemica
56. omments for pcDNA 1 2 V5 GW lacZ 6498 nucleotides attB4 bases 5 25 CMV promoter bases 137 724 attB1 bases 614 637 LacZ fusion protein bases 643 3798 LacZ ORF bases 643 3714 attB2 bases 3716 3739 V5 epitope bases 3739 3780 lacZ forward 2 priming site 840 859 lacZ reverse 2 priming site 1820 1839 C TK polyadenylation signal bases 3807 4078 attB3 bases 4079 4099 bla promoter bases 4603 4701 Ampicillin bla resistance gene bases 4702 5562 pUC origin bases 5707 6380 C complementary strand 37 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3
57. on the next page you will be using a 10 1 molar ratio of insert vector We recommend including the lacZ ds control oligo supplied with the kit as a positive control in your ligation experiment The lacZ ds control oligo is supplied as a 50 uM stock in 1X Oligo Annealing Buffer and needs to be re annealed and diluted 10 000 fold before use in a ligation reaction see page 15 See page ix for the sequence of each strand of the lacZ ds control oligo Note Once you have cloned the lacZ ds control oligo into pENTR U6 you may use the resulting entry clone as a positive control for the RNAi response in your mammalian cell line Simply co transfect the entry clone and the peDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into your mammalian cell line and assay for knockdown of p galactosidase expression Reminder When using the 5 nM ds oligo stock solution for cloning thaw the solution on ice Do not thaw the ds oligo by heating or the ds oligo duplexes may melt and form intramolecular hairpin structures After use return the tube to 20 C storage continued on next page 19 Performing the Ligation Reaction continued Materials Needed Ligation Procedure 20 Have the following reagents on hand before beginning Double stranded oligo of interest 5 nM in 1X Oligo Annealing Buffer thaw on ice before use lacZ ds control oligo 5 nM in 1X Oligo Annealing Buffer thaw on ice before use pENTR U6 li
58. on vector you will perform an LR recombination reaction using Gateway LR Clonase II Enzyme Mix Guidelines are provided in this section Because the U6 RNAi cassette contains its own promoter i e U6 promoter we do not recommend transferring the U6 RNAi cassette into a destination vector that contains a promoter e g pcDNA 6 2 V5 DEST We suggest performing LR recombination with a promoterless destination vector e g pLentio BLOCK T DEST pBLOCK iT 6 DEST Other promoterless destination vectors are available For more information about suitable destination vectors to use for this application see the RNAi Central application portal at www invitrogen com rnai or call Technical Service see page 38 Once you have performed the LR recombination reaction you will transform the recombination reaction into competent E coli and select for the appropriate transformants You may use any recA endA E coli strain including TOP10 DH5a or equivalent for transformation DO NOT transform the LR recombination reaction into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene Note When performing the LR recombination reaction with the pLenti BLOCK iT DEST RNAi vector transformation into the Stbl3 E coli strain is recommended for optimal results see ordering information below Product Amount Catalog no One Shot TOP10
59. ors to Consider To use the BLOCK iT U6 RNAi Entry Vector Kit you will first need to design two single stranded DNA oligonucleotides one encoding the target shRNA top strand oligo and the other its complement bottom strand oligo You will then anneal the top and bottom strand oligos to generate a double stranded TM oligonucleotide ds oligo suitable for cloning into the pENTR U6 vector The design of the single stranded oligonucleotides ss oligos is critical to the success of both the cloning procedure and ultimately the RNAi analysis General guidelines are provided in this section to help you choose the target sequence and to design the ss oligos Note however that simply following these guidelines does not guarantee that the shRNA will be effective in knocking down the target gene For a given target gene you may need to generate and screen multiple shRNA sequences to identify one that is active in gene knockdown studies We recommend using Invitrogen s RNAi Designer an online tool to help you design and order shRNA sequences for any target gene of interest The RNAi Designer incorporates the guidelines provided in this manual as well as other design rules into a proprietary algorithm to design shRNA sequences that are compatible for use in cloning into the pPENTR U6 or other appropriate RNAi entry vectors e g pENTR H1 TO Alternatively if you have identified a synthetic siRNA that is active in trigg
