MicroRNA Discovery Kit User Manual, v.3
Contents
1. pairs for 5S rRNA and U6 small RNA Page 14 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 lll Troubleshooting A No Product from cDNA Amplification If after step D 3 you do not see a smear on the 3 0 3 5 gel for your RNA samples try the following suggestions C D If you do not see a smear for any samples including the Control RNA One or more of the reagents were omitted during the procedure or the volume of the reactions is incorrect Calibrate your pipette and try amplifying the Control RNA again If you see a smear for the Control RNA but not for your RNA samples You may have less starting RNA than measured Place the amplification reactions back in the thermocycler for an additional three cycles If the expected smear described in Section D 3 is generated you should continue with qRT PCR If after additional cycles there is still no smear or a very weak smear compared with the Control RNA reaction your RNA may either be 1 too degraded or 2 contain an inhibitor Try the amplification again after repurifying the RNA If you still do not get sufficient yield try a different RNA purification kit No Product with Gene Specific Primers If you have confirmed that the amplification in step D 3 was successful but you do not get a product or get a non specific product with your gene specific primers there may be a problem with your PCR reagents Try to amplify with primers2. Classification Biogenesis and Function Mol Cells 19 1 15 Valencia Sanchez MA Liu J Hannon GJ Parker R 2006 Control of translation and mRNA degradation by miRNAs and siRNAs Genes Dev 20 515 525 Lewis B P Burge C B Bartel D P 2005 Conserved seed pairing often flanked by adenosines indicates that thousands of human genes are microRNA targets Cell 120 15 20 Xie X Lu J Kulbokas E J Goulub T R Mooth V Lindblad Toh K Lander E S and Kellis M Systematic discovery of regulatotory motifs in human promoters and 3 UTRs by comparison of several mammals Nature 434 338 45 Lagos Quintana M Rauhut R Lendeckel W Tuschl T 2001 Identification of Novel Coding for Small Expresses RNAs Science 294 853 858 Basyuk E Suavet F Doglio A Bordonne R Bertrand E 2003 Human let 7 stem loop precursors harbor features of RNase III cleavage products Nucleic Acids Res 31 6593 6597 Chomczynski P and Mackey K One hour downward capillary blotting of RNA at neutral pH 1994 Anal Biochem 221 303 305 Shi R Chiang V L 2005 Facile means for quantifying microRNA expression by real time PCR BioTechniques 39 519 525 Ding Y Chan C Y and Lawrence C E 2005 RNA secondary structure prediction by centroids in a Boltzmann weighted ensemble RNA 11 1157 1166 Griffiths Jones S Grocock R J Van Dongen S Bateman A Enright A J 2006 miRBase microRNA sequences
3. Technical Support sss 24 VI Licensing and Warranty Statement 25 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual I Introduction and Background A Overview This manual provides details and information necessary to use the MicroRNA Discovery Kit to uniformly and reproducibly amplify limited amounts of non degraded as well as degraded RNA to provide sufficient template for the cloning of selected small RNA gene transcripts processed by RNase Ill To ensure optimal results please read the entire manual before using the reagents and material supplied with this kit B Importance of MicroRNAs and Other Small Non Coding RNAs The field of non coding RNAs has gained increasing attention in recent years particularly due to the discovery of micro RNAs miRNA Micro RNAs are short typically 19 24 nucleotides single stranded RNAs that regulate the expression of target genes by interacting with complementary sites in the 3 UTR of the target mRNAs and inhibiting translation miRNAs are a conserved group of non coding RNAs with very important regulatory roles Mature miRNAs are excised from stem loop precursors which are themselves transcribed as part of longer primary transcripts These primary miRNAs appear to be first processed by the RNase Drosha in the nucleus after which the precursor miRNAs are exported to the cytoplasm where the RNase Dicer further processes them These enzy
