Home

Memorias 2009

image

Contents

1. cues TONE iin id ihoon perla vacet m Iha works WA fa 4 wie I TEL M ux j Cope ar th LS Yaa alae if Al ugs 150358 st up wi ile Ao ES Th ted if qui an d vaccin that works by ani kaula be THAD he plc pericos oe die 1 Mii lit iini ind 54 anathor surface thar halra TM Vines dul re HITUNG ihar namas lar campis seque neces el 1 mil AA exa u les fa Why seakan fle tran bah i jay Belle sae ach js iilis 8 porn thy Ar ng dal 5e tan Wetah apolt uncias Flu vac aramid weh at 2 i HE iio praka n de amete a oe SSS Jakat paper m m Die vaccine Akasa he td 1 d pitelee bey 20000 uml UN seid dl do gen a puraken te well E violy phi ff Dowd af al Dee for all Line fn d Ti a adn A E i 1 prem called fma aa ken cheers crear memeri al iiir mbentak tdl brefs fri anie Ir ae appealing
2. k r 1 y r g T d j 1 1 Y L P 1 1 F x Y NM Poy 1 J s L L 1 1 1 L s n xu EJ Wan TH _ Experiment 1 consisting of 5 dietary protein levels with eight replicates Each replicate contained 25 chicks for a total of 1000 chicks 20 21 22 23 and 24 protein ME 3200 Kcal Kg On day of natch all chicks were individually weighed wing handed and vaccinated with Coccivac B by oral gavage Once vaccinated chicks were randomly assigned to treatment groups using chick weight 1 Schering Plough Animal Health Corp Millsboro DE Protein Level Means with no common superscript differ significantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 209 Feed Conversion Day 1 21 9 T la T gt z 0 Q D 0 0 h 21 22 23 Protein Level Means with no common superscript differ significantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 210 Trial 1 In vaccinated chicks body weight gain and feed conversion was directly related to Increasing dietary protein levels Broilers fea 20 22 and 24 protein diets significantly differ in body weight and feed conversion values These three proteins levels were chosen for use In subsequent experiments prollers Vaccinated nallenge 2 reunion AECACEM Quer taro 2009 P g
3. 9 gt y 0 i 0 e 0 n Starter Grower Finisher Withdrawal Main Effect Means with different superscript differ stentficantly P lt 0 05 Cumulative Feed Conversion Day14 0 298 Day40 08 50 Main Effect Means with different superscript differ stenificantly P lt 0 05 Summary Body Weight Coccivac B broilers fed Diet B had the heaviest ending body weights and were significantly heavier at day 14 compared to Coccivac B brollers fed diet A Both Blo Cox groups Were similar to both groups of Coccivac B brollers at Day 14 There were no differences in body weight at day 90 with respect to coccidial control measure or dietary regimen No significant differences Were observed In mortality data not shown reunion AECACEM Quer taro 2009 P g 237 Summary Feed Conversion Diet A yielded a significantly higher cumulative mortality corrected feed conversion ratio compared to diet B Cumulative mortality corrected feed conversion was similar for Bio Cox and broilers Feed conversion was significantly increased In Coccivac B broilers versus Blo Cox during the starter and grower periods and significantly lower during the withdrawal period Replacement of medication with the vaccination program had no significant effects on cost kg of live weight reunion AECACEM Quer taro 2009 P g 238 Increasing dietary starter protein levels Improves broller perform
4. taki PATANG APT Ae E HA Vo ri kh the fei i iif Tins Ts E i ihai nand a parkir MH suche thy HS M vaca mu peg ditis from fu tha Eb foit aba pre agua dn drama mum n peels Eom patorg mak le wn Tal bye eee Horti e v coni whether ang af Be bead i will Ed tuy 11610 1 and ft vere lant they canal el kel 312 SOENCE Air i Hair thil 1111 C mur Ces E sn tan aki verdes na d sue Lind Th M2 si took y Er pam correos trien the vinis ahh E HA Hemagglutinin Sia A oP ay ME NA PI WAAAAAAAA MR INAAAAARA El cience April 2006 2 reunion AECACEM Quer taro 2009 P g 180 M2e A Conserved Influenza Antigen Human Influenza A strains consensus Mze sequence SLLTEVET PIRNEWGCRONDOo L A Brevig Mission 1 1919 HINI SLLTEVET PTRNEWGCRCNDSS A Puerto Rico 8 1934 HINI SLLTEVET PIRNEWGCRCNGSS A Chile 13 1957 H2N2 SLLTEVET PIRNEWGCRCNDSS A Japan 110 1302 HAN SLLTEVET PIRSEWGCRCNDSS D A An Arbor 1 H2N2 SLLTEVET PIRNEWGCRCNDSS A A1ch1 2 09 H3NZ SLLTEVET PIRNEWGCRCNDSS D A Englana 8 18 1909 H3N2 SLLTEVET PIRNEWGCRCNDSS A Caracas 27 H3N2 SLLTEVET PIRXBEWGCRCNDSS A Taiwan 3 11 H3N2 SFLTEVET PIRNEWGCRCNDSS A A1ch1 09 es
5. Departamento de Producci n Animal Aves DPA Aves FMVZ UNAM Av Universidad 3000 Ciudad Universitaria 04510 M xico D F Centro de Ense anza Investigaci n y Extensionismo en Producci n Av cola CEIEPAv FMVZ UNAM xochitl h yahoo com RESUMEN Se emple un dise o completamente al azar con dos tratamientos A Dieta sin coccidiostato y B Dieta con el programa permanente cada uno con 4 repeticiones de 30 pollos por corral Durante los 49 d as que dur la prueba cada semana se registraron los par metros productivos mientras que la pigmentaci n cut nea y el n mero de ooquistes por gramo de heces opgh fueron evaluados a partir del d a 21 y a esta misma edad cada ave fue inoculada por v a oral con 60 400 ooquistes esporulados de Eimeria spp Las variables productivas fueron evaluadas mediante un an lisis de observaciones repetidas y la prueba de T de Student Los resultados promedio obtenidos a los 49 dias de edad no mostraron diferencia significativa P gt 0 05 en la ganancia de peso A 2904g B 2963g consumo de alimento A 6228g B 6033g conversi n alimenticia A 2 14 kg B 2 04kg entre ambos tratamientos En las aves sin coccidiostato la pigmentaci n cut nea fue menor en el grupo A P 0 05 A 11 23 B 15 4 y se eliminaron una mayor P 0 05 cantidad de opgh con respecto al tratamiento B Esto sugiere que el uso continuo del programa anticoccidial administrado en esta prueba mostr resultados fav
6. Wendt Martin J Crowley JM Edwards SJ McKenzie AW Mitchell SV Maher DW Pearse MJ Basser RL Phase 1 study of HPV16 specific immunotherapy with E6E7 fusion protein and ISCOMATRIX adjuvant in women with cervical intraepithelial neoplasia vaccine 2004 23 172 181 Bavari S Bosio CM Wiegand E Ruthel Will AB Geisbert TW Hevey M Schmaljohn C Schmaljohn A Aman MJ Lipid raft microdomains a gateway for compartmentalized trafficking of Ebola and Marburg viruses J Exp Med 2002 593 602 Saifuddin M Hedayati T Atkinson JP Holguin MH Parker CJ Spear GT Human immunodeficiency virus type 1 incorporates both glycosyl phosphatidylinositol anchored CD55 and CD59 and integral membrane CD46 at levels that protect from complement mediated destruction J Gen Virol 1997 78 1907 1911 Storni Ruedl Schwarz Schwendener RA Renner WA Bachmann MF Nonmethylated CG motifs packaged into virus like particles induce protective cytotoxic T cell responses in the absence of systemic side effects J Immunol 2004 172 1777 1785 2 reunion AECACEM Quer taro 2009 P g 137 45 46 47 48 49 50 51 Chu RS McCool Greenspan NS Schreiber JR Harding CV CpG Oligodeoxynucleotides Act as Adjuvants for Pneumococcal Polysaccharide Protein Conjugate Vaccines and Enhance Antipolysaccharide Immunoglobulin G2a IgG2a and IgG3 Antibodies Infection and immunity 2000 68 3 1450 1456 Vajdy M Lycke N Stimulation
7. poultry Vet Rec 97 406 408 Brundtland GH 2000 Nutrition and infection malnutrition and mortality in public health Nutrition Reviews 58 2 S1 4 discussion S63 73 Byrd J B Hargis D Caldwell R Bailey K Herron J McReynolds R Brewers R Anderson K Bischoff T Callaway and L Kubena 2001 Effect of Lactic Acid Administration in the Drinking Water During Preslaughter Feed Withdrawl on Salmonella and Campylobacter Contamination of Broilers Poultry Sci 80 278 283 Caldwell D Y R W Moore D J Caldwell and B M Hargis 2001 Effect of photointensity sound intensity and ambient temperature on preening behavior and ingestion of spray applied biologics J Appl Poult Res 10 99 106 Caldwell D Y S D Young D J Caldwell and B M Hargis 2001 Effect of selected photointensity regimes on chick preening behavior and competitive exclusion culture efficacy J Appl Poult Res 10 107 111 2 reunion AECACEM Quer taro 2009 P g 19 Caldwell D Y S D Young D J Caldwell R W Moore and B M Hargis 2001 Interaction of Color and Photointensity on Preening Behavior and Ingestion of Spray Applied Biologics J Appl Poult Res 10 112 116 CDC Preliminary FoodNet Data on the Incidence of Foodborne Illness Selected Sites United States 2001 MMWR 2002 25 329 CDC 2002 National Antimicrobial Resistance Monitoring System 2002 Annual Report http www cdc gov narms annual Chaveerach
8. Baba E S Hagaishi T Pukata and A Arakawa 1991 The Role of Intestinal Microflora on the Prevention of Salmonella Colonization Gnotobiotic Chickens Poultry Sci 70 1902 1907 Bailey J L Blankenship N Stern N Cox and F McHan 1987 Effect of Anticoccidial and Antimicrobial Feed Additives on Prevention of Salmonella Colonization of Chicks Treated with Anaerobic Cultures of Chicken Feces Avian Diseases 32 324 329 Barbara G V Stanghellini C Berti Ceroni DeGiorgio Salvioli F Corradi Cremon and R Corinaldesi 2000 Role of Antibiotic Therapy on Long Term Germ Excretion in Feces and Digestive Symptoms after Salmonella infection Aliment Pharmacol Ther 14 1127 1131 Barnhart ET LL Sarlin DJ Caldwell JA Byrd DE Corrier and BM Hargis 1999 Evaluation of potential disinfectants for preslaughter broiler crop decontamination Poultry Science 78 1 32 7 Bean N H and P M Griffin 1990 Food borne disease outbreaks 1n the United States 1973 1987 Pathogens and trends J Food Prot 53 804 Bedford M R 2000 Exogenous enzymes in monogastric nutrition their current value and future benefits Anim Feed Sci Technol 86 1 13 Blankenship L J Bailey N Cox N Stern R Brewer and O Williams 1993 Two Step Mucosal Competitive Exclusion Flora Treatment to Diminish Salmonella Commercial Broiler Chickens Poultry Science 72 1667 1672 Borland 1975 Salmonella infection
9. Fungi Virus Best pH Activity Common Bacteria Bacteria For in Activity Organic Material Chlorhexidene Some Some Some Most Wide Good Equipment Activity Activity Activity Range Premises Footbath Formaldehydes epus se Wide Good Equipment and aldehydes Range Premises Footbath Chloramines Activity Poor Equipment Activity Poor Equipment Hydroxide Ameis ety aati Activity Activity Equipment Phenols Some Some Acid Good Equipment Activity Activity Premises Footbath Potassium Acid Good Equipment peroxymonosulfate Premises Footbath Table 2 General facts about disinfectants Becker PIH80 Wolfgang Pest control 16 vital to a good biosecurity program as both rodents and insects have been known to serve as vectors of avian disease In addition these pests are capable of causing extensive structural damage to a facility Farms with large rodent populations have even been known to have noticeably higher feed conversion due to loss of feed to rodents Carpenter 2000 Pest populations can often be managed with the use of rodenticides and insecticides Rodenticide bait placed into in simple PVC enclosures and placed at regular intervals in and around poultry houses can often help control the rodent populations Rodenticide products should be rotated as rodents often learn to avoid baits that are used for long periods of time Resistance to certain rodenticide poisons may 2 reunion
10. Live Qocyst Vaccination reunion AECACEM Quer taro 2009 P g 204 Nutritional or Dietary Variability During Live Qocyst Vaccination Nutritional programs varied in the previously cited Iterature Dietary composition not described NRC formulation Diets formulated for anticoccidial usage used for vaccination decrease In performance Is due to impaired protein digestibility during periods of clinical coccidiosis Turk 1972 Previous research has indicated that varying protein levels can influence performance during clinical coccidial Infection Sharma et al 1973 reunion AECACEM Quer taro 2009 P g 205 Control fo Control Measure Measure A i n Dietary Anticoccidial Feed Conversion Weight Gain 2 reunion AECACEM Quer taro 2009 P g 206 Since extreme dietary variability exists In reports where live oocyst vaccination has been compared to anticoccidial drug usage particularly In studies where vaccination has failed we hypothesize that such failures are in part due to attempting to vaccinate against coccidiosis using a nutritional and management platform designed for anticoccidial drug usage Experimental Objective investigate the Influence of dietary protein level and other micro Ingredients on coccidiosis vaccine efficacy 2 reunion AECACEM Quer taro 2009 P g 207 al 4 al P 5 waar S F 1 t 4 1
11. bia is tit Marrano cde ibat rayo up db sedo nim ii par r learn an eren vary Hem n Pi amm in d har oum tack tp ihe LU shared on he fe teft li hie hen aru i 16410 dl Uri nn 1 Mel pure n that ct had rodacad i in paek wilh a vaccine toe of Mae feo o ardet prote Ue core of The hipatii B virg dh These prati anas kip para k uT Metal excl more bli io Ze ie cb ca proto hol Hn m Freia Lab uri cil aberat iif he cese ceras gi B E Masang bau his imperd you m diserap comes rd de sihe Hep eiue delivering 1 mpra i Watra Tal yir an trad ak Le boh y repe Allah M3e coena there s a reall chance bart hie be rete To aaas presp Wan Inia la Phat Verna kanti pahan tey e i wid we ah renta wy bat oam fl trial giving hence POURS SQUE 01 Mik lisl ir in apes Mii miae alter 1 veck bui there b bu pei kawa Chae odd bee Cu acces sabes css roe verdi Tih wi har 5 NYATANE 2 ala hank ti Tis aloud do rule in 8
12. edici n 1998 M xico D F pp 722 725 Pascual T Semiolog a Homeop tica En Curso de homeopat a Miraguano Ed Madrid Espa a 1989 pp 15 70 2 reunion AECACEM Quer taro 2009 P g 155 Zs Philips Rauimonde M Sim n Diagnostico y Control de la Micoplasmosis en Pollos de Engorda Tecnolog a Avipecuaria en Latinoam rica A o 6 No 68 septiembre 1993 pp 35 46 Poitevin Bernard Introducci n a la Homeopat a Edici n Distribuida por Propulsora de Homeopat a SA NEMHM M xico 1992 ISBN 968 6774 089 4 pp 11 30 Rojo M E Enfermedades de las aves Edit Trillas 2 Reimpresi n M xico D F 1996 pp20 22 S nchez Bautista Norma Guadalupe Efecto de la Terap utica Homeop tica Aplicada a Vacas Holstein con Mastitis del Rancho Sangre de Cristo de la Ciudad de Oaxaca Oax Tesis Profesional Escuela de Medicina Veterinaria y Zootecnia Oax 1997 Sela T F Terap utica Homeop tica Pr ctica F Olmedo M xico DF 1988 pp 13 120 Silva Cabrera Enedina Homeopat a Veterinaria Ed Propulsora de homeopat a S A de C V Mirto 26 Col Santa Mar a la Ribera Delegaci n Cuauhtemoc M xico DF Tel 0155 55 47 9483 ISBN en tramite Valdivieso G A Infecci n por Micoplasma sinovea Avirama A o 8 Vol XII no 89 junio 1990 Departamento de Bacteriolog a FMVZ UNAM M xico 04510 DR V zquez Mart nez Ra l Tratamiento y Control de la Enfermedad Cr nica Respiratoria Estudio d
13. gt 0 05 A la semana 3 y 4 no se observ diferencia entre los tratamientos en pigmentaci n cut nea y a partir de la quinta semana las aves sin coccidiostato tuvieron menor pigmentaci n cut nea 6 62 con respecto aquellas que si recibieron el coccidiostato de uso permanente 9 83 P 0 05 Cuadro 1 Esta diferencia se mantuvo constante hasta las s ptima a pesar de que los animales sin coccidiostato consumieron mas pigmento 4064 mg con respecto a los animales que tuvieron el coccidiostato 3933mg En lo que respecta al conteo de ooquistes por gramo de heces se observo que las aves que ten an el programa anticoccidiano continuo mostraron menor cantidad de ooquistes por gramo de heces semanales P 0 05 esto refleja un menor dafio tisular al intestino y por ende una mayor pigmentaci n en este grupo Tambi n se observa que a la s ptima semana los conteos de ooquistes por gramo de heces fueron muy similares esto puede ser debido a que las aves que no ten an coccidiostato mostraron una inmunidad a las coccidias Cuadro 2 La severidad de las lesiones macrosc picas intestinales se mantuvieron sin diferencia entre ambos grupo y en un grado y se presentaron solo en algunas aves solo un ave del tratamiento sin coccidiostato mostr lesiones mas severas 2 DISCUSI N Y CONCLUSIONES No se observ una diferencia importante en las variables productivas entre los dos grupos es decir el beneficio de manejar un programa ant
14. 1992 Demonstration of the genetic stability of a Mycoplasma gallisepticum strain following in vivo passage Avian Diseases 36 554 560 Evans R D and Hafez Y S 1992 Evaluation of a Mycoplasma gallisepticum strain exhibiting reduced virulence for prevention and control of poultry mycoplasmosis Avian Diseases 36 197 201 Frey M L Hanson R P and Anderson D P 1968 A medium for the isolation of avian mycoplasmas American Journal Veterinary Research 29 2063 2171 Froyman R 1996 Antimicrobial Medication in Domestic Poultry In Jordan F T W and Pattison M eds Poultry Disease 4 The University Press Cambridge p 484 494 Ghazikhanian G Y Yamamoto R McCapes R H Dungan W M and Ortmayer H B 1980 Combination dip and injection of turkey eggs with antibiotics to eliminate Mycoplasma meleagridis infection from a primary breeding stock Avian Diseases 24 57 70 Hafez 1997 Krankheitsbekampfung und vorbeuge In Hafez and S Jodas ed Putenkrankheiten Ferdinand Enke Verlag Stuttgart ISBN 3 432291612 pp 16 31 Hafez H M Jodas S Popp C Lierz M and Korbel R 2006 Mycoplasma synoviae field infections in turkey breeder flock diagnostic tracing in siblings Tier rztliche Praxis Ausgabe Groftiere Nutztiere 34 259 262 Hall C F Flowers A I and Grumbles L C 1963 Dipping of hatching eggs for control of Mycoplasma gallisepticum Avian Diseases 7 178 183 H
15. 33 4 393 404 Carey JB Prochaska JF Jeffrey J Poultry facility biosecurity Texas Agricultural Extension Service Texas A amp M University L 5182 Carpenter GH 2000 Poultry Grower News Letter North Carolin Extension Summer Fall 2000 Fairchild BD 2006 Biofilms in poultry drinking systems Broiler Tip University of Georgia Cooperative Extension Service Finely R Ribble C Aramini J Vandermeer M Popa M Litman M Reid Smith R 2007 The risk of salmonellae shedding by dogs fed Salmonella contaminate commercial raw food diets Canadian Veterninary Journal 48 69 75 Gifford GH Shane SM Hugh Jones M Weigler BJ 1987 Evaluation of biosecurity in broiler breeders Avian Diseases 31 2 339 344 Helm JD 2004 Common diseases of chickens turkeys and gamebirds Clemson University Livestock Poultry Health Jeffrey JS 1997 Biosecurity for poultry flocks University of California Poultry Fact Sheet No 26 Jones FT 2002 Economic consequences of a major poultry disease break Avian Advice 4 4 2 University of Arkansas Cooperative Extension Service Kunze DJ Loneragan GH Platt TM Miller MF Besser TE Koohmaraie M Stephens T Brashears MM 2008 Salmonella enterica burden harvest ready cattle populations from the southern high plains of the United States Applied and Environmental Microbiology 74 2 345 351 Luttrell MP Stallknecht DE Kleven SH Kavanaugh DM Corn JL Fischer JR 2001 Mycoplasma gallisepti
16. Asociaci n de Especialistas en Ciencias Avicolas del Centro de M xico A C MEMORIAS DE LA SEGUNDA REUNION ANUAL DE LA ASOCIACI N DE ESPECIALISTAS EN CIENCIAS AV COLAS DEL CENTRO DE M XICO AC Juriquilla Quer taro 27 al 29 de febrero de 2009 ijs PE PAEK 2 reunion AECACEM Quer taro 2009 P g 1 MESA DIRECTIVA ALBERTO GARCIA MEADE PRESIDENTE JOSE QUESADA FOX VICEPRESIDENTE RICARDO CARRILLO BARCENAS TESORERO EMILIO PARDO CASTANEDA SECRETARIO JESUS ORTEGA WRIGHT MEMBRECIAS FRANCISCO AYALA CASTILLO JORGE SANCHEZ ZUNIGA ENRIQUE OSCAR GARCIA VERA GUILLERMO J CARDOSO HUITRON ALBERTO ESPINOZA BECERRIL ABELARDO SANCHEZ ROJAS GENARO ARTURO LAVIN BERISTAIN ARTURO VALLEJO RELACIONES NACIONALES COMISION CIENTIFICA Jorge Sanchez Z iga Jos Quesada Fox Victor Manuel Petrone RELACIONES COMERCIALES Enrique Oscar Garcia Vera Ricardo Salado Carbajal 2 reunion AECACEM Quer taro 2009 P g 2 Asociaci n de Especialistas Ciencias Avicolas dil Cesto de M xico Memorias De La Segunda Reunion Anual De La Asociaci n De Especialistas En Ciencias Av colas Del Centro De M xico AC 26 y 27 de febrero del 2009 Juriquilla Quer taro 2 7 Editor de las memorias eee Victor Manuel Petrone Garcia UNAM CUAUTITL N La reproducci n parcial o total de los trabajos no podr efectuarse sin la previa autorizaci n por escrito del autor y citando estas memorias como referencia La inf
17. Debido a su naturaleza antig nica as como por su tama o el cual en algunos casos se encuentra cercano a 40 nm corresponde a un tama o optimo para la captaci n de ant genos por parte de las c lulas dendr ticas 33 los VLP s son una opci n para la vacunaci n al servir como una plataforma para epitopos de agentes pat genos expresados en su superficie en lugar de solo administrar ectodominios solubles como vacunas el xito de estos como vacunas depender de un completo entendimiento de la tolerancia inmunol gica y una respuesta inmune ante un estimulo 21 26 32 34 37 Actualmente trabajos demuestran que el empleo de VLP s como vacunas tanto en animales como en humanos ya sea por v a oral o inyectada resultan en una respuesta inmune sist mica y o en mucosas 21 31 32 34 40 Otra aplicaci n de los VLP s es su empleo como transporte de mol culas terap uticas como vectores virales empleados como terapia g nica y en vacunas ADN explotando el tropismo natural de estas part culas 26 Dentro de los VLP s expresados en diversos sistemas se encuentran la prote na peque a de envoltura del virus de hepatitis B HBsAg n cleo antig nico del virus de hepatitis B HBCA g prote na mayor de la capside L1 del virus del papiloma humano HPV L1 prote na mayor truncada de la capside hepatitis E HEV HA NA y matriz proteica del virus de influenza N cleo E1 E2 HCV del virus de hepatitis C c pside VP0 1 3 de poliovi
18. Influence of Dietary Protein Level on Broiler Performance during Live Oocyst Coccidial 200 Vaccination David J Caldwell Jason Lee Harry D Danforth Steve Fitz Coy and Charlie Broussard Cardio pulmonary characteristics of pulmonary hypertension in broilers including the 246 impact of aerosolized lipopolysaccharide Gino Lorenzini gt 2 reunion Quer taro 2009 P g 5 CONTROL TOOLS OF SALMONELLA INFECTIONS IN THE U S A A D Wolfenden B M Hargis G Tellez University of Arkansas Fayetteville AR USA Although Salmonella enterica serovars are some of the best studied bacterial pathogens the field still has a long way to go especially when one considers that 1 they cause significant human morbidity and mortality worldwide 11 they have broad host ranges 111 they are able to establish persistent colonization in some species which serve as reservoirs for transmission shedding and 1v they are increasingly resistant to many antibiotics Boyle et al 2007 Poultry producers are challenged to improve production while using fewer antibiotics due to increased restriction on antimicrobial usage Probiotics consisting of live or dead organisms and spores Patterson and Burkholder 2003 non traditional chemicals Moore et al 2006 bacteriophages Higgins et al 2005 organic acids Jarquin et al 2007 Wolfenden et al 2007 and others have emerged in the last decades as some of the tools that could b
