pBAD/Thio His TOPO manual - Thermo Fisher Scientific
Contents
1. e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com SDS Safety Data Sheets SDSs are available at www invitrogen com sds Certificate of The Certificate of Analysis provides detailed quality control and product Analysis qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box continued on next page 32 Technical Service continued Limited Warrant2. AAGTCTCTAG AGTCTTGTAA Sp 1 GGCCGCGGGC GGCGACGGGG GCGAGCGCGG GCCTGGCCTC ACCAGTTGCG GAGGACGCGG TCCGTCCTCA CGATTAGTTC GATGGAGTTT GTAATTCTCC GACAGTGGTT CCACCGAGAA GCGCCGCCGT TGAGCGGAAA CGCTCGGGAG GCCGTCGCTT TCGAGCTTTT CCCCACACTG TTGGAATTTG CAAAGTTTTT GAACCGGTGC CTAGAGAAGG TCCGCCTTTT TCCCGAGGGT Start of Transcription TTCITTTTCG CAACGGGTTT CCCACAGTCC TGGCGCGGGG GGGGGAGAAC GCCGCCAGAA GGCCTGGCCT CTTTACGGGT AGTACGTGAT GCGCTTAAGG GCCGCGTGCG CCATTTAAAA TCTTGATCCC AGCCCCTTCG AATCTGGTGG TTTTTGATGA ATGCGGGCCA AGATCTGCAC CCCGTGCGTC CCAGCGCACA TCGGACGGGG GTAGTCTCAA Sp 1 Exon TATGGCCCTT GAGCTTCGGG CCTCGTGCTT CACCTTCGCG CCTGCTGCGA ACTGGTATTT TGTTCGGCEA GCTGGCCGGC Sp 1 GTATCGCCCC GCCCPGGGCG GCAAGGCTGG GATGGCCGCT TCCCGGCCCT Sp 1 AGCGGGCGGG TGAGTCACCC Ap 1 cATG GACTC CACGGAGTAC GGAGTACGTC GTCTTTAGGT AGTGGGTGGA GACTGAAGTT CCCTTTTTGA GTTTGGATCT 3 end of Intron 1 GCTGCAGGGA ACACAAAGGA CGGGCGCCGT TGGGGGGAGG AGGCCAGCTT TGGTTCATTC PGA s TTCTTCCATT TCAGGTGTCG 5 end of Exon 2 27 Map and Features of pEF5 FRT V5 D TOPO pEF5 FRT V5 D The figure below shows the features of pEF5 FRT V5 D TOPO vector The TOPO Map complete sequence of pEF5 FRT V5 D TOPO is available for downloading 28 from our Web site www invitrogen com or
3. 5 Yeast Extract 1 0 NaCl pH 7 0 1 3 and 4 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C add antibiotic if needed Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 This solution can be prepared from the following common stock solutions For 100 ml combine 1M Tris base 5 ml 5M NaCl 3 ml Nonidet P 40 1ml 2 Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCl 3 Bring the volume up to 100 ml Store at room temperature To prevent proteolysis you may add 1 mM PMSF 1 uM leupeptin or 0 1 uM aprotinin before use 1 2 3 Combine the following reagents 0 5 M Tris HCl pH 6 8 5ml Glycerol 10076 4 ml B mercaptoethanol 0 8 ml Bromophenol Blue 0 04 g SDS 0 8 Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed 31 Technical Service Web Resources Visit the Invitrogen website at www invitrogen com for
4. Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Gritz L and Davies J 1983 Plasmid Encoded Hygromycin B Resistance The Sequence of Hygromycin B Phosphotransferase Gene and its Expression in EF coli and S Cerevisiae Gene 25 179 188 Gronostajski R M and Sadowski P D 1985 Determination of DNA Sequences Essential for FLP mediated Recombination by a Novel Method J Biol Chem 260 12320 12327 Jayaram M 1985 Two micrometer Circle Site specific Recombination The Minimal Substrate and the Possible Role of Flanking Sequences Proc Natl Acad Sci USA 82 5875 5879 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biol 115 887 903 continued on next page 37 References continued Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Mizushima S and Nagata S 1990 pEF BOS a Powerful Mammalian Expression Vector Nucleic Acids Res 18 5322 Palmer T D Hock R A Osborne W R A and Miller A D 1987 Efficient Retrovirus Mediated Transfer and Expression of a Human Adenosine Deaminase Gene in Diploid Skin Fibrobl
5. PCR products are directionally cloned by adding four bases to the forward primer CACC The overhang in the cloning vector GTGG invades the 5 end of the PCR product anneals to the added bases and stabilizes the PCR product in the correct orientation Inserts can be cloned in the correct orientation with efficiencies equal to or greater than 90 Topoisomerase e CCCTT CACC ATG NNN NNN AAG GG GGGAAGTGG 6TGG TAC NNN NNN TTC QUC 2 PCR product Overhang fr Overhang invades double stranded 0 DNA displacing the bottom strand Topoisomerase CCCTTCACC ATG NNN NNN AAG GG GGGAAGTGG TAC NNN NNN TTC CC Experimental Outline Experimental Outline The table below describes the general steps needed to clone and express your gene of interest For more details refer to the pages indicated Step Action Page 1 Design PCR primers to clone your gene of interest in frame with the C terminal V5 epitope tag if desired Consult the diagram on page 8 to help you design your PCR primers 6 8 Produce your blunt end PCR product TOPO Clone your PCR product into pEF5 FRT V5 D TOPO and transform into One Shot TOP10 E coli Select transformants on LB plates containing 50 100 ug ml ampicillin 10 14 Analyze transformants by restriction digestion or PCR 15 Select a transformant with the correct restr
6. and Sadowski P D 1985 The FLP Recombinase of the 2 Micron Circle DNA of Yeast Interaction with its Target Sequences Cell 40 795 803 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Molec Cell Biol 7 2745 2752 Cheng C and Shuman S 2000 Recombinogenic Flap Ligation Pathway for Intrinsic Repair of Topoisomerase IB Induced Double Strand Breaks Mol Cell Biol 20 8059 8068 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Craig N L 1988 The Mechanism of Conservative Site Specific Recombination Ann Rev Genet 22 77 105 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goldman L A Cutrone E C Kotenko S V Krause C D and Langer J A 1996 Modifications of Vectors pEF BOS pcDNA1 and pcDNA3 Result in Improved Convenience and Expression BioTechniques 21 1013 1015 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the
7. be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time may yield more colonies 2 Place the reaction on ice and proceed to Transforming One Shot TOP10 Competent Cells next page Note You may store the TOPO Cloning reaction at 20 C overnight 11 Transforming One Shot TOP10 Competent Cells Introduction Materials Supplied by the User Note Preparing for Transformation Once you have performed the TOPO Cloning reaction you will transform your pEF5 FRT V5 D TOPO construct into competent E coli One Shot TOP10 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation however you may also transform electrocompetent cells see page vii for ordering information Protocols to transform chemically competent or electrocompetent F coli are provided in this section In addition to general microbiological supplies e g plates spreaders you will need the following reagents and equipment e 42 C water bath or electroporator with cuvettes optional e LB plates containing 50 100 ug ml ampicillin two for each transformation e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned in the correct orientation Sequencing primers are included in the kit to sequ
8. e eene eite ee it est peni cea Ra I Eee dre one 25 Human EE 16 Promoter 32e et etate e eet e eng erbe Fe deer a edet ie 27 Map and Features of pEF5 FRT VSD TOROS e tati i o a Ee epe 28 Map of pEE5 FRT V57 GW QAT iieri tenter tee ee n HF e i e eee torte eite Hot deinen 30 slm 31 Technical Service vais eects aks diel nune digan nda enfin eid eta EE 32 Purchaser Notification iustae tal eee Ue et Hee f eee e a eene qe ut ese tei isto 34 Gateway Clone Distribution PoliGy ated d rr NERO Ipse eR e 36 Reterences a m seite inest ete EE E Hee aee eee uei d 37 Important Information Shipping Storage pEF5 FRT V5 D TOPO Reagents The pEF5 FRT V5 Directional TOPO Expression Kit is shipped on dry ice Each kit contains two boxes Upon receipt store as detailed below Box Item Storage 1 pEF5 FRT V5 D TOPO Reagents 20 C 2 One Shot TOP10 chemically competent E coli 80 C pEF5 FRT V5 D TOPO reagents Box 1 are listed below Note that the user must supply a thermostable proofreading polymerase and the appropriate PCR buffer Store Box 1 at 20 C Item Concentration Amount pEF5 FRT V5 D TOPO 15 20 ng ul linearized plasmid DNA in 20 ul vector TOPO adapted 45 glycerol 50 mM Tris HCl pH 7 5 at 25 C 0 25 mM EDTA 0 28 M NaCl 1 mM DTT 0 05 Triton X 100 50 ug ml BSA 30 uM bromophenol blue dNTP Mix 12 5 mM dATP 10 pl 12 5 mM dCTP 12 5
