Home

SERVICE MANUAL - 3D Air Sales Ltd

1. Outdoor unit Stays OFF Unit number correction Keeps flashing Note 1 Outdoor unit Indoor unit address No address No 00 47 48 49 48 49 00 47 11 Error display 5 Indoor unit Red LED Green LED Only case of FDT112 114 type White is GND NO CNMI Red White DC280V CNW9 De DCISV YES 1 NO between CNWO9 3 and Note 1 CNWO9 3 is GND YES Does the fan motor turn smoothly by hand YES NO 2 Is the voltage at CNM2 3 DC 1V or higher YES NO Replacement indoor unit PCB Red LED Keeps flashing Green LED Secondary side of transformer red red 15V or more Note 2 CNW9 3 is GND Outdoor unit Stays OFF Keeps flashing Replacement indoor unit PCB YES NO Replacement transformer Replacement indoor unit PCB Detective fan motor Indoor unit fan motor abnormal Abnormal data check with remote controller After check reset fan runs on weak YES Was it reproduced NO Check the circumstances YES When the motor is turning does the voltage at CNM2 2 fluctuate between NO YES Replacement indoor unit PCB Display conditions If an indoor unit fan motor s speed is detected to be less than 200 rpm continuously for 30 seconds the fan motor stops for 2 seconds After 2 seconds it starts again but thi
2. ae MITSUB SERVICE MANUAL KXR4 3 pipe VRF Systems MIUA MITSUBISHI HEAVY INDUSTRIES VRF SERMCE MANUAL INDEX MAINTENANCE DATA ERROR CODES PCB INDOOR UNITS PCB OUTDOOR UNITS ERROR DISPLAY OUTDOOR UNIT OPERATIONAL DATA CHECK WRED CONTROLLER REMOTE CONTROL WIRED SETTING FUNCTIONS MAINTENANCE SCHEDULE MAINTENANCE CHECKLIST 1l 19 21 39 40 4 4 1 MAINTENANCE DATA 1 Before starting troubleshooting a Confirmation of the error code on the remote controller by pressing the inspection switch and the inspection display and normal disp os on PCBs Printed circuit board of indoor outidoor units The microcomputer detects errors on electrical components which include the microcomputer itself errors on the power supply line and errors overload etc on the refrigerant circuit and the location of trouble is displayed with the commbination of error symbols of remote controller normal green and inspection red display LED on PCBs of indoor outdoor units When any error occurs check first the inspection display It will guide you to trouble point and assist you to complete the repair work quickly Error code of the remote controller is recorded on microcomputer after the trouble has been reset automatically so that if you press the inspection switch of remote controller the error code and the number of unit in trouble are displayed for 10sec The inspection display lamp on the
3. connector The control board s power supply peepee 0 2 is supplied from the inverter board Power transistor thermistor temperature resistance characteristics check Thermistor resistance kQ T 80 C Thermistor resistance kQ T 8o C Temperature T C Power transistor module check Is there any short circuit open circuit or damage See page 345 for the check procedure Fuse Check There should be continuity If defective replace the inverter board Compressor rotor lock Compressor breakdown nverter board breakdown Compressor starting is defective Compressor breakdown nverter board breakdown Power transistor breakdown Transmission error between inverter and outdoor unit Connectors CN11 or CN12 is disconnected or broken wire between connectors Error on outdoor control PCB Error on inverter PCB iv Check procedure depending on indication lamps For the outdoor unit Error display Detected during operation only Indoor unit Red LED 2 time flash Green LED Keeps flashing Outdoor unit Red LED Stays OFF Green LED Stays OFF Outdoor unit Red LED Stays OFF Green LED Keeps flashing Is the paining of YES Indoor outdoor units OK NO Change of unit num ber setting Note 1 No outdoor unit corresponding to the indoor unit Replace the outdoor PCB
4. Is normal status restored after recovery YES Normal Error on the outdoor unit signal line Power supply check between L1 N or terminal block Power not supplied Power supply wiring error Repair E Unit is normal Is there AC 10V checked between CNA2 red red and AC 16 5V between blue blue of outdoor unit transfomer Nomalized YES Power supply Blown fuse 3 15A Replacement e Defective transformer Replcement Briken power supply wire in the unit Repair Defective outdoor unit PCB With power OFF disconnect the network signal line and measure Is the connection YES of network signal d the resistance across terminals wires good and B Repair the door con nection broken wire of network signal wires YES Is the resistance approximately 9 1 K 2 NO Super lynk protection fuse is blown NO Change the connector connection to the spare circuit Is the resistance approximately 9 1KQ Error display J Detection at the power on Outdoor unit Red LED continuously Green LED Irregular illumination Stays OFF or Lights gt Error on the outdoor unit signal line Its it normalized Unit is normal Malfunction by noise Power supply reset Defective outdoor unit PCB Replacement Defective network com munication circuit
5. ccccc ese e eee eeeeeae eens Print Name If you have any technical queries please contact the 3D Air Sales Technical Department on 01376 565505 MITSUBISHI HEAVY INDUSTRIES LTD air conditioning NOTICE The installation of this equipment must comply with all NATIONAL STATE and LOCAL CODES This Service Guide does not cover all installation circumstances and is meant for guidance only and therefore will not form part of any legally binding contract An installation guide is provided with the air conditioning equipment CE These Air Conditioners comply with EMC Directive 89 336 EEC LV Directive 73 23 EEC 3D Air Sales Ltd 3D Air Sales Ltd Sales amp Marketing Office Technical Sales Admin Spares Warranty 840 Brighton Road Anglia House Priors Way Purley Surrey CR8 2BH Coggeshall Essex CO6 ITL Telephone 020 8668 1112 Telephone 01376 565 505 Facsimile 020 8668 1113 Facsimile 01376 565 525
6. Display section Displays the error of higher priority When plural errors are persisting ED EID EID EP ES ESSE TPES EI g ee Displays the present errors When a new error has occurred after the former error was reset x Mt gt ri x on Error code Timing of error detection When the transmission error continuously for 2 min s Resetting was performed at the rate of 1 time per second An abnormal stop occured 32 sec time flash A check was made once every 20 second An abnormal stop occured 7 time running After a compressor ON command this failure was detected for 5 second in the period of 2 minutes to 2 minutes and 20 seconds E Fi This failure was detected continuously for 5 seconds E a At all times from 31 seconds after power ON Error code Timing of error detection A stop occurs when this abnormality occurs for 2 seconds running at 130 C After a stop for 3 minutes an recovery is automatically made An abnormal stop occurs when this abnormality occurs 2 times for 60 minutes The abnormal state is held for 45 minutes P t This failure is detected when it occurs for 5 seconds running in the period of 2 minutes to 2 minutes and 20 seconds with the compressor ON An abnormal stop occurs when this failure occurs 3 times for 40 minutes This failure is detected when it occurs for 5 seconds running in the period of 10 minutes to 10 minutes and 20 seconds with the compressor ON An abnormal sto
7. PC2 PC1 o C13 a C1 z 52X4 6 PC5 7 IC8 B Li eS 2 2 C11 Power source PCB CNWS IC12 Model select switch Remote controller Connector CNT SW10 SW5 CNQ N WS L Address switch EE DIP switch SW1 4 o ia ia SW9 Heat exchanger thermistor Return air thermistor Thi R1 Thi A DIP switch Heat exchanger thermistor SW5 Thi R2 J10 J11 SW10 e Function of jumper wires e Function of DIP switches SWS5 9 Funcio With Filter sign Valid None Filter sign Invalid it Normal operation operable e Operation permission prohibited ith Heating thermostat OFF Intermittenet operation Funcion SWS 1 Test run of condensate pump motor l Normal SW5 3 Reverse Invalid signal Run stop SWS A Emergency stop signal Invalid Emergency stop signal Valid SW9 3 Louver stop Louver Range Louver stop Normal ith Remote controller air flow 3 speed SW9 4 Fan control UH H M J10 SW10 2 TH SW10 3 None 0 Remote controller air flow 1 speed Fan control H M L None D n Remote coniro ier ur Tus 2 speed Note 1 AII OFF under load condition one Heating thermostat OFF Lo operation J3 SW7 3 JA SW7 4 j Heating thermostat OFF Stop one e Heating thermostat OFF Note 1 None means that jumper wire is not provided on the PCB or the connection is cut e Replacement procedure of indoor unit micrcomputer printed circuit board Microcompu
8. Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing At 63H1 1 2 operation 1 During cooling s the outdoor unit fan motor operating s there no short circuit air circulation for thr outdoor unit s there sufficient space for air inlet amp outlet 2 During heating s the gas side service valve fully opened Did 63H 1 2 operate Defective outdoor unit PCB Replacement Defective 63H1 1 2 input circuit Is the indoor unit heat exchanger thermistor detached from the detector case Is the filter clogged 3 During colling heating Is the refrigerant overcharge Display conditions Abnormal pressure detection If the 63H1 1 2 goes OFF open the compressor stops After a 3 minute Compressor stop delay the compressor restarts If this condition is detected 5 times within Compressor To 60 minutes or if the open state continues for 60 minutes without inter operating 3 15 4 15 ruption High pressure MPa 27 Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash D Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing of outdoor unit LED indicates power transistor CM1 overheat and double flashing indicates power transistor CM2 overheat NO Replacement inverter PCB If the compressor s stopped state continues for about 10 minutes abnormal reset is possible YES Is the indoor unit s installa
9. Resistance temperature characteristics Defective outdoor unit heat exchanger and sub cooling coil thermistor Replacement Resistance kQ Display conditions If the temperature sensed by the thermistor is 50 C or lower continu ously for 5 seconds between 2 minutes and 2 minutes 20 seconds after the compressor goes ON the compressor stops After a 3 minute delay the compressor restarts If this state is detected 3 times in 40 minutes Temperature C Error display 78 Defective outdoor temperature thermistor 7 segment diei EJA Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Is the outdoor Defective outdoor unit PCB gt temperature thermistor Replacement Defective outdoor characteristics OK is there temperature thermistor input circuit no broken wire Is the outdoor air temperature thermistor connector connection Temperature resistance characteristics of outdoor temperature thermistor Tho A Defective outdoor tempera 400 40 ture thermistor Replacement O Sl O O D D VII NI 300 30 Thermistor resistance kQ T Thermistor resistance kQ T 200 TOC 20 T 20 C e Display Conditions If the temperature detected by the thermistor is 30 C or lower con tinuously for 5 seconds between 2 minutes and 2 minutes 20 seconds 100 10 af
10. SW3 N swa G O al SWA T 9g f il moomeeee r E Er x all 2 CNN3 CNN LOCJLULUCJ aU CNNI CNN8 CNN7 CNN6 CNNI CNNS Q l l N Lej gt piii mr um l CNFM3 CNFM3 CNN4 OO m LJ mm PCB power supply LED red connector Primary side e Function of DIP switch FDCA224HKXRE4 FDCA280HKXRE4 Inspection LED reset sws Fore SW3 2 ON Backup operation With Backup operation None ON Renewal Normal ON Forced cooling heating Normal ON Test mode Normal Test run operatopm Normal Test run operation Cooling Test run operation Heating Pump down Normal SW4 5 e Function of oes wire Lus D None a ni We None a ns Ar None D Note 1 None means that jumper wire is not provided on the PCB or the connection is cut Demando change Compressor capabilicy 0 Demando change Compressor capabilicy 40 Demando change Compressor capabilicy 60 Demando change Compressor capabilicy 80 Address setup of master slave unit slave Address setup of master slave unit master SW3 3 SW3 7 SW3 8 External input level External input pulse Defrosting temp Strengthening Defrosting temp Normal Defrosting time Cold weather region None Defrosting time Normal SW5 1 SW5 2 SW5 3 Loco seer gee 19 e Replacement procedure of outdoor unit control printed circuit board Micromputer printed circuit board can
11. is over more than 17 units Two remote controller are provided for one controller is perfirmed Suy OFF cdd 0 47 Suy OFF Stays OFF Remote controller thermistor failure Outdoor unit power OFF Detected only during operation Keeps flashing Stays OFF Keeps flashing Irregular illumination Keeps flashing Keeps flashing Keeps flashing Keeps flashing Keeps flashing Keeps flashing Keeps flashing Stays OFF Keeps flashing Keeps flashing Stays OFF Keeps flashing Stays OFF Keeps flashing 1 time flash Keeps flashing E16 Keeps flashing Keeps flashing E28 Keeps flashing Stays OFF Keeps flashing Note 1 In the case of FDT112 140 or FDK22 56 type e Models FDCA224HKXRE4 280HKXRE4 335HKXRE4 Remote Indoor unit LED Outdoor unit LED Outdoor controller LED Keeps flashing Stays OFF Keeps flashing Unmatched indoor outdoor connection Duplication outdoor unit address No Keeps flashing Stays OFF Keeps flashing Outdoor unit address setting error 30 3 Keeps flashing Stays OFF Keeps flashing 32 L3 phase wiring is open phase or reversal phose 0 Cause 7 Segment Keeps flashing Stays OFF Keeps flashing E36 1 Discharge temperature Tho D1 abnormality E37 1 Outdoor unit heat exchanger thermistor Tho R1 failure E37 2 Outdoor unit heat exchanger thermistor Tho R2 failure 3 time flash E37 3 i i z i ES Keeps lashing Stays OFF Kesosdiashins Outdoor unit heat exchanger thermistor Tho R3 failure E37 4 Outdo
12. poor connection or broken signal wires between in fective network communi door outdoor units cation circuit 23 Connection error indoor and outdoor unit Indoor unit Outdoor unit Red LED Stays OFF Red LED time flash Green LED Keeps flashing Green LED Keeps flashing Connection of indoor and outdoor unit OK Defective outdoor unit PCB Replacement Duplicated unit No of outdoor units Indoor unit Outdoor unit Stays OFF Red LED 1 time flash Keeps flashing Green LED Keeps flashing Red LED Green LED Is the unit No duplicated on outdoor units Correction Defective outdoor unit PCB gt Replacement Defective unit No read circuit Antiphase on power supply or open 52C L3 phase primary side on power supply Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Is there antiphase on YES power supply NO YES Is L3 phase open at primary side NO Defective outdoor unit PCB Defective antiphase detection circuit Replace Note 1 Wrong wire connection of the antiphase detection circuit is suspected occured during replacement of the outdoor unit PCB Replacement work should be per formed carefully Correction 1 Is antiphase detection circuit wired properly YES Correction NO Correction A s Discharge temperature
13. replaced with following procedure 1 Confirm the parts numbers Refer to the following parts layout drawing for the location of parts number PCB505A042RC FDCA224HKXREA 280HKXREA 335HKXRE4 PCB505A042RF FDCA335HKXRE4 K 400HKXRE4 FDCA450HKXRE4 iii Parts layout on the outdoor unit inverter PCB Replacement procedure of outdoor unit inverter printed circuit board Inverter printed circuit board can replaced with following procedure 1 Confirm the parts numbers Refer to the following parts layout drawing for the location of parts number PCB505A044ZA FDCA224HKXRE4 280HKXREA 335HKXRE4 PCB505A044ZB FDCA335HKXRE4 K 400HKXRE4 450HKXRE4 Model FDCA224HKXRE4 280HKXRE4 335HKXRE4 It is OFF besides SW2 1 ON entirely 2 O CNIS C jum Ee ps ll It is OFF besides ol cQ D CLAY SW2 1 ON entirely ho s W Swi Swe 20 Check points of inverter outdoor unit gt Check with power ON at the points marked with This figure applies to the FDCA224HKXREA 280HK XREA 335HKXRE4 The FDCA335HKXRE4 K 400HKXRE4 and 450HKXRE4 have 2 inverter related systems Resistance R1 1 or R2 1 check Resistance is measured 15 2 Diode module check There should be no short circuit open circuit or destruction Capacitor check Check for abnormality in appearance such as damage swell etc DC reactor continuity check 30 mQ or higher but less than 100 mQ Fuse Check Ther
14. setting and remote controller 7 segment display address setting coexstents in the same network Indoor unit Stays OFF Red LED Keeps flashing Green LED Outdoor unit Stays OFF Keeps flashing Red LED Green LED automatic address and remote controller address coexstent on the same network YES Repair to remote controller address Defective outdoor unit PCB Replacement Abnormalities in an outdoor fan motor Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash 0 Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing of outdoor unit LED indicates FMOI and double flashing indicates FM02 e When outdoor unit is running NO Remove the foreign object Is a foreign object caught in the rotating parts of the fan motor YES Does the fan turn smoothly when turned by hand NO Replace the fan motor YES Is the voltage at the red and black leads of CNDCW1 2 308 339V DC NO Check the power supply voltage YES Reset the power supply NO Replace the fan motor Did it return to normal YES It occurred due to transient noise e Display Conditions If an overcurrent or overheating signal is received from the outdoor fan motors FMO1 2 the compressor and outdoor fans stop They start again after 3 minutes but if this same trouble occurs 5 times separatel
15. the heat dissipation fins tighten the screws apply silicone is insufficient Power transistor is defective 3 time flashes Compressor rotor lock Entondisul Red LED Compressor breakdown eb daa v nverter board breakdown 4 time flashes Compressor starting is defective Compressor breakdown nverter board breakdown Power transistor breakdown Lights up Transmission error between inverter and outdoor unit e Connectors CN11 or CN12 is disconnected or beoken wire between connectors Error on outdoor control PCB Error on inverter PCB Invertes 2 Check Indicator Table Whether a failure exists or not on the indoor unit and outdoor unit can be know by the contents of remote controller eroor code indoor outdoor unit green LED power pilot lamp and microcomputer normality pilot lamp or red LED check pilot lamp Remote controller error code Indoor unit LED Outdoor unit LED Keeps flashing Stays OFF Keeps flashing Stays OFF Stays OFF Stays OFF Keeps flashing Keeps flashing Keeps flashing Stays OFF Keeps flashing Cause Stays OFF Stays OFF Power OFF T phase wiring is open power source failure Remote controller wires X and Y are reversely connected For wire breaking at power ON the LED is OFF Remote controller wire is open X wire breaking A beep is produced and no indication is made Z wire breaking No beep and no indication The remote controller wires Y and Z are reversely connected No indica