19. X2 valor de las medias Sl desviaci n est ndar S2 desviaci n est ndar nl valor de la muestra n2 valor de la muestra M1 y M2 valor comparativo de la muestra Se obtuvieron las medidas de tendencia central de los resultados de producci n obtenidos de los tres lotes de aves DESVIACI N EST NDAR Es til como medida de variaci n en un conjunto de datos F rmula de desviaci n est ndar Y x xe XK S n 1 Donde S desviaci n est ndar X1 valor de la muestra valor de la media n valor de la muestra 2 reunion AECACEM Quer taro 2009 P g 151 Resultado 8 Las aves concretamente el pollo de abasto a trav s de esta prueba se demuestra la INCAPACIDAD DE ESTAS PARA EXPRESAR SIGNOS ESPECIFICOS Y CARACTERISTICOS DEL MEDICAMENTO HOMEOPATICO ADMINISTRADO SIGUIENDO LOS LINEAMIENTOS DE LA EXPERIMENTACION PURA SEGUN OBSERVACION REALIZADA La primera limitacion de la experimentacion pura en la avicultura seria Las aves no son capaces de exponer sintomas La segunda es que no obstante que las aves tienen la posibilidad de expresar signos estos son limitados en su variedad e intensidad la causa de esto es el desarrollo del Sistema Nervioso Central de las aves se encuentra muy distante evolutivamente hablando con el del humano Motivo por el cual al administrar un remedio homeopatico a estos animales no se observaron signos caracteristicos Esto explica el por que las Materias Medicas Homeopatic
20. de ooquiste en la c mara X 100 2 X 2 549 Severidad de las lesiones intestinales Las lesiones intestinales asociadas a la infecciones con Eimeria fueron evaluadas semanalmente a partir de los 14 d as de un pollo por corral de acuerdo a la escala de Johnson y Reid An lisis estad stico Los pesos y el pigmento cut neo fueron sometidos a un an lisis estad stico conforme al dise o experimental empleado y las diferencias entre las medias de los tratamientos se evaluaron con la prueba de observaciones repetidas en el tiempo Los resultados del n mero de ooquistes en heces fueron transformados a arco seno El grado de severidad de las lesiones intestinales se analiz con la prueba no param trica de Kruskall Wallis y se utiliz la prueba U de Mann Witney para determinar las diferencias entre las medianas de los tratamientos Todas las pruebas se evaluaron con una significancia de P lt 0 05 RESULTADOS Se observ que durante las primeras 6 semanas no hubo diferencia en la ganancia de peso entre los animales tratados con coccidiostato y sin coccidiostato P gt 0 05 mientras que en la semana siete existi una tendencia a ganar menor peso los pollos sin coccidiostato 521g con respecto a los 2 reunion AECACEM Quer taro 2009 P g 122 que si se les adicion el coccidiostato 551g P lt 0 05 sin embargo al comparar los dos tratamientos las ganancias de peso durante esta semana fueron similares 415g vs 424g
21. pp 59 66 M R Spinosa T Braccini and E Ricca On the fate of ingested Bacillus spores Res Microbiol 151 2000 pp 361 368 A Christiansson J Bertilsson and B Svensson Bacillus cereus spores in row milk factors 2 reunion AECACEM Quer taro 2009 P g 78 29 26 28 29 30 31 32 33 34 35 36 9 38 39 40 4 42 43 44 45 46 47 affecting the contamination of milk during the grazing period J Diary Sci 82 1999 305 314 Viljoen and von Holy Microbial populations associated with commercial bread production J Basic Microbiol 37 6 1997 pp 439 444 H Rosenkvist and A Hansen Contamination profiles and characterisation of Bacillus species in wheat bread and raw materials for bread production Int J Food Microbiol 26 1995 pp 353 363 P C B Turnbull and J M Kramer Intestinal carriage of Bacillus cereus J Hyg London 95 1985 pp 629 638 P C B Turnbull Anthrax vaccines past Vaccine 9 1991 pp 533 539 P C B Turnbull Current status of immunization against anthrax old vaccines may be here to stay for a while Curr Opin Infect Dis 13 2000 pp 113 120 M Hugh Jones 1996 1997 Global anthrax report J Appl Microbiol 87 1999 p 191 R Adone P Pasquali G La Rosa et al Sequence analysis of the genes encoding for the major virulence factors of Bacillus anthracis vaccine strain Ca
22. 045 050 055 a b Means in rows with different superscripts differ significantly at P lt 0 05 Experiment 2 Objectives The objective of the this design was the development of a dose response curve to selected levels of non phytate phosphorus and the evaluation of three commercially available heat stable phytase enzymes on broiler growth performance and bone ash when fed diets deficient in available phosphorus Materials and Methods The experimental design consisted of a total of 10 dietary treatments which are listed Table 5 Each treatment consisted of six replicate pens containing 50 straight run chicks Broilers were fed the starter until 14 days of age and then switched to a grower diet for the remainder of the experiment at 35 days of age Chicks were reared in floor pens with fresh pine shavings as litter material given age appropriate supplemental heat and given access to feed and water ad libitum 2 reunion AECACEM Quer taro 2009 P g 62 Table 5 Dietary Treatments fed to straight run market broilers which varied in available phosphorus concentration and supplemented with one of three commercially available phytase enzymes Starter Grower n Available P Starter Phytase Available P Grower Phytase 96 FTU kg 4 0225 022 Q0 0475 0 3 035 035 0 o5 0 410751 o375 Ool X 0325 Ool __ O E EN TT 6 PhytaseB 05 180 0 125 1850 8 PhytaseB 01t45 30 0
23. 24 hours of refeeding still resulted somewhat lower p lt 0 05 triglyceride levels compared with full fed but these were not different on day 4 following 48 hours of refeeding Gene Expression Microarray analysis of gene Figure 1 Relative Gene Expression of Pro expression in the hypothalamus opiomelanocortin POMC resulted in a total of 119 genes identified that were differentially expressed by at least 2 fold and significantly different as determined by ANOVA p lt 0 05 Genes that were significantly upregulated by fasting at 48h and were confirmed with qRT PCR were cytochrome p450 506 binding protein 51 coagulation Factor C deiodinase type II neuropeptide Y receptor 5 and somatostatin receptor 5 Genes that were significantly downregulated by fasting at 48 h and BRT PCR O Microarray oo XL WADON ONR 043 0101 01 I D eo 2 reunion AECACEM Quer taro 2009 P g 99 confirmed by qRT PCR include fatty acid binding protein 7 sal like 3 protein kinase iota cytochrome 39a and proopiomelanocortin POMC Figure 1 The list of 119 differentially expressed candidate genes was further analyzed using Pathway Miner http www biorag org pathway php a freely available program designed to detect genes that interact within the same pathway from comprehensive lists of genes The Pathway Miner analysis detected that six o
24. 800000 UN _ 600000 EH 900000 400000 300000 Ld 200000 100000 Eos D ana E E ERE UE UR NE 6 8 10 14 16 18 20 2 4 26 9 31 3 3 3 Y 4 Day of Placement 2 reunion AECACEM Quer taro 2009 P g 242 Diet B E B 000000 100000 600000 _ Q_ _ gt gt __ LL Ileo EPLGGO 400000 300000 200000 100000 Vi y v y ra n ka o y Q VI gt 0 0 0 ld y i 0 6 4 6 8 10 12 14 16 18 20 22 24 26 29 31 33 35 37 39 4 Day of Placement 2 reunion AECACEM Quer taro 2009 P g 243 Acknowledgements Technical Assistance pertaining to vaccination Paul Burke Schering Plough Animal Health Technical assistance with formulation of experimental diets Ur Phil Hargis Hargis and Associates Springdale Arkansas Thank You 77 Department of AN Poultry Science 2 reunion AECACEM Quer taro 2009 P g 24 CARDIO PULMONARY CHARACTERISTICS OF PULMONARY HYPERTENSION IN BROILERS INCLUDING THE IMPACT OF AEROSOLIZED LIPOPOLYSACCHARIDE Gino Lorenzini University of Arkansas Introduction Pulmonary Hypertension PH Pris the sustained Increase In pulmonary arterial pressure Pri develops when elevated PAP Is necessary to propel required cardiac output CQ through a non compliant pulmonary vasculature introduction
25. Consumo Consumo Peso Ganancia Induce de Observaciones ww ioe Diu e o a H8 358 138 3 2 p p ms oue psr mos 31 0 660 763 40 10527 1 62 La se debi a SA dietacion de 12 00 a 17 hrs Respuesta zoot cnica de la parvada de la 4 semana hasta la conclusi n Lote 1 6x Sem Mort Mort Consumo Consumo Peso Ganancia Indice de Observaciones m Te meom Japan comes o 4 13 33 0 888 0 619 0 466 1 9 Aves con bajo peso mM mE 5 4 2 6 14 00 1 272 1 085 0 740 1 6 3 muertas por SA 1 NENNEN rah e p s 1000 109 18 2mursporsA Lote 2 30x Sem Mort Mort Consumo Consumo Peso Ganancia ndice de Observaciones TT INT mene er n oss oaa 0457 19 Jimenaper sa 1 5 14 00 1 086 1 542 0 754 1 6 1 ave triada y 1 por v 140 22 049 Consumo Consumo Peso anancia Indice de Observaciones E kajane aa 0350 049 19 _ 0933 0824 0633 17 1 8 H4 122 14 0741 19 3muraporSA mo 140 2203 0466 26 T por necropsia 2 reunion AECACEM Quer taro 2009 P g 150 Analisis de los resultados zoot cnicos Este se llevo a cabo por medio del an lisis estad stico usando la Distribuci n t FORMULA DE DISTRIBUCION t 18 X2 MI M2 0 1 S1 82 nl n2 Donde tl coeficiente de confiabilidad X1 valor de medias
26. P D Keuzenkamp H Urlings L Lipman and F van Knapen 2002 In Vitro study on the Effect of Organic Acids on Campylobacter jejuni coli Populations in Mixtures of Feed and Water Poutry Sci 81 621 628 Cherrington CA Hinton M Mead GC amp Chopra I 1991 Organic acids chemistry antibacterial activity and practical applications Advances Microbial Physiology 32 87 108 Corrier D A Hollister D Nisbet C Scanlan R Beier and J LeRoach 1993 Competitve Exclusion of Salmonella enteritidis in Leghorn Chicks Comparison of Treatment by Crop Gavage Drinking Water Spray or Lyphilized Alginate Beads Avian Diseases 38 297 303 Davidson P M 2001 Chemical preservatives and natural antimicrobial compounds In Food Microbiology Fundamentals and Frontiers ed M P Doyle L R Beuchat and T J Montville 2nd ed pp 593 627 ASM Press Washington D C Davis B D R Dulbecco H N Eisen H S Ginsberg and W B Wood Editors 1967 Salmonella Pages 756 763 in Microbiology Harper and Row Publishers Inc New York NY Denyer S P Stewart G S A B 1998 Mechanisms of action of disinfectants International Biodeterioration and Biodegradation 41 3 4 pp 261 268 Eklund T 1983 The antimicrobial effect of dissociated and undissociated sorbic acid at different pH levels The Journal of Applied Bacteriology 54 3 383 9 Fernandez A C Lara A Loste S Calvo and M Marca 2001 Control of Salmonella
27. Pulmonary Hypertension PH PH has been extensively studied However there are areas where more research Is needed to consolidate the understanding of PH First chapter Introduction Previous experiments confirmed a genetic component of PH In chickens Anthony et al 2001 Objective To determine key differences In hemodynamics between experimental lines of broilers Pho resistant PHS susceptible Relaxed unselected reunion AECACEM Quer taro 2009 P g 249 Materials and methods Three lines selected by Dr Anthony for gt 12 generations Relaxed Prio ousceptible PHo Resistant A flow probe was positioned on the pulmonary artery gt A catheter was Introduced through the wing veln and advanced to the pulmonary artery gt Pulmonary vascular resistance PVR PAPICO reunion AECACEM Quer taro 2009 P g 250 Results PAP mm Hg Sus susceptible n 12 Res resistant n 12 Rel relaxed n 12 Sus Res Rel PVR 00 BW normalized mL Kg of BW x min 170 170 160 160 150 150 14 140 130 1 Sus Res Rel Sus Res Ral 2 reunion AECACEM Quer taro 2009 P g 251 What Initiates Pulmonary Hypertension BROILER LUNG 4 Hypothesis A PAH Hypothesis B PVH PUpstean Resistance Downstream Resistance L atrio ventricular valve failure cardiomyopathy y 2 reunion AECACEM Quer taro 2009 P g 252 Materials and methods H
28. Rev 59 171 200 Kimura A C V Reddy R Marcus P R Cieslak J C Mohle Boetani H D Kassenborg S D Segler F P Hardnett T Barrett and D L Swerdlow 2004 Chicken consumption is a newly identified risk factor for sporadic Salmonella enterica serotype enteritidis infections in the United States A case control study in foodnet sites Clin Infect Dis 38 5244 5252 Kingsley R A and A J Baumler 2000 Host adaptation and the emergence of infectious disease The Salmonella paradigm Molec Microbiol 36 1006 1014 Kudva I T S Jelacic P I Tarr P Youderian and C J Hovde 1999 Biocontrol of Escherichia coli O157 with O157 specific bacteriophages Appl Environ Microbiol 65 3767 3773 2 reunion AECACEM Quer taro 2009 P g 43 Loc Carrillo C M R J Atterbury A El Shibiny P L Connerton E Dillon A Scott and I F Connerton 2005 Bacteriophage therapy to reduce Campylobacter jejuni colonization of broiler chickens Appl Environ Microbiol 71 6554 6563 McEvoy J M A M Doherty J J Sheridan I S Blair and D A McDowell 2003 The prevalence of Salmonella spp in bovine faecal rumen and carcass samples at a commercial abattoir J Appl Microbiol 94 693 700 Mead P S L Slutsker V Dietz L F McCraig J S Bresee Shapiro M Griffin and R V Tauxe 1999 Food related illness and death the United States Emerg Infect Dis 5 607 625 Naumova E N J
29. el calor fue proporcionado por una criadora tipo campana de gas de capacidad sobrada para las 50 aves y la ventilaci n se llevo a cabo con el manejo seg n el caso de las cortinas Las excepciones al manejo fueron no se administro ning n tipo de aditivo desinfectante o qu mico en el agua de bebida con respecto al alimento se restringi en el horario nocturno ya que nunca se proporciono luz adicional a las aves y a partir de la 3 semana se dieto en el d a con respecto a sanidad no se aplico por ninguna v a vacuna alguna Las variables objeto de observaci n durante la administraci n de la Pulsatilla fueron Presentaci n de signos inherentes la Pulsatilla tos estornudos moqueo traqueobronquitis inquietud friolentas disminuci n en el consumo de agua Cambios en la conducta actitud y comportamiento hura as como ejemplo 17 2 reunion AECACEM Quer taro 2009 P g 148 Modificaci n de los par metros zoot cnicos 14 La observacion de la parvada se realizo 3 veces al dia por el tiempo que duro la prueba verificandose la actitud y el comportamiento de los pollos en prueba contra el grupo control La evaluaci n zoot cnica como es lo usual se llevo a cabo a la conclusi n de la respectiva semana de vida y la informaci n se concentr en el registro ver registros 2 reunion AECACEM Quer taro 2009 P g 149 Resultados La respuesta zoot cnica de la parvada de la 1 a la 3 semana Sem Mort
30. enteritidis Phage Type 4 Experimental Infection by Fosfomycin Newly Hatched Chicks Com Immu Microbiol And Infect Dis 24 207 216 Foegeding P M and T Roberts 1994 Foodborne Pathogens Risks and Consequences Counsil for Agricultural Science and Technology R122 September 87 FoodNet 2005 Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food 10 Sites United States 2004 Morbid Mort Week Rep 54 352 356 Furuse M and H Yokota 1984 Protein and energy utilization in germ free and conventional chicks given diets containing different levels of dietary protein Br J Nutr 51 255 264 2 reunion AECACEM Quer taro 2009 P g 20 Furuse M S I Yang N Niwa and J Okumura 1991 Effect of short chain fatty acids on the performance and the intestinal weight in germ free and conventional chicks Br Poult Sci 32 159 165 Gast RK and JF Stephens 1988 Effects of kanamycin administration to poultry on the proliferation of drug resistant Salmonella Poultry Science 67 5 689 98 Ghosh S M J May and E B Kopp 1998 NF kappa B and Rel proteins evolutionarily conserved mediators of immune responses Ann Rev of Immunol 16 225 260 Goodnough MC and EA Johnson 1991 Control of Salmonella enteritidis infections poultry by polymyxin B and trimethoprim Applied and Environmental Microbiology 57 3 785 8 Hinton A D Corrier G Spates J Nor
31. lulas dendr ticas DC por medio de los receptores Toll like 9 26 44 Los CpG s DNA se encuentran en ADN bacteriano y consisten de un dinucleotido CpG no metilado central flanqueado por dos 5 purinas y dos 3 pirimidinas Estos CpG s DNA han demostrado ser un adyuvante til en combinaci n con ant genos proteicos aumentando una respuesta inmune humoral y celular ante su aplicaci n 45 ya que de manera directa activan linfocitos B LB c lulas NK NK macr fagos y c lulas dendr ticas y aumentan la producci n de citocinas como IFN y interleucina 6 IL 6 IL 12 y factor de necrosis tumoral a 45 Otros adyuvantes orales como toxinas bacterianas pueden ser empleadas ya que se conoce que promueven la generaci n de c lulas inmunes de memoria sist micas y en tejido linfoide asociado a mucosas 31 46 La expresi n de VLP s han sido reportado en diferentes sistemas heter logos procariotes y eucariotes como E coli S thyphimurium S cereviseae S pombe P pastoris S frugiperda 51 9 T ni Hi 5 X laevis y c lulas de mam fero COS 1 CHO HepG2 HeLa BHK y plantas como tabaco tomate papa ma z y lechuga 26 32 Debido a su f cil producci n y costo el empleo de levaduras se ha popularizado para la expresi n de mol culas tiles para la industria a pesar de su limitada capacidad de glucosilacion en el caso de Escherichia coli la falta de glucosilaci n limita su uso en algunos casos Los sistemas de cultiv
32. n as como transformaci n de pl smidos cabe destacar que en la expresi n dentro de cloroplastos no permite la glucosilacion de las prote nas expresadas 30 al igual que en otros sistemas procariotes Uno de los VLP s con los que se han experimentado y tenido xito es HBcAg el cual ha sido probado como VLP s quimera y ha sido utilizada como vacuna oral 34 26 Estos trabajos han demostrado que su empleo es capaz de inducir una respuesta inmune al ser administrado por separado por v a oral e intraperitoneal ante los virus contra los cuales se expresan sus epitopos entre ellos M2e del virus de influenza expresado en HBcAg 21 25 Se reporta la expresi n de HBcAg en plantas 34 con un nivel de expresi n en un rango de 10 a 50 ug g de hoja liofilizada y de 24 ug g a 2 mg g de hoja fresca 26 Diversos experimentos se alan que la posici n en la cual son insertados los epitopos dentro de la secuencia de HBcAg determina la inmunogenicidad del VLP 36 50 La posici n central de los epitopos reduce la respuesta contra el HBcAg y a la vez permite una mejor respuesta a los epitopos for neos insertados en el VLP 50 La fusi n del epitopo al amino terminal del HBcAg a trav s de una secuencia de uni n con HBcAg resulta en una respuesta alta contra el epitopo insertado sin alterar la inmunogenicidad propia del VLP mientras que la fusi n al carboxilo terminal de HBcAg 2 reunion AECACEM Quer taro 2009 P g 133 permi
33. n es comensal encontrando a C jejuni en mayor concentraci n en mucosa de criptas del ciego y en menor grado en intestino delgado 2 3 En humanos la infecci n esta relacionada al consumo de productos av colas contaminados adem s de incluir otros productos de origen animal como leche no pasteurizada y carne de bovinos 4 5 Campylobacter spp Campylobacter jejuni C coli y C lari es microaerofilica y sensible a la exposici n al aire desecaci n pH bajos y al almacenaje prolongado 6 Actualmente la importancia de la infecci n con C jejuni a aumentado debido a la aparici n de cepas resistentes a antibi ticos en pacientes humanos 6 Aunado a que la infecci n en humanos la infecci n con C jejuni se relaciona con enfermedades autoinmunes como el s ndrome Guillian Barr o artropat as 7 8 Campylobacter spp se propaga por ruta fecal oral y coloniza la mucosa de criptas de ciego y mucosa del intestino delgado Dosis menores a 40 unidades formadoras de colonias son capaces de colonizar a un pollito de 1 dia de edad aunque la dosis infectante puede variar seg n la cepa de C jejuni La transmisi n es principalmente horizontal siendo las aves silvestres animales de granja y otros posibles vectores su reservorio 1 Una de las metas actuales es el desarrollo de estrategias contra la infecci n y contaminaci n con C jejuni a trav s de la cadena de producci n de los productos de origen av cola evitando perdidas econ micas
34. necatrix because it develops deep in the sub epithelial tissues Whereas E praecox is less pathogenic and develops primarily above the host cell nucleus and just beneath the brush border of the cells Parasite fecundity plays a role in the pathology and pathogenicity however the species that are highly pathogenic tend to produce a lower number of offsprings primarily due to 2 reunion AECACEM Quer taro 2009 P g 91 the tissue damage loss during the earlier replication stages necatrix 1s unique in that the asexual stages occur in the small intestine and the sexual development occur in the ceca this creates for a lower fecundity rate as compared to say E acervulina in which all the endogenous stages occur in the upper small intestine Laboratory altered strains such as the precocious and attenuated organisms are less pathogenic and also demonstrate less or lowered degree of pathology than their parent or non altered strains This 1s due to the reduction in the number of meront stages Innate host susceptibility plays a role in the pathology and pathogenicity some commercial strains of broilers are more tolerant to coccidia that other strains personal data The parameters that are routinely monitored to determine pathogenicity are growth rate feed utilization and skin pigmentation Factors affecting coccidiosis Several factors may affect the incidence and severity of coccidiosis in floor raised commercial poultry Excess litter
35. 1 25 de AAT DPA fue mayor P 0 05 para las hembras sin embargo al aumentar el AAT disminuy P lt 0 05 para EPA los sexos fueron similares P gt 0 05 y se increment al adicionar AAT lt 0 05 Para pechuga AGP AGM AGS y en sexos fueron similares P gt 0 05 al aumentar el AAT en la dieta los AGP se incrementaron P 0 05 con 1 y 1 25 en relaci n al testigo AGM y AGS con 0 75 de AAT disminuyeron P lt 0 05 LA al adicionar AAT aumento P 0 05 con 1 y 1 25 en relaci n al testigo para AA al adicionar AAT disminuy P lt 0 05 con 0 75 DHA y EPA no tuvieron diferencia entre sexos P gt 0 05 sin embargo al adicionar el AAT se incrementaron P lt 0 05 con 1 y 1 25 en relaci n al testigo Se concluye que el mejor nivel de inclusi n del AAT es con 1 25 9o Palabras clave Omega tres aceite de atun pollos de engorda cidos grasos Introducci n El crecimiento en la producci n de pollo de engorda en M xico en los ltimos a os es debido a la demanda 2 5 millones de toneladas fueron producidas en 2005 por su menor precio que otras carnes para los mexicanos www una org mx y consumida por la mayor a de la poblaci n por lo que adicionarle en el alimento de las aves ingredientes que aporten AGo 3 de origen marino le da un valor agregado al producto para prevenir causas de origen nutricional en la poblaci n Baucellis et al 2000 Cherian et al 1996 que pueden producir enfermedades cardiovascula