4. cDNA library Sequence clones t BLAST Search GenBank Ribosomal Non matches Ribosomal Matches BLAST Search Sanger miRNA database E known unknown t Characterize the putative new miRNA like molecules Northern Blot F4 3 RACE RT PCR Fig 1 Workflow schematic for a typical MicroRNA Discovery experiment 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual SBI s small RNA amplification system includes 3 steps which can be completed in less than 4 hours 1 A degenerate adaptor mixture is ligated to both the 5 end and 3 ends of total RNA Our use of chimeric DNA RNA adaptors unique cocktail of enzymes and optimized reaction conditions ensure efficient ligation Figure 2 describes this process in detail and Table 1 contains the sequences for the adaptor 2 Reverse transcription of the RNA using a primer complementary to the attached adaptor 3 PCR amplification of the cDNA The amplified cDNA is ready for direct TOPO TA cloning Invitrogen Cat K4500 01 with no additional purification necessary If desired the amplified cDNA can also be cloned by standard cloning protocols Upper strand adaptor 1 5 P ACTCTGCGTTGATACCACTGCTT 3 Lower strand adaptors 2 3 rNrTrGrAGACGCAACTATGGTGACGAA NHz5 5 3 3 rNrNrTrGrAGACGCAACTATGGTGACGAA NH25 5 4 3 rNrNrNrTrGrAGACGCAACTATGGTGACGAA NH25 5 5 3 rNrN
5. different cell lines with different treatments inducing repressing conditions For this purpose it is very convenient to use 3 RACE RT PCR For example see Figures 7 and 8 In many cases miRNAs display different patterns in different tissues which can be an additional indication of discovery of new non coding small RNA molecules G Size Selection of Amplified cDNA optional 1 Amplified cDNA from Step D 2 can be size selected for low molecular weight products For purification use 5 ul of cDNA solution Apply the sample on a 3 3 5 agarose gel with 1X TAE Include a DNA size ladder with markers in the range of 50 2 000 bp e g Bio Rad AmpliSize DNA Ladder Cut the gel between 50 to 120 bp even if you do not see any smear in this region Purify cDNA from the agarose using QIAGEN s QlAquick Gel Extraction Kit Cat 28704 following the manufacturer s protocol Use all of the extracted material for additional PCR amplification Add the following 53 ul RNase free Water 10 ul 10X PCR Buffer 2 ul dNTP Mix 2 ul RT and PCR Primer 3 ul PCR Polymerase 50X 100 y Total volume including the 30 ul from gel purified material Place the reactions in a thermal cycler and cycle using the following program 95 C for 2 min 95 C for 20 sec 68 C for 25 sec PSOQeS 15 C hold After amplification run 2 5 ul of each reaction on a 3 0 3 5 agarose gel in 1X TBE or TAE Buffer Include a DNA size ladder with
6. herein SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2006 System Biosciences SBI Page 24 ver 3 061101 www systembio com
7. targets and gene nomenclature Nucleic Acids Research 34 D140 D144 Shingara J Keiger K Shelton J Laosinchai Wolf W Powers P Conrad R Brown D Labourier E 2005 An optimized isolation and lebeling platgorm for accurate microRNA expression profiling RNA 1 1 1461 1470 He L Thomson J M Hemann M T Hernando Monge E Mu D Goodson S Powers S Cordon Cardo C Lowe S W Hannon G J Hammond S M 2005 A microRNA polycistron as a potential human oncogene Nature 435 828 833 Lai E C Wiel C Rubin G M 2004 Complementary miRNA pairs suggest a regulatory role for miRNA miRNA duplexes RNA 10 171 175 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual 17 Ambros V Bartel B Bartel D P Burge C B Carrington J C Chen X Dreyfuss G Eddy S R Griffiths Jones S Marshall M Matzke M Ruvkun G Tuschl T 2003 A uniform system for microRNA annotation RNA 9 277 279 18 Obernosterer G Leuschner P J F Alenius M Martinez J 2006 Post transcriptional regulation of microRNA expression RNA 12 1 7 19 Dostie J Mourelatos Z Yang M Sharma A Dreyfuss G 2003 Numerous microRNPs in neuronal cells containing novel microRNAs RNA 9 180 186 Page 18 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 V Appendix A Data Generated with the MicroRNA Discovery Kit The data bel