16. time flash Keeps flashing Stays OFF Keeps flashing 1 time flash 1 time flash Keeps flashing Stays OFF Keeps flashing 2 time flash Discharge temperature Tho D2 abnormality 1 time flash Outdoor unit heat exchanger thermistor Tho R 1 failure 2 time flash Outdoor unit heat exchanger thermistor Tho R2 failure Kerne shine Stays OFF Reens Hasime 3 time flash E37 3 Outdoor unit heat exchanger thermistor Tho R3 failure 4 time flash Outdoor unit heat exchanger thermistor Tho R4 failure 5 time flash Outdoor unit heat exchanger thermistor Tho SC failure 6 time flash Outdoor unit heat exchanger thermistor Tho H failure Keeps flashing Stays OFF Keeps flashing time flash Outdoor air temperature thermistor Tho A failure time flash E39 1 Discharge temperature thermistor Tho D1 failure Keeps flashing Stays OFF Keeps flashing 2 time flash E39 2 Discharge temperature thermistor Tho D2 failure Keeps flashing Stays OFF Keeps flashing 1 time flash High pressure 63H1 1 2 error 1 time flash E41 1 Power transistor CM 1 overheat Keeps flashing Stays OFF Keeps flashing 2 time flash E41 2 Power transistor CM2 overheat 1 time flash E42 1 Abnormal current cut of compressor CM 1 Keeps flashing Stays OFF Keeps flashing 2 time flash EA2 2 Abnormal current cut of compressor CM2 Keeps flashing Stays OFF Keeps flashing time flash The number of connectable units is exceeded time flash E45 1 Transmission error between inverter and o
17. 2 2 Error display 5 Outdoor unit signal line error power supply error Indoor unit Red LED 2 time flash Green LED Keeps flashing 1 purdooruni the aa a Power supply eam spom gt C duin Green LED Stays OFF operatioon Blown fuse Broken or loose wire at Ll L2 or N Phase Was not there the power failure Note 1 This case is limited to the separate power supplies to indoor outdoor units Combination of indoor unit red LED 2 time flash and outdoor unit green LED stays off means that the power supply to the outdoor unit has been interrupted during operation Outdoor unit Red LED Stays OFF or Is it Malfunction due to noise etc Keeps flashing Power supply reset normalized Out of control CPU of outdoor unit due to noise during power on Green LED Irregular illumination Defective outdoor unit PCB gt Replacement Defective network communication circuit Outdoor unit Signal wire Red LED Stays OFF poor connection at YES Repair Green LED Keeps flashing outdoor unit NO Q Signal wire poor contact between indoor outdoor unit Dio Repair Unit is normal Malfunction by accidental noise NO Power supply reset Notes 1 Check for poor connection looseness misconnection at out door unit terminal block and droken signal wires between out Defective outdoor unit door units l l PCB Replacement De 2 Check the
18. Communications error between the master unit and slave units 7 segment display 5 Conbination unit only Indoor unit Outdoor unit Stays OFF Red LED 1 time flash Keeps flashing Green LED Keeps flashing Red LED Green LED Are the address Nos of outdoor units set correctly between the master and slave units Turn the power OFF then turn it on again Is an error message displayed Replace the outdoor unit PCB Abnormal noise etc Error display Scram 7 segment display 457 Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Note 1 Check if the power supply system is normal Is a refrigerant leak indicated by a refrigerant leakage sensor input at indoor CnT emergency stop input Refrigerant circuit check NO Scram input check 36 MOS MM Maio IMMO MM UM MM UM AALL MM AUIL AUIL AALL AALL MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM Mm Checking the power transistor module including the drive circuit MS MM lOO IMMO AUU AUIL MM MM MM IMMO MM UM MM UMMIM MM MM MM MM MM MM MM MM MM MM MM MOI MM MM MM MM MM HU HM WIM gl HMM Og Htt Is there any breakage or burn damage NO in the power transistor module YES Is there a NO 1 Power transistor module terminal short circuit check short circuit between the power transi
19. EDs of cooling and heating illuminated simultaneously or the like is observed even if the remote controller is not operated or the remote or the remote controller and as the result the operation of units may be disabled or similar abnormal phenomenons are observed When noises intruded into the microcomputer of printed circuit board State of operation becomes abnormal such as the units perform irregular operation while the remote controller is not operated the operation cannot be stopped with the remote controller etc Electro magnetic noise prevention example Cover the entire surface of control box or the inside of unit cover with the cover foil or cover Interisified shielding the entire unit with a wire net of control section Signal wire Insert in a steel pipe shield Use the shield or Remote controller wire twist pair wires Outdoor unit Make a positive Put in a steel case Remote controller ground machine oh welder Hi frequency Unless it has a sufficient current capacity mini split current drops momentarily at the start stop of cutting machine Separate from cutting machine as far as possible This is very effective Cuttin S 3 H o o S Ra because the effect of noise is inverse proportion to 1 5 times of distance Shut off electrically the noise source or put z c A void supply fro
20. NO AC 220 240V at both terminals of CNR YES Drain motor check of NO motor wiring NO Replacement indoor unit PCB YES Is drain piping unclogged Is the slop OK YES Drain motor check 8 Error display 7 Control of 1 remote controller VS multiple units Excessive number of units more than 17 units Indoor unit Outdoor unit Stays OFF Red LED Stays OFF Keeps flashing Green LED Keeps flashing Red LED Green LED Are more than 17 units connected Reduce to 16 units to a remote or less controller Defective indoor unit PCB Replacement 9 Error display Addresses setting for plural remote controllers Indoor unit Outdoor unit Stays OFF Red LED Stays OFF Keeps flashing Green LED Keeps flashing Red LED Green LED plural indoor units connected to one remote Connect each remote controller separately controller and isn t it in the remote or use the remote controller with manual controller address address setting condition The remote controller is defective Replacement 16 10 Error display g Indoor unit Red LED Green LED Are unit number set for see following Defective indoor unit PCB Replacement defective unit number input circuit Red LED Keeps flashing Green LED Address No combination eroor or addressing is preformed with the following combinations
21. Note 1 While attempting to restart the compressor 2 or 3 times the e Display conditions liquid refrigerant inside the compressor may be dispelled to outside the compressor and the starting abnormality may improve and recover 2 A remote control reset is possible after 3 minutes passes Error display 4 5 Compressor loader position detection error 7 segment His 1 If it can t be started 2 times in 7 attempts Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Notes 1 Check if the power supply system is normal 2 Single flashing of outdoor unit LED indicates compressor CM1 loader position detection error and double flashing indicates compressor CM2 loader position detection error It doesn t recur Transient noise may be causing it to malfunction Ta Does it return to normal when the power reset Does the compressor make an abnormal noise Operation Does the compressor start YES NO NO Does E42 occur ke measures to eli minate any nearby NO E59 YES YES E60 recurs noise Sources i Replacement Display conditions 1 After rotor position detection operation if the rotor s position cannot be detected again 4 times in 15 minutes an error is displayed 2 A remote control reset is possible after 3 minutes passes 345 Error display
22. Red LED Green LED Green LED Keeps flashing unit is not yet determined Polarity determination is completed within a few seconds after the power on If it is not completed in time CPU out of cotnrol etc is suspected Remote controller LCD display WAIT amp Inside control board LED Flashes continuously Notes 1 When CPU of one unit goes out of control it occuping the transmis sion section of the network so the transmission of other units are not done and the polarity of the whole network will not be determined 2 The unit which has its indoor and green LED keeps flashing or no lighting is the one with a defective indoor unit PCB 3 If it becomes normal after replacing the PCB it can be considered that the PCB is defective defective network transmission circuit Power supply reset Is it more than 10 sec after power on Is the remote If yes itis a controller LCD malfunction by nomal electrical noise NO Center or Remote only display unit only Multiple units on network on network 2 3 Defective indoor unit PCB Replacement Defective indoor unit PCB on some units Replacement Power supply line error Outdoor unit Red LED Stays OFF Green LED Stays OFF Indoor unit Indoor outdoor unit transfomer CNW indoor CNA outdoor Is AC 15V checked between Power supply checked Red Stays between O re