9. isothiocyanate FITC conjugated antibodies allow one step detection in immunofluorescence experiments The amount of antibody supplied is sufficient for 25 Western blots or 25 immuno staining reactions FITC conjugated antibody only Product Epitope Catalog no Anti V5 Antibody Detects 14 amino acid epitope R960 25 Anti V5 HRP Antibody derived from the P and V proteins R961 25 of the paramyxovirus SV5 Anti V5 AP Antibody Southern et al 1991 R962 25 Anti V5 FITC Antibody GKPIPNPLLGLDST R963 25 Overview Introduction pEF5 FRT V5 Directional TOPO Vector Introduction The pEF5 FRT V5 Directional TOPO Expression Kit combines the Flp In System with TOPO Cloning technology to provide a highly efficient 5 minute cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a vector for targeted expression of the gene of interest in mammalian cell lines Blunt end PCR products clone directionally at greater than 90 efficiency with no ligase post PCR procedures or restriction enzymes required pEF5 FRT V5 D TOPO is a 5 8 kb expression vector designed to facilitate rapid directional TOPO cloning and expression of PCR products using the Flp In System available from Invitrogen When cotransfected with the pOG44 Flp recombinase expression plasmid into a Flp In mammalian host cell line the pEF5 FRT V5 D TOPO vector containing the PCR produc
10. mM dGTP 12 5 mM dTTP in water pH 8 Salt Solution 1 2 M NaCl 50 ul 0 06 M MgCl Sterile Water 1ml T7 Promoter Sequencing 0 1 ug ul in TE Buffer pH 8 20 ul Primer BGH Reverse Sequencing 0 1 ug l in TE Buffer pH 8 20 ul Primer Expression Control 0 5 ug ul in TE Buffer pH8 10 ul Plasmid pEF5 FRT V5 GW CAT Control PCR Primers 0 1 ug ul each in TE Buffer pH 8 10 ul Control PCR Template 0 1 ug ul in TE Buffer pH 8 10 ul continued on next page Important Information continued Sequences of the Primers One Shot TOP10 Reagents Genotype of TOP10 vi The table below provides the sequences of T7 Promoter and BGH Reverse sequencing primers Two micrograms of each primer are supplied Primer Sequence pMoles Supplied 17 Promoter 5 IAATACGACTCACTATAGGG 3 328 BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 358 The table below lists the items included in the One Shot TOP10 Chemically Competent E coli kit Box 2 Transformation efficiency is 1 x 10 cfu ug DNA Store Box 2 at 80 C 0 5 mM EDTA pH 8 Item Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 21 x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 ul F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str
11. sequence increasing the probability that the PCR product will clone in the opposite orientation You want to avoid this situation DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TAG 3 Proposed Reverse PCR primer sequence TG AGC TGC TGC CAC AAA 5 Another solution is to design the reverse primer so that it hybridizes just down stream of the stop codon but still includes the C terminus of the ORF Note that you will need to replace the stop codon with a codon for an innocuous amino acid such as glycine alanine or lysine continued on next page Designing PCR Primers continued Example 2 of Reverse Primer Design Important TOPO Cloning Site for pEF5 FRT V5 D TOPO 1519 1579 1627 1678 1729 1789 Below is the sequence of the C terminus of a theoretical protein The stop codon is underlined GCG GTT AAG TCG GAG CAC TCG ACG ACT GCA TAG 3 To fuse the ORF in frame with a C terminal tag remove the stop codon by starting with nucleotides homologous to the last codon TGC and continue upstream The reverse primer will be 5 TGC AGT CGT CGA GTG CTC CGA CTT 3 This will amplify the C terminus without the stop codon and allow you to join the ORF in frame with a C terminal tag If you don t want to join the ORF in frame with a C terminal tag simply design the reverse primer to include the stop codon 5 CTA TGC AGT CGT CGA GTG CTC CGA CTT 3 Remember that pEF5 FRT V5 D TOPO acc
12. solution Add 1 5 volumes Binding Buffer Load solution no more than 1 ml at a time from Step 3 onto a S N A P column Centrifuge 1 minute at 3000 x g in a microcentrifuge and discard the supernatant If you have solution remaining from Step 3 repeat Step 4 Add 900 ul of the Final Wash Buffer Centrifuge 1 minute at full speed in a microcentrifuge and discard the flow through Repeat Step 7 Elute the purified PCR product in 40 ul of TE or sterile water Use 4 ul for the TOPO Cloning reaction and proceed as described on page 11 An even easier method is to simply cut out the gel slice containing your PCR product place it on top of the S N A P column bed and centrifuge at full speed for 10 seconds Use 1 2 ul of the flow through in the TOPO Cloning reaction page 11 Be sure to make the gel slice as small as possible for best results continued on next page 25 Gel Purifying PCR Products continued Low Melt Agarose Method Note 26 If you prefer to use low melt agarose use the procedure below Note that gel purification will result in a dilution of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the t
13. the next page Use the appropriate percentage of acrylamide to resolve your fusion protein continued on next page 19 Assaying for Expression continued Polyacrylamide Gel Electrophoresis Note Assay for CAT Protein 20 To facilitate separation and visualization of your recombinant fusion protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen The NuPAGE Gel System avoids the protein modifications associated with Laemmli type SDS PAGE ensuring optimal separation for protein analysis In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our Web site www invitrogen com or contact Technical Service page 32 The C terminal peptide tag containing the V5 epitope will add approximately 5 kDa to the size of your protein If you use pEF5 FRT V5 GW CAT as a positive control vector you may assay for CAT expression using your method of choice Note that CAT is fused to the C terminal V5 epitope tag so you can use Western blot analysis and an Anti V5 antibody to detect expression of CAT CAT Antiserum is also available separately from Invitrogen see page vii for ordering information Other commercial kits are
14. ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 Southern et al 1991 An example of a Kozak consensus sequence is G AJNNATGG Other sequences are possible but the G or A at position 3 and the G at position 4 are the most critical for function shown in bold The ATG initiation codon is underlined Note If your sequence of interest does not contain an initiation codon within the context of a Kozak sequence design the forward PCR primer to contain a Kozak sequence at the 5 end of the primer see Example below Below is the sequence of the N terminus of a theoretical protein and the proposed sequence for your forward PCR primer The ATG initiation codon is underlined DNA sequence 5 ATG GGA TCT GAT AAA Proposed Forward PCR primer 5 C ACC ATG GGA TCT GAT AAA If you design the forward PCR primer as noted above then the ATG initiation codon falls within the context of a Kozak sequence see boxed sequence allowing proper translation initiation of the PCR product The first three base pairs of the PCR product following the 5 CACC overhang will constitute a functional codon continued on next page Designing PCR Primers continued Guidelines to Design the Reverse Primer Example 1 of Reverse Primer Design When designing your reverse PCR primer consider the points below Refer to page 8 for a diagram of the TOPO Cloning site for pEF5 FRT V5 D T