8. to 96 well PCR plate Transfer 0 6 ul of cell culture directly from the 96 well flat bottom plate to the 96 well PCR plate Seal the top of the PCR plate and place into the PCR thermal cycler 4 Cycle using the following program 95 C for 2 min 95 C for 20 sec 2 68 C for 25 sec v Eyes 15 C hold 5 After amplification analyze 2 5 ul of each reaction on a 3 0 3 5 agarose gel in 1X TBE or TAE Buffer Include a DNA size ladder with markers in the range of 50 2 000 bp e g Bio Rad AmpliSize DNA Ladder Cat 170 8200 6 Select clones with inserts of desired Note RT PCR primer will add approximately 50 base pairs bp to the size of the insert i e clones with insert of 70 85 bp will be more likely contain mature form of miRNA or miRNA like molecules Larger inserts may contain precursors of miRNA or miRNA like molecules 7 Grow cells with desired size insert for plasmid purification followed by sequencing For sequencing we recommend purifying plasmid from 3 ml of overnight culture using QIAGEN s QlAprep Spin Miniprep Kit Cat 27104 8 After sequencing identify flanking vector sequences containing BamHI sites GGATCC Trim adaptor sequences from both sides of the insert 24 nucleotides for the adaptor The remaining internal sequence is the actual insert sequence which requires further analysis 9 Use this sequence for a BLAST search against GenBank http www ncbi nim nih gov Choose the dat
9. using 0 5 pg of the total RNA as starting material For tailing of total RNA use poly A polymerase we recommend Epicentre s A Plus Poly A Polymerase Tailing Kit Cat PAP5104H and follow the manufacturer s protocol To analyze the presence of putative miRNA sequences in total RNA prepare a PCR master mix for number of reactions equal to the number of different sequences to be analyzed For PCR we recommend KlenTaq LA DNA Polymerase from Sigma Cat D5062 1 Rxn 10 Rxn RNase free Water 153 ul 153 ul 10X PCR Buffer 20 yu 20 ul 50X dNTP Mix 10 uM each 0 4 y 4 y Forward RT PCR Primer 0 4 ul 4 yu Reverse RT PCR Primer 0 4 ul 4 yu cDNA from step 14 10 ul 10 ul PCR Polymerase 05 ul 5 y Total volume 20 0 uw 200 uw Place the reactions in a thermal cycler and cycle using the following program 95 C for 2 min 95 C for 20 sec 2 60 C for 25 sec agers e 15 C hold After amplification analyze 2 5 ul of each reaction on a 3 0 3 5 agarose gel in 1X TBE or TAE Buffer Include a DNA size ladder with Page 12 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 18 markers in the range of 50 2 000 bp e g Bio Rad AmpliSize DNA Ladder If you confirm by Northern blot or by 3 RACE RT PCR analysis that the sequence is very likely to be a new miRNA or miRNA like molecule you may want to examine the distribution and maturation stages of this RNA sequence in different tissues or
10. 9 SBI System Biosciences MicroRNA Discovery Kit Cat RA410A 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 3 061101 contained in this user manual MicroRNA Discovery Kit Cat RA410A 1 Contents l Introduction and Background A Overview re ean a Mert i nerf inneren pere ARP 2 B Importance of MicroRNAs and Other Small RNAs 2 C Overview of Protocol sss 3 D ListofComponents ss 6 E Additional Required Materials ss ic iss 6 F Procedural Guidelines ss 6 ll Protocol As Starting RNAs oe oo oe oot eee dei oh aes eae ectad 7 B Adaptor Ligation sss 7 C First Strand cDNA Synthesis 8 D PCR Amplification sss 8 E TOPOTACloning eee 9 F Sample Screening Guidelines for Identification of Putative miRNA or miRNA like Molecules in Amplified cDNA 10 G Size Selection of Amplified cDNA optional 13 H Gene Specific Amplification Using Amplified cDNA 14 lll Troubleshooting A No Product from cDNA Amplification sass 16 B No Product with Gene Specific Primers 16 C No Colonies after TOPO TAcloning 16 D No Product with PCR primer during colony screening 16 IV References 18 V Appendix A Data Generated with the MicroRNA Discovery Kit 20 B Related Products eee eese 24 C
11. A clones data not shown For more information and additional data please visit our website at www systembio com Page 22 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 B Related Products e Pre Made MicroRNA Enriched cDNAs Cat RA500A 1 RA509A 1 Tissue specific amplified cDNA generated by SBI using the MicroRNA Discovery Kit can be used for cloning microRNA e Global MicroRNA Amplification Kit Cat RA400A 1 Simple amplification kit allows cDNA amplification for qRT PCR and microarray studies from as little as 50 ng of starting total RNA e Full Spectrum Complete Transcriptome RNA Amplification Kit Cat RA101A 1 The Full Spectrum RNA Amplification Kit provides an inexpensive method to amplify reverse transcribed RNA in a sequence independent unbiased and uniform manner with better representation of 5 end of mRNA sequences This approach maintains the relative levels of each transcript in the starting MRNA samples even when using starting amounts of RNA as low as 5ng or when using heavily degraded RNA e Full Spectrum MultiStart Primers for T7 IVT Cat RA300A 2 Extract more data from your RNA than currently available primers in nearly all commercially available T7 IVT kits using Full Spectrum technology Just replace the existing T7 primer with the Full Spectrum primers Compatible with Affymetrix GeneChip hybridization C Technical Support For more i