60. ose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 References Ambros V 2001 MicroRNAs Tiny Regulators with Great Potential Cell 107 823 826 Anandalakshmi R Pruss G J Ge X Marathe R Mallory A C Smith T H and Vance V B 1998 A Viral Suppressor of Gene Silencing in Plants Proc Natl Acad Sci USA 95 13079 13084 Andersson S Davis D L Dahlback H J rnvall H and Russell D
61. ponents to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such produc
62. quarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
63. ral Features of shRNA Hallmarks of RNA Polymerase Ill Based Expression Using a Vector Based System to Express shRNA Exogenous short hairpin RNA can be transcribed by RNA Polymerase III Paule and White 2000 and generally contain the following structural features e A short nucleotide sequence ranging from 19 29 nucleotides derived from the target gene followed by e A short spacer of 4 15 nucleotides i e loop and e A 19 29 nucleotide sequence that is the reverse complement of the initial target sequence The resulting RNA molecule forms an intramolecular stem loop structure that is then processed into an siRNA duplex by the Dicer enzyme RNA Polymerase III transcribes a limited number of genes including 5S rRNA tRNA 7SL RNA U6 snRNA and a number of other small stable RNAs that are involved in RNA processing Paule and White 2000 Some of the hallmarks of RNA Polymerase III based transcription are that e Transcription initiates and terminates at fairly precise points e There is little addition of unwanted 5 and 3 sequences to the RNA molecule For more information about RNA Polymerase III transcription refer to published reviews or reference sources Paule and White 2000 White 1998 Use of siRNA diced siRNA or synthetic siRNA for RNAi analysis in mammalian cells is limited by their transient nature To address this limitation a number of groups have developed vector based systems to facilita
64. rapid and highly efficient way to move your DNA sequence of interest e g U6 RNAi cassette into multiple vector systems To express your TM shRNA of interest using the pENTR U6 vector simply 1 Clone your ds oligo encoding the shRNA of interest into the pENTR U6 vector to generate an entry clone 2 Transfect your entry construct into mammalian cells to transiently assay for the RNAi response OR 3 Perform an LR recombination reaction between the entry construct and a suitable Gateway destination vector to generate an expression clone for use in other RNAi applications For more information about the Gateway Technology refer to the Gateway Technology with Clonase II manual which is available for downloading from our Web site www invitrogen com or by calling Technical Service see page 38 continued on next page 1 Overview continued Purpose of this Manual Important Where to Go For More Information This manual provides the following information e An overview of the pathway by which shRNA facilitates gene knockdown in mammalian cells e Guidelines to design the appropriate single stranded oligonucleotides representing the target gene e Instructions to anneal the single stranded oligonucleotides to generate double stranded oligonucleotides ds oligo TM e Guidelines and instructions to clone the ds oligo into the pENTR U6 vector and transform the ligation reaction into competent F coli
65. t If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com The use of the CMV promoter is covered under U S Patent Nos 5 168 062 and 5 385 839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation UIRF 214 Technology Innovation Center Iowa City Iowa 52242 For further information please contact the Associate Director of UIRF at 319 335 4546 This product may be covered by one or more of U S Patent No 6 506 559 and or foreign equivalents and is sold under license to Invitrogen Corporation by the Carnegie Institution of Washington A separate license from the Carnegie Institute of Washington may be required to use this product This product is for non clinical research use only It is not to be used for commercial purposes Use of this product to produce products for sale or for diagnostic therapeutic or high throughput drug discovery purposes the screening of more than 10 000 compounds per day is prohibit