23. Red LED Stays OFF Red LED time flash Green LED Keeps flashing Green LED Keeps flashing Doesn t the number of indoor unit connected exceed the specified value Notes 1 The maximum number of connectable units of each model is as follows FDCA224 type 13 FDCA280 type 16 FDCA335 type 20 FDCA400 type 23 FDCAA50 type 26 FDCA735 type 43 FDCA800 type 47 FDCA850 900 type 48 2 Outdoor No setting check for indoor units to Power supply reset see if outdoor No is of other system 3 In case of auto addressing erase the addresses Is it Defective outdoor unit stored in memory and perform re setting normalized PCB Replacement Unit is normal malfunction by accidental noise Transmission error between inverter and Outdoor unit PCB Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash D Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing of outdoor unit LED indicates transmission error bitween inverter and outdoor unit PCB CM1 Double flashing of outdoor unit LED indicates transmission error bitween inverter and outdoor unit PCB CM2 connection good at the connectors between the control board and the inverter board YES Are all the switches except SW2 1 ON OFF YES Replacement outdoor unit PCB Did it return to normal NO Replacement inverter PCB 30 Error display fe address
24. T 80 C Defective suction pipe temperature thermistor Indoor unit Outdoor unit Stays OFF Red LED 1 time flash Keeps flashing Green LED Keeps flashing Red LED Green LED Are the suction pipe Defective outdoor unit PCB thermistor characteristics Replacement Defective suction OK is there any pipe thermistor input circuit broken wire Defective suction pipe thermistor Replacement Is the suction pipe thermistor connector OK Suction pipe thermistor Tho S Resistance temperature characteri stics e Display conditions Resistance kQ If the temperature detected by the thermistor is 50 C or lower continuously for 5 seconds between 2 minutes and 2 minutes 20 seconds after the compres sor goes ON the compressor stops After a 3 minute delay the compressor restarts If this condition is detected 3 times within 40 minutes 0 10 20 30 40 50 Temperature C 22 E Error BISpIS 2 Defective low pressure and high pressure sensor Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash D Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing indicates PSL and double flashing indicates PSH Is the connection of the low pressure sensor connector and high pressure sensor connector OK YES Does the pressure actual measurement match with the value in the 7 segment di
25. alities from the past they will be displayed by an error code and unit No Example E8 Lighted up T U No 00 A Flashing 5 Using the AJ or W button select the indoor unit No you want to display the error data for If only one indoor unit is connected the indoor unit No does not change 6 Fixthe selection using the SET button The displayed indoor unit No will change from flashing to light up continuously Example E8 DATA LOADING This message flashes while data are being read l pg ERROR DATA The data are then displayed beginning with item No 01 Displayed items are as shown below 7 Display the other data for when the error occurred in order from the currently displayed operation data No 01 using the AJ or W button Depending on the model items for which corresponding data do not exist are not displayed 8 To change the indoor unit press the AIR CON No button and return to the indoor unit selection display 9 Press the ON OFF button to end the abnormal operation data check I U HEAT EXCH1 6 C I U HEAT EXCH2 5 C 06 VU HEAT EXCH3 4C I U FAN Hi 08 REQUIRED HERTZ ASH 10 n n 22 23 T 25 26 27 28 29 CT 26A 31 O U FAN Hi 2 Z 40 Erm PAL Enhanced High Performance Air Conditioning Z2 MITSUBISHI HEAVY INDUSTRIES LTD Maintenance Schedule Unit Measure Winding Res Insulation 1MOhm If less replace Ee al posom pete 8 Visuall
26. ays the settings related to timer operation Temperature setting switches These switches are used to set the temperature of the room TIMER switch This switch is used to select a timer mode Timer setting switches These switches are used to set the timer mode and time GRILL switch This switch has no function When this switch is pressed do INVALID OPER Invalid Operation is displayed but it does not mean a failure AM SUBISHI HEAVE INDUSTRIES LTD CH H Ty AM 421 ZZ PM EH OA ICENTERT 7 GUN Won QUO WED M FR GA 31 AM I PE l Fhour 34 PM 62 Ll Li COFF 44 MODE AIR CON No CHECK TEST 08 S2 _ AIR CON No Air conditioning system No switch Displays the number of the connected air conditioning system CHECK switch This switch is used at servicing TEST switch This switch is used during test operation If you oress any of the switches above and d INVALID OPER v jg display the switch has no function But it does not mean a failure 39 Vent Indicator Indicates operation in the Ventilation mode Weekly timer display Displays the settings of the weekly timer Operation setting display area Displays setting temperature airflo
27. d red and AC 10V between red red fent LED OFF orD or AC16 5V between blue blue Green Stays LED OFF Blown fuse indoor unit 3 15A outdoor unit 3 15A Replacement Defective transfomer Replacement Broken power cables of inside or outside of unit Repair No power supply wiring error of power line Repair Indoor unit Outdoor unit Red LED Red LED Stays OFF Green LED Keeps flashing Green LED Keeps flashing Flash of green LED means CPU is normal Remote controller wiring connect check Red White Black Approximately 10 11 V between Power supply reset Note 1 Z is GND NO YES Remote controller wire Maltifunction by is removed accidental noise YES Remeasure YES between X Z 10 11V Remote controller wire short circuit Remote controller defective NO Replacement indoor unit PCB Power supply Unit is normal Malfunction by noisse Is it normalized NO Defective remote control ler PCB Replacement 3 Error display Indoor and outdoor unit Red LED Stays OFF Green LED Keeps flashing Z remote controller covering multiple Power supply reset Is it normalized Is the power ON on all indoor units Note 1 With the separate power supplies for indoor outdoor units the outdoor unit green LED may flash in some cases Pow
28. djust LS lever and check again a click sound is heard Defective LS Replacement Defective indoor unit PCB Replacement E 2 When the indoor unit blower does not operate gt Inspect at the indoor unit side All of cooling blower heating thermaldry do not operate Check FMi Is Voltage detected between CNF terminals Defective indoor unit PCB Replacement Defective indoor unit PCB Replacement YES Defective FMI capacitor CFI Replacement 3 Four way valve does not switch during heating operation Is the voltage between connector CNNI or CNN5 D and 2 AC 380 415 V Defective 20S or 20SL Replacement Defective outdoor unit PCB Replacement ii When the cooling heating effect is felt insufficient Check also the refrigeration cycle for the refrig erant quantity etc in addition to the following 1 When the cooling effect is insufficient Check if the protective function has tripped and as a result the compressor operation frequency has dropped below the specified frequency Does the indoor expansion valve operate properly Is it clogged s the frosting prevention function operated Check method of the indoor unit electronic expansion valve Check the indoor controller output to the expansion valve with the following procedures gt Check how much volt is detected at the expansion gt The indoor controller i
29. e should be continuity Noise filter check There should be continuity and there should be no short circuit between phases Check of power supply Check the power supply on L1 L2 and L3 of terminal block TB It is normal if AC 380 415V is detected X DC380 415V Signal wire Power transistor thermistor Power transistor module Transformer g ontrol P C B C o CNDC1 oes AA LED1 LED2 LEDS T Red Green Green L LL eR CNO1 CNO2 LED2 LED1 Green Red Inverter P C B F4 250V 3A Communication cheched at the CN11 will show the following values Voltage za 12V l EEV P C B Swings between 8 12 V analog tester CNEEV1 CNEEV2 CNEEV3 Swings between 4 5 V analog tester LC PO Cd a Q a a I or LED2 Green check n If it flashes the microcomputer LEDI Red Check time flashes Current cut power transistor over current Short circuited compressor wiring Trouble on inverter PCB Trouble on power transistor 4 time Compressor motor neutral line disconnected flashes 3 time flashes Power transistor overheat Fastening of the power transistor to the heat dissipation fins tighten the screws apply silicone is insufficient Power transistor is defective Lights up operates normaly Note 1 The operati ae perating frequency etc is If E i ys o Te pus displayed by the 7 segment display in M n accordance with the setting of SW8 9