12. abase from the appropriate organism for your search to eliminate unrelated hits For clones from human sources use the human database for mouse sources of RNA use the mouse database and so on The first GenBank BLAST search serves to rapidly eliminate background Page 10 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 10 11 12 13 14 sequences derived from rRNA and tRNA and their degradation products When analyzing results from the first BLAST be aware that some mRNA may have extensive homology up to 180 200 nt to rRNA and omitting clones containing these inserts may limit the number of potential microRNA sequences for discovery In parallel you can BLAST search this sequence against the mRNA database RefSeq of GenBank which can help confirm results from the initial GenBank BLAST search The RefSeq BLAST search cannot substitute for the GenBank BLAST search because RefSeq does not contain known miRNA or other known small non coding RNA entries When analyzing sequences give the most attention to the hits with short sequence homology usually 18 35 nt to mRNA or S UTR of mRNA in plus minus orientation to mRNA sequences These are potentially new microRNA like sequences An important criterion for miRNA validation is evidence of miRNA biogenesis This typically requires the identification of pre miRNA stem loop precursors For secondary structure analysis use the whole insert sequence as
13. ater C First Strand cDNA Synthesis 1 For each RNA sample add the components to a 0 2 or 0 5 ml PCR tube in the order specified 6 0 ul RNase free Water 1 0 ul RT and PCR Primer 5 0 ul Ligation from Step B 12 0 ul Total volume 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Incubate the reactions at 95 C for 3 minutes and then allow tubes to cool down to room temperature Keep reactions on ice until you are ready to start the RT step While the reactions are incubating set up a Master Mix sufficient for the number of first strand synthesis reactions you are processing This is done by adding to a microfuge tube the volume of each of the following components multiplied by the number of reactions you are processing 4 0 ul 5X Reverse Transcriptase Buffer 2 0 ul dNTP Mix 1 0 ul Dithiothreitol DTT 1 0 ul Reverse Transcriptase 8 0 ul Total volume Note If you have 2 reactions you should have 16 ul of Master Mix if you have 3 reactions 24 0 ul etc Add 8 0 ul of the Master Mix set up in step 3 to the 12 ul ligation reaction from step 2 Mix well by pipetting up and down Incubate the first strand reactions for 1 hour at 42 C and then immediately place them at 95 C for 5 minutes Keep reactions on ice The first strand cDNA can be stored at 20 C until you are ready to proceed with the PCR Amplification D PCR Amplification 1 Use 2 ul of react
14. derived in step 9 as well as the complementary strand For this purpose we utilized the Sfold tool which is available online at http sfold wadsworth org 12 Folding analysis was performed on both the direct sequence read from the clone and the complementary sequence from which we select the best stem loop structure with lowest minimum free energy Complete bioinformatics analysis of the data gathered in step 10 together with predicted secondary structure from step 11 can reduce the number of potential new microRNA or microRNA like sequences that require further experimental analysis Based on the definition of biogenesis of miRNA sequences the mature miRNA should be in a stem of the stem loop structure and lie on one side of the stem Northern blotting is still the most important criterion to categorize a new sequence as a miRNA Note We recommend that the oligonucleotide probes used for Northern blot hybridization are designed to be complementary to the mRNA sequence or 3 UTR sequence of mRNA this is with the assumption that this particular mRNA is the target for new miRNA In the case of a lack of signal in the expected region you can try to use the sequence homologous to the mRNA sequence in the case that the mRNA is the precursor in miRNA maturation and the target is a different mRNA sequence which is not found in the BLAST search Note Lack of signal in the expected range may be due to low abundance level of the particula