36. 145 3700 9 PhytaseA 025 100 0 750 Results With regards to body weight on day 14 a linear relationship was observed with significant increases with each incremental increase in available phosphorus Table 6 Mortality corrected feed conversion FCR through 14 days of age following a similar pattern however improvement was only observed through 0 325 available phosphorus diet Boilers fed the lowest level of available phosphorus with out supplemental phytase Trt 1 were terminated prior to the end of the study due to decreased mobility and observed morbidity Body weights for day 35 followed a similar linear pattern as on day 14 with incremental increases with increases available phosphorus inclusion FCR also maintained a similar pattern with the lowest remaining available phosphorus level yielding the highest FCR while the two highest levels were similar Tibia weights and ash percent following a similar linear pattern as body weight Broilers fed phytase supplemented diets Trt 5 10 that were lower available phosphorus than those not supplemented Trt 1 4 yield performance characteristics similar to that of Trt 1 and 2 However evaluate parameters varied amongst the three commercially available phytase enzymes with regard to body weight FCR tibia weight and tibia ash These data indicate that the commercially available phytase enzymes can be an effective means to reduce the amount of dietary supplemental phosphorus used in poul
37. 2003 Development of a DIVA Differentiating Infected from Vaccinated Animals strategy using a vaccine containing a heterologous neuraminidase for the control of avian influenza Avian Pathology 32 47 55 7 Chen H Smith G J D Zhang S Y Qin K Wang J Li S Webster R G Peiris J S and Guan Y 2005 Avian flu H5NI virus outbreak in migratory waterfowl Nature 436 191 192 14 July 2005 8 EC 2005 Council directive 2005 94 EC of 20 December 2005 on Community measures for the control of avian influenza and repealing Directive 92 40 EEC Official Journal of the European Commission L 10 16 65 9 FAO 2006a Should wild birds now be considered a permanent reservoir of the virus FAO AIDEnews 2006 Jun 19 issue No 40 10 FAO 2006b Wild birds role in HPAI crisis confirmed Jun 1 2006 11 Fouchier R A M Munster V Wallensten Bestebroer T M Herfst S Smith D Rimmelzwaan Olsen B and Osterhaus A D 2005 Characterization of a novel influenza A virus hemagglutinin subtype H16 obtained from black headed gulls Journal of Virology 79 2814 2822 12 Gao W Soloff A C Lu X Montecalvo A Nguyen D C Matsuoka Y Robbins P D Swayne D E Donis R O Katz J M Barratt Boyes S M and Gambotto A 2006 Protection of mice and poultry from 2 reunion AECACEM Quer taro 2009 P g 52 135 14 I5 16 17 18 19 20 2 22 25 2
38. 212 E Non Vaccinated Vaccinated Means with no common superscript differ significantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 213 Co r E gt 0 0 M 0 LL is mk ma Non Vaccinated Vaccinated Means with no common superscript differ significantly P 0 05 2 reunion AECACEM Quer taro 2009 P g 214 Non Vaccinated VaccinatedNon Non Vaccinated Vaccinated Non Challenge Challenge Challenge Challenge 4 Means with no common superscript differ significantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 215 4 9 u he 0 2 E 0 0 2 0 LL Non Vaccinated VaccinatedNon Non Vaccinated Vaccinated Non Challenge Challenge Challenge Challenge Means with no common superscript differ significantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 216 Weight Gain and Feed Conversion Vaccination increased body weight gain and decreased feed conversion of broilers during challenge when compared to non vaccinated broilers Vaccinated broilers fed 22 protein performed equal to the 24 dietary level post challenge Trial 900 Randomly assigned broilers Non Vaccinated Nor Challenge 2 reunion AECACEM Quer taro 2009 P g 218 Day 13 Day 17 Day 21 Mam Effect Means with different superscript differ significantly P 0 05
39. 30 to 50 wk old grandparents vaccinated with the AAV 8 11 vaccine were adequately protected against challenge with the AAV 8 and 11 serotypes and the Stanford strain serotype 9 Control of EDS Beside biosecurity vaccination with an inactivated vaccine prior to lay is mostly important to prevent egg production losses and reduced egg shell quality in commercial layer and breeder flocks Initial vaccination occurs between 14 and 16 weeks of age However vaccination cannot completely inhibit virus excretion in faeces but decrease virus shedding Heffels et al 1982 2 reunion AECACEM Quer taro 2009 P g 87 References I 10 1 12 13 14 15 16 nt 18 19 Adair BM and Smyth JA 2008 Egg drop syndrome In Diseases of Poultry 12th Edition saif YM Fadly AM Glisson JR McDougald LR Nolan LK and Swayne DE eds Iowa State University Press Iowa USA pp 267 276 Afzal M and Ahmad I 1990 Cited from Balamurugan and Kataria 2004 Ahmad I Malik MI Iqbal K Ahmed K and Naz S 1990 Cited from Balamurugan and Kataria 2004 Alvarado IR Villegas P El Attrache J Jensen E Rosales G Perozo F and Purvis L B 2007 Genetic Characterization Pathogenicity and Protection Studies with an Avian Adenovirus Isolate Associated with Inclusion Body Hepatitis Avian Dis 51 27 32 2007 Balamurugan V and Kataria JM 2004 The hydropericardium syndrome in poultry a current scenario Vet Re
40. 32 24hFed 42 12 7 15 2 64 0 19 261 964 120 895 0 17 24h Fast 39 11 2 86 3 14 0 30 237 60 54 878 0 29 48h Fed 58 27 3 977 154 0174 418 542 97 324 0 18 48h Fast 37 90 3 44 1480 0 174 185 68 33 673 0 312 toa I 43442 5 74 1 120 134 289 663 91 174 0 13 72h Fed 74 13 6 30 0 93 0 10 390 212 102 736 0 20 53 17 3 94ef 0 80 0 06 357 502 73 201 0 18 96h Fed 95 77 8 35 0 61 0 05 391 492 120 753 0 16 poe 66 09 6 20 0 5940 06 361 26 101 506 0 16 Circulating glucose levels were lt 300 mg dL in chicks at hatch and in both fed and fasted chicks on day Table 2 By day 2 fed chicks had higher p lt 0 05 glucose levels than fasted chicks or chicks refed for 4 h However refeeding for 4 hours caused glucose levels to increase p lt 0 05 compared with chicks fasted for 48 h Samples compared on day 3 and day 4 following refeeding for 24 or 48 h respectively revealed no differences glucose levels between full fed chicks and refed chicks In contrast triglyceride levels were very different on day 1 with fed chicks having twice the concentration compared with fasted chicks 120 9 mg dL vs 54 9 mg dL Table 3 Chicks fasted for 24 or 48 hours did not have differences in triglycerides compared with chicks at hatch Interestingly chicks fasted for 48 hours and refed for 4 hours had levels of triglycerides that matched full fed chicks and were higher p lt 0 05 than fasted chicks On day 3
41. A Ciabattini and Spinosa Immunization with recombinant Streptococcus gordonii expressing tetanus toxin fragment C confers protection from lethal challenge mice Vaccine 19 2001 pp 1931 1939 Ciabattini A Isticato Parigi Ricca E Pozzi G Oral priming of mice using recombinant spores of Bacillus subtilis Euroconference Workshop Novel Strategies of Mucosal Immunisation through Exploitation of Mechanisms of Innate Immunity in Pathogen Host Interaction 6 10 November 2002 Siena Abstract 2 reunion AECACEM Quer taro 2009 P g 80 AVIAN ADENOVIRUSES INFECTIONS WITH SPECIAL ATTENTION TO INCLUSION BODY HEPATITIS HYDROPERICARDIUM SYNDROME AND EGG DROP SYNDROME Hafez Mohamed Hafez Institute of Poultry Diseases Faculty of Veterinary Medicine Free University Berlin Konigsweg 14163 Berlin Germany E mail hafez vetmed fu berlin de The first avian adenovirus AAV associated with clinical disease was isolated from an outbreak of respiratory disease quail in 1950 Olson 1950 Since that time AAVs have been found in all types and breeds of chickens and from a variety of other avian species The infections may be asymptomatic or associated with several clinical and pathological conditions Aetiology The avian adenoviruses are non enveloped DNA viruses Adenoviruses are resistant to many several disinfectants and are relatively tolerant to heat and pH changes Iodophor and aldehyde disinfectants seem to
42. AECACEM Quer taro 2009 P g 29 also develop if baits are not rotated While it is nearly impossible to make a poultry barn impervious to rodents steps should be taken to seal all potential entry points to keep out of as many rodents out as possible In addition to baits and rodent proofing steps should be taken to eliminate all potential rodent nesting areas Insecticides should be sprayed on all surfaces of a poultry barn after cleaning to reduce insect numbers Flies are often controlled through litter management as keeping litter dry will often keep down the number of flies If flies become a problem on a facility some larvacides are able to be added to feed and can effectively control maggots Pyrethrum fogs or mists will help control adult fly populations Stringham 1996 General maintenance of facility grounds is vital to good biosecurity To help keep rodent populations under control all vegetation in close proximity to poultry barns should be kept short to decrease the nesting area available Concrete or gravel placed several feet around poultry barns as a perimeter also acts as a deterrent to rodents as they often do not like to cross open spaces All feed spills both inside and outside should be quickly cleaned up to cut off potential feed sources for wild birds and rodents Outside feed spills may be a particular problem as they often attract wild birds which are known to carry ectoparasites mycoplasmas and other poultry pathogens Lutt
43. D 1 1 4 2 reunion Quer taro 2009 P g 219 5 gt 0 6 e Q 13 17 Day 24 2 reunion AECACEM Quer taro 2009 P g 220 9 2 U 0 n Non Vaccinated Non Vaccinated Non NonVaccinated Vaccinated Challenge Challenge Challenge Challenge Means with no common superscript differ significantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 221 Body Weights and Feed Conversion On day 13 vaccinated broilers had similar performance characteristics compared to non vaccinated Body weights were reduced due to vaccination on Day 1 and 21 Starter duration had no effect on broiler body weight Feed conversion was unaffected by vaccination pre challenge Body Weights and Feed Conversion During challenge vaccinated broilers gained Significantly more body weight and had reduced feed conversions compared to non vaccinated rollers During the challenge period non challenged rollers had similar performance parameters regardless of vaccination status Cumulative feed conversion for non challenged broilers were similar for non vaccinated and vaccinated The previous experimental trials support the following conclusions 1 Vaccination efficacy Is influenced by dietary protein level during the starter phase of broiler grow out 2 Vaccination generates protective Immunity against subsequ
44. E Coates 1982 The uptake of nutrients from the small intestine of gnotobiotic and conventional chicks Br J Nutr 47 349 356 2 reunion AECACEM Quer taro 2009 P g 23 BIOSECURITY FOR BROILER BREEDERS AND PRIMARY BREEDING STOCK Ross Wolfenden PhD Student Poultry Science Department University of Arkansas Fayetteville AR USA Introduction By the time a typical broiler breeder hen lays her first egg over 7 22 has been spent on her Jones 2002 This cost is the result of the cost of feed chick cost vaccine medication utilities fuel grower payment service as well as other miscellaneous costs Jones 2002 This number does not include the value of future egg production or the value of chicks from this hen 99 Since dead hens do not lay eggs it is important that this substantial investment is properly protected by the use of the best possible management practices including a well managed biosecurity program Biosecurity is simply defined as security of life In reference to livestock and poultry in particular biosecurity 1s a set of management policies and practices set forth to protect the overall well being of the animals with specific emphasis on prevention of disease Since many valuable animals are housed in a single airspace for over a year precaution must be taken to prevent the outbreak of disease If a pathogen gains entrance into a facility it may be nearly impossible to stop the spread of that patho
45. Fits All Flu Vaccine The threat ot avian influenza has revived efforts ta develop universal flu vaccines that protect against all human influenza strains Although that qual remains elusive vaccines that protect against seasonal flu variants could be closer Modern medicina mala agairel n mlana viaa na weelully nrang sena Each seat have lu ree hai bek nan sae pilit d sire dung year i pee th us minha i iil hive lo has mngali uih mans de bahrain Mis oublie a padone draa w be vires of Vo pret d Ing wii ob A 8 v3 sing dad can picela pinu dier li se or ee a ife The exci vet il fu vac is ll lig wa een pede Dal Sg iy Ls ie dating of pu prov fi bond vC RE quita hi aa Sam dhat an ui hs wep site balls tle cold 125 ibility co he nre nama eri Maman kahanan Ural now fu has been akena Igi eneug en hr lar de Diog seh fuii 44 ANE o th ane ENAK pn Ja moda unge fer 14 which includes tbe cram ga well eri gena aide enti iae opis de use eon v pralena aal don util uch year bo yout lolis B rhe ihr Tore
46. H3N2 SLLTEVET PIRNEWECRCNGSS A Wuhan 3NZ SLPTEVET PIRSEWGCRONDSS D A Wisconsin m 99 SLLTEVET PIRNGWECECNDSS D A New York ae 2003 HINI SLLTEVET PIRNEWGCRCNDSS D Nz A New York 318 Z005 Es OLLTEVET PIRNEWOCRONDOS 0 M2e insertion sequence aroA htrA HM From Javier Saelens EVETPIRN x2 CD194 EVETPTRN x2 human avian 2 reunion AECACEM Quer taro 2009 P g 181 Primary Direct Challenge Vaccination With Al Direct Challenge o Swayne Southeast Poultry Research Laboratory USDAIARS Athens 2 reunion AECACEM Quer taro 2009 P g 182 Mize Antibody Response SIP Ratios 0 45 IE SP Sample Negative Control Positive Ctl Negative Ctl IK 034 025 024 0 194 41 0 05 m Saline aroA htrA 0 Y 1 V Boost reunion AECACEM Quer taro 2009 P g 183 Virus Neutralization Neutralizing Index Days Daye mw m wy Ww M d 0 1 HON2 avian gt 2 positive assay result u gt protective Morbidity Following Direct Challenge with LPAI H7N2 2 fa L 2 12145 6 23 1 Days Post Challenge 2 reunion AECACEM Quer taro 2009 P g 185 Morbidity Following Direct Challenge with HPAI HSN wide AINE ef DATA HM 2 Is Ta 0 2 9 0 1 2 13 Days Post Challenge 2 reunion AECACEM Quer taro 2009 P g 186 OCCIAIOSIS Unsporulated Sporulated Docyst Docyst noninfectious infect
47. S Jagai B Matyas A DeMaria I B MacNeill and J K Griffiths 2007 Seasonality in six enterically transmitted diseases and ambient temperature Epidemiol Infect 135 281 292 Nisbet D 2002 Defined competitive exclusion cultures in the prevention of enteropathogen colonisation in poultry and swine Antonie van Leeuwenhoek 81 481 486 Oot R A R R Raya T R Callaway T S Edrington E M Kutter and A D Brabban 2007 Prevalence of Escherichia coli 0157 and O157 H7 infecting bacteriophages in feedlot cattle feces Lett Appl Microbiol 45 445 453 Patton S J S Dickson S Lonergan S A Cutler and C H Stahl 2007 Inhibitory activity of colicin el against Listeria monocytogenes J Food Prot 70 1256 1262 Rabsch W H Tschape and A J Baumler 2001 Non typhoidal salmonellosis Emerging problems Microb Infect 3 237 247 Raya R R P Varey R A Oot M R Dyen T R Callaway T S Edrington E M Kutter and A D Brabban 2006 Isolation and characterization of a new t even bacteriophage cevl and determination of its potential to reduce Escherichia coli O157 H7 levels in sheep Appl Environ Microbiol 72 6405 6410 Reiber M A D E Conner and S F Bilgili 1995 Salmonella colonization and shedding patterns of hens inoculated via semen Avian Dis 39 317 322 Rodriguez A P Pangloli H A Richards J R Mount and F A Draughon 2006 Prevalence of Salmonella in diverse e
48. Shane 1996 evaluated five inactivated vaccines used in Mexico Complete protection with an absence of histological changes in chicks challenged with 10 LDso of the DCV 94 adenovirus strain was observed Icochea et al 2001 evaluated the efficacy of three inactivated vaccines against IBH HPS 1n Peru in two different experiments and concluded that the protective effect of a commercial oil adjuvanted cell culture IBH vaccine was superior to the autogenous vaccines and that the mortality rates were not dose dependent As most cases of IBH are the result of vertical transmission vaccines have been proved to be highly successful at controlling IBH by preventing vertical transmission and inducing maternal immunity Toro et al 2002 Alvarado et al 2007 Toro et al 2002 reported that effective protection of the progeny of chickens against IBH HPS could be achieved by dual vaccination of breeders with FAV 4 and CAV Alvarado et al 2007 isolated pathogenic adenovirus identified as Stanford strain and characterized as European serotype 9 The level of protection against IBH was evaluated in two broiler breeder progenies from AAV 8 11 vaccinated grandparent flocks and a commercial broiler flock by challenge at 1 or 7 days of age with the AAV 8 and 11 serotypes and or the Stanford strain The broiler breeder progenies and the commercial broiler flock exhibited protection against IBH after challenge They conclude that broiler breeder progenies from
49. T R Callaway T S Edrington R B Harvey and D J Nisbet 2006 Low level nitrate or nitroethane preconditioning enhances the bactericidal effect of suboptimal experimental chlorate treatment against Escherichia coli and Salmonella typhimurium but not Campylobacter swine Foodborne Path Dis 3 461 465 Atterbury R J P L Connerton C E R Dodd C E D Rees and I F Connerton 2003 Application of host specific bacteriophages to the surface of chicken skin leads to a reduction in recovery of Campylobacter jejuni Food Sci 69 6302 6306 Berrang M E N A Cox S E Craven and N J Stern 1998 Effect of sub therapeutic levels of antibiotics in feed on intestinal carriage of Campylobacter and Salmonella in turkeys Poult Sci 77 95 Braden C R 2006 Salmonella enterica serotype Enteritidis and eggs A national epidemic in the United States Clin Infect Dis 43 512 517 Byrd J A D E Corrier J R Deloach D J Nisbet and L Stanker 1998 Horizontal transmission of Salmonella Typhimurium in broiler chicks J Appl Poult Res 7 75 80 Callaway R C Anderson S Edrington O Elder J Genovese Bischoff T L Poole Y S Jung R B Harvey and D J Nisbet 2002 Preharvest intervention strategies to reduce food borne pathogens in food animals J Anim Sci 81 Electronic Supplement 2 17 24 Callaway T R T S Edrington A D Brabban E Kutter L Karrike
50. The goals of a good biosecurity plan should be to lower the probability of infection by lowering the number of pathogens a flock comes in contact with as well as shifting the infectious dose curve to the left increasing the number of pathogenic organisms an animal or flock may be exposed to before becoming infected through immunizations and proper animal husbandry These goals can be attained through three interconnected principles isolation traffic control sanitation and resistance Jeffery 1997 Wolfgang Isolation and Traffic Control The objective of isolation and traffic control is to prevent pathogens from gaining entry into a facility While it is possible for air born fomites to infect poultry the chances of this occurring are relatively low as most pathogens can travel relatively short distance without a vector this is one reason why poultry production facilities should optimally be spaced 1 2 miles apart Carey et al L5182 It is much more common for a pathogen to be brought onto a premises on personnel equipment vehicles feed biological vectors and new or replacement poultry To reduce the probability of infection only those people and things absolutely necessary to the operation of a farm should be allowed in a facility 2 reunion AECACEM Quer taro 2009 P g 25 People are a common vehicle for poultry pathogens particularly if those individuals come in contact with poultry people or equipment from multiple poultry f
51. Toro et al 2001 Mazaheri et al 2003 There 1s evidence that adenovirus infections can become latent and that periods of stress such as the onset of egg production will reactivate viral shedding Girshick et al 1980 reported that there is evidence that adenovirus infection can remain latent and undetected for at least one generation a specific pathogen free flock The bird to bird transmission of the virus in a flock occurs horizontally by the oral faecal route and further spread take place by mechanical means and by contamination with infected faeces Commercial hatching eggs may be a mechanism of spread of AAV from one country to another Mazaheri et al 1998 tested the pathogenicity of FAV serotype 4 isolated from typical field cases of hydropericardium syndrome in Pakistan and Ecuador in one day old specific pathogen free SPF chicks Infected chickens as well as their contact sentinels showed depression and reduced flight reactions between day 6 and 11 p i After this period no further clinical signs were seen Mortality commenced 7 days and continued for 5 days It was impossible to isolate adenovirus from the livers from any killed chicks at 3 days p i Isolation of virus was possible from the livers of following oral infection of 1 day old chicks with purified field isolates Under field condition the disease is characterized by sudden onset of mortality in chickens lt 6 weeks old and as young as 4 days of age Mortali