15. Catalog no pcDNA5 FRT 20 ug lyophilized in TE V6010 20 pEF5 FRT V5 DEST 6 ug V6020 20 Gateway Vector pcDNA5 FRT V5 His TOPO TA 1 kit K6020 01 Expression Kit pSecTag FRT V5 His TOPO 1kit K6025 01 TA Expression Kit continued on next page vii Accessory Products continued Flp In Host Cell Lines Detection of Recombinant Proteins viii For your convenience Invitrogen has available several mammalian Flp In host TM cell lines that stably express the lacZ Zeocin fusion gene from pFRT lacZeo or PFRT lacZeo2 Each cell line contains a single integrated FRT site as confirmed by Southern blot analysis The cell lines should be maintained in medium containing Zeocin For more information about each cell line refer to our Web site www invitrogen com or contact Technical Service page 32 Cell Line Amount Catalog no Flp In 293 3 x 10 cells frozen R750 07 Flp In CV 1 3 x 10 cells frozen R752 07 Flp In CHO 3 x 10 cells frozen R758 07 Flp In BHK 3 x 10 cells frozen R760 07 Flp In 3T3 3 x 106 cells frozen R761 07 Flp In Jurkat 3 x 106 cells frozen R762 07 Expression of your recombinant fusion protein can be detected using Anti V5 antibodies available from Invitrogen Horseradish peroxidase HRP or alkaline phosphatase AP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection methods Fluorescein
16. Flp Recombinase Mediated DNA Recombination FRT Site FRT Site in pEF5 FRT V5 D TOPO In the Flp In System integration of your pEF5 FRT V5 D TOPO expression construct into the genome occurs via Flp recombinase mediated intermolecular DNA recombination The hallmarks of Flp mediated recombination are listed below e Recombination occurs between specific FRT sites see below on the interacting DNA molecules e Recombination is conservative and requires no DNA synthesis the FRT sites are preserved following recombination and there is minimal opportunity for introduction of mutations at the recombination site e Strand exchange requires only the small 34 bp minimal FRT site see below For more information about the Flp recombinase and conservative site specific recombination refer to published reviews Craig 1988 Sauer 1994 The FRT site originally isolated from Saccharomyces cerevisiae serves as a binding site for Flp recombinase and has been well characterized Gronostajski and Sadowski 1985 Jayaram 1985 Sauer 1994 Senecoff et al 1985 The minimal FRT site consists of a 34 bp sequence containing two 13 bp imperfect inverted repeats separated by an 8 bp spacer that includes an Xba I restriction site see figure below An additional 13 bp repeat is found in most FRT sites but is not required for cleavage Andrews et al 1985 While Flp recombinase binds to all three of the 13 bp repeats strand cleavage act
17. Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Allows detection of your recombinant protein with the Anti V5 antibodies Southern et al 1991 BGH Reverse priming site Allows sequencing of the insert Bovine growth hormone BGH polyadenylation signal Allows efficient transcription termination and poly adenylation of mRNA Goodwin and Rottman 1992 Flp Recombination Target FRT site Encodes a 34 bp 14 bp of non essential sequence that serves as the binding and cleavage site for Flp recombinase Gronostajski and Sadowski 1985 Jayaram 1985 Senecoff et al 1985 Hygromycin resistance gene no ATG Allows selection of stable transfectants in mammalian cells Gritz and Davies 1983 when brought in frame with a promoter and an ATG initiation codon through Flp recombinase mediated recombination via the FRT site SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli bla promoter Allows expression of the ampicillin bla resistance gene Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli 29 Map of pEF5 FRT V5 GW CAT Description pEF5 FRT V5 GW CAT is a 6560 bp control vector expressing chloramphenicol acetyltransferase CAT pEF5 FRT V5 GW CAT was constructed using the Gateway LR r
18. Invitrogen by technologies pEF5 FRT V5 Directional TOPO Expression Kit Five minute directional TOPO Cloning of blunt end PCR products into an expression vector containing the human EF 1o promoter and a C terminal V5 epitope for use with the Flp In System Catalog no K6035 01 Rev Date 7 July 2010 Manual part no 25 0476 MANO0000265 Table of Contents Important Information 1 eiit e Deseret eset tee e esee ie taeda etes fes obese as sete telaio esiste v Accessory Products coiere ose edible baee eddie free ed ded bs rire b erige vii Introduction pm 1 OV6etVie Was ee enee dee Odes ath eet n aet HU Be bees iae tdi te bee Le ie rete eden 1 How Directional TOPO Cloning Works ue epi Ee 4 Experimental Outlime enne opto eR eoe ote be ee 5 M thodS Re 6 D signing PCR Primers gsis isein reserse e ee Det PERIERE RE meses fut noie ee ue ye desde s tiere 6 Producing Blunt End PCR Products EEN 9 Performing the TOPO Cloning Reaction etii qiealent tdem prata edat 10 Transforming One Shot TOPIO Competent Calls a e en Sel sacs asthe uen Me tiun eoru eds 12 Analyzing Transformants EEN 15 Generating the Flp In Expression Kelte ege EE RO T VER rv Ro Rn eR 17 Assaying for Expression 2s aoo eid e eei tpe e e vente adf te pore eed tvi nash pires denos 19 Troubleshooting EE 21 Is Tt qe 23 Performing the Control Reactions EE 23 Gel Purifying PCR Products mee edited
19. OPO e To ensure that your PCR product clones directionally with high efficiency the reverse PCR primer MUST NOT be complementary to the overhang sequence GTGG at the 5 end A one base pair mismatch can reduce the directional cloning efficiency from 90 to 50 increasing the likelihood of your ORF cloning in the opposite orientation see Example 1 below We have not observed evidence of PCR products cloning in the opposite orientation from a two base pair mismatch e If you wish to fuse your PCR product in frame with the C terminal V5 epitope tag design the reverse PCR primer to remove the native stop codon in the gene of interest see Example 2 on the next page e If you do NOT wish to fuse your PCR product in frame with the C terminal V5 epitope tag include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site see Example 2 on the next page Below is the sequence of the C terminus of a theoretical protein You want to fuse the protein in frame with a C terminal tag The stop codon is underlined DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TAG 3 One solution is to design the reverse PCR primer to start with the codon just up stream of the stop codon but the last two codons contain GTGG underlined below which is identical to the 4 bp overhang sequence As a result the reverse primer will be complementary to the 4 bp overhang
20. a full refund Otherwise please complete the User Registration Card and return it to Life Technologies Life Technologies grants you a non exclusive license to use the enclosed System for research purposes only The System is being transferred to you in furtherance of and reliance on such license You may not use the System or the materials contained therein for any Commercial Purpose without licenses for such purpose Commercial Purpose includes any use of the System or Expression Products in a Commercial Product any use of the System or Expression Products in the manufacture of a Commercial Product any sale of the System or Expression Products any use of the System or Expression Products to facilitate or advance research or development of a Commercial Product and any use of the System or Expression Products to facilitate or advance any research or development program the results of which will be applied to the development of a Commercial Product Expression Products means products expressed with the System or with the use of any vectors or host strains in the System Commercial Product means any product intended for sale or commercial use Access to the System must be limited solely to those officers employees and students of your entity who need access to perform the aforementioned research Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distr