66. te expression of siRNA and shRNA in mammalian cells Brummelkamp et al 2002 Paddison et al 2002 Paul et al 2002 Sui et al 2002 Yu et al 2002 At Invitrogen we have developed the Gateway adapted pENTR U6 vector to facilitate generation of an entry clone containing a ds oligo encoding an shRNA of interest within the context of an RNA Polymerase III driven expression cassette i e U6 RNAi cassette see the next page The resulting pENTR U6 entry construct may be introduced into dividing mammalian cells for transient expression of the shRNA of interest and initial RNAi screening if desired Once initial screening is complete the U6 RNAi cassette may then be easily and efficiently transferred into a suitable destination vector by LR recombination for use in other RNAi applications e g stable constitutive expression of shRNA continued on next page Using shRNA for RNAi Analysis continued Features of the U6 RNAi Cassette Human U6 Promoter Structure of the shRNA The U6 RNAi cassette in PENTR U6 contains all of the elements required to facilitate RNA Polymerase III controlled expression of your shRNA of interest including a e Human U6 promoter see below for more information e Double stranded oligo encoding an shRNA to your target gene of interest e Polymerase III Pol III terminator consisting of a cluster of six thymidine T residues Bogenhagen and Brown 1981 See the diagram below for an il
67. tes Note Longer incubations seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Dy gv xe c9 7 Spread 20 100 ul from each transformation on a pre warmed LB agar plate containing 50 ug ml kanamycin and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have well spaced colonies If you are transforming the pUC19 control plate 20 100 ul of the transformation reaction on pre warmed LB plates containing 100 ug ml ampicillin 8 An efficient ligation reaction may produce several hundred colonies Pick 5 10 colonies for analysis see Analyzing Transformants next page 21 Analyzing Transformants Analyzing Transformants Important Sequencing Note 22 To analyze positive clones we recommend that you 1 Pick 5 10 kanamycin resistant colonies and culture them overnight in LB or SOB medium containing 50 ug ml kanamycin 2 Isolate plasmid DNA using your method of choice To obtain pure plasmid DNA for automated or manual sequencing we recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 or S N A P MidiPrep Kit available fro
68. the RNAi response in your mammalian cell line In this vector B galactosidase is expressed as a C terminally tagged fusion protein under the control of the human cytomegalovirus CMV promoter Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 See page 37 for more information The pcDNA 1 2 V5 GW lacZ vector is supplied as 500 ng l of plasmid DNA in TE Buffer pH 8 0 Dilute the stock as necessary for use in transfection see below If you wish to propagate the plasmid transform a recA end A E coli strain such as TOP10 Use 10 ng of plasmid for transformation and select on LB agar plates containing 100 ug ml ampicillin To perform RNAi analysis using the lacZ control reagents you will co transfect the pcDNA 1 2 V5 GW lacZ reporter plasmid and the pENTR U6 GW lacZ Fh entry construct that you have generated into your mammalian cell line For optimal results we recommend using 6 fold more entry construct DNA than reporter plasmid DNA in the co transfection For example use 600 ng of pENTR U6 GW lacZ DNA and 100 ng of pceDNA 1 2 V5 GW lacZ DNA when transfecting cells plated in a 24 well format For an example of results obtained from such an RNAi experiment see the next page If you perform RNAi analysis using the control entry clone containing the lacZ ds oligo i e pENTR U6 GW lacZ 5 you may assay for f galactosidase expression and knockdown by Western blot analysis or activity assay using c
69. tides rrnB T2 transcription terminator bases 268 295 C rrnB T1 transcription terminator bases 427 470 M13 forward 20 priming site bases 537 552 attL1 bases 569 668 C U6 promoter bases 705 968 U6 forward priming site bases 890 909 5 overhang bases 965 968 C 5 overhang bases 969 972 Pol Ill transcription terminator bases 969 974 attL2 bases 979 1078 M13 reverse priming site bases 1119 1135 Kanamycin resistance gene bases 1248 2057 pUC origin bases 2178 2851 C complementary strand continued on next page 35 Map and Features of pENTR U6 continued Features of pENTR U6 36 pENTR U6 2854 bp contains the following elements All features have been functionally tested and the vector fully sequenced Feature Benefit rrnB T1 and T2 transcription terminators Reduces potential toxicity in E coli by preventing basal expression of the double stranded oligonucleotide of interest M13 forward 20 priming site Allows sequencing of the insert attL1 and attL2 sites Bacteriophage A derived recombination sequences that allow recombinational cloning of a gene of interest in the entry construct with a Gateway destination vector Landy 1989 Human U6 promoter Allows RNA Polymerase III dependent expression of the short hairpin RNA shRNA Kunkel et al 1986 Kunkel and Pederson 1988 U6 forward priming site Allows sequencing of the insert