52. against foodborne pathogenic bacteria Phages have been used around the world in place of antibiotics in human medicine and have been used to reduce foodborne and animal pathogens in several species of food producing 2 reunion AECACEM Quer taro 2009 P g 39 animals Smith and Huggins 1983 Huff et al 2002 Higgins et al 2005 To date the effectiveness of phage treatment in the gut of animals has been variable Kudva et al 1999 Higgins et al 2005 Raya et al 2006 In 2007 a phage that kills E coli 157 7 on live cattle before slaughter was approved for use by the U S FDA as a pre harvest hide spray Other researchers have developed phage as an intervention to reduce Campylobacter and Salmonella in live poultry and swine Connerton et al 2004 Loc Carrillo et al 2005 Callaway et al 2007 and by spray onto carcasses and or meat products Atterbury et al 2003 Goode et al 2003 Preliminary results by the present author utilizing phage active against Salmonella 1n newly hatched broiler chicks have been mixed Callaway unpublished data UNINTENDED CONSEQUENCES DISASTER ARISES FROM THE BEST INTENTIONS Any actions we take to reduce S enterica colonization in animals must be taken with the full awareness of unintended consequences The emergence of S Enteritidis as a human pathogen associated with poultry eggs 1s a case in point Kingsley and Baumler 2000 Rabsch et al 2001 Salmonella Gallinarum Pullorum caus
53. also for protection of the host from pathogens An effective method of protecting birds from pathogens such as Salmonella is the use of CE and OA These alternatives also offer promising results in protecting animals from other types of pathogens Development of defined CE cultures is a step forward in the control of pathogens with CE A defined CE can be more easily reproduced than undefined cultures The organisms in a defined culture can selected to be oxygen tolerant and capable of being produce a mass fermentation culture thus reducing the cost of amplification define culture would also meet safety standards as well as improve quality control of the product While there are many advantages to CE and OA there are some disadvantages First the preparation and maintenance of competitive exclusion bacteria can be difficult and expensive The bacteria in these cultures could be aerobic or anaerobic thus requiring different conditions to be effective The second disadvantage to CE is the delivery method Oral gavage is the preferred method because all of the birds receive a consistent amount and concentration of the culture but 2 reunion AECACEM Quer taro 2009 P g 17 this is the most labor and time intensive method of delivery Administering the culture in the drinking water is possible but one cannot be sure all birds are drinking the same amount of the water or that the product 15 being administered correctly Administering the cul
54. and Summers 2005 Due to rising dietary costs including supplemental phosphorus allowing a margin of safety with regards to dietary phosphorus concentration may no longer be practical and increasing the demand of phosphorus release with phytase inclusion may decrease cost Therefore two experiments were designed to investigate the minimum level of non phytate phosphorus needed to maximize growth performance and determine the amount of phosphorus release from phytate with the inclusion of three commercially available phytase enzymes Experiment 1 Objective The objective of this experimental design was to determine the minimum non phytate phosphorus level in a two dietary phase program needed to maximize growth in straight run broilers through 28 days of age reared in two different rearing environments Experimental Design The experimental design consisted of a total of six dietary treatments with selected calculated non phytate phosphorus concentrations in the started diet of 0 30 0 35 0 40 0 45 0 50 and 0 55 Each treatment consisted of five replicate pens containing 40 straight run chicks per pen for a total of 1200 chicks placed Broilers were fed the starter until 14 days of age and then switched to a grower diet The grower diet was fed through the termination of the study at 28 days of age The high nutrient density diet for raising straight run market broilers found in Leeson and Summers 2005 with an available phosphorus le
55. aspersi n Al d a 21 las aves fueron desafiadas con de Eimeria sp aisladas de campo y al d a 28 se realiz la toma de muestras y el sacrificio El peso el consumo e ndice de conversi n de las aves se vio afectado por la presencia de las micotoxinas p lt 0 05 es importante destacar que las aves vacunadas y que consumieron aflatoxinas u ocratoxinas tuvieron un comportamiento similar a las aves que nicamente fueron desafiadas La evaluaci n del hematocrito y prote nas se vieron afectadas por la presencia de las micotoxinas y en las aves que fueron desafiadas con y sin vacunaci n p lt 0 05 Respecto a la concentraci n s rica de transaminasas y bilirrubinas solo se increment en aquellos tratamientos que consumieron alg n tipo de micotoxinas p lt 0 05 Palabras claves Aflatoxina B Ocratoxina Pollo de engorda Interacci n Coccidiosis Eimeria 2 reunion AECACEM Quer taro 2009 P g 112 INCLUSION DE ACEITE DE ATUN COMO FUENTE DE ACIDOS GRASOS OMEGA TRES EN DIETAS PARA POLLO DE ENGORDA E Morales S Carrillo M Castillo M J Gonz lez O Prado 1 Departamento de Producci n Agr cola y Animal Universidad Aut noma Metropolitana Calzada del hueso No 1100 Col Villa Quietud M xico D F CP 04960 e mail jemorab Qcorreo xoc uam mx 2 Instituto Nacional de la Nutrici n y Ciencias M dicas Salvador Subir n Vasco de Quiroga No 15 14000 M xico D F 3 Universidad Aut noma Chapingo Car
56. complete nucleotide sequence data reveal that it is an intermediate virus between mammalian and avian adenoviruses Hess et al 1997 EDS virus transmits vertically from hens to chicks and also horizontally from chicken to chicken Cook and Darbyshire 1980 1981 Darbyshire and Peters 1980 Contaminated eggs as well as egg trays or faeces seem to be the main sources for virus spread Smyth and Adair 1988 However some outbreaks have been attributed to contact with wild birds or water contaminated by faeces from wild birds Smyth et al 1988 carried out an investigation on the pathogenesis of EDS in laying hen After experimental infection viral antigen and intranuclear inclusion bodies were detected in the surface epithelium of the nasal cavity of conventional hens 2 to 6 days p i Low levels of viral antigen were detected in lymphoid tissue throughout the body 2 to 5 days p 1 and inflammatory lesions and viral antigen were observed in the infundibulum 3 to 5 days p 1 Viral replication was first detected the pouch shell gland PSG 8 days 1 Viral antigen was never detected in the surface epithelium of the alimentary tract 2 reunion AECACEM Quer taro 2009 P g 84 The disease 15 most severe in broiler breeders and brown egg layers White layer lines are less affected The mortality 1s usually negligible Birds infected vertically can remain asymptomatic until the bird become sexually mature The eggs from infected birds are
57. embryos as well as for turkey embryos was demonstrated by Lierz et al 2007a b The authors described severe tissue edema with infiltrates of heterophils necrosis in liver intestine and CAM in the embryos died The clinical signs and the course of the disease are influenced by several factors such as the presence of concurrent microorganisms such as TRT Influenza Reo ORT and E coli and or improper management increased dust and ammonia levels the environment The clinical manifestation due to MG may include drops feed consumption coughing sneezing rales ocular and nasal discharge and swelling of sinuses In some cases sinusitis may be absent and only rhinitis tracheitis und airsacculitis could be found accompanied with fibrinous pneumonia MS has the affinity for synovial membranes and may infect the membranes of joints resulting in swelling of the joints followed by lameness Hocks footpads wing joints and the sternal bursa are most frequently involved Affected birds are not able to move and lose weight or fail to gain MS may also cause respiratory disease and airsac lesions similar to MG The role of MS as a primary pathogen in both respiratory and locomotory disease of turkeys is less clear and other factors may be involved and responsible for the onset of clinical signs MM causes embryo deaths sinusitis stunting airsacculitis and occasionally bone defects as well as swollen hock joints MI causes mortality of turkey
58. las instalaciones en la etiqueta del producto Aunque no se observaron diferencias entre el resto de las variables posiblemente debido al desaf o moderado la diferencia en pigmento es significativa debido a que la buena pigmentaci n es muy apreciada y juega un papel muy importante en la comercializaci n del producto final Con base en los resultados obtenidos bajo las condiciones experimentales empleadas se concluye que el desinfectante coccidicida mostr un efecto negativo en la cantidad total de ooquistes lo cual se relacion con un mayor da o de la pared as como que el uso del desinfectante coccidicida en las instalaciones previo a la crianza y en el tapete sanitario durante toda la prueba mejor la pigmentaci n cut nea del pollo de engorda de manera significativa 2 reunion AECACEM Quer taro 2009 P g 143 REFERENCIAS 1 10 11 13 14 15 Palermo JN Current and futures perspectives on the regulation of anticoccidial drugs and vaccines X Internacional Coccidiosis conference 2005 September 19 23 Foz do Iguassu Parana Brazil Brazil Parana Fundacao apicno de ciencia e tecnologia avicolas AC 2005 19 23 Serrano PDJ Cuanto cuesta un brote de coccidia Memorias del IJ Simposium de Integridad Intestinal y 3er encuentro AMVEAV 2004 junio 25 Guadalajara Jalisco M xico M xico DF AVECA G AECAS AMVEAV y U of A AC 2004 80 92 McDougal LR Coccidiosis In Saif YM Barnes HJ Glisson JR F
59. main advantage of the test is that 1t can demonstrate the presence of avian influenza within 15 30 minutes The disadvantages are that it may lack sensitivity 1t has not been validated for different species of birds and subtype identification is not achieved Several serologic tests can be useful to diagnose the disease such as AGID ELISA Haemagglutination inhibition HI tests and Neuraminidase inhibition test The last mentioned test requires specialized expertise and reagents consequently this testing 15 usually done in OIE Reference Laboratory Control approaches Bio security is the first defence line to prevent the introduction of an infectious disease in an area In case of present an infectious disease in an area several measures can be adopted in aim to prevent further spread this can include beside bio security measures the culling of infected flock and vaccination of non exposed flocks The community measures for the control of highly pathogenic avian influenza are based first on the depopulation of the infected flocks in accordance with community legislation on animal welfare If an outbreak occurs it 1s necessary to prevent any further spread of infection by carefully monitoring and restricting movements of poultry and by tightening biosecurity measures at all levels of poultry production by cleaning and disinfecting the infected holding by establishing protection based on a minimum radius of three kilometres around the inf
60. mentioned previously the infectious dose of a pathogen required to infect a flock 1s variable It depends not only on the pathogen itself but also on the host Many factors such as overall health vaccination stress temperature and environment can play a role in the resistance a flock will have to infection One of the most effective ways to increase the disease resistance of a flock is through vaccination Vaccination programs must be tailored to individual farms and regions as the same disease threats are not present in all areas Vaccination programs in areas where there is a high density of poultry production often must use a more comprehensive vaccination program than areas where poultry flocks are spread further apart If the right vaccines are selected and then administered correctly the infectious dose required for disease will be greatly increased Mortality and morbidity may also be improved even if a flock does become infected Proper management of environmental conditions will allow the flock to have maximum disease resistance Flocks that have undergone temperature stress often have a lower level of disease resistance Flocks which are exposed to high levels of dust and ammonia are often more vulnerable to even opportunistic pathogens due to damage to mucus membranes Oyetundl978 Opportunistic pathogens such as coli are not usually a problem for poultry producers but can become a problem when poor ventilation management practices o
61. mutagenesis protocol to insert epitope sequence to chromosome o ententidis chromosome expressing Redrecombinase from plasmid Insertion site loop 9 eee lamB gene Overlapping extension PCR a Electroporation Foreign DNA a qi z 4 5 i L Intermediate construct Km selection ad fa L 4 s J Electroporation F i ocelrecogniton sequence Knf gene 3 dy selection and counter selection no growth on Km 2 S ententidis chromosome expressing foreign sequence DO EI 2 reunion AECACEM Quer taro 2009 P g 173 lamB Loop 9 Sequence CETTE AATGTACAAGTGGACGCCAATCATGAGCACCCTGCTGGAAGTCGGCTACGAC AACGTGAAATCTCAGCAGACCGGCGATCGTAACAATCAATATAAAATCACCCT GGCGCAACAGTGGCAGGCGGGCGACAGCATCTGGTCGCGICCGGCTATCCG o ATITCCACC AACAGCCGTGGCGATAGCGATGAGTGGACCTTCGGCGCCCAGATGGAAATCTG GTGGTAA lamB Loop 9 Sequence with Insert COTGARATCTCAGCAGACCGGCGATCGTAACAATCAATATAARATCACCCTGGC GOAACAG TGGCAGGCGOGUCACAGCATUTGGTOGOG TCOGGCTATOOOTATTT TCGCCACC TACGCGAAATGGGA TGAGAAATGGGGCTATATCAAAGACGGCGAT AACATTTCCCGTTATGCCGCAGCGACTAACTCCGGCSSSARGFAKSSSWAEKGY YTMSSSAT T TCCACCAACAGCCGTOGCGATAGCGATGAGTGGACC TTCG
62. n Av cola CEIEPA de la FMVZ de la UNAM Bayer de M xico SA de CV otili0645 hotmail com RESUMEN La coccidiosis aviar es la parasitosis mas comun y de mayor costo para la industria avicola a nivel mundial Las p rdidas econ micas que ocasiona se relacionan principalmente a su prevenci n y tratamiento as como a la mala absorci n menor pigmentaci n cut nea baja productividad y mayor mortalidad Las condiciones propias de la producci n av cola intensiva aunadas a una gran resistencia de la Eimeria al medio ambiente y a los desinfectantes comunes han favorecido su presentaci n y permanencia en las granjas av colas Debido a lo anterior han surgido nuevos productos desinfectantes y con ello la necesidad de conocer su desempe o tanto in vitro como en campo El objetivo de este trabajo fue evaluar el efecto de dos desinfectantes uno general y otro espec fico sobre la viabilidad de Eimeria spp in vitro y en los par metros productivos de pollo de engorda Los resultados obtenidos in vitro mostraron da o en la pared y un menor n mero de ooquistes en el grupo tratado con el desinfectante espec fico P lt 0 05 Las aves criadas en la secci n tratada con este mismo desinfectante no mostraron diferencia P gt 0 05 con respecto al desinfectante general en la severidad de lesiones macrosc picas intestinales conteos de ooquistes por gramo de heces peso corporal conversi n alimenticia y consumo de alimento excepto en la pigmen
63. of antigen specific T and B cell memory in local as well as systemic lymphoid tissues following oral immunization with cholera toxin adjuvant Immunology 1993 80 197 203 Thanavala Y Huang Z Mason HS Plant derived vaccines a look back at the highlights and a view to the challenges on the road ahead Expert Rev Vacc 2006 5 249 260 Valentine L Agrobacterium tumefaciens and the Plant The David and Goliath of Modern Genetics Plant Physiology 2003 133 948 955 Clifton NJ Methods in molecular biology Binary vectors and super binary vectors 2006 343 15 41 Sh del F Moriarty AM Peterson D Zheng J Hughes JL Will H Leturcq DJ McGee JS Milich DR The position of heterologous epitopes inserted in hepatitis b virus core particles determines their immunogenicity J Virol 1992 66 106 114 Huang Z Santi L LePore K Kilbourne J Arntzen CJ Mason HS Rapid high level production of hepatitis B core antigen in plant leaf and its immunogenicity in mice Vaccine 2006 24 2506 2513 2 reunion AECACEM Queretaro 2009 Pag 138 EVALUACION DE UN DESINFECTANTE COCCIDICIDA SOBRE LA VIABILIDAD DE OOQUISTES DE Eimeria SPP Y LOS PARAMETROS PRODUCTIVOS EN POLLO DE ENGORDA Ortiz Garc a Otilio Hern ndez Velasco X chitl Fuente Mart nez Benjamin Tejeda Gil Ruth Jasso Villazul Antonio Departamento de Producci n Animal Aves DPA Aves de la FMVZ de la UNAM Centro de Ense anza Investigaci n y Extensionismo en Producci
64. pH Thus organic acids sometimes cause cell death through depletion of energy through the ATP driven proton pump The end result can be impaired bacterial cell function and or lysis The potential targets of biocidal compounds such as organic acids include the cell wall cytoplasmic membrane and specific metabolic functions in the cytoplasm associated with replication protein synthesis and function Denyer and Steward 1998 Davidson 2001 Ricke 2003 Some of the most common organic acids used as food additives are propionic acetic citric lactic tannic and butyric Byrd et al 2001 showed a reduction in Salmonella typhimurium recovered from the crop of chickens during an 8 h feed withdrawal period when using 0 5 lactic or formic acid The study also showed significant reduction in crop contamination with both Salmonella and Campylobacter Salmonella isolation incidence in pre chill carcass rinses was also reduced by 52 4 The problem with the use of lactic acid at an inclusion rate of 0 5 1s that voluntary water consumption 1s reduced presumably due to the taste of the acid Therefore the use of lactic acid at this concentration is not likely to be widely used in the poultry industry Thompson and Hinton 1997 included formic and propionic acid in the diets of hens obtaining an in vivo reduction of Salmonella enteritidis Chaveeraach et al 2002 used formic acetic propionic and hydrochloric acid alone and combined formic acetic
65. partir de la zona apterita pectoral derecha con un color metro de reflectancia CR 400 Minolta Co Osaka Japan An lisis estad stico Los valores de pigmento cut neo y el n mero de ooquistes en heces se evaluaron conforme al dise o experimental empleado y la comparaci n entre las medias se realiz con la prueba de T de student Para la comparaci n de las lesiones se utiliz la prueba de Kruskall Wallis y las diferencias existentes entre medianas de cada grupo se analizaron con la prueba U de Mann Whitney Para todas las pruebas se fij un nivel de significancia P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 141 RESULTADOS En relaci n al conteo de ooquistes viables a las 4 horas postratamiento el grupo A desinfectante espec fico present en promedio un n mero estad sticamente menor P lt 0 05 de ooquistes ml 240 000 20 428 DS en comparaci n con el resto de los dos grupos Aunque el grupo B tambi n mostr una reducci n en el numero de ooquistes ml 342 400 21 395 DS esta fue solo diferente con respecto al grupo C 473 600 27 897 DS Cabe se alar que en el grupo tratado con el desinfectante coccidicida se observaron con mayor frecuencia esporoblastos o esporozoitos libres ooquistes con la membrana da ada Figura 1 y granulaciones o precipitados alrededor de la membrana externa que en el grupo B o C Figura 2 MEM o 22 o S A Figura 1 Ooquiste con la pared da ada el g
66. propionic administered in the drinking water These researchers showed bactericidal effects at pH 4 0 but the bactericidal effect was reduced at higher 2 reunion AECACEM Quer taro 2009 P g 16 pH Barnhart et al 1999 developed a simulated crop assay to evaluate some disinfectants in the presence of large quantities of organic matter In this assay d Limonene and citric acid among other disinfectants were used to eliminate Salmonella The combination of d Limonene and citric acid showed the best results of Salmonella killing using the simulated crop assay Acidifiers have been used by the poultry industry for several years and there are many putative claims of the effects caused by acids Recently the characteristics and qualities of organic acids have been explored in greater detail Currently the goal is to use organic acids to reduce Salmonella in the crop and the ceca of poultry The crop and ceca represent the main source of carcass contamination during processing A reduction in crop and cecal Salmonella contamination would likely translate to a reduction of carcass contamination during evisceration in the processing plant based on previous associations of decreased Salmonella burden in vivo and reduced recovery at the procession plant Byrd et al 2001 The intestinal microflora is a complex ecosystem and the intestinal mucosa is the largest immune barrier in the body making it not only important for digestion and absorption but
67. refiere al grado de diluci n del medicamento abarca desde la Tintura madre hasta las potencias m s altas y su uso esta determinado por el grado de semejanza entre el medicamento experimentado remedio y los s ntomas que presenta el enfermo es el grado de energ a que alcanza una sustancia por medio de la dinamizaci n Comprobaci n de la Pulsatilla en aves de abasto 8 9 10 y 11 El trabajo que se documenta se realizo en la Escuela de Medicina Veterinaria y Zootecnia de la Universidad Aut noma Benito Ju rez de Oaxaca y consisti en administrar a una parvada de 45 aves de abasto el remedio Pulsatilla con el prop sito de comprobar la semejanza entre el cuadro cl nico de Enfermedad Cr nica Respiratoria Complicada ECRC que presentan las aves a causa de la infecci n por Micoplasma gallisepticum principalmente y el efecto complicante dado por bacterias del genero Echericha coli E coli y otras La parvada fue encasetada en la nave de la 2 reunion AECACEM Quer taro 2009 Pag 147 EMVZ esta es del tipo de Nave de Ambiente Natural NAN se les someti al manejo establecido para este tipo de aves y naves y el seguimiento se a cabo sobre dos vertientes la primera la evidencia de signos inherentes al efecto EXPERIMENTADOR del remedio Homeopatico 12 y 13 Condiciones de la primera vertiente de la investigaci n 12 y 13 Los grupos de estudio se establecieron a las 4 semanas de vida de la parvada siend