21. a single discrete band follow the manufacturer s recommendations to optimize your PCR with the polymerase of your choice Alternatively you may gel purify the desired product see pages 25 26 e Estimate the concentration of your PCR product You will use this information when setting up your TOPO Cloning reaction see Amount of PCR Product to Use in the TOPO Cloning Reaction next page for details Performing the TOPO Cloning Reaction Introduction Amount of PCR Product to Use in the TOPO Cloning Reaction Once you have produced the desired PCR product you are ready to TOPO Clone it into the pEF5 FRT V5 D TOPO vector and transform the recombinant vector into TOP10 E coli It is important to have everything you need set up and ready to use to ensure that you obtain the best possible results We suggest that you read this section and the section entitled Transforming One Shot TOP10 Competent Cells pages 12 13 before beginning If this is the first time you have TOPO Cloned perform the control reactions on pages 23 24 in parallel with your samples When performing directional TOPO Cloning we have found that the molar ratio of PCR product TOPO vector used in the reaction is critical to its success To obtain the highest TOPO Cloning efficiency use a 0 5 1 to 2 1 molar ratio of PCR product OPO vector see figure below Note that the TOPO Cloning efficiency decreases significantly if the ratio of PCR produc
22. asts from an Adenosine Deficient Human Proc Natl Acad Sci U S A 84 1055 1059 Sauer B 1994 Site Specific Recombination Developments and Applications Curr Opin Biotechnol 5 521 527 Senecoff J F Bruckner R C and Cox M M 1985 The FLP Recombinase of the Yeast 2 micron Plasmid Characterization of its Recombination Site Proc Natl Acad Sci USA 82 7270 7274 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Wieler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 2010 Life Technologies Corporation All rights reserved For research use only Not intended for any animal
23. available for assaying CAT expression The molecular weight of the CAT V5 fusion protein is approximately 30 kDa Troubleshooting TOPO Cloning Reaction and Transformation The table below lists some potential problems and possible solutions that may help you troubleshoot the TOPO Cloning and transformation reactions To help evaluate your results we recommend that you perform the control reactions in parallel with your samples see pages 23 24 Problem Reason Solution Few or no colonies Suboptimal ratio of PCR Use a 0 5 1 to 2 1 molar ratio of PCR obtained from sample product TOPO vector used in the product TOPO vector reaction and the TOPO Cloning reaction EE control Too much PCR product used in the e Dilute the PCR product ave colonies B TOPO Cloning reaction e Usea0 5 1 to 2 1 molar ratio of PCR product TOPO vector PCR product too dilute e Concentrate the PCR product e Use a0 5 1 to 2 1 molar ratio of PCR product TOPO vector PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Incorrect PCR primer design e Make sure that the forward PCR primer contains the sequence CACC at the 5 end e Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Used Taq polymerase or a Taq proofreading polymerase mixture for PCR Use a proofreading polymerase for PCR Long PCR product e Increase the incubatio
24. by contacting Technical Service page 32 gt v 5 apes MESS 20 MERI stop pEF5 FRT V5 D TOPO Comments for pEF5 FRT V5 D TOPO 5831 nucleotides EF 1a promoter bases 348 1531 i T7 promoter priming site bases 1548 1567 pUC ori TOPO recognition site 1 bases 1612 1616 Overhang bases 1617 1620 TOPO recognition site 2 bases 1621 1625 V5 epitope bases 1705 1746 BGH reverse priming site bases 1784 1801 BGH polyadenylation signal bases 1790 2014 FRT site bases 2297 2344 Hygromycin resistance gene no ATG bases 2352 3372 SV40 early polyadenylation signal bases 3504 3634 pUC origin bases 4017 4690 bla promoter bases 5696 5794 complementary strand Ampicillin b a resistance gene bases 4835 5695 complementary strand continued on next page Map and Features of pEF5 FRT V5 D TOPO continued Features of pEF5 FRT V5 D TOPO pEF5 FRT V5 D TOPO 5831 bp contains the following elements All features have been functionally tested Feature Benefit Human elongation factor 1a hEF 1a promoter Allows overexpression of your recombinant protein in a broad range of mammalian cell types Goldman et al 1996 Mizushima and Nagata 1990 T7 Promoter priming site Allows in vitro transcription in the sense orientation and sequencing through the insert TOPO Cloning site directional Allows rapid directional cloning of your PCR product V5 epitope
25. d incubate overnight at 37 C We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction may produce several hundred colonies Pick 5 colonies for analysis see Analyzing Transformants page 15 Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the One Shot TOP10 chemically competent cells for electroporation 1 Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 11 into a 0 1 cm cuvette containing 50 ul of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Electroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see the next page Immediately add 250 ul of room temperature S O C medium Transfer the solution to a 15 ml snap cap tube e g Falcon and shake for at least 1 hour at 37 C to allow expression of the ampicillin resistance gene Spread 20 100 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction may produce several hundred colonies Pick 5 colonies for analysis see Analyzing Transf
26. ecombination reaction between an entry clone containing the CAT gene and the pEF5 FRT V5 DEST destination vector For more information on Gateway Cloning refer to the Gateway Technology manual which is available for downloading from our Web site www invitrogen com CAT is expressed as a fusion to the V5 epitope tag The molecular weight of the protein is approximately 30 kDa pEF5 FRT V5 GW The figure below summarizes the features of pEF5 FRT V5 GW CAT The CAT Map complete sequence of pEF5 FRT V5 GW CAT is available for downloading 30 from our Web site www invitrogen com or by contacting Technical Service page 32 Fu m CAT attB2 V5 epitope ec Comments for pEF5 FRT V5 GW CAT 6560 nucleotides EF 1a promoter bases 348 1531 T7 promoter priming site bases 1548 1567 attB1 recombination site bases 1653 1669 DUC ori CAT ORF bases 1699 2355 attB2 recombination site bases 2356 2381 V5 epitope bases 2434 2475 BGH reverse priming site bases 2513 2530 BGH polyadenylation signal bases 2519 2743 FRT site bases 3026 3073 Hygromycin resistance gene no ATG bases 3081 4101 SV40 early polyadenylation signal bases 4233 4363 pUC origin bases 4746 5419 bla promoter bases 6425 6523 complementary strand Ampicillin b a resistance gene bases 5564 6424 complementary strand Recipes LB Luria Bertani Medium and Plates Cell Lysis Buffer 4X SDS PAGE Sample Buffer Composition 1 0 Tryptone 0
27. ence across an insert in the multiple cloning site to confirm orientation and reading frame For each transformation you will need one vial of competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e Warm the vial of S O C medium from Box 2 to room temperature e Warm LB plates containing 50 100 ug ml ampicillin at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot TOP10 cells from Box 2 for each transformation continued on next page Transforming One Shot TOP10 Competent Cells continued One Shot TOP10 Chemical Transformation Protocol Transformation by Electroporation Qi Sgt oa Oe Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 11 into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 50 200 ul from each transformation on a prewarmed selective plate an