15. ely thaw all reagents and vortex to mix thoroughly Briefly centrifuge each mixture once to ensure there is no solution left on the sides lid of the tube When setting up multiple reactions we recommend that you prepare a master mix ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 ll Protocol A Starting RNA We recommend starting with approximately 500 ng of total RNA Our studies have consistently shown greater than 95 representation of RNA species in the amplified population when compared with unamplified RNA with starting concentrations greater than or equal to 500 ng nl IMPORTANT NOTE The RNA isolated by the investigator must contain small RNA We suggest using RNA isolated using an acid phenol method of extraction such as TRIzol Invitrogen Cat 15596 026 We recommend Ambion s mirVana miRNA Isolation Kit Cat AM1560 for the isolation of small RNAs B Adaptor Ligation 1 For each RNA sample add the components to a 0 2 or 0 5 ml PCR tube in the order specified 5 0 ul RNase free Water 2 0 ul Ligase buffer warmed to 37 C before use 1 0 ul Ligation Adaptor Mix 1 0 ul Total RNA 1 0 ul Ligase Cocktail 10 0 ul Total volume Note Because reagent volumes are small accurate pipetting is critical 2 Incubate the reactions at 16 C for 1 hour and then keep on ice until the RT step Step C The ligation reactions can be also be stored at 70 C and used l
16. from different tissues 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual D List of Components Each MicroRNA Discovery Kit provides enough material to amplify miRNA like molecules from 10 different RNA samples 10 reactions 10 70 8 1 2 10 60 10 60 20 50 150 25 The rece rece ul Ligase Cocktail T4 DNA amp RNA ligase ul Ligation Buffer ul Control RNA 500 ng ul ml RNase free Water ul Ligation Adaptor Mix ul RT and PCR Primer ul Reverse Transcriptase ul 5X Reverse Transcriptase Buffer ul Dithiothreitol DTT ul dNTP Mix 10 uM each ul 10X PCR Buffer ul PCR Polymerase 50X kits are shipped in blue ice and should be stored at 20 C upon ipt Properly stored kits are stable for 1 year from the date ived E Additional Required Materials TOPO TA Cloning Kit Invitrogen Cat K4500 01 Microbiological plates with LB agar with 50 ug ml ampicillin Thermocycler with heated lid 3 0 3 5 Agarose Gel in Tris Borate EDTA TBE or Tris Acetate EDTA TAE Buffer DNA Size Ladder with markers from 50 to 2 000 bp Bio Rad AmpliSize DNA Ladder Cat 170 8200 Optional for samples from sources with high RNase activity Ribonuclease Inhibitor Ambion SUPERase IN Cat AM2694 Optional for size selection of Amplified cDNA QlAquick Gel Extraction Kit QIAGEN Cat 28704 F Procedural Guidelines Page 6 Before dispensing complet
17. ied and cloned the RNase lll processed RNA fraction from total RNA without any size selection The size of the cloned cDNA inserts ranged in size between about 100 and 300 bp In the first small survey 60 clones were selected for further examination by sequencing BLAST searches against GenBank found that approximately 60 clones were derived from rRNAs or tRNAs and were omitted from further study The remaining clones were found to have homologies of between 18 29 nts to sequences in GenBank While not 100 predictive it is expected that a true miRNA will have a detectable level of similarity with its corresponding target transcript miRNAs regulate 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual mRNA translation and or mRNA stability through hybridization with their target mRNA transcripts Ultimately the set of non rRNA tRNA clones were found to contain four previously known microRNAs and seven new miRNA like sequences which are discussed in more detail below Four cDNA clones 4 7 10 and 13 were identified to contain miRNA like sequences Clones 10 and 13 each contained more than one miRNA like sequence for a total of seven individual miRNA like sequences 4 7 10a 10b 13a 13b 13c Multiple miRNAs in the same precursor referred to as polycistronic miRNAs have been described 15 With current miRNA cloning methods these longer precursor molecules are lost during the multiple s