30. er supply ON Unit is normal Malfunction by accidental noise Defectve indoor unit PCB Replacement Communication error between remote controller Indoor unit Defectve indoor unit PCB Replacement Indoor unit Outdoor unit Red LED Red LED Stays OFF Green LED Keeps flashing Green LED Keeps flashing Lamp OFF if remote controller wire is broken at power ON Voltage between X and Z approximately 10 11 V YE P Replacement remote Remote controller controller wire is removed Is the resistance between Y Z on the remote le approximately 10kQ NO fluctuates between NO 5 11 V between Replacement remote controller Power supply OFF NO Remote controller wire disconnection Resistance is approximately 10kQ between indoor Y Z Replacement indoor unit YES NO Terminal block CNB Remote controller harness is defective wire short circuit NO YES Power supply reset Noise After the green LED lights up once YES it begins flashing again continuously NO The louver moves once in the Bay erase close direction Replacement remote pp controller YES uctuates between 5 10 V between CNB Y and Z YES Indoor unit resets every 4 minutes Noise Mi NO Replacement indoor unit PCB Indoor unit Outdoor unit Stays OFF or Lights Red LED continuously Red LED Stays OFF Stays OFF or Lights Green LED continu
31. error Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing ofoutdoor unit LED indicates Tho D1 and double flashing indicates Tho D2 Is the discharge pipe ther mistror characteristics normal operation Charge the refrigerant measure s it the oveload operation Discharge pipe temperature error i l bs At coolio aane Insufficient refrigerant 7 s the filter clogged Check the unit side Check the unit side Is the heat exchanger dirty or clogged s the installation space of indoor outdoor unit adequate s there any short circuit air flow for indoor outdoor units a ee ey Discharge pipe temperature normal Is the abnormal temperature detection actual measurement correct NO Defective outdoor unit PCB Replacement Is the unit normalized If the discharge pipe temperature Tho D1 2 exceeds the set value the capacity of the compressor are controlled to restrict the rise in the discharge pipe temperature Compressor control Compressor capacity is reduced at 5 seconds Reset 110 C 120 C Discharge pipe temp S E Eu Eu I 1 I Retention I I i Display conditions Abnormal temperature detection If the discharge pipe temperature becomes 130 C or higher for 2 seconds Error s
32. h display of cool ing degree Hi ther mostat 23 C Power supply reset Power supply line error O gt See page 321 l YES Does the error repeat Cause is acccidental noise etc and the unit is normal YES Check of error code Errors due to external noise etc Error code may be displayed or the error may not be displayed normally even 1f the controller is normal because of external noise source or joined or parallel arrangement of power cables and singal wires It is because the wire of remote controller wired remote controller signal wires for multiple units or the network signal wires may be influenced by external noises whitch are judged as signals by the microcomputer whitch reacts mistakenly When there is any noise source it is necessary to the shield wire for the remote controller and signal wires Note 1 High frequency medical machine rectifier motor application device thyristor broadcast transmission tower power transmission line power line of electric train automatic door motor elevator voltage drop wireless telephone high voltage power distribution line computer personal computer and their cables These do not necessarily always cause problems but they can be a source of electrical noise 2 Reference Effect of noise When noises inturude into remote controller Abnormal or irregular display such as the flashing of irrelevant display lamp for example L
33. hen the error has been reset Indoor unit Press the Timer switch and the Stop switch while the Inspection switch of wired remote controller is held down or detach the power supply connector CnW2 of indoor unit PCB and connect again or turn OFF the power Outdoor unit Detach the power supply connector CNA2 of outdoor unit PCB and connect again or turn OFF the power supply or turn on and off the SW3 1 4 Indications with 7 segement indicator Refer to page 166 202 2 Procedures of trouble diagnosis When any error occurs inspect in following sequence Detailed explanation on each step is given later in this text Check of inspection display In door outdoor unit PCB remote controller or Indication board Power supply check Error indoor outdoor unit Check of inspection display In Check of unit door outdoor unit PCB remote controller or Indication board Replacement or repair of defective parts Test run adjustment controller a Diagnosis by the power supply reset When any error occurs reset the power supply as described below to see if it is the result of accidental noise etc Check at the indoor unit side Is any errror code display 2 NO Check the error code displayed ON OFF switch OFF Does the error code disappear Microcomputer out of control Turn off the wiring breaker power supply and back on again min later ON OFF switch OFF Does start operation wit
34. indoor outdoor unit PCB keeps flashing glowing even after the trouble was reset automati cally Inspection lamp on the indoor unit PCB is turned off if the remote controller is reset 1 Inspection normal List of power display Section Display Section Display Contents of display Power supply display LCD At power ON Displays always the return air temperature and Center Remote LCD At error Displays El E63 or blank depending on the kings of error Inspection display Red LED At error Flash continuously indicates the occurence of error At power ON normal Flash continuously Remote controller Normal displa pay Gren LED At error Off or continuous glowing or irregular illumination At error Flash 1 3 times 5 sec for indoor unit depending on the kinds of error continuous flash irregular illumination or off Error display Red LEDI Indoor outdoor unit At error Flash 1 6 times 10 sec for outdoor unit depending on the kinds of error continuous flash irregular illumination or off At power ON normal Flash continuously Normaly display Green LED At error Off or continuous glowing or irregular illumination time flashes Current cut power transistor over current e Short circuited compressor wiring Trouble on inverter PCB Trouble on power transistor Compressor motor neutral line disconnected 2 time flashes Power transistor overheat Fastening of the power transistor to
35. m the same distribution LU SSE board to prevent troubles by the power source propagation Install the line filter at the power supply of cuting machine of mini Beware of noises split Positive grounding is necessary transmitted via air b Error diagnosis procedures at the indoor unit side To diagnose the error measure the voltage AC DC resistance etc at each connector around the printed circuit board of indoor unit PCB on the inspection display or the operation state of unit no operation of comressor or blower no switching of 4 way valve etc If any defective parts are discovered replace with the assembly of parts as shown below i Unit of replacement parts releated to indoor unit printed circuit board Electric components on and around the microcomputer Indoor unit printed circuit board thermistor Return air heat exchanger remote controller switch limit switch trans former fuse Note 1 Judges the troubles on the parts of driving power circuit or cooling cycle with the ordinary check method 10 ii Parts layout on the indoor unit printed circuit board e The control board in the following figure shows for the FDT type Fan motor For power source PCB isti d 22 80 CNW CNW9 C O OO I ow ow 5 Fan motor ibid LC al Louver motor cafe 6 90 160 UJ a CNW9 in kad KN1 17 r3 a 52X7 k 52x6 52x1 52x2 52x3 a C 5 es A
36. n space inadequate volume of refrigerant etc the location and cause of trouble will be discovered without difficulty In addition the display lamps error code of indoor outdoor unit is kept flashing except when the power supply is iterrupted after the irregularity is automatically recovered to give irregularity information to the service presonnel If any mode of higher priority than the error retained in memory occurs after the reset of error it is switched to that mode and saved in the memory i Replacement parts assembly related to the outdoor unit PCB Outdoor unit PCB outdoor unit inverter PCB power transistor module diode module capacitor reactor noise filter thermistor heat exchanger discharge pipe outdoor temperature etc fuse transformer etc ii Parts layout on the outdoor unit PCB PCB power supply connector Secondary side 7 segement indicator LED3 green LED2 green QNG4 CNG3 CNG2 C mm CNSI CNII 1 e w o oo PSP MUL JC Cleo NONO 9 O Ajgeeee ee LICL i 11 e CNLI VI A T E i J e DEF O 7SEGI 7SEG2 g SW10 9 L Outdoor unit a G B 8 8 8 8 8 fe q LS o U number address o m v My setting switch ON PN SW Order or 10 2 sw Cad D po Outdoor unit a amp O F number address m SW e Y setting switch m gi S IDNOIGEOT IE E 1 2 ise d RN O 7 ie Zz sws SW3 2 ows ua eme TES H g LI DO C mm EN