28. endA1 nupG Accessory Products Introduction Additional Products Flp In Expression Vectors The products listed in this section may be used with the pEF5 FRT V5 Directional TOPO Expression Kit For more information refer to our Web site www invitrogen com or contact Technical Service page 32 Some of the products included in the pEF5 FRT V5 Directional TOPO Expression Kit as well as other reagents that may be used with the Flp In System are available separately from Invitrogen Ordering information is provided below Product Amount Catalog no Hygromycin 1g R220 05 Zeocin 1g R250 01 5g R250 05 pFRT lacZeo 20 ug lyophilized in TE V6015 20 pFRT lacZeo2 20 ug lyophilized in TE V6022 20 pOG44 20 ug lyophilized in TE V6005 20 Phosphate Buffered Saline pH 7 4 500 ml 10010 023 One Shot TOP10 10 reactions C4040 10 Chemically Competent Cells 20 reactions C4040 03 40 reactions C4040 06 One Shot TOP10 10 reactions C4040 50 Electrocompetent Cells J0 reacti ns C4040 52 CAT Antiserum 50 ul R902 25 The amount supplied is sufficient to perform 25 Western using 10 ml working solution per reaction TM Additional Flp In expression vectors are available from Invitrogen For more information about each vector refer to our Web site www invitrogen com or contact Technical Service page 32 Product Amount
29. endations Product for the polymerase you are using 1 To produce the 750 bp control PCR product set up the following 50 ul PCR Control DNA Template 100 ng 11d 10X PCR Buffer appropriate for enzyme 5 pl dNTP Mix 0 5 ul Control PCR Primers 0 1 ug l each 1 ul Sterile Water 41 5 ul Thermostable polymerase 1 2 5 units ul 1 ul Total Volume 50 ul Overlay with 70 ul 1 drop of mineral oil if required 3 Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 55 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 750 bp band should be visible 5 Estimate the concentration of the PCR product and adjust as necessary such that the amount of PCR product used in the control TOPO Cloning reaction results in an optimal molar ratio of PCR product TOPO vector i e 0 5 1 to 2 1 Proceed to the Control TOPO Cloning Reactions next page continued on next page 23 Performing the Control Reactions continued Control TOPO Cloning Reactions Analysis of Results Transformation Control 24 Using the control PCR product produced on the previous page and the pEF5 FRT V5 D TOPO vector set up two 6 ul TOPO Cloning reactions as described below If you plan to transf
30. epts blunt end PCR products Do not add 5 phosphates to your primers for PCR This will prevent ligation into pEF5 FRT V5 D TOPO We recommend that you gel purify your oligonucleotides especially if they are long gt 30 nucleotides Use the diagram below to help you design suitable PCR primers to clone your PCR product into pEF5 FRT V5 D TOPO Restriction sites are labeled to indicate the actual cleavage site The sequence of pEF5 FRT V5 D TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 32 3 end of hEF 1 Intron 1 T7 promoter priming site l TCAGGTGTCG TGAGGAATTA GCTTGGTACT AATACGACTC ACTATAGGGA GACCCAAGCT 5 end of hEF 1a Exon 2 uM d M GGCTAGGTAA GCTTGGTACC GAGCTCGGAT CATCCCTTOeNPNele ENNEN AAG GGT GTAGGGAAG TCC ee TTC CCA E Lys Gly Spel EcoRV Je Not l l ACT AGT CCA GTG TGG TGG AAT TCT GCA GAT ATC CAG CAC AGT GGC GGC CGC Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His Ser Gly Gly Arg Sfu V5 epitope TCG AGT CTA GAG GGC CCG CGG TTC GAA GGT AAG CCT ATC CCT AAC CCT CTC Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Pme l CTC GGT CTC GAT TCT ACG CGT ACC GGT TAG TAATGAGTTT AAACCCGCTG ATCAGCCTCG Leu Gly Leu Asp Ser Thr Arg Thr Gly BGH reverse priming site ACTGTGCCTT CTAGTTGCCA GCCATCTGTT GTTTGCCCCT CCCCCGTGCC TTCCTTGACC Producing Blunt End PCR Products Introduc
31. final extension incubate at 72 C for 10 minutes Store at 4 C DOW Pe 2 Visualize by agarose gel electrophoresis continued on next page 15 Analyzing Transformants continued If you have problems obtaining transformants or the correct insert perform the Important control reactions described on page 23 24 These reactions will help you trouble shoot your experiment Long Term Once you have identified the correct clone be sure to purify the colony and make Storage a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colony on LB plates containing 50 100 ug ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 100 ug ml ampicillin Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Generating the Flp In Expression Cell Line Introduction S MENO RECO Nous l Plasmid Preparation Methods of Transfection This section provides general information for cotransfecting your pEF5 FRT V5 D TOPO construct and pOG44 plasmid into your mammalian Flp In host cell line to generate your stable Flp In expression cell line We recommend that you include the pEF5 FRT V5 GW CAT positive control vector and a mock transfection negative control in your experiment to evaluate y
32. gner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 We typically use lipid based transfection reagents to introduce Flp In expression constructs into Flp In host cell lines If you wish to use a lipid based reagent for transfection we recommend using Lipofectamine 2000 Reagent available from Invitrogen Catalog no 11668 027 For more information about Lipofectamine 2000 Reagent and other transfection reagents available from Invitrogen refer to our Web site www invitrogen com or contact Technical Service page 32 continued on next page 17 Generating the Flp In Expression Cell Line continued Positive Control Hygromycin B Determination of Hygromycin Sensitivity Important pEF5 FRT V5 GW CAT is provided as a positive control vector for mammalian cell transfection and expression see page 30 for a map and may be used to assay for recombinant protein expression levels in your Flp In host cell line Cotransfection of the positive control vector and pOG44 into your Flp In host cell line allows you to generate a stable cell line expressing chloramphenicol acetyl transferase CAT at the same genomic locus as your gene of interest If you have several different Flp In host cell lines you may use the pEF5 FRT V5 GW CAT control vector to compare protein expression levels between the various cell lines To propagate and maintain the plasmid 1 Use the stock solutio
33. h the hygromycin resistance gene through Flp recombinase mediated integration of pEF5 FRT V5 D TOPO at the FRT site For more information about the generation of the Flp In host cell line and TM TM details of the Flp In System refer to the Flp In System manual How Directional TOPO Cloning Works How Topoisomerase I Works Directional TOPO Cloning Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites CCCTT and cleaves the phosphodiester backbone in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Directional joining of double strand DNA using TOPO charged oligonucleotides occurs by adding a 3 single stranded end overhang to the incoming DNA Cheng and Shuman 2000 Southern et al 1991 This single stranded overhang is identical to the 5 end of the TOPO charged DNA fragment At Invitrogen this idea has been modified by adding a 4 nucleotide overhang sequence to the TOPO charged DNA and adapting it to a whole vector format In this system