18. ion mix from RT reaction for PCR amplification To each first strand synthesis reaction from Part C add the following 82 ul RNase free Water 10 ul 10X PCR Buffer 2 ul dNTP Mix 2 ul RT and PCR Primer 2 ul PCR Polymerase 50X 100 ul Total volume including the 2 ul from Part C Place the reactions in a thermal cycler and cycle using the following program 95 C for 2 min 95 C for 20 sec 30 cycles Stop at 20 cycles if you 6870 for 25 sec decide to perform size 68 C for 1 min selection see Part E 15 C hold Page 8 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 Note You will need to vary the number of cycles depending on the amount of starting RNA Refer to the table below to determine the approximate number of times you should cycle Starting RNA Cycles 1 ug 27 500 ng 30 The of cycles depends on the amount of total RNA used in the ligation reaction 3 After amplification run 2 5 ul of each reaction on a 3 0 3 5 agarose gel in 1X TBE or TAE Buffer Include a DNA size ladder with markers in the range of 50 2 000 bp e g Bio Rad AmpliSize DNA Ladder You should see results similar to those shown in Figure 5 The typical yield from 500 ng RNA and above is 2 3 ug cDNA from 50 ng the yield is 1 1 5 ug Depending on your particular RNA sample more cycles may be necessary If so perform an additional 2 cycles and check your amplified cDNA again You do no
19. ize selection steps 75 and 140 pre unknown pre precursor Table 3 Summary of miRNA like sequences identified Page 20 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 According to the recommended criteria for miRNA annotation 17 a sequence must fulfill several requirements to be annotated as a miRNA The first is verification of expression by Northern blots or cDNA cloning of a small RNA 22 nts Figure 6 shows results of Northern blot hybridization for clones 4 and 7 where they demonstrate transcripts of distinctly different sizes A B miRNA like miRNA like sequence 4 sequence 7 my my 150 S 150 lt precursor 100 9g P lt precursor 193 80 80 lt precursor 70 70 60 60 50 X 50 40 40 lt mature 30 x 30 5 lt mature 2 S 20 Fig 6 Northern blot analysis of miRNA like sequences Synthetic oligonucleotides representing the miRNA like complimentary sequences in GenBank were used as hybridization probes 10 nt size markers are indicated A Results of hybridization of the probe complementary to sequence from clone 4 B Results of hybridization of the probe complementary to sequence from cDNA clone 7 For the five remaining sequences 10a 10b 13a 13b and 13c we did not detect any signal on Northern blot which may be due to low abundance leve
20. l for these molecules in the total RNA 3 RACE RT PCR was also performed to identify the presence and size of all seven putative miRNA transcripts A poly A tail is added to the 3 end of the RNA with poly A polymerase An oligo dT containing 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual adaptor is annealed and used for first strand cDNA synthesis Following reverse transcription a primer complimentary to the adaptor was used as a reverse RT PCR primer The forward primer consisted of the miRNA like sequence itself see Figure 7 3 RACE RT PCR 5 3 poly A polymerase A tailed 5 AAAAAA 9 miRNA NVTTTTTT m 5 i RT i 95 C 10 min First strand M 1 cDNA 3 NVTTTTTT 5 5 _ gt 5 3 4 5 miRNA specific Reverse primer Forward primer PCR Fig 7 Schematic of 3 RACE RT PCR method r miRNA like Sequences _ p 10 r 138 324 M miR 16 4 7 a b a b C M bp 200 100 507 Fig 8 3 RACE RT PCR for seven newly identified miRNA like sequences and miR 16 Numbers on the top of the gel correspond to cDNA clone number Letters indicate specific sequence found in corresponding clone A second criterion for miRNA annotation is evidence of miRNA biogenesis This typically requires the identification of pre miRNA stem loop precursors Stem loops were observed in majority of cDN
21. markers in the range of 50 2 000 bp e g Bio Rad AmpliSize V DNA Ladder You should see results similar to those shown in Figure 4 The typical yield is 2 3 ug cDNA You can continue adding two cycle 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual increments until you see the sufficient product from your amplification reaction however you should not exceed 30 cycles RNA o N 29 8 oo oS 9 co M 38 38 RNA bp 300 200 150 100 50 Fig 4 Distribution of cDNA after amplification before and after size selection You can continue adding two cycle increments until you see the sufficient product from your amplification reaction However you should not exceed 30 cycles H Gene Specific Amplification Using Amplified cDNA The amplified cDNA is ready to use as a template without purification However you must denature the amplified cDNA by incubating it for 10 minutes at 95 C before starting gene specific PCR It is critical that you use a non hotstart PCR polymerase We typically use Ambion s SuperTaq Polymerase Cat AM2052 We recommend that the amplified cDNA be added as a 1 component of your gene specific PCR reactions Thus for a 25 ul gene specific PCR reaction you should add 0 25 ul of the amplified cDNA for a 50 ul PCR reaction add 0 5 ul of the amplified cDNA etc As small RNA controls we recommend using Ambion s RT PCR primer