68. rzano Ch vez Aplicaci n de la Pulsatilla para reproducir el cuadro cl nico de la Enfermedad Cr nica Respiratoria Complicada que se presenta en la Avicultura Intensiva Tesis Escuela de Medicina Veterinaria y Zootecnia Universidad Autonoma Benito Juarez de Oaxaca enero de 2006 pp 3 88 Jord n F T W Pattison M Enfermedad de las aves Edit Manual moderno tercera edici n 1998 M xico D F pp 79 84 Mosqueda T Angel y Benjam n Lucio M Enfermedades Comunes de las Aves Dom sticas Dpto de Producci n Animal Aves FMVZ UNAM SUA pp 75 85 2 reunion AECACEM Quer taro 2009 P g 154 11 12 13 14 15 16 17 18 Calnek B W Enfermedad de las aves Edit Manual moderno segunda edicion 2000 M xico D F pp198 207 Morales L pez Ra l S ntesis de Farmacia Homeop tica T cnica y Practica Derechos Reservados N mero de Registro 7365 90 Libro 10 Foja 363 M xico DF 3 de abril de 1990 pp 113 120 S nchez Ortega Proceso Introducci n a la medicina Homeop tica Teor a y T cnica Derechos Reservados 1992 Dr Proceso S nchez Ortega Biblioteca de Homeopat a de M xico Tlaxcala no 58 Col Reforma CP 06760 ISBN 970 92000 03 1 ed pp 157 182 187 188 Quetana J A Avitecnia ED Trillas 2 edici n 1991 M xico D F COBB VANTRESS INC Technical Information Service COBB 500 Broiler Performance PO BOX 1030 SILOAM SPRINGS Arkansas 72761 Tel 14795243166 Email info cobb v
69. the reasons behind such control programs for all people involved throughout the poultry production chain References AI 1 Aly M M Arafa A Selim El Kanawati Z R Abd El Wahab E M Hassan and Hafez 2008 Outbreak of Highly Pathogenic Avian Influenza 5 vaccinated turkey flock in Egypt Case Report Proceedings of the 7 International Symposium on Turkey Diseases 19 21 June 2008 Berlin Ed H M Hafez Verlag der DVG Service GmbH ISBN 978 3 939902 96 6 pp 222 229 2 Anon 2007 Scientific Opinion on Vaccination against avian influenza of H5 and H7 subtypes in domestic poultry and captive birds Adopted on 11 May 2007 European food Safety Authority The EFSA Journal 2007 489 http www efsa europa eu EFSA efsa locale 1178620753812 1178621165004 htm 3 Anon 2000 The Definition of Avian Influenza The use of Vaccination against Avian Influenza Draft report for possible adoption on 27 June 2000 Scientific Committee on Animal Health and Animal Welfare European Commission Sanco B3 AH R17 2000 pp 1 38 4 Beard C W Schnitzlein W M and Tripathy D N 1992 Effect of administration on the efficacy of a recombinant fowlpox virus against H5N2 avian influenza Avian Diseases 36 1052 1055 5 Capua I and Marangon S 2006 Control of avian influenza in poultry Emerging Infectious Diseases 12 1319 1324 6 Capua L Terregino C Cattoli G Mutinelli F and Rodriguez J F
70. to control or replace pathogens in the animal by harnessing the power of commensal organisms Competitive exclusion probiotics prebiotics vaccination sodium chlorate and bacteriophage can indeed impact intestinal and environmental carriage of foodborne pathogens but they must be used in conjunction with in plant interventions Thus cleaning up animals may temporarily reduce the incidence of foodborne pathogenic bacteria but intestinal populations of other pathogens step into the breach Therefore it 1s it critical to include other comprehensive 2 reunion AECACEM Quer taro 2009 P g 41 strategies that provide other intestinal bacteria a selective advantage to occupy the vacated niche The rise of Salmonella Enteritidis following the elimination of fowl typhoid emphasizes the possible unintended consequences of such significant changes in the microbial population of the gut LITERATURE CITED Anderson R C S A Buckley T R Callaway K J Genovese L F Kubena R B Harvey and D J Nisbet 2001 Effect of sodium chlorate on Salmonella typhimurium concentrations in the weaned pig gut J Food Prot 64 255 259 Anderson R C S A Buckley L F Kubena L H Stanker R B Harvey and D J Nisbet 2000 Bactericidal effect of sodium chlorate on Escherichia coli O157 H7 and Salmonella typhimurium DT 104 in rumen contents in vitro J Food Prot 63 1038 1042 Anderson R C Y S Jung K J Genovese J L McReynolds
71. used commercial layer flocks and now are used in broiler breeder flocks in many areas world wide The bacterins provide good protection against egg production losses Hildebrand et al 1983 In vaccinated flocks feed conversion improvements and reductions of medication costs have been demonstrated In vaccinated breeder flocks a drastic reduction of egg transmission also has been observed The lag period between infection and egg shedding in vaccinated flocks is longer and this period could be prolonged by revaccination of the birds during production However inactivated vaccines have some disadvantages they are expensive they must be applied by injection which leads to higher labour costs and do not provide optimal protection against infection and tracheal colonization by field strains A live MG vaccine called 6 85 strain has been introduced Evans and Hafez 1992 Evans et al 1992 It 1s apparently less pathogenic for both chickens and turkeys providing a significant protection against airsacculitis and egg losses Also a live vaccine based on a Temperature sensitive TS 11 mutant strain of MG has been developed and 15 widely used in Australia and licensed in some other countries Whithear et al 1990 MG vaccines have had less use turkeys The F strain is too pathogenic for consideration in turkeys but 6 85 15 11 strains may have potential use under very limited circumstances There has been relatively little work on MS va
72. vertically transmitted from the hen to the egg or it can be contracted by a young chick from the environment usually in the hatchery Borland 1975 In humans foodborne salmonellosis can cause diarrhea fever and abdominal cramps Occasionally the infection can become serious or even fatal spreading to the blood bone marrow or brain In the United States it is estimated that 500 1000 persons die each year due to Salmonella food borne illness Foegeding and Roberts 1994 Data from the United States Centers for Disease Control CDC FoodNet estimates that 76 million people experience foodborne illness every year in the United States In 2001 surveillance data indicated that the greatest number of foodborne illnesses were caused by Salmonella comprising 40 of all laboratory diagnoses FoodNet 2004 Madie et al 1992 calculated that in the U S money lost due to Salmonella induced foodborne illness is 1 4 billion dollars annually This estimate took into account lost human productivity medical expenses and increased animal production costs Poultry and poultry products often serve as the vehicle for human Salmonellosis Bean and Griffin 1990 Persson and Jendteg 1992 the poultry industry and governmental agencies are focused on reducing or eliminating Salmonella both in live birds and in the processing plant Hargis et al 2001 Antibiotic resistance especially antibiotic resistance due to antibiotics administered to food produ
73. virus de estos receptores as como tambi n en la neutralizaci n viral mediada por anticuerpos 13 El virus de IA es sensible al calor pH extremos solventes org nicos y detergentes 14 15 IA es estable en el ambiente protegido por materia org nica puede ser almacenado a 70 Cy resistir la liofilizaci n 16 Los virus de Influenza VI se organizan en g neros o tipos de acuerdo a reacciones serol gicas de prote nas como NP o MI 17 la clasificaci n resulta en tres tipos A B y C donde IA pertenece al tipo los tipos B y C no han sido aislados en pollos 18 Una subclasificaci n del virus de IA basada en reacciones serol gicas de HA y NA describe 15 HA y 9 NA reconocidas 17 la mayor a de las combinaciones de HA y NA se ha observado en los virus de IA aislados en pollos y aves salvajes 18 La vacunaci n y medidas de bioseguridad son la principal estrategia para el control de IA En el presente las vacunas no pueden proteger contra muchos serotipos y esto es debido a que los pollos son susceptibles a cualquier serotipo de los 15 HA conocidos 19 Las variaciones antig nicas en HA y NA entre los serotipos son muy comunes debido a la presi n por vacunaci n y a la recombinaci n 20 Actualmente la investigaci n con IA ha guiado sus esfuerzos hacia el desarrollo de una vacuna basada en un pequeno ectodominio de la prote na matriz 2 de VI M2 denominado M2e el cual es una prote na de membrana homotetr mero que fu
74. y da o al consumidor Uno de nuestros esfuerzos se enfoca en la expresi n de ant genos de C jejuni en sistemas tanto procariotes como eucariotes para su empleo como vacuna contra la colonizaci n bacteriana 2 reunion AECACEM Quer taro 2009 P g 127 Influenza aviar es conocida por ser una enfermedad sist mica que produce s ndromes desde infecciones asintom ticas signos respiratorios baja de postura hasta mortalidad cercana al 100 9 El virus de JA es clasificado en la familia de los Orthomyxoviridae genero influenzavirus tipo A 10 11 IA es considerada un problema global y su prevenci n y control requiere de la cooperaci n internacional 9 En la superficie del virus de IA se encuentran dos tipos de proyecciones glicoproteicas trimeros con forma de vara denominados hemaglutininas HA y tetr meros con forma de hongo denominados neuraminidasa NA 10 El genoma viral del virus de IA esta compuesto por ocho segmentos cadena sencilla sentido negativo RNA que codifica para diez prote nas ocho prote nas constitutivas del virus HA NA NP M1 M2 PB1 PB2 y PA y dos no constitutivas del virus NSI y NS2 observadas en el citoplasma de la c lula infectada 12 La uni n del virus de IA se realiza por medio de las HA adem s de que estas juegan un papel importante en la virus neutralizaci n medida por anticuerpos NA contribuye como receptor celular y en procesos enzim ticos que intervienen en la liberaci n del
75. 0 2 ng per mouse all immunised mice were protected while the control group rapidly died unpublished results Recombinant spores of B subtilis were also shown to be able to prime mice by the mucosal route Animals immunised by the oral route with spores expressing TTFC developed an efficient secondary response following a subcutaneous injection with soluble TTFC 58 unpublished results 7 Perspectives The main goal in vaccine development is the design of heat stable non parenteral vaccines which simplify vaccine delivery Yet correct targeting of antigens to the most appropriate cellular compartment for generation of a protective immune response is still an unresolved task Bacillus spores used widely as probiotics have an excellent safety record in humans when taken orally Due to the physical and biological characteristics of the spore these preparations powders or spore suspensions in distilled water are extremely resistant and have a prolonged shelf life Also the cost of production of spores for oral bacteriotherapy 1s low with respect to any production of purified vaccine components The option to use these organisms for generation of recombinant vaccines 1s made even more feasible by the well described systems available for genetic engineering of B subtilis The immunostimulating properties of spores their interaction with antigen presenting cells APC and induction of pro inflammatory cytokines are characteristics which tak
76. 2 27 36 y 40 semanas as mismo fueron colectadas muestras de humor acuoso e hisopos de ojo para realizar aislamiento de Mycoplasma sp en aves de 40 semanas En las muestras remitidas para histopatolog a las lesiones m s relevantes fueron las observadas en ojo las cuales consistieron en queratoconjuntivitis y panuveitis fibrinoheterofilica y linfocitaria de moderada a severa aunado a lesiones traqueales y pulmonares que se caracterizaron por traque tis y neumon a fibrinoheterofilica en las etapas iniciales progresando a traque tis y neumon a linfocitaria en las etapas finales En las muestras de las aves de 22 semanas se encontraron lesiones compatibles con enfermedad de Marek en secciones de h gado proventr culo y enc falo De los hisopos y humor acuoso remitidos para aislamiento se logro recuperar una cepa de Mycoplasma gallisepticum cabe se alar que las aves no hab an sido vacunadas Esa cepa de Mycoplasma gallisepticum fue clonada para pruebas de concentraci n minima inhibitoria en donde la tiamulina tilosina y doxiciclina fueron los antibi ticos que se requirieron en menor cantidad para inhibir el crecimiento de esa cepa de Mycoplasma gallisepticum En conclusi n la inmunodepresi n causada por la infecci n del virus de Marek y la presencia constante de virus vacunales como Newcastle y Bronquitis contribuyeron en la patog nesis de las lesiones oculares causadas por la infecci n de Mycoplasma gallisepticum Palabras clave Myco
77. 214 0 12 0 81 0 06 0 82 0 03 0 90 0 16 PECHUGA i E 0 23 0 04 0 53 0 09 1 68 0 24 1 26 0 28 0 31 0 08 0 35 0 30 1234017 1 44 0 34 1 62 0 16 1 46 0 17 0 91 0 20 0 92 0 07 2 24 0 25 0 97 0 21 1 75 0 33 1 54 0 24 1 92 0 39 0 59 0 05 1 77 0 18 1 67 0 29 c Medias con diferente literal son estadisticamente significativas a P lt 0 05 EEM Error est ndar de la media Porcentaje del total de acidos grasos AAT aceite de atun En pierna y muslo LA y AA no tuvieron diferencia entre sexos P gt 0 05 sin embargo al adicionar AAT disminuyeron P lt 0 05 en relaci n al testigo En pechuga LA no mostr diferencia P gt 0 05 entre sexos al adicionar AAT pero al ir incrementando el AAT aumento P lt 0 05 con 1 y 1 25 en relaci n al testigo para AA existi diferencia P gt 0 05 entre sexos sin embargo al adicionar AAT disminuy P lt 0 05 con 0 75 en relaci n al resto de los tratamientos Para los cidos omega tres los resultados se presentan en el Cuadro 7 Para pierna y muslo los AG 3 DHA no tuvo diferencia entre sexos P gt 0 05 para los efectos principales sin embargo con 1 y 1 25 de AAT se increment P lt 0 05 el nivel de DHA en relaci n al testigo para DPA el nivel del AGo 3 fue mayor P lt 0 05 para las hembras sin embargo al aumentar el AAT disminuy P lt 0 05 para EPA no hay
78. 4 25 26 21 28 29 30 sL lethal H5N1 avian influenza virus through adenovirus based immunization Journal of Virology 80 1959 1964 Garcia M Crawford J M Latimer J W et al 1996 Heterogeneity in the haemagglutinin gene and emergence of the highly pathogenic phenotype among recent H5N2 avian influenza viruses from Mexico Journal of General Virology 77 1493 1504 Gardin Y 2007 Vaccination against h5nl highly pathogenic avian influenza some questions to be addressed Proceedings of the 56th Western Poultry Disease Conference March 26 29 2007 Las Vegas Nevada USA pp 80 83 Ge J Deng G Wen Z Tian G Wang Y Shi J Wang X Li Y Hu S Jiang Y Yang C Yu K Bu Z and Chen H 2007 Newcastle Disease Virus Based Live Attenuated Vaccine Completely Protects Chickens and Mice from Lethal Challenge of Homologous and Heterologous HSN1 Avian Influenza Viruses Journal of Virology 81 150 158 Kilpatrick A M Chmura A A Gibbons D W Fleischer R C Marra and Peter Daszak P I 2006 Predicting the global spread of HSN1 avian influenza Proceedings National Academy of Sciences of the USA 103 51 19215 19216 Lee C W Senne D A and Suarez D L 2004 Effect of vaccine use in the evolution of Mexican lineage H5N2 avian influenza virus Journal of Virology 78 8372 8381 Lipatov A S Webby R J Govorkova E A S et al 2005 Efficacy
79. 40 min box and nebulizer 24 h period A catheter was introduced through the wing vein and advanced to the pulmonary artery gt 2mg LPS challenge 2 reunion AECACEM Quer taro 2009 P g 264 Materials and Methods Experiment Male broilers 43 to 90 d reared on clean litter in environmental chambers Non Aerosolized broilers NA LPS I V Water Aerosolized broilers WA 11 LPS Red Food Color Aerosolized broilers RA 1 LPS Yellow amp Blue Food Color Aerosolized broilers 1 1 LPS Propylene Glycol Aerosolized broilers PGA 1 1 LPS reunion AECACEM Quer taro 2009 P g 265 Percentage change in PAP Results Experiment 1 Red Food Color Aemsolized broilers nz 13 NA Non Aerosoli zed broilers n 1 v WA Water Aerosolized brollers nz TU YEA Yellow amp Blue Aerosolized broilers n SE FGA Prooylene Glycol Aerosolized brollers n 9 sample Intervals 2 min each 2 reunion AECACEM Quer taro 2009 P g 266 Conclusions The responses to LPS were higher using than routes probably due to the direct interaction with Immune cells Pulmonary mucosal defenses appear to apply a pattern of tolerance by binding inactivating or discriminating non threatening agents to minimize inflammation strong Immune responses may produce more damage than protection Ewaschul and Dieleman 2006 Aerosol Red food colorant 3 and P
80. 53 9 2 Belo P S D R Romsos and G A Leveille 1976 Blood metabolites and glucose metabolism in the fed and fasted chicken J Nutr 106 1135 1143 Coll AP I S Farooqi S O Rahilly 2007 The hormonal control of food intake Cell 129 2 251 262 4 dela Fuente A P Brazhnik and P Mendes 2002 Linking the genes inferring quantitative gene networks from microarray data Trends Gen 18 395 398 5 Ellestad L E W Carre M Muchow S A Jenkins X Wang L A Cogburn and T E Porter 2006 Gene expression profiling during cellular differentiation in the embryonic pituitary gland using cDNA microarrays Physiol Genomics 25 414 425 6 Geyra A Z Uni O Gal Garber D Guy and D Sklan 2002 Starving affects CDX gene expression during small intestinal development the chick J Nutr 132 911 917 7 Halevy O Geyra M Barak Z Uni and D Sklan 2000 Early posthatch starvation decreases satellite cell proliferation and skeletal muscle growth in chicks J Nutr 130 858 864 8 Juul Madsen Su and P Sorensen 2004 Influence of early or late start of first feeding on growth and immune phenotype of broilers Br Poult Sci Apr 45 2 210 22 9 Knight C D and J J Dibner 1998 Nutritional programming in hatchling poultry Why a good start 15 important Poult Dig Aug Sept 20 26 10 Noy Y A Geyra D Sklan 2001 The effect of early feeding on growth and small intestinal development in
81. 976 Long and Millard 1979 Fitz Coy 1993 Smith A L et al 2002 Jenkins et at 2004 But the question that has not been answered 15 how prevalent or wide spread are these variant organisms Some strains or isolates within a species may be better antigens for a vaccine candidate than others Some vaccines use multiple maxima antigens to enhance the antigen capabilities of that species Many of these reports might not have address vaccines antigens and might have also challenged birds when they were poorly immunized or due to timing of the challenge of the birds 2 reunion AECACEM Quer taro 2009 P g 93 There have been reports concerning organisms within a species that behave uniquely different but are these one and the same species or are other species involved Researchers recently shared data on the genetic characterization of coccidia from chickens and revealed more taxonomic confusions about the species of chicken Eimeria These unknown agents are referred to as cryptic species These findings are agreeing with normal species diversity How important are these organisms Within these diverse populations what is the relative abundance of these organisms Things to ponder 1 2 3 4 5 6 Conformation on the validity of the species some references acknowledge seven species other acknowledge nine species Based on my working experiences with coccidia of chicken there are nine species E acervulina E mivat
82. D Swayne and B M Hargis Department of Poultry Science University of Arkansas Fayetteville AR USA and 3Department of Poultry Science Texas A amp M University College Station TX USA Southeast Poultry Research Laboratory USDA ARS Athens GA Development and Evaluation of a Novel Bacterial Vaccine Vector system Against Viral Bacterial and Protozoal Pathogens 9 L Layton K Cole D KapczynsKP M M Cok Y M Kwon L R W J Bottle D Swayne and B M Hargis Department of Poultry Science University of Arkansas Fayetteville AR USA and Department of Poultry Science Texas A amp M University College Station TX USA Southeast Poultry Research Laboratory USDA ARS Athens GA UNIVERSITY OF ARKANSAS e tt 2 reunion AECACEM Quer taro 2009 P g 161 Vaccination Important Medical Advancement www ehistorvbuff co m pastuerals html http www wisedude com http focosi immunesig org preventionprima santas dieran immunovaccine html 2 reunion AECACEM Quer taro 2009 P g 162 Vaccination Traditional m Live Attenuated A Weakened primary pathogen More favorable administration routes Vaccine reaction akilled Killed by chemical or mechanical Inactivation More cost prohibited labor more antigen needed for response 2 reunion AECACEM Quer taro 2009 P g 163 Salmonella as a Vaccine Vector Low pathogenicity S
83. E LOS PC PELIGROS EVIDENTES SE CONTROLAN MEDIANTE PROGRAMAS PREVENTIVOS MIENTRAS QUE LOS PCC SE CONTROLAN MEDIANTE UN PROGRAMA EMERGENTE El razonamiento es NO PUEDO CONTROLAR LOS PUNTOS FINOS DE MI PROCESO SI ANTES NO CONTROLO LO BASICO Y EVIDENTE Y este razonamiento nos lleva a lo que se conoce como PROGRAMAS DE PRERREQUISITOS programas previos a la implementaci n del HACCP desarrollados para puntos de control algunos de los cuales son los siguientes o Definici n de la Misi n y Visi n de la Empresa Manual de Calidad Pr cticas de Sanitizaci n Buenas Pr cticas de Manufactura Control de plagas Control de qu micos Retiro y rastreabilidad del producto Quejas del consumidor relacionadas con la seguridad del alimento Or O QC o 12029 Como en el sector productivo pecuario no se produce lo que se considera propiamente alimento sino solo la materia prima que se procesara posteriormente en las plantas entonces no es posible aplicar un HACCP que por definicion se aplica solo a procesos de elaboracion de alimentos pero 51 sus principios y prerrequisitos y uno de los mas importantes son las Buenas Pr cticas de Producci n Primaria o Buenas Pr cticas Pecuarias equivalentes a las GMP s Esto significa que el primer paso para un negocio seguro en el sector de producci n primaria granjas incubadoras etc es trabajar sobre los puntos b sicos de control pr cticas estrat gicas que var an en cada empresa pero
84. ECA 2002 mayo 1 4 Puerto Vallarta Jalisco M xico M xico DF Asociaci n Nacional de Especialistas en Ciencias Av colas de M xico AC 2002 Cuadro 1 Pigmentaci n cut nea en pollo de engorda con un programa anticocidiano permanente y desafiado con Eimeria spp Nota Letras distintas entre tratamientos y dentro de una misma semana de edad denotan diferencia estadistica significativa lt 0 05 Cuadro 2 Numero de ooquistes por gramo de heces en pollo de engorda con un programa anticoccidiano permanente y desafiado con Eimeria spp Nota Letras distintas entre medias de los tratamientos dentro de una misma semana de edad denotan diferencia estadistica significativa lt 0 05 2 reunion AECACEM Quer taro 2009 P g 124 RESPUESTA ANTIBIOTICA IN VITRO EN DOS CEPAS DE Mycoplasma synoviae AISLADAS EN GALLINAS DE POSTURA CLINICAMENTE SANAS Y ENFERMAS Camacho Jos Angel Ju rez Mireya Petrone V ctor Gigantes Tepatitlan S A de C V Collins Divisi n Veterinaria S A de FESC UNAM vmpetrone hotmail com Los micoplasmas aviares son de gran importancia para la industria avicola debido a que representan una fuente de p rdidas econ micas importante ya sea como pat geno nico como parte de un complejo respiratorio Hablando particularmente de Mycoplasma synoviae su importancia se ha relacionado principalmente con las perdidas asociadas a problemas locomotores y retraso en el crecimiento e