37. nd double flashing indicates power transistor CM2 overheat If the compressor s stopped state continues for about 10 minutes abnormal reset is possible NO Replacement inverter PCB YES Is the indoor ape NO i unit s installation Correction space proper YES Does the NO Replace either the outdoor unit fan motor or control board fan rotate power transistor thermistor characteristics OK is there any broken wire YES NO Replacement power transistor thermistor Is the power transistor thermistor connector OK YES NO It connects Inverter cooling Inspect cooling fan fan is running Replace cooling fan Is fastening of the power transistor to the heat dissipation fins OK eFastening screws e Apply heat dissipation silicone YES ait Fastened correctly NO Does not recur YES Temperature resistance characteristics of power transistor thermistor Tho P O 100 10 Display conditions VI T lt 80 C A power transistor temperature error occurs when a tempera s 7 T 80 C ture of 110 C or higher continues for 15 minutes including Q compressor stops Abnormal temperature detection 50 5 Compressor stop E Re starting RZ 90 110 E Power transistor temp C 0 0 0 20 50 80 100 120 Temperature T C 33 Thermistor resistance kQ
38. or unit heat exchanger thermistor Tho R4 failure E37 5 Outdoor unit heat exchanger thermistor Tho SC failure 1 Outdoor unit heat exchanger thermistor Tho H failure Outdoor air temperature thermistor Tho A failure Discharge temperature thermistor Tho D1 failure Abnormal current cut of compressor CM 1 The number of connectable units is exceeded Transmission error between inverter and outdoor unit control PCB CM1 Keeps flashing StaysOFF Keeps flashing StaysOFF Automatic address setting and remote controller address setting coexists in the same network Keensf ashna Stays OFF LE E Abnormalities in an outdoor fan motor FMOI Abnormalities in an outdoor fan motor FM02 E53 Keeps flashing Stays OFF Keeps flashing 1 time flash E53 Suction pipe temperature thermistor Tho S failure E54 1 Low pressure sensor PSL disconnection output error Keeps flashing Stays OFF Keeps flashing E54 2 High pressure sensor PSH disconnection output error ESS Keeps flashing Stays OFF Keeps flashing E59 1 Compressor startup error CM1 E60 Keeps flashing Stays OFF Keeps flashing E60 1 Compressor loader position detection error CM1 E63 Keeps flashing Stays OFF Keeps flashing Emergency stop of indoor unit e Models FDCA335HKXRE4 K 400HKXRE4 450HKXRE4 Indoor unit LED Outdoor unit LED Outdoor Keeps flashing Stays OFF Keeps flashing 1 time flash Keeps flashing Stays OFF Keeps flashing 1
39. ously Green LED Keeps flashing Unit 1s normal Runaway of indoor unit CPU due to noise etc gt Transient trouble Power supply reset Is it normalized Defective indoor unit PCB Replace Defective CPU 14 V1 4 Error display Indoor unit Duplicated indoor unit No or More than 49 indoor unit are connected Outdoor unit Red LED Red LED Stays OFF Green LED Keeps flashing Green LED Keeps flashing Is the indoor unit f No duplicated or Correction of unit No More than 49 indoor setting unit are connected Deede ndorus Notes 1 When correcting the unit number check again the pairing of indoor PCB Replacement outdoor units same Number assigned to coupled units is correct defective unit number circuit 2 If it is normalized by changing PCB judge the unit number input circuit 1s defective 5 Error display 5 Defective indoor unit heat exchanger thermistor Indoor unit Outdoor unit Return air thermistor Th A Red LED Red LED Stays OFF Indoor unit heat exchanger thermistor Green LED Keeps flashing Green LED Keeps flashing Th R1 R2 R3 Resistance temperature characteristics Defective indoor unit PCB Replace ment Defective indoor unit heat exchanger themistor input circuit Are characteristics of indoor unit heat exchanger thermistor OK or is there any broken wi
40. p occurs when this failure occurs 3 times for 40 minutes E H H An abnormal stop occurs when this abnormality occurs 5 times for 60 minutes rtt Stops at 110 C or higher recovers automatically at 90 C or lower abnormal stop L 1I if this occurs 5 times in 60 minutes E u d An abnormal stop occurs when this abnormality occurs 4 times for 15 minutes This error is detected when the number of connectable units is set over the specified value at remote control addressing coc With a delay of 3 minutes a recovery is automatically made An abnormal stop L Ial occurs when this errors occurs 4 times for 15 minutes This failure is detected when it occurs for 5 seconds running in the period of 2 minutes to 2 minutes and 20 seconds with the compressor ON An abnormal stop occurs when this failure occurs 3 times for 40 minutes d Recording and reset of error Error code e Saves in memory the mode of higher Stop the unit operation by pressing the ON OFF switch of remote priority controller 7E 7 e Operation can be started again if the error has been reset Indoor unit inspection lamp e Cannot save in memory red Outdoor unit inspection lamp Saves in memory the mode of higher red priority Notes 1 Priority is in the order of E1 gt gt E10 gt gt 63 2 Reset is disabled for 45min at the error of outdoor unit or compressor overcurrent or the discharge gas temperature error e Reset of error code in memory w
41. re NO NO Correction Defective indoor unit heat exchanger themistor Replacement e Display condition Is the indoor unit heat exchanger thermistor connector connection OK Resistance kQ 0 10 20 30 40 50 Temperature C If a temperature of 40 C or lower is detected by the thermistor continuously for Note 1 22 5 kQ at 6 C 5 seconds 6 Error display 7 Detective Return air thermistor Indoor unit Outdoor unit Red LED Red LED Stays OFF Green LED Keeps flashing Green LED Keeps flashing Is the return air Defective indoor unit PCB thermistor characteristics Replacement Defective return air eae aa thermistor input circuit Is the return air thermistor connector connection OK Correction If a temperature of 20 C or lower is detected by the thermistor continuously for 5 seconds Defective return air thermistor Replacement Note 1 Characteristics as per the above graph e Display Condition Error display 4 Drain trouble Indoor unit Outdoor unit Red LED Red LED Stays OFF Green LED Keeps flashing Green LED Keeps flashing Abnormal data check in remote controller DC 12 V at both terminals of CNI Is there any d overflow AP Replacement indoor unit PCB YES YES Float switch check Drain motor ON from remote controller Drain motor operation
42. remote controller therm Replacement Detective re istor OK or is there any mote thermistor input circuit broken wire Is the remote controller thermistor connector co nnection OK NO Detective remote controller thermistor Replacement Resistance temperature characteristic of remote controller thermister Temperrature C Resistance value KQ Temperrature C Resistance value KQ Temperrature C Resistance value kQ Temperrature C Resistance value kQ 6 j 5 J 53 6 4 o e s 33 J 3 5 8 o 9 s 7 a m 9 o 059 2 5 Jq3 B 2 o 4589 z z J5353 m 4 3 l 2J24 m s o 49 3 19 9 59 5 4 e 5 14 2 2 16 0 9 18 7 3 20 5 8 22 3 4 24 1 0 26 19 36 8 18 ERN NN ERN o s 2 s 4 52 o c Error diagnosis procedures at the outdoor unit side At the error diagnosis related to the outdoor unit check at first the error code of remote controller and the illumination patterns of norma 1 and inspection display lamps in the same manner as the case of indoor unit Then estimate the outline the cause and the location of error based on the pattern and proceed to the inspcetion and repair Since the self diagnosis function by means of the microcomputers of indoor outdoor units provide the judgement of error of microcomputers them selves irregularity power supply line overload etc caused by the installatio
43. rent cut CM1 and double flashing indicates current cut CM2 Check the compressor s insulation resistance and winding resistance Is the high pressure appropriate during operation Is the power supply voltage correct proper YES YES NO Check of power supply Check the refrigeration Replacement compressor circuit Frequency during current cutoff e Display Conditions eur D The compressor stops if the inverter s out put current exceeds the set value After a 3 minute delay the compressor re starts If this operation repeats 4 times in 15 minutes Check of power transistor module Reference to 345 NO Replacement inverter PCB OK Is installation space for the indoor and outdoor units appropriate Is there any short circuits in the indoor outdoor units During Cooling Is FMo operaing At heating If the power Is FMI operaing supply is reset 2 3 times s the service valve gas side opened fully does it return to normal s liquid flowing back to the compressor Is overheating level control normal Is the low pressure sensor normal e Is the compressor emitting an abnormal noise s the filter clogged Replacement inverter PCB t may be malfunctioning as a result of transient noise If there is a noise source nearby take countermeasures to eliminate it 20 Indoor unit Outdoor unit