70. try clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for a single colony on an LB plate containing 50 ug ml kanamycin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 ug ml kanamycin 3 Grow until the culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store the glycerol stock at 80 C TM Once you have obtained your pENTR U6 entry clone you have the following options e Transfect the entry clone directly into the mammalian cell line of interest to perform transient RNAi analysis see Transfecting Cells next page TM e Perform an LR recombination reaction with your pENTR U6 construct and a suitable Gateway destination vector to generate an expression clone see Guidelines to Perform the LR Recombination Reaction page 28 BigDye is a registered trademark of Applied Biosystems 23 Transfecting Cells Introduction Important Factors Affecting Gene Knockdown Levels Plasmid Preparation 24 TM This section provides general guidelines to transfect your pPENTR U6 construct into the mammalian cell line of interest to perform transient RNAi analysis Performing transient RNAi analysis is useful to e Quickly test multiple shRNA sequences to a particular target gene e
71. uctions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 39 Purchaser Notification Introduction Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy 40 Use of the BLOCK iT U6 RNAi Entry Vector Kit is covered under the licenses detailed below This product and its use is the subject of one or more of U S Patent Nos 5 888 732 6 143 557 6 171 861 6 270 969 and 6 277 608 and or other pending U S and foreign patent applications owned by Invitrogen Corporation The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of t
72. ure that this oligo contains the sequence CACC at the 5 end e Bottom strand oligo Make sure that this oligo contains the sequence AAAA at the 5 end and is complementary to the top strand oligo Top strand oligo CACCG Bottom strand oligo AAAA 4 C Annealing ds oli CACCG 4 go C AAAA You will anneal equal amounts of the top and bottom strand oligos to generate the ds oligos We generally perform the annealing reaction at a final single stranded oligo concentration of 50 uM Annealing at concentrations lower than 50 uM can significantly reduce the efficiency Note that the annealing step is not 100 efficient approximately half of the single stranded oligos remain unannealed even at a concentration of 50 uM If your single stranded oligos are supplied lyophilized resuspend them in water or TE Buffer to a final concentration of 200 uM before use If you plan to use the lacZ ds control oligo in the ligation reaction make sure to re anneal it along with the other oligos as described on the next page Since the lacZ ds control oligo already comes at a concentration of 50 uM in 1 x Oligo Annealing Buffer re anneal the lacZ ds control oligo without further dilution continued on next page Generating the Double Stranded Oligo ds oligo continued Materials Needed Annealing Procedure Have the follo
73. ureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 S N A P MidiPrep Kit Catalog no K1910 01 or CsCl gradient centrifugation continued on next page Transfecting Cells continued Methods of Transfection N D _f Ne o i E Positive Control For established cell lines e g COS HEK 293 consult original references or the supplier of your cell line for the optimal method of transfection Pay particular attention to media requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 Choose the method and reagent that provides the highest efficiency transfection in your mammalian cell line For a recommendation see below For high efficiency transfection in a broad range of mammalian cell lines we recommend using the cationic lipid based Lipofectamine 2000 Reagent Catalog no 11668 027 available from Invitrogen Ciccarone et al 1999 Using Lipofectamine 2000 to transfect plasmid DNA into eukaryotic cells offers the following advantages e Provides the highest transfection efficiency in many mammalian cell types TM e DNA Lipofectamine 20