85. G sensitized or primed the respiratory system allowing a more consistent pulmonary hypertensive response to 14 LPS reunion AECACEM Quer taro 2009 P g 267 Materials and Methods Experiment 2 Male broilers 35 to 53 d reared on previously used litter in a commercial type poultry house Non Aerosolized LPS i v broilers NA LPS iv LPS Non Aerosolized Saline broilers NA S 1 mL of i t 0 9 NaCl Non Aerosolized LPS broilers NA LPS 1 t LPS Red Food Color Aerosolized broilers RA red food color Lt LPS 2 reunion AECACEM Quer taro 2009 P g 268 PAF men Hg Results Experiment 2 NA LPS Non Aerosolized L PS broilers n 10 NA LPS 1 v Non Aerosolized LP 3 1 n 10 R Red Food Color Aerosolized broilers n 10 i 5 Non Aerosolized saline broilers 9 32 LPS 30 d E 28 ssl kal y pus WN t d 26 ab ab ab ab NK A d ab pm gt ap 24 ab apt a 4 Xn A E 20 i d ab 8 i b i 7 20 A b b A b sample intervals 2 min each 2 reunion AECACEM Quer taro 2009 P g 269 Conclusions Exposure to used litter appeared to naturally prime or sensitize the airways to react with hypertensive responses after 1 1 LPS reunion AECACEM Quer taro 2009 P g 270 Materials and Methods Experiment 3 Male broilers 49 to 33 d reared on clean wood shaving
86. GCGC CCAGATGGARATCTGGIGGTAA 2 reunion AECACEM Quer taro 2009 P g 174 Cell Surface Expression of Chosen Epitope and 00154 my Confirmed by A 1 DNA sequencing 2 Plate agglutination L e pitope 2 reunion AECACEM Quer taro 2009 P g 175 hIKImi Acid Tyrosine Essential and TERI 4 Phenylalanine in Host Cell NY CES Tryptophan d 1 xi 3 E 2 3 dihydroxybenzoic acid ud Para aminobenzolc acid folate Chorismic Acid BAN Parahydroxybenzolc acid el O succinyl benzoic acid i A E NYA encodes a periplasmic serine protease that degrades aberrant proteins during extracytoplasmic stress conditions E NYA impairs host response to stress and its ability to survive In macrophages increased susceptibility to hydrogen peroxide 11 0 2 reunion AECACEM Quer taro 2009 P g 176 Avian Influenza kaiki WO aka sah Co a i P 1 ly ate b COUP 3 P QUI V iui v 2 reunion AECACEM Quer taro 2009 P g 177 Novel Vaccine Concept Non Immunogenic but Immunoprotective Non Immunogenic but Immunoprotective Potential antigenic epitopes that have been conserved unchanged over time olrategy Is to hide these Protective when presented to the Immune system Presented by live bacterial vector reunion AECACEM Quer taro 2009 P g 179 18 NEWS A One Size
87. MS uL NN uU T pe a uid ads Uter pu T t wo x a pathogen thereby reducing the pathogen load In the environment dramatically reducing the 22 rate of herd infection and transmission of disease 65 through the hera 2 reunion AECACEM Quer taro 2009 P g 168 Epitope Selection Bra Aino Aci Overall immune response Sequences Which IE as highly Conserved a Antigenic immunogenic a Immunoprotective B cell T cell Response mor 08 B cell with I tides c mplexed with T viral peg illa i Macriphag with menger and CDA B cell pr atis and predica itp courses cm utexas edu robertus ch330k o verheads Lc immune res pg 2 reunion AECACEM Quer taro 2009 P g 169 Type Glycoprotein Member of INF Ligand Family Binds CD40 on B cells and Activated T cells CD40 eWAEKGY Biologically Active Binding Region Vega et al 2003 2 reunion AECACEM Quer taro 2009 P g 170 Salmonella Vectored Vaccine Candidate Outside of the cell Loop 1 9 y Presumptive Antigenic Epitope A multiole copies Tal MAN B tie d sed LS z i Va f wi i Fiw vun FOIS a A a ai B B B membrane Conos Inside of the cell 2 reunion AECACEM Quer taro 2009 P g 171 2 reunion AECACEM Quer taro 2009 P g 172 Scarless
88. N d d Mall 4 E maxima strains 2 E tenella strains 2 reunion AECACEM Quer taro 2009 P g 189 Experimental Design Experiment Terminated 0 Primary Direct Challenge 75 5 Vaccination Eimeria maxima OAY QW 2 reunion AECACEM Quer taro 2009 P g 190 Evaluation of Coccidiosis Candidate Vaccine Mortality at Day 26 Challenge Group 9 Days Post Challenge Vaccinated TRAP 1 40 2 TRAP Serum Antibody Titers 14 A a a fit v ds mur Control TRAP Vaccinated reunion AECACEM Quer taro 2009 P g 192 Necrotic Enteritis Clostridium perfringens 2 reunion AECACEM Quer taro 2009 P g 193 Collect Blood Samples y Primary Culture Vector Recovery Vaccination cecal tonsils liver amp spleen 2 reunion AECACEM Quer taro 2009 P g 194 Colonization Invasion and Clearance of Salmonella Vaccine Vector Daya Day3 Dayl0 Dayl0 Day 20 Day 20 Day 30 Day 30 Liverf Cecal Liverf Cecal Cecal Liver Cecal Spleen Tonsils Spleen Tonsis Spleen Tonsis Spleen Tonsil 015 ots ons ots 015 05 ond ond SE 445 1018 1045 tons 715 tite 15 Vector Alpha 9 15 14 15 12 15 1315 12 05 1 14 9 14 Toxin Vaccine 2 reunion AECACEM Quer taro 2009 P g 195 0 39 SP Sample Negative Control Positive Ctl Negative Ctl E Saline 0 20 BSE V
89. Olsen et al 2001 suggested that the heavy use of antimicrobial agents can cause an increase the outbreaks of fluoroquinolone resistant Salmonella enteritidis In 2001 CDC reported that among the 1419 paratyphoid Salmonella isolates reported to the CDC laboratories 28 were resistant to one or more antimicrobial agents 22 were resistant to two or more agents 12 were resistant to five or more agents and 3 were resistant to eight or more agents Of the 176 isolates resistant to five or more agents 114 65 were serotype Typhimurium Of the 40 isolates resistant to eight or more agents 31 77 were serotype Newport The antimicrobial agents to which the 1419 Salmonella demonstrated the highest prevalence of resistance were tetracycline sulfamethoxazole streptomycin and ampicillin 280 20 were resistant to tetracycline 251 18 were resistant to sulfamethoxazole 241 17 were resistant to 2 reunion AECACEM Quer taro 2009 P g 9 streptomycin and 247 17 were resistant to ampicillin Among the 282 Salmonella enteritidis isolates 40 14 were resistant to one or more antimicrobial agents and 16 6 were multidrug resistant NARMS Annual Report 2001 Antibiotics can reduce Salmonella in infected poultry Goodnough and Johnson 1991 Muirhead 1994 However Manning et al 1992 1994 have reported increased Salmonella colonization following treatment of chickens with selected antibiotics possibly as a result of des
90. S CON UN TRATAMIENTO DE ACIDO CITRICO ACUOSO M ndez Albores Del Rio Garcia J C Moreno Ramos C Salgado Transito L Moreno Mart nez E UNAM Facultad de Estudios Superiores Cuautitl n Unidad de Investigaci n Multidisciplinaria Laboratorio 14 Alimentos Micotoxinas y Micotoxicosis Las aflatoxinas son metabolitos secundarios producidos por ciertos hongos pertenecientes principalmente al g nero Aspergillus Este tipo de compuestos suelen producirse en una gran variedad de productos agr colas y son los contaminantes naturales de los alimentos mas extendidos a nivel mundial siendo altamente t xicos mutagenos cancer genos terat genos inmunosupresores Debido a la gran variedad de efectos t xicos y sobre todo a su extrema termoresitencia la presencia de las aflatoxinas en los alimentos es considerada de alto riesgo para la salud del hombre y de sus animales Consecuentemente en el presente trabajo se evalu la degradaci n de las aflatoxinas en las raciones destinadas para las aves mediante un tratamiento con cido c trico acuoso confirmando la detoxificaci n con el m todo de inmunoafinidad con columna de anticuerpos monoclonales el ensayo de Ames y con patos de un d a de edad Peking White Las determinaciones de inmunoafinidad mostraron que la aflatoxina a una concentraci n inicial de 110 ng g fue parcialmente destoxificada 8676 por el tratamiento acido Los resultados de la prueba de Ames indicaron que la mutag
91. a Homeopat a ha mostrado ventajas que son dif ciles de soslayar tanto para las circunstancias que caracterizaron el desarrollo econ mico de la sociedad humana en un pasado no tan lejano y mucho m s importante en el escenario presente Siendo algunas de estas ventajas el costo el nulo efecto contaminante y ser una corriente holistica O sea el costo de adquisici n de los medicamentos la designaci n espec fica de estos en esta corriente es REMEDIO 1 es menor a los Alop ticos La contaminaci n que puedan generar las substancias que se administra e ingieren los animales en el presente son de fundamental importancia ya que en la actualidad se sabe del riesgo que los residuos medicamentosos significan para la salud humana al permanecer tanto en el organismo 2 reunion AECACEM Quer taro 2009 P g 145 animal y sus productos pudiendo pasar por la ingesta de los mismos al organismo humano La otra posibilidad de este riesgo se dar a en relaci n a la contaminaci n que puede darse a nivel ambiental esto por medio de los desechos animales La ventaje en raz n de este factor que tiene la Homeopat a es que en este m todo el efecto terap utico esta en raz n al valor energ tico o sea la potencia ver adelante de los remedios y no en la proporci n del contenido material del sustrato medicamentoso 2 El elemento holistico esta dado en el hecho de que para esta corriente medica los signos y s ntomas que manifiesta el e
92. a la expresi n de prote nas recombinantes en plantas En este caso el ant geno es expresado por un genoma de virus de plantas modificado y el genoma de las plantas productoras no es afectado El virus modificado es inoculado en el tejido de las plantas t picamente hojas infectando a las c lulas de la planta y permitiendo la expresi n de las prote nas recombinantes en el citoplasma de las c lulas vegetales por lo que al igual que la expresi n en cloroplastos estas prote nas no son glucosiladas 30 El empleo de estos tiene ventajas como la producci n de prote na recombinante en un tiempo de 3 a 14 d as pos infeccion seg n el tipo de sistema usado 26 Su empleo permite la f cil producci n de una gran cantidad de diferentes construcciones para probar aunado a que es f cil su inoculaci n permitiendo su empleo en gran escala 30 Es Importante considerar la apropiada glucosilaci n proteica una correcta conformaci n y ensamblaje as como optimizaci n de codones para la selecci n de un sistema de expresi n adecuado a lo requerido 32 En el caso de plantas para alcanzar altos niveles de expresi n se consideran varias estrategias como la optimizaci n de genes promotores fuertes para un tejido especifico secuencias lideres no traducibles y 3 fuertes se alizaci n sub celular fusi n a transportadores estables entrecruzamiento de plantas obtener homozigosis entrecruzamiento de l neas transg nicas con alta expresi
93. a producci n Cuarto Principio Todas las pr cticas desarrolladas e implementadas en una explotaci n tienen impacto sobre la sanidad de la misma por lo que en la realidad no existe un programa de bioseguridad sino un nivel de bioseguridad que se obtiene al trav s del dise o de pr cticas que contemplan los peligros PREDECIBLES asociados a los diferentes procesos el grado de riesgo asociado a cada peligro y las acciones para controlarlos POE POES etc Estas se conocen generalmente como BUENAS PR CTICAS DE PRODUCCI N PRIMARIA O BUENAS PR CTICAS PECUARIAS LITERATURA CONSULTADA 1 Asociaci n de Productores Av colas de Chile A G Chilean Pork amp Poultry Quality Assurance Program y Asociaci n Gremial de Productores de Cerdo de Chile 2003 Manual de Implementaci n HACCP para Aves Cerdos y Bovinos Versi n Final a Consulta 40 pp 2 Asociaci n de Productores Av colas de Chile A G Chilean Pork amp Poultry Quality Assurance Program y Asociaci n Gremial de Productores de Cerdo de Chile 2003 Manual de Implementaci n HACCP para Aves Cerdos y Bovinos Versi n Final a Consulta 40 pp 3 Asociaci n de Productores Av colas de Chile A G Chilean Pork amp Poultry Quality Assurance Program y Ministerio de Agricultura Gobierno de Chile 2003 Manual de Auditor a de Buenas Pr cticas en Producci n Av cola Versi n I 60 pp 4 Asociaci n de Productores Av colas de Chile A G Chilean Pork amp Poultry Quality Assur
94. a serotypes isolated from humans i 0 2000 2001 2002 2003 2004 2005 Year reported 2 reunion AECACEM Quer taro 2009 P g 46 DIAGNOSIS AND CONTROL OF RESPIRATORY DISEASES OF POULTRY WITH SPECIAL ATTENTION TO AVIAN INFLUENZA AND Mycoplasma spp Hafez Mohamed Hafez Institute of Poultry Diseases Faculty of Veterinary Medicine Free University Berlin Konigsweg 14163 Berlin Germany E mail hafez vetmed fu berlin de Respiratory diseases of poultry remain of major economic and public health importance Many pathogenic microorganisms are present to a limited degree under most management conditions If conditions favourable for multiplication of the specific pathogen exist an active disease outbreak may occur in apparently healthy flocks The severity and course of any respiratory disease 15 influenced by virulence of the agent immune status of the birds and management Respiratory diseases of poultry are associated with severe economic losses due to high mortality high medication cost drop egg production in layer and breeder flocks and in many case low fertility and hatchability In breeder flocks attention must be paid to prevent infections with vertically transmitted agents Early recognition and monitoring programmes are essential in managing the infections and minimizing the economic impacts Many of these diseases once introduced into a geographic area can explode into an epidemic and may have a significant negativ
95. accine in the control of avian influenza In C W Beard and B C Easterday eds Proceedings of the Second International Symposium on Avian Influenza U S Animal Health Association Richmond VA 1987 264 270 Murphy BR Webster RG Orthomyxoviruses In Fields BN Knipe DM Howley PM eds Fields Virology 1996 3rd ed Lippincott Raven PA 1397 1445 Neirynck S Deroo T Saelens X Vanlandschoot P Jou WM Fiers W A universal influenza A vaccine based on the extracellular domain of the M2 protein Nature medicine 1999 10 1157 1163 De Filette M Martens W Roose K Deroo T Vervalle F Bentahir M Vandekerckhove J Fiers W Saelens X An influenza A vaccine based on tetrameric ectodomain of matrix protein 2 J Biol Chem 2008 283 11382 11387 Tompkins SM Zhao ZS Lo CY Misplon JA Liu T Ye Z Hogan RJ Benton KA Tumpey TM Epstein SL Matrix protein 2 vaccination and protection against influenza viruses including subtype H5N1 Emerg Infect Dis 2007 13 426 435 Huleatt JW Nakaar V Desai P Huang Y Hewitt D Jacobs A Tang J McDonald W Song L Evans RK Umlauf 5 tussey L Powell TJ Potent immunogenicity and efficacy of a universal influenza vaccine candidate comprising a recombinant fusion protein linking influenza M2e to TLRS ligand flagellin Vaccine 2008 26 201 214 De Filette MA Ramneb A Birkett A Lycke L wenadler Min Jou BW Saelens X Fiers W The universal influenza vaccine M2e HBc administered intranasally i
96. adly AM McDougald LR Swayne DE editors Disease of Poultry Ames Iowa Iowa State University Press U S A 2003 974 990 Juarez M A Evaluacion de parametros productivos y grado de pigmentacion en pollos de engorda vacunados contra coccidiosis y medicados con salinomicina Memorias de la XXVII convenci n anual de la ANECA 2002 mayo 1 4 Puerto Vallarta Jalisco M xico M xico DF Asociaci n Nacional de Especialistas en Ciencias Av colas de M xico AC 2002 Ju rez RM Efecto de varios agentes sobre la pigmentaci n cut nea en pollos de engorda tesis de licenciatura M xico DF Facultad de Medicina Veterinaria y Zootecnia UNAM 2002 Williams RB Laboratory tests of phenolic disinfectants as oocysticides against the chicken coccidium Vet Rec 1997 141 447 448 Belli IS Smith CN Ferguson JPD The coccidian oocyst a tough nut to crack Trends in Parasitol 2006 22 9 416 423 Long PL Millard BJ Joyner LP Norton CC a guide to laboratory techniques used in the study and diagnosis of avian coccidiosis Fol Vet Lat 1976 4 201 217 Trout JM Lillehoj HS Eimeria acervulina Evidence for the involvement of CD8 lymphocytes in sporozoites transport and host protection Poult Sci 1995 74 1117 1125 Vicente SJL Pigmentacion en la industria avicola En Serrano AR y Hernandez VX Sistemas de Producci n animal I Aves Vol FMVZ UNAM 2005 203 221 Long PL Rowell JG Counting oocysts of chicken coccidia Lab Prac
97. afectadas tumefaciens incluyen dicotiledonarias gymnoespermas y algunas monocotidelonarias 26 Agrobacterium es una bacteria presente en la tierra que al detectar una planta con una herida se desplaza guiada por las azucares y los compuestos fen licos exudados por la herida se adhiere y comienza a transforma las c lulas de la planta al inducirse la transcripci n de genes de virulencia presentes en un pl smido especifico denominado Tumor inductor Ti ADN plasmido el cual contiene el ADN de transferencia T ADN que junto con prote nas bacterianas VirDI VirD2 VirE2 inducen la transcripci n procesamiento de T ADN su exportaci n e integraci n al genoma de la planta El T ADN codifica para una hormona de planta que induce la producci n de enzimas que estimulan el crecimiento de tumores y enzimas metab licas de sustratos espec ficos para Agrobacterium Como resultado se genera un microambiente ideal para esta bacteria 48 Para la transferencia de ADN con Agrobaterium se requiere que el gen de inter s sea insertado entre los bordes naturales del T ADN presente en el pl smido original de la bacteria T1 ADN El cual se delimita por dos bordes con dos secuencias de gu a imperfectas de 25 pares de bases de longitud y son estas cis elementos requeridos por el T ADN de la bacteria para su inserci n al genoma del n cleo de las c lulas de las plantas 26 49 La inserci n aleatoria observada en este m todo sugiere un mecani
98. al ecology within the poultry gut Due to the recent implementation of the USDA FSIS Salmonella attack plan and the inherent difficulties with Campylobacter in poultry this manuscript we will focus primarily on Salmonella however the same ecological principles apply to all targeted foodborne pathogenic bacteria Salmonella is diverse widespread and present in many environments 2 reunion AECACEM Quer taro 2009 P g 36 Although there are more than 2 500 serotypes of the Gram negative bacteria Salmonella only a few serotypes are responsible for the majority of human illnesses CDC 2006 USDA FSIS 2007 The serotypes isolated most frequently from poultry products and humans pooled across the U S are shown in Table 1 The most common serotype found in eggs the U S 1s S Enteritidis Braden 2006 but it is found at a very low prevalence Ebel and Schlosser 2000 There is a high degree of correlation between the serotypes found poultry products and those responsible for a large number of human illnesses Table 1 Therefore it is critical to target the sources of these serotypes to interrupt the transmission cycle before they can cause human illnesses although serotypes involved do vary yearly Figure 1 Salmonella spreads easily in both chickens and turkeys via a fecal oral contamination route Rodriguez et al 2006 In a broad study 16 of poultry farms tested positive for Salmonella and was present in soil beddi
99. alle de Salvador Diaz Mir n No 89 en la Colonia Santiago Zapotitl n de la Delegaci n Tl huac Distrito Federal a una altura de 2250 msnm Las aves fueron colocadas en corrales dispuestos en una caseta experimental dividida en dos secciones Aves Se utilizaron 480 pollitos Ross de 1 d a de edad con un peso promedio de 49 0 6g mitad hembras y mitad machos provenientes de una planta incubadora comercial A su llegada los pollitos fueron asignados aleatoriamente a ambos tratamientos y fueron criadas de manera comercial bajo sistemas convencionales de manejo Los requerimientos nutricionales fueron 2 reunion AECACEM Quer taro 2009 P g 140 cubiertos de acuerdo con los requerimientos de la estirpe y se les proporcion agua y alimento libre acceso durante toda la prueba Dise o experimental Se realiz la limpieza de todas las instalaciones y equipo de rutina y posteriormente administraron el in culo de Eimeria por medio de un aspersor con gota gruesa en todos los corrales Al t rmino de esto se asign a una secci n el tratamiento con el producto a probar y a la otra la desinfecci n con el producto general Estos productos tambi n se utilizaron en los tapetes sanitarios respectivos de cada secci n durante el tiempo que dur la prueba Ambas secciones se cerraron por 3 d as para que actuara el desinfectante Desinfectantes El desinfectante especifico contra Eimeria spp que se compone principalmente de o cresol 4 cholor
100. almonella isolates effectively present antigens to immune cells after mucosal penetration Recent work from our laboratory indicates that obligatory expression of cell surface epitopes can result in strong and persistent antibody responses 2 reunion AECACEM Quer taro 2009 P g 164 Attenuated Salmonellae as Vectors Some isolates are invasive Genetically tractable Well characterized virulence mechanisms Provide cross protection against related Salmonella serovars Strong mucosal immune response reunion AECACEM Quer taro 2009 P g 165 Pi Bacterial got by 4 Macrophage Plasma Intraepithelial ymphocyte 95 Dendritic A ceils 4 9 0 CD4 calls 00 Regulatory T cells 2 reunion AECACEM Quer taro 2009 P g 166 Advantages of mucosal routes of immunization E Induces protective Immunity at the site of Infection E Induces both systemic and mucosal immunity a Effective in the presence of maternal antibodies No Injection site reaction no needles required a Readily administered I e oral vaccines combined with feed reunion AECACEM Quer taro 2009 P g 167 Even if mucosal immunization does not totally eliminate infection Mucosal antibody limits the degree of replication 14 1 n LS p MA F TT ad i 1 an i P 7 7 n
101. alth Millsboro DE 2 reunion AECACEM Quer taro 2009 P g 200 Live oocyst vaccination has been used by the poultry industry for over 30 years Initial use was primarily for broiler breeder and replacement layer stock Chapman ef al 2002 The basis for vaccination Is the host immunity that Is generated against subsequent infections by the same species Yun ef al 2000 Live oocyst vaccination affords protection against subsequent Eimeria challenge as evidenced by Increased body weight gain Danforth 1998 Crouch ef a 2003 Williams 2003 Lee etal 2005 Improved feed conversion ratios Crouch ef al 2003 Lee etai 2009 Reduced lesion development following challenge Danforth 1990 Crouch et al 2003 Williams 2003 Lee etal 2009 2 reunion AECACEM Quer taro 2009 P g 202 Limited AC 2 of Coccidiosis Vaccination m Stream Broiler Production Large scale broller integrators within the U S have been reluctant to introduce vaccination programs due to reported reduced performance Allen and Fetterer 2002 Such reports involve decreased weignt gain and Increased feed conversion compared to feed based anticoccidial usage during grow out Wiliams 2002 Waldenstedt ef al 1999 Danforth 19 Control Measure E Anticoccidial Management Feed Additives Options Feed Conversion Weight Gain Control Measure