44. s normal if the seconds and valve SM connector and at the pin at control side of voltages as indicated at left are confirmed the connector CnA white 7P 5 cores and measure When the expansion valve does not operate while also how many seconds the voltages are applied the voltages are detected operating sound is not White Brown heard the expansion valve is defective Approx DC 5VO is detected gt If the thermostat setting is changed the expan for approx 15 seconds at Yellow Brown Orange Brown sion valve will operate approx 20 seconds later the power on Blue Brown Then approx 5V will be confirmed at the CnA same as above Notes 1 5V is maintained for 8 seconds after the power on then it drops momentarily and recovers 5V for approx 7 seconds 2 When measured with a digital multi tester voltages of approx 6 3V are output one after another 38 2 OUTLINE OF OPERATION CONTROL BY MICROCOMPUTER 1 Remote controller a Wired remote controller The figure below shows the remote controller with the cover opened Note that all the items that may be displayed in the liquid crystal display area are shown in the figure for the sake of explanation Characters displayed with dots in the liquid crystal display area are abbreviated Pull the cover downward to open it Central control display Displayed when the air conditioning system is controlled by the option controller Timer operation display Displ
45. s occurs 4 times within a period of hour Only case of FDK22 56 type one aae After check reset with remote controller fan runs on weak NO V Check the circumstances 3 black is GND NO Replace the indoor unit s board NO S YE Is the voltage DC 280 between CNM 1 and 3 red black Was it reproduced YES mm 3 black is GND 1 voltage DC 15 V between CNM 4 and 3 white black the motor is turning does the voltage at CNRC blue EE BEEN voltage on the trans former secondary side brown brown AC 17 V or higher NO YES Replace the transformer us NO Note 1 CNM 3 black is GND Does the NO Replacement fan motor turn smoothly Detective fan motor True unit PCB by hand Is the voltage at CNM 5 yellow DC 1V or higher Display conditions If an indoor unit fan motor s speed is detected to be less than Note 2 CNM 3 black is GND YES 200 rpm continuously for 30 seconds the fan motor stops for 2 seconds After 2 seconds it starts again but this occurs 4 times indoor unit PCB within a period of 1 hour Error display Directive remote controller thermistor Indoor unit Outdoor unit Red LED Stays OFF Red LED Stays OFF Green LED Keeps flashing Green LED Keeps flashing Are characteristics of Detectivie remote controller PCB
46. splay Code No 28 or 29 NO Replacement low pressure or high pressure sensor YES Is the refrigerant level appropriate Change of outdoor NO Is there any abnormality in the unit PCB refrigeration circuit Did it return to normal Display conditions If the voltage detected by the sensor is OV or lower or 3 49 V or higher continuously for 5 seconds between 2 minutes and 2 minutes 20 seconds after the compressor goes ON the compressor stops After a 3 minute delay the compressor restarts If this condition is detected 3 times within 40 minutes 34 Abnormalities in compressor starting Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Notes 1 Check if the power supply system is normal 2 Single flashing of outdoor unit LED indicates abnormalities in compressor CM1 starting and double flashing indicates abnormalities in compressor CM2 starting Check of power transistor module Reference to 345 Check the compressor s insulation resistance and winding resistance NO NO NG OK 1 Check the refrigerant level Replacement Try operating starting Did it improve Is the balance pressure proper during starting Is the power supply voltage correct proper YES OK YES NG Replacement power transistor module NO Replacement compressor
47. stor module procedure E CN terminals 1 Disconnect the compressor wiring then check for short circuits using a tester YES P U P V P W N U N V N W Check between the P and N terminals It is easy to make tester contact with the following locations on each of the terminals P Red harness side of the power transistor module terminal block N Blue harness side of the power transistor module terminal block NO U End of red harness to the compressor There is a difference of 10 V End of white harness to the compressor or greater in the current W End of blue harness to the compressor between phases except YES during acceleration and deceleration Normal Replacement power transistor module d How to advance checks for each faulty symptom Is the compressor current inter phase balance good i Inspection method when there is no error display 1 Louver motor does not operate gt Inspect at the indoor unit side Does the louver operate at power on Operate more than min later YES Is the louver operated with the remote controller NO Is LM wire broken NO NO _ Defective indoor unit PCB YES YES YES Normal Only case of FDTQ FDTS Note 1 LM Louver motor LS Limit switch It is normal Turn off and back on again if it stops with the power and check the 2 pushes on LS motion of LS Does the louver link push the LS till A
48. t and slave units Keeps flashing Stays OFF Keeps flashing 1 time flash Emergency stop of indoor unit Remote controller Cause error code Unmatched indoor outdoor connection Duplication outdoor unit address No Outdoor unit address setting error L3 phase wiring is open phase or reversal phose Discharge temperature Tho D1 abnormality 3 Display sequence of error inspection display lamp a One kind error Display corresponding to the error is shown b More than one errors Section Error code of remote controller Inspection LED red of indoor unit PCB Inspection LED red of outdoor unit PCB c Timing of error detection e Indoor unit side Error detail Transmission error of remote controller indoor unit CPU is out of control Transmission error between indoor outdoor units Broken wire of heat exchanger thermistor Broken wire of indoor unit return air thermistor Drain error float switch motion e Outdoor unit side Error detail Discharge temperature abnormality Broken wire of heat exchanger thermister Broken wire of outdoor temperature thermistor Broken wire of discharge thermistor High pressure cut Power transistor overheat Current cut Excessive number of indoor and outdoor units Transmission error between inverter and outdoor unit PCB Broken wire of low pressures sensor Broken wire of high pressures sensor
49. ter printed circuit board can replaced with following procedure Confirm the parts numbers Refer to the following parts layout drawing for the location of parts number PartsNo PatsNo Mod PJA505A137ZG FDTA28 90 PJA505A138ZC FDOM FDUM FDTW FDR FDFL FDFU FDUR PJA505A137ZF FDTA112 140 PJA505A138ZD PJA505A139ZH FDE PHA505A022ZB FDKA22 56_ Model select switch SWO 71 Switch iii Check method when the error code is displayed Remote controller or Indication board Inspection LED error code Indoor unit PCB Red LED inspcetion display Green LED CPU normal display Outdoor unit PCB Red LED inspcetion display Green LED CPU normal display iv Check procedure depending on indication lamps For the indoor unit The next page error diagnosis is applicable to cases where only 1 unit is installed in a network unless stated otherwise but the check method is same even if there are multiple units on the network Except the network occupation state due to out of control indoor unit CPU the error display indicates the state of respective units Check each unit specified by the error display as explained on next page 11 Polarity determination trouble Indoor unit Stays OFF Keeps flashing When the LCD display Center Remote temperature display etc of remote controller flashes it means the polarity on the Outdoor unit Red LED Stays OFF
50. ter the compressor goes ON the compressor stops After a 3 minute delay the compressor restarts If this condition is detected 3 times within 40 minutes 0 0 50 0 50 Temperature T C 96 Defective discharge pipe thermistor Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing of outdoor unit LED indicates Tho D1 and double flashing indicates Tho D2 Is the discharge pipe thermistor connector connection OK Are the discharge Defective outdoor unit PCB pipe thermistor characteristics Replacement Defective dis OK is there no charge pipe thermistor input broken wire circuit Temperature resistance characteristics of discharge NO NO pipe thermistor Tho D1 2 Repai Defective discharge pipe peus thermistor Replacement Display conditions If the temperature sensed by the thermistor is 3 C or lower con tinuously for 5 seconds between 10 minutes and 10 minutes 20 seconds after the compressor goes ON the compressor stops Af ter a 3 minute delay the compressor restarts If this state is de tected 3 times in 40 minutes 0 20 50 80 100 120 Temperature T C Thermistor resistance KK2 T x 80 C Thermistor resistance K 2 T 80 C 63H1 1 2 motion Indoor unit Outdoor unit Red LED Stays OFF