74. wing materials on hand before beginning Your top strand single stranded oligo 200 uM in water or TE Buffer Your bottom strand single stranded oligo 200 uM in water or TE Buffer 50 uM stock of lacZ ds control oligo thaw on ice 10X Oligo Annealing Buffer supplied with the kit Box 1 DNase RNase Free Water supplied with the kit Box 1 0 5 ml sterile microcentrifuge tubes 95 C water bath or heat block Follow this procedure to anneal your single stranded oligos to generate the ds oligo Note that the final concentration of the oligo mixture is 50 uM 1 Ina 0 5 ml sterile microcentrifuge tube set up the following annealing reaction at room temperature Reagent Amount Top strand DNA oligo 200 uM 5 pl Bottom strand DNA oligo 200 uM 5 pl 10X Oligo Annealing Buffer 2 ul DNase RNase Free Water 8 ul Total volume 20 ul If re annealing the lacZ ds control oligo centrifuge its tube briefly 5 seconds and transfer contents to a separate 0 5 ml sterile microcentrifuge tube Incubate the reaction at 95 C for 4 minutes Remove the tube containing the annealing reaction from the water bath or the heat block and set on your laboratory bench Allow the reaction mixture to cool to room temperature for 5 10 minutes The single stranded oligos will anneal during this time Place the sample in a microcentrifuge and centrifuge briefly 5 seconds Mix gently Remove 1 ul of the anne
75. you want to perform RNAi analysis with synthetic RNAi reagents use Stealth RNAi or short interfering RNA siRNA duplexes see the RNAi Designer at www invitrogen com rnai to design your duplexes In addition the BLOCK iT Dicer RNAi Kits are available to facilitate production of diced siRNA d siRNA For more information about these or any other BLOCK iT RNAi products visit the RNAi Central application portal at www invitrogen com rnai BLOCK iT U6 RNAi Entry Vector Kit Description of the System Generating shRNA Using the Kit The BLOCK iT U6 RNAi Entry Vector Kit facilitates the generation of an entry construct that permits high level expression of an shRNA of interest in mammalian cells for RNAi analysis of a target gene The kit contains the following major components e The pENTR U6 entry vector into which a ds oligo encoding the shRNA of interest will be cloned to generate an entry clone that contains the elements required for expression of the shRNA in mammalian cells The pENTR U6 vector is supplied linearized with 4 nucleotide 5 overhangs on each strand to facilitate directional cloning of the ds oligo insert The resulting entry clone containing the U6 RNAi cassette i e human U6 promoter ds oligo Pol III terminator may be transfected into mammalian cells for transient RNAi analysis or used to transfer the U6 RNAi cassette into a suitable destination vector using Gateway Technology For more infor
76. your shRNA i e Pol III promoter and terminator Using shRNA for RNAi Analysis The RNAi Pathway RNAi describes the phenomenon by which dsRNA induces potent and specific stRNA and shRNA inhibition of eukaryotic gene expression via the degradation of complementary messenger RNA mRNA and is functionally similar to the processes of post transcriptional gene silencing PTGS or cosuppression in plants Cogoni et al 1994 Napoli et al 1990 Smith et al 1990 van der Krol et al 1990 and quelling in fungi Cogoni and Macino 1999 Cogoni and Macino 1997 Romano and Macino 1992 In plants the PTGS response is thought to occur as a natural defense against viral infection or transposon insertion Anandalakshmi et al 1998 Jones et al 1998 Li and Ding 2001 Voinnet et al 1999 In eukaryotic organisms dsRNA produced in vivo or introduced by pathogens is processed into 21 23 nucleotide double stranded short interfering RNA duplexes siRNA by an enzyme called Dicer a member of the RNase III family of double stranded RNA specific endonucleases Bernstein et al 2001 Ketting et al 2001 Each siRNA then incorporates into an RNA induced silencing complex RISC an enzyme complex that serves to target cellular transcripts complementary to the siRNA for specific cleavage and degradation Hammond et al 2000 Nykanen et al 2001 In addition to dsRNA other endogenous RNA molecules including short temporal RNA stRNA se

U6 RNAi Entry Vector (BLOCKiT)

Contents

Download Pdf Manuals

Related Search

Related Contents