102. among the 10 treatment groups were analyzed further 2 reunion AECACEM Quer taro 2009 P g 97 FURTHER DATA ANALYSIS Genes in clusters exhibiting specific and reciprocal responses to fasting and refeeding are currently being evaluated Gene Ontology biological process analysis has been completed for these genes http www agbase msstate edu Gene ontology 15 a list of terms that are assigned to genes using a common vocabulary between species to describe the biological process molecular function and cellular processes that the gene is involved in Additionally for genes that were significant lt 0 05 and differed expression by at least 2 fold 119 genes we determined the human orthologues and submitted our genes for analysis through Pathway Miner a freely available program through the Bioresource for Array Genes http www biorag org This analysis utilizes three available databases to search for genes within a list of submitted genes that are present in a common biological pathway This analysis identified six genes within our list of differentially regulated genes that were associated within a pathway pro opiomelanocortin adrenergic receptor beta 2 somatostatin receptor 5 neuropeptide Y receptor 5 glutamate receptor 8 and relaxin 3 qRT PCR Microarrays yield expression data for thousands of genes simultaneously However the large number of statistical comparisons made can lead a proportionately large number of fal
103. an be grown from a single sample and compete regularly with the growth of a pathogenic one To avoid such difficulties MG and MS DNA probe test kits have been developed and are now commercially available The test is highly sensitive and specific and 15 able to detect small amount of mycoplasmas even in long term frozen samples within 8 hours The cost is comparable to isolation procedures In addition several PCR based tests have also been published for MG and are cited by Kempf 1998 including a multiplex PCR which is designed to detect all four avian mycoplasma pathogens Wang et al 1997 Furthermore a manual published by Lauerman 1998 contains a validated PCR assay for avian mycoplasmas Recently Lierz et al 2008b reported on the use of polymerase chain reactions to detect Mycoplasma gallisepticum Mycoplasma imitans Mycoplasma iowae Mycoplasma meleagridis and Mycoplasma synoviae in birds of prey For serological examinations the most commonly used initial screening test is the rapid serum plate agglutination test SPA The test is based on the use of specific stained antigen for MG MS and MM that are commercially available The test is quick inexpensive and highly sensitive Kleven 1975 but there are also variations between batches in sensitivity and specificity Kleven and Levisohn 1996 Serum plate agglutination suspected reactors generally must be confirmed by other tests such as a Haemagglution inhibition test HI using fres
104. ance Vaccination Is highly effective at generating immunity to Eimeria challenge Vaccination Improves broiler performance during an Eimeria challenge Growth depression associated with vaccination appears between 13 and 1 days of age 2 reunion AECACEM Quer taro 2009 P g 239 Recommendations Vaccination success depends upon early phase of production specifically the starter period Our research has shown a significant interaction between diet and vaccine efficacy establishment when starter protein levels were specifically formulated and fed at a level of 22 protein This enhanced establishment resulted in performance equivalent to ionophore usage in a less effective dietary platform Recommendations Other research offers Insight Into focusing early In production with vaccination Teeter et al 2007 Majority of broiler growth occurs post day 2 Insults to performance Eimeria challenge pre day 2 can be overcome by compensatory gain Insults to performance post day 2 result in permanent performance loss for the animal Vaccination fits this model well Low grade controlled Eimeria Infection early In production peaks by Day 21 results in immunity development and improved performance during post day 27 production reunion AECACEM Quer taro 2009 P g 241 Y 1 E 0 s O ini Y gt y Q 1000000 900000
105. ance All people and things coming onto a poultry farm must be properly cleaned and sanitized before entering the premises The prior whereabouts of all people and things coming onto a facility should be verified Any replacement poultry coming onto a farm need to be screened for disease Doors to houses should be locked to keep out unwanted guests Houses should be sealed to keep out pests A pest management program should be implemented to control pest populations All in all out poultry production should be practiced At a minimum poultry barns should have all organic material removed between flocks mortality should be disposed of in a manner which animals and pests cannot contaminate other flocks The water source should be free of pathogenic bacteria If the source it self 1s not clean then the water should be sanitized prior to use Finally good environmental management practices and an effective vaccination program should help poultry maintain maximum disease resistance 2 reunion AECACEM Quer taro 2009 P g 32 References 10 11 12 13 14 15 Becker Meyerholz GW Gaskin JM Selection and use of disinfectant disease prevention Herd Health Purdue University Cooperative Extension Service PIH80 Capua I and Marangon S 2007 Control and prevention of avian influenza in an evolving scenario Vaccine 25 5645 5652 Capua I and Alexander DJ 2004 Avian Influenza Recent developments Avian Pathology
106. ance Program y Ministerio de Agricultura Gobierno de Chile 2003 Manual de de Buenas Pr cticas en Producci n Av cola Versi n I 79 pp 5 Irueste M A 2002 Prologo 2 En Novelo S A Rosado 2002 El mito de la ISO 9001 2000 Es esta norma un sistema de calidad Total Ed Panorama 84 pp 6 Kotler P et al 2004 Marketing D cima Edici n Pearson Educaci n S A Prentice All 758 pp 7 Madigan M T Martinko J M amp Parker J 2003 Biolog a de los microorganismos D cima Edici n 1385 pp 8 Seymour B 2001 Disinfection Sterilization and Preservation Fifth Edition Ed Lippincott Williams amp Wilkins 1481 pp 2 reunion AECACEM Quer taro 2009 P g 110 9 SENASICA 2003 Manual de Buenas Pr cticas Pecuarias en el Sistema de Producci n de Ganado Bovino Productor de Carne en Confinamiento Ed SAGARPA www sagarpa gob mx www sagarpa senasica gob mx 54 pp 10 SENASICA 2003 Inscripci n al Programa voluntario de Buenas Pr cticas de producci n en la engorda de ganado bovino en confinamiento Manual del Usuario Ed SENASICA http www senasica sagarpa gob mx bovinoscarne 11 SENASICA 2004 Manual de Buenas Pr cticas de Producci n en Granjas Porc colas Ed senasica 85 pp www sagarpa gob mx o www sagarpa senasica gob mx 12 SENASICA 2004 Manual de Buenas Pr cticas en Producci n de Leche Caprina Ed senasica 85 pp www sagarpa gob mx o www sagarpa senasica gob mx 2 reunion AECACEM Quer t
107. and purification of total lipids from animal tissues J Biol Chem 226 497 509 Gonz lez Esquerra R Lesson S 2001 Effects of feeding hens regular or deodorizer Menhaden oil on production parameters yolks fatty acid profile and sensory quality of eggs Poultry Science 79 1597 1602 si pp 41 Herber S M Van Elswyk M E 1996 Dietary marine algae promotes efficient deposition of n 3 fatty acids for the production of enriched shell eggs Poultry Sci 75 1501 1507 NRC 1994 Nutrient requirements of poultry 9a edition National Research Council National Academy Press Washington D C USA SAS 2008 Statical Analysis System The SAS System for Windows Release 9 1 USA of and recommended dietary intakes for omega 6 and omega 3 fatty acids Prostaglandins Leuko Essent Fatty Acids 63 119 121 Steel R G D y Torrie J A 1988 Bioestad stica Principios y Procedimientos Segunda edici n Editorial McGraw Hill M xico D F Van Elswyk M E Sams A R Hargis P S 1992 Composition functionally and sensory evaluation of eggs from hens fed dietary menhaden oil J Food Sci 57 342 344 amp 349 www una org MK 2 reunion AECACEM Quer taro 2009 P g 119 EFECTO DEL USO PERMANENTE DE UN PROGRAMA ANTICOCCIDIAL EN LOS PARAMETROS PRODUCTIVOS DE POLLO DE ENGORDA DESAFIADO CON Eimeria SPP Laguna Tamayo Leslie Asahetd Hern ndez Velasco X chitl Fuente Martinez Benjamin Avila Gonz lez Ernesto
108. antress com Urquiza O Sistema de producci n animal Vol II Edit UNAM 1998 M xico D F pp 65 67 Vannier Le n Compendio de Materia Medica Homeop tica Ed Porr a SA Av Rep blica Argentina 15 M xico 1989 pp 440 446 Wayne W D Bioestad stica Base para el an lisis de las ciencias de la salud ED Limusa 4 reimpresi n de la 3 edici n M xico D F 1996 pp 183 186 Literatura consultada A B Castell Llobet Jos A Manual Pr ctico de la Avicultura Real Escuela Oficial y Superior de Avicultura Arenys de Mar Barcelona 2 ed pp 229 254 Examen General de Calidad profesional Para la Medicina Veterinaria y Zootecnia Materia de Estudio rea Aves Dr Isidro Castro Mendoza Consejo Nacional de Educaci n de la Medicina Veterinaria y Zootecnia AC Sistema de Universidad Abierta SUA UNAM Centro Nacional de Evaluaci n para la Educaci n Superior AC 1 ed 1996 pp275 279 Galindo Mendoza Manuel C HOMEOPAT A y el Alma Enferma M todo 1 ed Oaxaca M xico 2001 ISBN 968 7984 33 3 P 40 G mez S nchez Jes s et al Terap utica Av cola Registro en tr mite FMVZ UNAM pp 111 147 170 210 Investigaci n en homeopat a Ed Boiron Francia 1999 2 2002 ISBN 2 85742 160 5 Kleven H Stanley Avances en el Control de la Micoplasmosis Avicultura Profesional Vol 8 No 2 1990 pp 50 63 North M O Bell D D Manual de producci n av cola Edit Manual moderno Tercera
109. arms For this reason only those individuals with an absolute need to come onto a facility should be granted access Signs should be posted at all access points letting people know they are not to come onto the facility without explicit consent A fence should surround the perimeter of a facility to block unwanted visitors from entering and all access points should be well secured It 1s a good practice to ask where a person has recently been prior to coming to that facility to determine the level of risk they may pose to the poultry Contractors salesmen as well as company personnel are all people who often visit multiple poultry farms These people often understand and practice good biosecurity practices such as not visiting other flocks after visiting diseased flocks It is however the responsibility of the farm owner or manager to make sure these people are following the biosecuirty measures put in place by company or facility management It 1s also good practice to maintain a visitor logbook As most pathogens have a known incubation period this log may be useful to determine the source of an outbreak If a person must come onto the facility steps should be taken to shield the poultry from any potential diseases the visitor or employee may carry The most effective way to lower the potential for introduction of a disease 1s by having all personnel and visitors shower and change into clean clothing and footwear preferably laundered on the faci
110. aro 2009 P g 111 EFECTO DE LAS OCRATOXINAS Y LAS AFLATOXINAS SOBRE LAS VARIABLES PRODUCTIVAS EN POLLOS DE ENGORDA VACUNADOS CONTRA LA COCCIDIOSIS AVIAR Del R o GJC Rinc n Delgado Mart nez LJP Mendez Albores A Valdivia AG Morales AAE Moreno Ramos C y Moreno Mart nez E Facultad de Estudios Superiores Cuautitl n UNAM Unidad de Investigaci n Multidisciplinaria Alimentos Micotoxinas y Micotoxicosis Depto de Parasitolog a y Unidad de Investigaci n Multidisciplinaria Patog nesis Microbiana La industria av cola es afectada constantemente por la presencia de Eimerias sp las cuales provocan p rdidas econ micas importantes Una medida para contrarrestar el efecto negativo de estos protozoarios es el uso de vacunas sin embargo en ocasiones estas no dan la protecci n esperada e incluso aparentemente la vacunaci n provoca la la enfermedad a pesar de que la vacuna cuenta con buenas pr cticas de mano factura Una posible explicaci n es la presencia de micotoxinas en el alimento en concentraciones consideradas como no da inas En ste estudio se evalu el efecto de las aflatoxinas y las ocratoxinas en pollos de engorda vacunados contra la coccidiosis aviar a trav s de alteraci n en las variables productivas y la qu mica sangu nea Se utilizaron 90 aves de un d a de edad estirpe Ross para aplicar 8 tratamientos por un per odo de 28 de edad Las aves fueron vacunadas al d a de edad por
111. artimientos como por ejemplo el cloroplasto En quinto lugar se puede producir la prote na recombinante en plantas a escala industrial Finalmente los riesgos a la salud que se presentan por posible contaminaci n del producto recombinante con pat genos humanos son m nimos Inclusive el cruce de l neas de plantas transg nicas permite la expresi n de m ltiples prote nas en la misma planta 26 Hay dos reas en donde esta tecnolog a est teniendo un impacto importante la producci n de anticuerpos y en la producci n de compuestos biofarmace ticos incluyendo ant genos 30 31 47 Si uno asume que se requiere de mas de diez miligramos de una vacuna de subunidad normal para su administraci n oral 1 000 veces mas de lo requerido en una v a inyectada se podr a considerar que se requeririan cientos de gramos de una planta para lograr una respuesta inmune sin embargo es posible aumentar esta concentraci n procesando el materia vegetal as como tecnolog as que permitir n aumentar la expresi n de estas prote nas en las plantas La expresi n de ant genos en plantas permite a su vez obtenerlo encapsulado de manera natural en el tejido de la planta este previene la degradaci n del ant geno al ser administrado de manera oral permitiendo que este sea liberado gradualmente en el tracto digestivo Esta protecci n hace que tambi n que se reduzca la cantidad de prote na requerida para su administraci n oral La expresi n
112. as Avicolas existentes siempre son extrapolacion de las Materia Medicas Humanas De la segunda vertiente de la investigaci n o sea la zoot cnica se tuvo los siguientes resultados a los par metros establecidos Peso Ganancia de peso e Indice de conversi n GRAFICA COMPARATIVA DE PARAMETROS PRODUCTIVOS 3 2 5 2 m PESO Kg 1 5 DG Kg9 0 5 0 CONTROL 6X 30 X Resultados promedios de los par metros de los sublotes El peso promedio de las aves del sublote 3 es de 2 236 Kg El peso promedio de las aves del sublote 2 es de 2 296 kg El peso promedio de las aves del sublote 1 es de 2 436 kg 2 reunion AECACEM Quer taro 2009 P g 152 Cuadro Comparacion del peso final Peso 7 sem kg 2436 Lote 2 30 2 296 a23 La Diferencia en la Ganancia de Peso lograda entre los lotes carece de significancia Cuadro 2 El ndice de conversi n tuvo los siguientes resultados LC 7 sem grs Lote 230 Lote 3 control 199 Donde el lote 1 tuvo mejor conversi n por 0 08 y el lote 2 tuvo desventaja de 0 02 en comparaci n al lote control Para el an lisis estad stico se procedi a comparar el ndice de conversi n promedio de los lotes de la siguiente manera a Lote control vs Lote 1 a Lote control vs Lote 2 El resultado de la primera comparaci n fue de 11 2 03138 y el valor critico fue de 0 094192 los resultados de la seg
113. asation of antibiotic treatment Seuna et al 1980 thus providing an opportunity for CE to be administered after treatment with antimicrobials to prevent reinfection with Salmonella Common practice the poultry industry is to use spray application of certain vaccines such as Newcastle and infectious bronchitis These biologics use respiratory and or ocular portals of entry Although these vaccines can be effective thru the respiratory tract or ocular system some biologics must be ingested to be effective Caldwell and co workers tested the effectiveness of spraying biologics that require ingestion in order to be effective They discovered that certain environmental conditions needed to be optimized order for the birds to preen at sufficient rate for the probiotic to be ingested Caldwell 2001 Many different probiotics have been compared and several labs have shown spray application to be as effective at providing protection as drinking water application Schneitz 1992 Corrier 1994 Blankenship 1993 In order for many probiotics to be effective at preventing infection the probiotic must be administered early in life and the application should be uniform In many cases the drinking water application of probiotics can be compromised by water quality and medicator function and cleanliness All of these issues can be addressed and minimized if the probiotic was administered at the hatchery by spray application In the research preformed
114. ascendi las fronteras mexicanas e hizo su aparici n en diferentes eventos acad micos de Estados Unidos La tecnolog a de la pigmentaci n tambi n llam la atenci n de los empresarios mismos que a os m s tarde desarrollaron esta tecnolog a a nivel industrial Palabras claves Cempasuchil Tagetes erecta pigmentaci n aves Fundaci n Rockefeller Investigaci n financiada por Proyecto N 47751 De la ciencia ingenieril a la ciencia acad mica en M xico La articulaci n ciencia ingenier a industria 1880 1970 Del Consejo Nacional de Ciencia y Tecnologia M xico 2 Facultad de Medicina Veterinaria y Zootecnia Universidad Nacional Aut noma de M xico Facultad de Filosof a y Letras Universidad Nacional Aut noma de M xico 2 reunion AECACEM Quer taro 2009 P g 126 EVALUACI N DE UNA VACUNA ORAL CONTRA INFLUENZA AVIAR Y Campylobacter jejuni EXPRESADA EN Cicotiana benthamiana Castellanos I 1 Moreno E 1 Del Rio JC 1 G mez MA 2 T llez G 3 Hargis BM 3 Layton S 3 1 Facultad de Estudios Superiores Cuautitl n UNAM 2 Centro de investigaciones y estudios avanzadas del Instituto Polit cnico Nacional campus Irapuato Guanajuato 3 Department of Poultry Science University of Arkansas Fayetteville AR USA Introducci n Actualmente Campylobacter jejuni es una de las principales causas de contaminaci n bacteriana en los alimentos de origen av cola 1 En pollo de engorda comercial la infecci
115. ate University Press Ames Iowa U S A 2003 17 55 P rez V Control de la coccidiosis aviar Memorias de VII Magno evento de la ANECA G 2005 octubre 13 14 Manzanillo Colima M xico M xico Jalisco Asociaci n de M dicos Veterinarios Especialistas en Ciencias Av cola de Guadalajara AC 2005 P rez SEA Asesores Hern ndez VX Petrone VM Efecto de varios m todos de conservaci n sobre la viabilidad y esporulaci n de ooquistes de Eimeria spp proveniente de pollo de engorda Facultad de Medicina Veterinaria y Zootecnia UNAM Licenciatura 8 de julio de 2004 Long PL Rowell JG Counting oocysts of chicken coccidia Lab Pract 1958 7 515 519 Jonhson J Reid WM Anticoccidial drugs Lesion scoring techniques in battery and floorpen experiments with chickens Exp Parasitol 1970 28 30 36 Zar HJ Bioestatistical Analysis Third edition Prentice Hall Inc Upper Saddle River New Jersey 1996 Blentner JK Mitchell RP Tugwell RL The effec of Eimeria maxima on broiler pigmentation Pou Sci 1966 45 689 694 Serrano PDJ Cuanto cuesta un brote de coccidia Memorias del II Simposium de Integridad Intestinal y 3er encuentro AMVEAV 2004 junio 25 Guadalajara Jalisco M xico M xico DF AVECA G AECAS AMVEAV y U of A AC 2004 80 92 Ju rez M A Evaluaci n de par metros productivos y grado de pigmentaci n en pollos de engorda vacunados contra coccidiosis y medicados con salinomicina Memorias de la XXVII convenci n anual de la AN
116. athology and pathogenicity of the coccidia species are characteristic traits of the species Eimeria praecox 1s relatively benign whereas E necatrix 16 highly pathogenic The fecundity of the organisms chicken house management practices and the methods of coccidia control may influence the prevalence of the coccidia species in the environment The most pathogenic species E necatrix is the least prevalent or even extinct from broiler chicken houses Coccidia damage host tissue and the sequel is weight loss impaired_feed utilization poor pigmentation and mortality Coccidia are ubiquitous and are in most all commercial poultry houses and pose a threat to the health of the animals These prolific organisms are resistant several environmental conditions but susceptible to desiccation Host tissue 1s destroyed during the development of various stages the damage 15 directly related to the number of coccidia and species of eimeria ingested Controlling coccidiosis is essential and 1s achieved via facilitate low parasite burden resulting in minimal cells destroyed through the use of effective drugs and biological means Introduction Avian coccidiosis is a disease of enormous economic importance and estimated to cost the world poultry industry billion of dollars annually In the presence of loss of drug effectiveness and an explosion in the available coccidia vaccines we are still in fairly high learning curve when it comes to avian coccidiosis Many of t
117. atic Bacteriology IJSB until 1998 which group into 3 4 major clusters This diversity documented by ribosomal 16S rRNA typing underlines the fact that the genus Bacillus comprises a wide variety of species whose taxonomic position in a single genus is unsatisfactory and needs revision Bacillus subtilis Bacillus licheniformis Bacillus coagulans Bacillus cereus Bacillus thuringiensis and Bacillus anthracis all fall within the well defined group I 1 Members of the B cereus B thuringiensis phylogenetic group which includes B anthracis are virtually indistinguishable by 16S rRNA sequence analysis with as much variability present among the multiple rDNA operons of an individual species as among different isolates 2 Multi locus enzyme electrophoresis and analysis of nucleotide polymorphisms suggest they may represent a single species 3 and 4 Most isolates of the species B cereus B thuringiensis and B anthracis carry plasmids that vary in number and size with some plasmids exceeding 500 kb 2 In fact the virulence factors of B anthracis and B thuringiensis are encoded by plasmid carried genes 5 6 and 7 2 Bacillus spores as probiotics Probiotic is a word derived from the Greek meaning for life It was first used the modern context to describe organisms which contribute to intestinal microbial balance by Parker m 1974 8 Probiotics maintain or enhance the indigenous defence mechanisms in the animal