22. mes are also involved in the generation of mature small inhibitory RNAs siRNA from exogenously transferred double stranded siRNA precursors The current method for identifying novel miRNA molecules involves many steps and can take several days to complete The method of Lagos Quintana et al requires three size selection steps of small RNA two ligation steps each requiring gel electrophoresis and RNA extraction steps a reverse transcription step followed by PCR amplification SBI s MicroRNA Discovery Kit drastically reduces both the labor and time required to investigate miRNA populations The kit utilizes an innovative set of degenerate adaptors to specifically recover RNase Ill processed molecules including mature miRNAs as well as larger stem loop precursor molecules that current methods miss Recently previously unknown germline specific classes of miRNA like molecules were identified in mouse testes and mouse oocytes illustrating the need for continued and in depth miRNA discovery efforts across a wide range of tissues These facts taken together demonstrate an ever increasing need for simple robust and sensitive methods that enable discovery and quantitation of microRNAs and their precursors Page 2 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 C Overview of Protocol Total RNA ligation of adaptors Amplified cDNA 1 day size selection optional a clone miRNA like
23. nformation about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual VI Licensing and Warranty Statement Limited Use License Use of the MicroRNA Discovery Kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined
24. ow demonstrate that the cloning and amplification techniques used in SBI s MicroRNA Discovery Kit enrich for the majority of known miRNAs Additionally data is presented that demonstrates the power of the technique to identify novel RNase III processed miRNA like transcripts A robust miRNA amplification procedure should both maintain the presence of individual miRNAs within the population and enrich specifically for the target miRNA molecules In our experiment we have demonstrated that the majority of known miRNAs 13 of 14 were amplified and maintained throughout the amplification procedure It should be expected that our amplification process will enrich for miRNA like sequences We examined this question by comparing the number of PCR cycles needed to amplify a miRNA and the number needed to amplify a segment of the 5S rRNA transcript Before amplification the difference in the number of cycles needed to amplify the 5S rRNA and miR 16 was 9 After amplification the number of cycles was 1 The difference was about 10 cycles which suggests an enrichment factor of about 1 000 Care was taken to avoid the plateau phase of the PCR amplification by limiting cycle numbers Results are shown in Table 2 Cycles of PCR Difference in cycles 5S rRNA miR 16 miR 16 5S rRNA Table 2 Estimation of miR 16 enrichment factor after cDNA amplification Using techniques described in detail in the MicroRNA Discovery Kit we amplif
25. r putative miRNA in total RNA and the low sensitivity of Northern blot hybridization RT PCR can be used to reduce the number of sequences subjected to Northern blotting RT PCR is a much faster and more sensitive 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual 15 16 17 method than Northern blot analysis Since the miRNA and miRNA like molecules are very small a modified form of RT PCR termed 3 RACE RT PCR can be performed Both Northern blotting and RT PCR analyses are based on the specific hybridization of a small synthetic oligonucleotide to the target RNA either as a probe or as a primer Northern blot analysis can estimate the size of the miRNA directly while RT PCR can also be used to estimate the size of the miRNA by gel electrophoresis In this case the size is estimated by subtraction of the length of the adaptor from the size of the RT PCR products Furthermore both methods can identify precursor forms of miRNA The method of Shi and Chiang 11 can be adapted for RT PCR analysis of putative miRNAs In this method a poly A tail is added to the 3 end of the RNA with poly A polymerase see Figure 7 An oligo dT containing adaptor is annealed and used for first strand cDNA synthesis Following reverse transcription a primer complimentary to the adaptor was used as a reverse RT PCR primer The forward primer consisted of the miRNA like sequence itself We recommend