51. tion Stays OFF The remote controller wires are connected to A and B on the terminal block The indoor outdoor signal wire are connected in loop form The indoor unit micro Stays OFF computer runs away Stay OFF or Lights Stay OFF or Lights Keeps flashing Stays OFF Indoor unit PCB fault continuously continuously Keeps flashing Keeps flashing Keeps flashing Keeps flashing Keeps flashing Stays OFF Keeps flashing Keeps flashing Keeps flashing Irregular illumination E Keeps flashing Keeps flashing Remote control wire breakage signal For wire breaking at power ON the LED is OFF Stays OFF No duplication at indoor unit addressing More than 49 indoor unit are connected Stays OFF Outdoor unit power supply OFF detected only during operation Stays OFF Stays OFF The corresponding outdoor unit address No is not found Detected only during operation Stays OFF or Lights continuously Stays OFF Indoor outdoor transmission error Wire A and B swapping after power ON Outdoor power unit failure when the indoor power supply is different from the stays OFF outdoor one plays ER or Lights Outdoor unit microcomputer failure continuously Stays OFF Indoor unit heat exchanger thermistor failure Stays OFF Indoor unit return air thermistor failure Stays OFF The float SW operates with FS only Drain up kit wiring fault When multi unit control by remote controller is performed the number of units
52. tion space proper YES Does the outdoor unit fan rotate NO Replace either the Correction power transistor thermistor characteristics OK is there any broken wire YES NO Replacement power transistor thermistor Is the power transistor thermistor connector OK YES Inverter cooling fan is running NO It connects Replace cooling fan Is fastening of the power transistor to the heat dissipation fins OK Fastening screws Apply heat dissipation silicone YES nis Fastened correctly NO Does not recur YES Display conditions If the power transistor s temperature exceeds the set value the compressor stops When the temperature drops to 90 C or lower the compres sor restarts but if this occurs 5 times within 1 hour or if this condition continues uninterrupted for 1 hour Abnormal temperature detection Temperature resistance characteristics of power transistor thermistor Tho P 10 Compressor stop Thermistor resistance kQ2 T x 80 C N a Re starting 90 110 0 20 50 60 100 120 Power transistor temp C Temperature T C 78 Thermistor resistance K 2 T 80 C Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash D Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing of outdoor unit LED indicates cur
53. top the compressor stops If it drops to 90 C or lower the compressor restarts but if this operation Operable occurs 2 times within 60 minutes 90 C 130 C Discharge pipe temp Temperature resistance characteristics of discharge pipe thermistor ThO D1 2 100 10 Ts 80 C 50 5 Thermistor resistance kQ2 T lt 80 C Thermistor resistance kQ2 T 80 C 0 20 50 80 100 120 Temperature T C 3245 Error display E 3 7 Defective outdoor unit heat exchanger and sub cooling coil thermistor 7 segment display eo Nyy MM Indoor unit Outdoor unit LN Red LED Stays OFF Red LED time flash Green LED Keeps flashing Green LED Keeps flashing Note 1 Tho R1 flashes 1 time Tho R2 flashes 2 times Tho R3 flashes 3 times Tho R4 flashes 4 times Tho SC flashes 5 times Tho H flashes 6 times hay j I Ux af fr Pr Pr Pr Pi Pe U t tU ttn 1g g jme Mg gt pem T Are the outdoor unit heat exchanger and sub cooling coil themistor characteristics OK is there any broken wire Is the outdoor unit heat exchanger and sub cooling coil themistor connector Defective outdoor unit PCB Replacement Defective outdoor unit heat exchanger and sub cooling coil themistor input circuit Outdoor unit heat exchanger themistor Tho R1 R4 sub cooling coil Tho SC H
54. utdoor unit control PCB CM1 Keeps flashing Stays OFF Keeps flashing 2 time flash E45 2 Transmission error between inverter and outdoor unit control PCB CM2 Keeps flashing Stays OFF Keeps flashing Stays OFF Fo Automatic address setting and remote controller address setting coexists in the same network f 1 time flash E48 1 Abnormalities in an outdoor fan motor FMOI Keeps flashing Stays OFF Keeps flashing 2 time flash E48 2 Abnormalities in an outdoor fan motor FM02 Keeps flashing Stays OFF Keeps flashing 1 time flash Low pressure error PSL time flash E51 1 Power transistor overheating CM1 15 minute continuation Keeps flashing Stays OFF Keeps flashing 2 time flash E51 2 Power transistor overheating CM2 15 minute continuation Keeps flashing Stays OFF Keeps flashing time flash Suction pipe temperature thermistor Tho S failure time flash E54 1 Low pressure sensor PSL disconnection output error Keeps flashing Stays OFF Keeps flashing f 2 time flash E54 2 High pressure sensor PSH disconnection output error 1 time flash E59 1 Compressor startup error CM1 Keeps flashing Stays OFF Keeps flashing 2 time flash E59 2 Compressor startup error CM2 1 time flash E60 1 Compressor loader position detection error CM1 Keeps flashing Stays OFF Keeps flashing 2 time flash E60 2 Compressor loader position detection error CM2 Keeps flashing Stays OFF Keeps flashing 1 time flash Communication error between outdoor unit master uni
55. w volume operation mode and operation message Operation Check indicator light During operation Lit in green In case of error Flashing in red Operation Stop switch This switch is used to operate and stop the air conditioning system Press the switch once to operate the system and press it once again to stop the system MODE switch This switch is used to switch between operation modes FAN SPEED switch This switch is used to set the airflow volume VENT switch Switch that operates the connected ventilator LOUVER switch This switch is used to operate stop the swing louver SET switch This switch is used to apply the timer operation setting This switch is also used to make silent mode operation settings RESET switch Press this switch while making settings to go back to the previous operation This switch is also used to reset the FILTER CLEANING message display Press this switch after cleaning the air filter e Check abnormal operation data with the remote controller Operation data are recorded when there is an abnormal state and these data can be displayed in the remote controller by operating the remote controller buttons 1 Press the CHECK button The display will change from t FUNCTION 5 o d SET OPERATION DATA W 2 Press the Y button once The display will change to ERROR DATA A 3 Press the SET button to enter the abnormal operation data display mode 4 Ifthere are abnorm
56. y Check For Damage Replace if Damaged Condensate 6 Months Check connections mountings Tighten as necessary Drain system Check for blockage and dirt Clean as necessary Check Pump and Float Switch Pump clears drain tray Replace if necessary gives alarm Replace if necessar Coil and refrig 12 Months Check operation Unit produces Cooling Investigate and fix any faults system Heating on demand Check of contamination Clean as necessar Measure Winding Res Insulation 1MOhm If less replace Measure Winding Res Insulation 1MOhm If less replace Coil and refrig 12 Months Check operation Unit produces Cooling Investigate and fix any faults system Heating on demand Check of contamination Clean as necessar Electrical Check tightness of terminals EE system e e issue 04 03 02 MITSUBISHI HEAVY INDUSTRIES LTD AIR CONDITIONING MAINTENANCE CHECK LIST Clients Name cccccccceccccccccccucccccauccecunuceeenuueeetnueeeenas Sheet No tick each box if applicable Unit A Unit B Unit C Unit D Unit E Unit F Unit G Unit H a ere ModelNo T Jj S a I Note if fault code displayed E Note if fault code displayed E Last recorded fault will be shown nvestigate if fault remedied and reset display Run system in each mode to check operation ystem left fully operational ENONCIAR ee tenner rn Date n aaan Clients Signature
57. y for FMOI 2 again within 1 hour or once within 45 minutes of the power being turned ON an abnormal stop occurs 3 Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash Green LED Keeps flashing Green LED Keeps flashing Is the connection of the low pressure sensor connector OK YES Does the pressure actual measurement match with the value in the en display Code No 29 NO Replacement low pressure sensor YES Is the refrigerant level appropriate Change of outdoor NO Is there any abnormality unit PCB Did it return to normal in the refrigeration circuit e Display conditions f the low pressure sensed by the low pressure sensor is 0 134 MPa or Abnormal pressure detection lower the compressor stops After a 3 minute delay the compressor CM operation restarts If this occurs 2 times within 60 minutes If the pressure sensed by the low pressure sensor while the compressor is CM stop stopped is 0 18 MPa or lower If this occurs 5 times within 60 minutes ae 0 18 Note 1 It recovers only if there is a power supply reset Low pressure MPa 3 Power transistor overheating 15 minute continuation Conbination unit only Indoor unit Outdoor unit Red LED Stays OFF Red LED 1 time flash D Green LED Keeps flashing Green LED Keeps flashing Note 1 Single flashing of outdoor unit LED indicates power transistor CM1 overheat a

SERVICE MANUAL - 3D Air Sales Ltd

Contents

Download Pdf Manuals

Related Search

Related Contents