34. hat the forward PCR primer contains the sequence CACC at the 5 end e Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot competent E coli stored incorrectly Store One Shot competent E coli at 80 C If you are using another E coli strain follow the manufacturer s instructions One Shot transformation protocol not followed correctly Follow the One Shot transformation protocol provided on page 13 Insufficient amount of E coli plated Increase the amount of E coli plated Transformants plated on selective plates containing the wrong antibiotic Use the appropriate antibiotic for selection 22 Appendix Performing the Control Reactions Introduction We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product using the reagents included in the kit and using this product directly in a TOPO Cloning reaction Before Starting For each transformation prepare two LB plates containing 50 100 ug ml ampicillin Producing the Use your thermostable proofreading polymerase and the appropriate buffer to Control PCR amplify the control PCR product Follow the manufacturer s recomm
35. he 17 Promoter and BGH Reverse primers are included in the kit to help you sequence your insert Refer to the diagram on page 8 for the location of the primer binding sites If you download the sequence for pEF5 FRT V5 D TOPO from our Web site note that the overhang sequence GTGG will be shown already hybridized to CACC No DNA sequence analysis program allows us to show the overhang without the complementary sequence You may analyze positive transformants using PCR For PCR primers use a combination of the T7 Promoter primer or the BGH Reverse primer and a primer that hybridizes within your insert You will have to determine the amplification conditions If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The protocol below is provided for your convenience Other protocols are suitable Materials Needed PCR SuperMix High Fidelity Invitrogen Catalog no 10790 020 Appropriate forward and reverse PCR primers 20 uM each Procedure L For each sample aliquot 48 ul of PCR SuperMix High Fidelity into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick5 colonies and resuspend them individually in 50 ul of the PCR cocktail from Step 1 above Incubate reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases Amplify for 20 to 30 cycles For the
36. ibute the System or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the System to a third party without written notification to and written approval from Life Technologies You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Life Technologies This product is licensed under U S Patent Nos 5 654 182 and 5 677 177 and is for research purposes only Inquiries about licensing for commercial or other uses should be directed to The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Department of Intellectual Property and Technology Transfer Phone 858 453 4100 ext 1703 Fax 858 450 0509 Email mwhite salk edu 35 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 36 The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that
37. icensing lifetech com For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy page 36 continued on next page Purchaser Notification continued Limited Use Label License No 60 EF1 o Promoter Limited Use Label License No 64 FIp In System EF lalpha promoter products are sold under license for research purposes only The use of this product for any commercial purpose including but not limited to use in any study for the purpose of a filing of a new drug application requires a license from Mochida Pharmaceutical Co Ltd 7 Yotsuya 1 Chome Shinjuku Ku Tokyo 160 Japan Tel 81 3 3225 5451 Fax 81 3 3225 6091 Life Technologies Corporation Life Technologies has a license to sell the Flp In System and its components System to scientists for research purposes only under the terms described below Use of the System for any Commercial Purpose as defined below requires the user to obtain commercial licenses as detailed below Before using the System please read the terms and conditions set forth below Your use of the System shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the System pursuant to these terms and conditions please contact Life Technologies Technical Services within 10 days to return the unused and unopened System for
38. iction pattern and sequence it to confirm that your gene is cloned in frame with the C terminal V5 epitope tag if desired 15 Cotransfect your pEF5 FRT V5 D TOPO construct and pOGA4 into the Flp In host cell line using your method of choice and select for hygromycin resistant clones see the Flp TM In System manual for more information 17 18 Assay for expression of your protein of interest 19 20 Methods Designing PCR Primers Designing Your PCR Primers Guidelines to Design the Forward PCR Primer Example of Forward Primer Design Note The design of the PCR primers to amplify your gene of interest is critical for expression Consider the following when designing your PCR primers e Sequences required to facilitate directional cloning e Sequences required for proper translation initiation of your PCR product e Whether or not you wish your PCR product to be fused in frame with the C terminal V5 epitope tag When designing your forward PCR primer consider the following points below Refer to page 8 for a diagram of the TOPO Cloning site for pEF5 FRT V5 D TOPO e To enable directional cloning the forward PCR primer MUST contain the sequence CACC at the 5 end of the primer The 4 nucleotides CACC base pair with the overhang sequence GTGG in pEF5 FRT V5 D TOPO e Make sure your sequence of interest includes a Kozak translation initiation sequence with an
39. n time of the TOPO reaction from 5 minutes to 30 minutes e Gel purify the PCR product to remove primer dimers and other artifacts PCR reaction contains artifacts i e does not run as a single discrete band on an agarose gel e Optimize your PCR using the proofreading polymerase of choice e Gel purify your PCR product to remove primer dimers and smaller PCR products Cloning large pool of PCR products or a toxic gene e Increase the incubation time of the TOPO reaction from 5 minutes to 30 minutes e Use a0 5 1 to 2 1 molar ratio of PCR product TOPO vector continued on next page 21 Troubleshooting continued TOPO Cloning Reaction and Transformation continued Problem Reason Solution Large percentage of inserts cloned in the incorrect orientation Incorrect PCR primer design Make sure that the forward PCR primer contains the sequence CACC at the 5 end Reverse PCR primer is complementary to the GTGG overhang at the 5 end Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Large number of incorrect inserts cloned PCR reaction contains artifacts i e does not run as a single discrete band on an agarose gel e Optimize your PCR using the proofreading polymerase of choice e GeLlpurify your PCR product to remove primer dimers and smaller PCR products Incorrect PCR primer design e Make sure t
40. n to transform a recA end A E coli strain like TOP10 DH5o or equivalent Select transformants on LB agar plates containing 50 100 ug ml ampicillin Prepare a glycerol stock of a transformant containing plasmid for long term storage The pEF5 FRT V5 D TOPO vector contains the hygromycin resistance gene Gritz and Davies 1983 for selection of transfectants with the antibiotic hygromycin B Palmer et al 1987 When added to cultured mammalian cells hygromycin B acts as an aminocyclitol to inhibit protein synthesis Hygromycin B is available separately from Invitrogen Catalog no R220 05 For instructions to TM handle and store hygromycin B refer to the Flp In System manual TM Before generating a stable Flp In expression cell line we recommend that you generate a kill curve to determine the minimum concentration of hygromycin TM required to kill your untransfected Flp In host cell line Generally concentrations between 10 and 400 ug ml hygromycin are required for selection of most mammalian cell lines General guidelines for performing a kill curve are TM provided in the Flp In System manual The hygromycin resistance gene in pEF5 FRT V5 D TOPO lacks a promoter and an ATG initiation codon therefore transfection of the pEF5 FRT V5 D TOPO plasmid alone into mammalian host cells will not confer hygromycin resistance to the cells The SV40 promoter and ATG initiation codon required for expres
41. nsideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outl
42. or human therapeutic or diagnostic use The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners 38 invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
43. orm E coli using electroporation DO NOT include the salt solution 1 Setup control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Sterile Water 4 ul 3 ul Salt Solution 1 ul 1 ul Control PCR Product 1 ul pEF5 FRT V5 D TOPO vector 1 ul 1g Final volume 6 ul 6 ul 2 Incubate at room temperature for 5 minutes and place on ice 3 Transform 2 ul of each reaction into separate vials of One Shot TOP 10 cells page 13 4 Spread 100 200 ul of each transformation mix onto LB plates containing 50 100 ug ml ampicillin Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies 5 Incubate overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced To analyze the transformations isolate plasmid DNA and digest with Not I The table below lists the digestion patterns that you should see for inserts that are cloned in the correct orientation or reverse orientation Orientation Expected Fragments bp Correct orientation 682 5868 Reverse orientation 156 6394 Empty vector 5831 Greater than 90 of the colonies should contain the 750 bp insert in the correct orientation Relatively few colonies should be produced in the vector only reaction pUC19 plasmid is included to check the transformation efficiency of the One Shot TOP10 competent cells Transform one vial of One Shot TOP10 cells with 10
44. ormants page 15 continued on next page 13 Transforming One Shot TOP10 Competent Cells continued A XN NA wei 5 v m o Si To prevent arcing of your samples during electroporation the volume of cells should be between 50 and 80 ul 0 1 cm cuvettes or 100 to 200 ul 0 2 cm cuvettes If you experience arcing during transformation try one of the following suggestions e Reduce the voltage normally used to charge your electroporator by 10 e Reduce the pulse length by reducing the load resistance to 100 ohms e Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation Analyzing Transformants Analyzing Positive 1 Pick5 colonies and culture them overnight in LB or SOB medium containing Clones Sequencing Important Analyzing Transformants by PCR 50 100 ug ml ampicillin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using the PureLink HO Mini Plasmid Purification Kit Catalog no K2100 01 3 Analyze the plasmids by restriction analysis to confirm the presence and correct orientation of the insert Use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert You may sequence your construct to confirm that your gene is cloned in the correct orientation and in frame with the C terminal V5 epitope tag if desired T
45. our results Specific guidelines and protocols as well as detailed information about pOG44 and generation of the Flp In host cell line can be found in the Flp TM In System manual TM TM Several Flp In host cell lines which stably express the lacZ Zeocin fusion gene and contain a single integrated FRT site are available from Invitrogen see page viii for ordering information For more information on these cell lines refer to our Web site www invitrogen com or contact Technical Service page 32 Plasmid DNA for transfection into eukaryotic cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HO Mini Plasmid Purification Kit Catalog no K2100 01 or CsCl gradient centrifugation For established cell lines e g HeLa CHO consult original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow exactly the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wieler et al 1977 lipid mediated Felgner et al 1989 Fel
46. pg of pUC19 using the protocol on page 13 Plate 10 ul of the transformation mixture plus 20 ul of S O C on LB plates containing 100 ug ml ampicillin Transformation efficiency should be 1 x 10 cfu ug DNA Gel Purifying PCR Products Introduction Note Using the S N A P Gel Purification Kit Quick S N A P Method Smearing multiple banding primer dimer artifacts or large PCR products 73 kb may necessitate gel purification If you wish to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Three simple protocols are provided below Note that cloning efficiency may decrease with purification of the PCR product e g PCR product too dilute You may wish to optimize your PCR to produce a single band see Producing Blunt End PCR Products page 9 The S N A P Gel Purification Kit available from Invitrogen Catalog no K1999 25 allows you to rapidly purify PCR products from regular agarose gels 1 Electrophorese amplification reaction on a 1 to 5 regular TAE agarose gel Note Do not use TBE to prepare agarose gels Borate interferes with the sodium iodide step below 2 Cut out the gel slice containing the PCR product and melt it at 65 C in 2 volumes of the 6 M sodium iodide
47. rect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 33 Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology Gateway Clone Distribution Policy 34 Use of the pEF5 FRT V5 Directional TOPO Expression Kit is covered under the license detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for co
48. sion of the hygromycin resistance gene are integrated into the genome in the Flp In host cell line and can only be brought into the correct proximity and frame with the hygromycin resistance gene through Flp recombinase mediated integration of pEF5 FRT V5 D TOPO at the FRT site Assaying for Expression Introduction Note Detection of Recombinant Fusion Proteins Preparation of Cell Lysates You may use a functional assay to detect the protein encoded by your PCR product or a Western blot analysis if you have an antibody to the protein If you have elected to express your PCR product as a fusion to the V5 epitope you may use antibodies to the V5 epitope to detect the fusion protein see below Your gene of interest will be expressed from pEF5 FRT V5 D TOPO under the control of the human EF 1a promoter Once you have generated the Flp In expression cell line your recombinant fusion protein will be constitutively expressed To detect expression of your recombinant fusion protein by Western blot analysis you may use the Anti V5 antibodies available from Invitrogen see page viii for ordering information or an antibody to your protein of interest In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing a V5 epitope tag The ready to use WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescen
49. st be reduced to 50 mM NaCl 2 5 mM MgCl to prevent arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use the Dilute Salt Solution to set up the TOPO Cloning reaction as directed below Use the procedure below to perform the TOPO Cloning reaction Set up the TOPO Cloning reaction depending on whether you plan to transform chemically competent E coli or electrocompetent E coli Reminder For optimal results be sure to use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector in your TOPO Cloning reaction Note The blue color of the TOPO vector solution is normal and is used to visualize the solution Reagents Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution Lu E Dilute Salt Solution 1 4 lul Sterile Water add to a final volume of 5 ul add to a final volume of 5 ul TOPO vector lul 1 ul Final volume 6 ul 6 ul Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield plenty of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may
50. such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 References Andrews B J Proteau G A Beatty L G