26. rNrNrTrGrAGACGCAACTATGGTGACGAA CNH2 5 d RT and PCR primer 6 5 AAGCAGTGGTATCAACGCAGAGT 3 Table 1 Sequences of adaptors and primers used in this study Page 4 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 Adaptor mixture x N G C U A Stem loop pre miRNA y 3 3 ITT o rN AD we T 5 simplified NIN qu structures Intermediate double stranded rNrNrN CD miRNA 56 y rNrNrNrN NH2 L seco E on ToT N rN oH Only one end of zo sm 8 adaptor ligated RNA zd shown NrN N eS POTTS NN AHD d on NINN oT NNN oW Ligation Fig 2 Depiction of degenerate adaptor ligation step A pool of double stranded degenerate adaptors which have a variable 3 overhang is ligated to total RNA The expected size distribution and banding pattern of amplified cDNA is shown in Figure 3 below The size of the amplified cDNA can be refined through the use of a size selection step see Part Il step C and Figure 4 in this manual While optional we have found that this step can reduce the number of background clones resulting from ribosomal and transfer RNA transcripts as well as increase the number of mature miRNAs recovered o 3 E Kidney Placenta Prostate Spleen testes f 3 o0 brain Colon nu i Fig 3 Size distribution of amplified cDNA
27. specific for an abundant gene such as mi16 or mi24 which are ubiquitously expressed miRNA If the PCR still fails to generate a product after 35 cycles try using new PCR reagents and enzyme Try using Clontech s QTaq Polymerase Cat 639651 No Colonies after TOPO TA cloning Try to use fresh PCR reaction product to make sure the TOPO TA cloning kit is working Submit amplified cDNA for an additional 5 PCR cycles and repeat cloning No Product with PCR primer during colony screening If you do not amplify product or see non specific products smearing with PCR primers during colony screening there may be a problem with your PCR reagents Try to amplify with M13 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual forward and reverse primers If the PCR still fails to generate a product after 35 cycles try using new PCR reagents and enzyme e We typically use KlenTaq LA DNA Polymerase from Sigma Cat D5062 Page 16 ver 3 061101 www systembio com MicroRNA Discovery Kit Cat RA410A 1 IV References 1 10 11 12 13 14 Sonthelmer E J Carthew R W 2005 Silence from within Endogenous siRNAs and miRNAs Cell 122 9 12 Zamore P D Haley B 2005 Ribo gnome The big world of small RNAs Science 309 1519 1524 Bartel D 2004 MicroRNAs Genomics Biogenesis Mechanism and Function Cell 116 281 297 Kim Narry V 2005 Small RNAs
28. t need to add additional PCR Polymerase even if your reaction was cycled overnight as long as you held the reaction at 15 C after cycling You can continue adding two cycle increments until you see the sufficient product from your amplification reaction however you should not exceed 40 cycles The amplified cDNA may be stored at 4 C for a couple of weeks For long term storage we recommend storing the cDNA at 20 C E TOPO TA Cloning When using Invitrogenss TOPO TA Cloning Kit follow the manufacturer s protocol We recommend using 4 ul of amplified cDNA in a 6 pl TOPO cloning reaction F Sample Screening Guidelines for Identification of Putative miRNA or miRNA like Molecules in Amplified cDNA 1 After cloning the cDNAs into the TOPO cloning vector Invitrogen select white colonies and transfer them to a 96 well flat bottom microtiter plate with 100 ul LB media supplemented with 100 pg ml ampicillin Grow colonies in the shaker at 37 C for two hours 2 To analyze the size of the inserts prepare a PCR master mix for the number of reactions equal to number of the clones that need to be analyzed 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual 1 Rxn 10 Rxn RNase free Water 16 0 ul 160 ul 10X PCR Buffer 20 ul 20 ul 50X dNTP Mix 10 uM each 04 ul 4 ul RT and PCR Primer 05 ul 5 ul PCR Polymerase 05 ul 6 u Total volume 194 ul 194 ul 3 Aliquot 19 4 ul of PCR master mix
Download Pdf Manuals
Related Search