51. t TOPO vector is lt 0 1 1 or gt 5 1 see figure below These results are generally obtained if too little PCR product is used i e PCR product is too dilute or if too much PCR product is used in the TOPO Cloning reaction If you have quantitated the yield of your PCR product you may need to adjust the concentration of your PCR product before proceeding to TOPO Cloning Tip For the pEF5 FRT V5 D TOPO vector using 1 5 ng of a 1 kb PCR product or 5 10 ng of a 2 kb PCR product in a TOPO Cloning reaction generally results in a suitable number of colonies 100 50 Relative Activity colonies reaction 0 0 1 1 10 PCR Product Vector Molar Ratio continued on next page Performing the TOPO Cloning Reaction continued Using Salt Solution in the TOPO Cloning Reaction Performing the TOPO Cloning Reaction You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see page vii for ordering information e If you are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed below e If you are transforming electrocompetent E coli the amount of salt in the TOPO Cloning reaction mu
52. t Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our Web site www invitrogen com or contact Technical Service page 32 To detect your fusion protein by Western blot you will need to prepare a cell lysate from transfected cells A sample protocol is provided below Other protocols are suitable To lyse cells 1 Wash cell monolayers 5 x 10 to 1 x 10 cells once with phosphate buffered saline PBS see page vii for ordering information Scrape cells into 1 ml PBS and pellet the cells at 1500 x g for 5 minutes Resuspend in 50 ul Cell Lysis Buffer see the Appendix page 31 for a recipe Other cell lysis buffers are suitable Vortex 4 Incubate cell suspension at 37 C for 10 minutes to lyse the cells Note You may prefer to lyse the cells at room temperature or on ice if degradation of your protein is a potential problem 5 Centrifuge the cell lysate at 10 000 x g for 10 minutes at 4 C to pellet nuclei and transfer the supernatant to a fresh tube Assay the lysate for protein concentration Note Do not use protein assays utilizing Coomassie Blue or other dyes NP 40 interferes with the binding of the dye with the protein 6 Add SDS PAGE sample buffer see the Appendix page 31 for a recipe toa final concentration of 1X and boil the sample for 5 minutes 7 Load 20 ug of lysate onto an SDS PAGE gel and electrophorese see
53. t of interest is integrated in a Flp recombinase dependent manner into the genome Features of the vector include e The human EF 1a promoter for high level expression of your PCR product in a wide range of mammalian cells Goldman et al 1996 Mizushima and Nagata 1990 see page 27 for a diagram e Directional TOPO Cloning site for rapid and efficient directional cloning of blunt end PCR products see page 9 for more information e C terminal peptide containing the V5 epitope tag for detection of your recombinant protein e FLP Recombination Target FRT site for Flp recombinase mediated integration of the vector into the Flp In host cell line see next page for more information e Hygromycin resistance gene for selection of stable cell lines Gritz and Davies 1983 see important note on page 3 The control plasmid pEF5 FRT V5 GW CAT is included for use as a positive control for transfection and expression in the Flp In host cell line of choice TM For more information about the Flp In System the pOG44 plasmid and generation of the Flp In host cell line refer to the Flp In System manual The Flp In System manual is supplied with the Flp In Complete System Catalog no K6010 01 or the Flp In Core System Catalog no K6010 02 and is also available for downloading from our Web site www invitrogen com or by contacting Technical Service page 32 continued on next page Overview continued
54. tion Materials Supplied by the User Producing Blunt End PCR Products Checking the PCR Product Once you have decided on a PCR strategy and have synthesized the primers produce your blunt end PCR product using any thermostable proofreading polymerase Follow the guidelines below to produce your blunt end PCR product You will need the following reagents and equipment for PCR Note dNTPs adjusted to pH 8 are provided in the kit e Thermocycler and thermostable proofreading polymerase e 10X PCR buffer appropriate for your polymerase DNA template and primers for PCR product Set up a 25 ul or 50 ul PCR reaction using the guidelines below Follow the instructions and recommendations provided by the manufacturer of your thermostable proofreading polymerase to produce blunt end PCR products e Use the cycling parameters suitable for your primers and template Make sure to optimize PCR conditions to produce a single discrete PCR product e Usea 7 to 30 minute final extension to ensure that all PCR products are completely extended e After cycling place the tube on ice or store at 20 C for up to 2 weeks Proceed to Checking the PCR Product below After you have produced your blunt end PCR product use agarose gel electrophoresis to verify the quality and quantity of your PCR product Check for the following outcomes below e Be sure you have a single discrete band of the correct size If you do not have
55. ually occurs at the boundaries of the 8 bp spacer region see figure below Andrews et al 1985 Senecoff et al 1985 Minimal FRT site m mm CS Af amp GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAAC TTC Xba CS CS cleavage site The pEF5 FRT V5 D TOPO vector contains a single FRT site immediately upstream of the hygromycin resistance gene for Flp recombinase mediated integration and selection of the pEF5 FRT V5 D TOPO construct following cotransfection of the vector with pOG44 into a Flp In mammalian host cell line The FRT site serves as both the recognition and cleavage site for the Flp recombinase and allows recombination to occur immediately adjacent to the hygromycin resistance gene The Flp recombinase is expressed from the pOG44 plasmid For more information about pOG44 refer to the pOG44 manual or the TM Flp In System manual continued on next page Overview continued Important The hygromycin resistance gene in pEF5 FRT V5 D TOPO lacks a promoter and an ATG initiation codon therefore transfection of the pEF5 FRT V5 D TOPO plasmid alone into mammalian host cells will not confer hygromycin resistance to the cells The SV40 promoter and ATG initiation codon required for expression of the hygromycin resistance gene are integrated into the genome in the Flp In host cell line and are only brought into the correct proximity and frame wit
56. ube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 11 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 ul directly into One Shot TOP10 cells using the method on page 13 Note that the cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band Human EE jo Promoter Description The diagram below shows the features of the human EF 1a promoter Mizushima and Nagata 1990 used in the pEF5 FRT V5 D TOPO vector Features are marked as described in Uetsuki et al 1989 339 399 459 519 579 639 699 759 819 879 939 999 1059 1119 1179 1239 1299 1359 1419 1479 m 5 end of human EF 1o promoter GGAGTGCCTC GTGAGGCTCC GGTGCCCGTC AGTGGGCAGA GCGCACATCG CCGAGAAGTT GGGGGGAGGG TAAACTGGGA AAGTGATGTC TATA box CGTATATAAG TGCAGTAGTC m 5 end of Intron 1 CACAGGTAAG TGCCGTGTGT GCGTGCCTTG TTGGAAGTGG GAGTTGAGGC CCTGTCTCGC CGCTTTTTTT CGGTTTTTGG Sp 1 GGCGGGGCCT CTGCTCTGGT CCCGGTCGGC GCTCAAAATG AAAGGGCCTT CCAGGCACCT GGTTTTATGC GGCACTTGAT TCAAGCCTCA AATTACTTCC GTGGGAGAGT CTGGCCTGGG TGCTTTCGAT CTGGCAAGAT GTCGGCAATT GTGTACTGGC GCCGTGAACG GGTTCCCGCG ACCTGGCTGC TCGAGGCCTT CGCTGGGGCC
57. y Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indi
Download Pdf Manuals
Related Search