118. be effective 1f they are allowed to have contact to the virus for longer time Composting infected chicken carcasses for 20 days completely inactivates the virus Senne et al 1994 In the past the family Adenoviridae was divided by host range and antibody reactivity into two genera the genus Mastadenovirus for viruses isolated from mammalian and the genus Aviadenovirus for viruses isolated from birds Recently The International Committee on Taxonomy of Viruses has divided the member of the family adenoviridiae four genera Benk et al 2005 The Mastadenovirus genus contains the mammalian adenoviruses such as the human simian bovine porcine equine murine porcine ovine and caprine adenoviruses The genus Aviadenovirus formerly designated as group I avian adenoviruses AAV contains 11 of the 12 recognized European adenovirus serotypes classified in five A to E molecular groups and other related viruses The genus Siadenovirus formerly designated as group avian adenoviruses includes the Haemorrhagic enteritis virus of turkeys HEV Marble spleen disease of pheasants MSDV and Avian adenovirus splenomegaly virus of chickens AASV The genus Atadenovirus formerly designated as group III avian adenoviruses includes the Egg drop syndrome virus EDS Table 1 According to Jensen and Villegas 2005 the nomenclature used for the serotypes of avian adenoviruses from chicken has created some confusion as different systems have been
119. be pathogenic to turkeys Mycoplasma meleagridis MM causes airsacculitis and Mycoplasma iowae MI causes decreases in hatchability Mycoplasmas are the smallest self replicating procaryotic organisms They have no cell wall but are bounded by a triple layered plasma membrane which is composed mainly of lipids and proteins The genus Mycoplasma belongs to the family Mycoplasmataceae order Mycoplasmatales of the class Mollicutes Razin 1992 Mycoplasmas are sensitive in the environment and susceptible to the most commonly used chemical disinfectants The viability of Mycoplasmas outside the host is of short duration at 5 10 C nearly 2 8 days Sunlight kills the organism in 20 30 min They remain stable in faeces at 20 C for 3 days in hatchery fluff for 5 days and at 20 C for several months Chandiramani et al 1966 Mycoplasma can survive in the human nose for 24 hours up to 4 days on human hair 3 days and on feathers for 2 to 4 days Christensen et al 1994 Lierz et al 2008a They may exist for very long periods in the respiratory tract of infected birds and these apparently healthy carriers are essential for mycoplasma survival in poultry populations 2 reunion AECACEM Quer taro 2009 P g 54 The disease spreads by vertical transmission through infected eggs Infected progeny then transmit the agent horizontally either by direct bird to bird contact or by indirect contact through contaminated feed water and equipment Concerni
120. by Caldwell and co workers these investigations found that a decrease in photointensity prior to spray application increased preening Also if the birds were subjected to an increase in photointensity immediately after spray application of the probiotic the chicks preening increased and resulted in more probiotic ingestion Caldwell et al 2001 Another alternative to antibiotics that has been claimed to offer occasional against Salmonella in poultry is the use of organic acids Organic acids are compounds that primarily include the saturated straight chain monocarboxylic acids and their respective derivatives unsaturated 2 reunion AECACEM Quer taro 2009 P g 15 hydroxylic phenolic and multicarboxylic versions and are often referred to as fatty acids volatile fatty acids or weak or carboxylic acids Cherrington et al 1991 Ricke 2003 Organic acids are weak acids by nature The pH of OA solutions are directly related to microbial killing because pH affects the concentration of undissociated acid formed Davison 2001 Ricke 2003 It 1s believed that undissociated forms of organic acids can easily penetrate the lipid membrane layer of the bacterial cell and once internalized into the neutral pH of the cell protoplasm they can dissociate into anions and protons Eklund 1983 1985 Davidson 2001 Ricke 2003 This dissociation inside the cell potentially causes problems for bacteria as the organism must maintain a specific internal
121. c health and veterinary services in the respective regions 30 http www vetmed lsu edu whocc mp world htm Presently the most widely used vaccine for the prevention of anthrax animals 15 the Sterne strain vaccine This vaccine is based on a toxigenic live attenuated variant of B anthracis developed by Sterne in 1937 strain 34F2 This non encapsulated strain lacks plasmid pOX2 that codes for capsule formation In Russia and China live spore vaccines equivalent to the Sterne strain are in use strain 55 while in Italy animals are vaccinated with a strain Carbosap which still carries both virulence plasmids being nevertheless attenuated virulence 31 and 32 General procedures for manufacturing all these vaccines are equivalent and are described by a FAO position paper 33 After a single subcutaneous vaccination 5000 10 000 live spores per dose depending on vaccinated animal in 0 1 saponin immunity develops following 7 10 days While a single dose will provide immunity for about a year repeated vaccinations six doses are required for long term protection 28 The residual virulence of all these live vaccine strains local side reactions and occasional casualties of vaccinated animals discouraged their use in humans 29 To overcome this problem acellular vaccines have been developed as response to threats of biological warfare or bioterrorism since the end of World War II In the USA a cell free culture filtrate adsorbe
122. cAg se debe probablemente a su naturaleza polimerica a la presencia en su estructura primaria de potentes epitopos para linfocitos T Helper LT h y a la habilidad de activaci n directa a linfocitos B LB 51 Los mon meros de HBc conforman dos tama os de VLPs integrados por 180 6 240 subunidades con un arreglo T 3 o T 4 simetria icosahedrica Su expresi n se reporta en tanto en sistemas procariotes como en sistemas eucariotes 51 Material y m todos En el presente trabajo se planto expresar el VLP quimera HBcAg en un sistema eucariote Nicotiana benthamiana La transformaci n de las plantas se logro mediante la t cnica de agroinfiltracion para la expresi n transitoria del HBcAg en hojas de plantas mediante el empleo de un vector binario 49 pHBV33 proporcionado por el CINVESTAV Irapuato al cual se le inserto la secuencia codificante para M2e CD154 CD40 y 0113 proporcionados por la universidad de Arkansas El sitio de inserci n fue en la parte interna del vector binario mediante enzimas de restricci n Para la expresi n de estas prote nas se decidi hacer las siguientes combinaciones Plasmido 1 conteniendo 2 pl smidos 2 conteniendo M2e CD 154 y plasmido 3 conteniendo M2e 0113 En el caso de dos epitopos combinados se empleo una secuencia de separaci n entre las dos secuencias a ser expresadas en la superficie de HBcAg Se empleo la cepa coli cepa DH5a para la clonaci n del vector binario y para la transformac
123. ccines There has been one MS bacterin licensed in the USA but it apparently has had little field use Kleven 2004 References 1 Bickford S M Soy J I and Barnes L E 1973 Gentamycin concentrations in turkey eggs and in tissues of progeny following egg dipping Avian Diseases 17 301 307 2 Bozeman L H Kleven S H and Davis R B 1984 Mycoplasma challenge studies in budgerigars Melopsittacus undulatus and chickens Avian Diseases 28 426 434 3 Bradbury J 1998 Recovery of Mycoplasmas from birds In Mycoplasma protocols Eds R Miles amp R Nicholas New Yersey Humana Press Inc 45 51 2 reunion AECACEM Quer taro 2009 P g 57 10 b 12 13 14 15 16 17 18 19 20 21 22 2954 24 25 26 Bradbury J M 1999 Turkey mycoplasmas revisited Proceedings of the 274 international symposium on turkey diseases Berlin Ed H M Hafez and A Mazaheri ISBN 3 930511 75 4 pp 118 122 Chandiramani N K Van Roekel H and Olesiuk O M 1966 Viability studies with Mycoplasma gallisepticum under different environmental conditions Poultry Science 45 1029 1044 Christensen N H Yavari C A McBain A J and Bradbury J M 1994 Investigations into the survival of Mycoplasma gallisepticum Mycoplasma synoviae and Mycoplasma iowae on materials found in the poultry house environment Avian Pathology 23 127 143 Evans R D Hafez Y S and Schreurs C S
124. ceite de at n Ingrediente lo AA A 11 An lisis calculado EM Kcal Kg 2 20 20 Grasa cruda Lisina 4 Treonina Calcio total 09 09 09 Requerimientos NRC 1994 RESULTADOS Los resultados obtenidos al adicionar diferentes niveles de AAT para los cidos grasos polinsaturados se encuentran en el Cuadro 3 Cuadro 3 cidos grasos poliinsaturados en pierna muslo y pechuga en pollos alimentados con dietas a diferentes niveles de aceite de at n AAT 0 AAT 0 7596 AAT 1 0 AAT 1 2596 Promedio EEM Promedio EEM Promedio EEM Promedio EEM Promedio EEM 29 9342 35 13 0 2 03 15 54 2 96 18 49 3 82 14 24 1 98 22 20 1 89 17 60 1 10 16 28 0 7 20 05 1 15 19 03 0 79 26 06 1 92 15 30 1 33 15 91 1 90P 19 27 1 90 Pp 6 31 0 79 4 26 0 75 9 50 1 45 2 7 81 41 45 6 97 0 69 4 63 0 68 2 81 0 23 8 91 1 11 9 33 1 90 6 27 0 81 a b c Medias con diferente literal son estadisticamente significativas P lt 0 05 EEM Error estandar de la media Porcentaje del total de acidos grasos AAT Aceite de atun Para pierna y muslo en los tratamientos las hembras disminuyeron lt 0 05 los AGP y para los efectos principales los AGP fueron similares P gt 0 05 para machos y hembras al incrementar el AAT en la dieta disminuyeron P lt 0 05 en relacion al testigo Al incluir AAT en la dieta en pechuga no hubo diferencia P gt 0 05 entre sexos y el ni
125. ch product by the manufacturers The benefit of using vaccines with drug sensitive strains of coccidia 15 that the anticoccidial drugs can be physically rested This practice may extend preserve or prolonged the life of the anticoccidials by judiciously using them in rotation with drug sensitive vaccines In a relatively poor drug program the non immune animals become carriers of the infectious agents and play a major role in the spread of the disease However in the immune animal the parasitemia keeps the body alert and therefore keeps the immune system in a defensive mode Eventually the animal becomes solidly immune to the coccidia infection Recently the practice to manage coccidia involves the host parasite and environment relationship By managining coccidiosis the infestation pressure is kept relatively low to avoid or prevent devastating losses and to minimizing the buildup of infection pressure Variant coccidia There are now several citations concerning the evidence of drug resistance to several species of chicken and turkey Eimeria This decline drug efficacy has occurs over time and may be exacerbated by the over use period or in discriminate use of these drugs All species of Eimeria are fairly antigenic and may offer protection to different strains within each species but offer no cross species protection There are reports of poor protection or variability in cross protection among strains of E maxima Norton and Hein 1
126. chez y Juan Jos Salda a Gonz lez Resumen El objetivo de la investigaci n fue hacer una reconstrucci n historiogr fica del desarrollo en M xico en la d cada de 1960 de la tecnolog a de la pigmentaci n del pollo de engorda y de la yema del huevo a partir de la extracci n de carotenoides de la flor de cempas chil Tagetes erecta Para tal efecto fue necesario utilizar la metodolog a se la historia social de la ciencia latinoamericana En esta investigaci n fueron analizados principalmente los factores internos que propiciaron el desarrollo de esta tecnolog a Estos fueron la presencia del cempas chil en la cultura mexicana la disposici n de las instituciones mexicanas por el estudio de las plantas nativas el establecimiento de la avicultura industrial por medio de la introducci n en M xico del paquete tecnol gico del pollo de engorda y de la gallina de postura la preferencia del p blico mexicano por el pollo y huevo pigmentado As mismo se analizaron brevemente algunos factores externos como por ejemplo la influencia de la fundaci n Rockefeller y de los qu micos espa oles que desarrollaron la qu mica org nica en M xico Teniendo estos antecedentes un grupo de investigadores mexicanos que trabajaban para la fundaci n Rockefeller M xico comenzaron a buscar algunas alternativas para pigmentar los productos av colas entre las que se encontraba el cempasuchil Tagetes erecta Fue as que se desarroll la tecnolog a que tr
127. chia coli and Salmonella serovars 1n retail chicken turkey pork and beef from the greater Washington D C Area Appl and Environ Microbiol 67 5431 5436 Table 1 Most common Salmonella serotypes isolated across the U S in 2005 in order of prevalence Serotypes in bold represent top five isolates from clinically ill humans found in poultry products Order of Serotypes from Serotypes from Serotypes from prevalence broilers in ground chicken clinically ill commercial in commercial humans plants FSIS plants FSIS CDC First Kentucky Enteritidis Typhimurium includes Copenhagen Second Heidelberg Kentucky Enteritidis Third Typhimurium Heidelberg Newport includes Copenhagen Fourth Enteritidis Typhimurium Heidelberg includes Copenhagen Fifth I4 5 12 1 I4 5 12 1 Javiana Total Salmonella 80 85 56 accounted for by top 5 serovars Food safety Inspection Service United States Department of Agriculture USDA FSIS 2006 2 Centers for Disease Control and Prevention CDC 2006 2 reunion AECACEM Quer taro 2009 P g 45 Figure 1 Salmonella serotypes isolated from humans from 2000 through 2005 data taken from the Centers for Disease Control and Prevention CDC 2006 Open circles depict S Typhimurium e represent S Enteritidis A indicate 5 Newport show 9 Heidelberg and indicate S Javiana 25 Salmonell
128. cific pathogen free chickens Avian Dis 24 527 531 Hafez HM and Hess M 1999 Modern techniques in diagnosis of poultry diseases Archiv fur Geflugelkunde 63 237 245 Heffels U Khalaf SED and Kaleta EF 1982 Studies on the persistence and excretion of egg drop syndrome 1976 virus in chickens Avian Pathol 11 441 452 Helmboldt CF and Frazier MN 1963 Avian hepatic inclusion bodies of unknown significance Avian Dis 7 446 450 Hess M 2000 Detection and differentiation of avian adenoviruses a review Avian Path 29 195 206 Hess M Blocker H and Brandt P 1997 The complete nucleotide sequence of the egg drop syndrome virus an intermediate between mastadenoviruses and aviadenoviruses Virology 238 145 156 Hess M Raue R and Hafez HM 1999 PCR for specific detection of haemorrhagic enteritis virus of turkeys an avian adenovirus Journal of Virological Methods 81 199 203 Icochea E Alba M Fiory L and Ramirez A 2001 Cited from Balamurugan V and Kataria JM 2004 Ivanics E Palya V Glavits R Dan A Palfi V R v sz T and Benk M 2001 The role of egg drop syndrome virus in acute respiratory disease of goslings Avian Pathol 30 201 208 Jensen L and Villegas P 2005 Inclusion Body Hepatitis Control in Breeder and Broiler Chickens AviaTech Eric Technical information for the broiler industry 2 1 1 6 Luschow D Prusas C Lierz M Gerlach H Soike D Hafez HM 2007 Adenovirus of psittacine bird
129. cing animals has the attention of both the poultry industry and government agencies Due to antibiotic resistance of many species of Salmonella antibiotic therapy is frequently not effective at eliminating Salmonella infections in poultry Angulo et al 2000 Threfall et al 1997 Manning et al 1994 Seuna et al 1980 In 1990 and 1995 40 of persons with Salmonella infections who required medical attention were treated with antimicrobial agents CDC 2000 Even though antibiotics are not required for people with uncomplicated gastrointestinal problems patients that suffer bacteremia meningitis or other 2 reunion AECACEM Quer taro 2009 P g 7 extraintestinal Salmonella infections need antibiotics for effective treatment Angulo et al 2000 A study conducted by CDC in 1996 demonstrated that approximately 6 of Salmonella culture confirmed cases involved extraintestinal infection suggesting that antibiotics were necessary for only 2 400 patients but as many as 16 000 were treated with antibiotics In 1996 1 272 human Salmonella isolates were tested for antimicrobial resistance 21 were resistant to ampicillin 10 to chloramphenicol and 4 to trimethoprim sulfamethoxazole but nearly all were susceptible to flouroquinilones and third generation cephalosporins CDC 1996 Thus flouroquinilones and cephalosporins are frequently the favored treatment for Salmonellosis by physicians Resistance to fluoroquinilones and third gene
130. conocimiento sera posible establecer algunas acciones para prevenir la ocurrencia de micotoxicosis en estos animales Es necesario saber c mo evaluar la relaci n costo beneficio en la prevenci n de esta enfermedad tan peligrosa y silenciosa en la salud animal Efecto de las micotoxinas en la salud de las aves El efecto de las micotoxinas en la avicultura est relacionado directamente al tipo y la cantidad de toxinas ya que existen cerca de 300 tipos conocidos Las micotoxinas conocidas por afectar m s la salud y el desempe o de las aves est n presentadas en el cuadro Cuadro Micotoxinas m s estudiadas en la avicultura Micotoxina G nero f ngico productor Aflatoxina Bl B2 Gl G2 Aspergillus y Penicillium Tricotecenos Fusarium T2 DON DAS nivalenol etc Ocratoxina Aspergillus y Penicillium Patulina Aspergillus y Penicillium Zearalenona Fusarium Citrinina Aspergillus y Penicillium Fumonisina Fusarium Gliotoxina Aspergillus cido penic lico Penicillium Moniliformina Fusarium Ergotamina Claviceps cido ciclopiazonico Aspergillus cido fus rico Fusarium Efecto de micotoxinas sobre el comportamiento y desempe o animal Normalmente los casos comunes de micotoxicosis a campo cr nica las aves no poseen ninguna se al o comportamiento t pico de la enfermedad Los signos m s comunes son caracterizados por apat a y pueden ser observados en estados avanzados de la enfermedad por lo que existe la posibilidad de se
131. coplasma gallisepticum depende de la presencia concomitante de otros pat genos o factores debilitantes ya que es frecuente que las infecciones sin complicaciones no causen signos cl nicos o mortalidad excepto en aves j venes En este punto es importante se alar que los casos de queratoconjuntivis descritos en gallinas de postura asociados a Mycoplasma gallisepticum se han descrito durante la crianza y han estado vinculados a la presencia de agentes inmunodepresores como infecci n por el virus de Gumboro El objetivo de este trabajo es realizar la descripci n cl nica y patol gica de un caso de micoplasmosis ocular en gallinas de postura en producci n Este caso fue observado en una granja de postura comercial compuesta por dos secciones cada secci n con 6 casetas de 13 000 aves cada una el problema se presento a la semana 19 de edad despu s de la aplicaci n de una vacuna ocular contra el virus de Newcastle y se caracterizo por exoftalmia conjuntivitis blefaritis lagrimeo opacidad y congesti n corneal uni o bilateral aunado a la presencia de signos respiratorios estos cambios fueron observados aproximadamente en el 3 de las aves al inicio del problema afectando posteriormente al 45 de las aves Se remitieron al laboratorio para histopatolog a fragmentos de tr quea pulm n ojo h gado proventr culo ovario coraz n bazo ri n articulaci n nervio y enc falo Las muestras fueron colectadas de aves reci n sacrificadas a las 2
132. crobiol 67 2001 pp 834 839 J Wang and D Y Fung Alkaline fermented foods a review with emphasis on pidan fermentation Crit Rev Microbiol 22 1996 pp 101 138 M H Guinebretiere H Girardin C Dargaignaratz F Carlin and C Nguyen The Contamination flows of Bacillus cereus and spore forming aerobic bacteria in a cooked pasteurized and chilled zucchini puree processing line Int J Food Microbiol 37 6 1997 pp 439 444 G Fiorini C Cimminiello and R Chianese Bacillus subtilis selectively stimulates the synthesis of membrane bound and secreted IgA Chemioterapia 4 1985 pp 310 312 M Muscettola G Grasso Z Blach Olszewska et al Effects of Bacillus subtilis spores on interferon production Pharmacol Res 26 1992 pp 176 177 T T Hoa L H Duc R Isticato et al Fate and dissemination of Bacillus subtilis spores in a murine model Appl Environ Microbiol 67 2001 pp 3819 3823 G Casula and S M Cutting Bacillus probiotics spore germination in the gastrointestinal tract Appl Environ Microbiol 68 2002 pp 2344 2352 A Adami and M Cavazzoni Occurrence of selected bacterial groups in faeces of piglets fed with Bacillus coagulans as probiotic Basic Microbiol 39 1999 pp 3 9 T Hosoi A Amenati K Kiuchi and S Kaminogawa Changes in fecal microflora induced by intubation of mice with Bacillus subtilis natto spores are dependent upon dietary components Can J Microbiol 45 1999
133. ction of commercial poultry Rev sci tech 2000 19 376 395 4 Taylor DE Eaton M Yan W Chang N Genome maps of Campylobacter jejuni and Campylobacter coli J Bacteriol 1992 174 2332 2337 5 Stern NJ Hernandez MP Blankenship LC Deibel KE Doores S Doyle MP Ng Pierson MD Sofos JN Sveum WH Westhoff DC Prevalence and distribution of Campylobacter jejuni and Campylobacter coli in retail meats J Food Prot 1985 48 595 599 6 Saif Y M Banes H J Fadly A M Glisson J R McDougald L R Swayne 2003 Diseases of poultry CD 11 edition Iowa state press Blackwell publishing company 7 Allos BM Blaser MJ Campylobacter jejuni and the expanding spectrum of related infections Clin Infect Dis 1995 20 1092 1101 8 Blaser M J Allos BM Lang D Development of Guillain Barr Syndrome following Campylobacter infection J Infect Dis 1997 176 Suppl 2 S91 9 Easterday BC Hinshaw VS Halvorson DA Influenza In Calnek BW Barnes HJ Beard CW McDougald LR Saif YM eds Diseases of Poultry 1997 10th ed Iowa State University Press Ames IA 583 605 10 Cox NJ Fuller F Kaverin N Klenk HD Lamb RA Mahy BW McCauley JW Nakamura K Palese P Webster RG 2000 Orthomyxoviridae In Regenmortel Van MH Fauquet CM Bishop DHL Carstens EB 2 reunion AECACEM Quer taro 2009 P g 135 11 2 13 14 I 16 17 18 19 20 21 22 23 24 25 26 27 Estes Lemon SM Manil
134. cum 1n house finches Carpodicus mexicanus and other wild birds associated with poultry production facilities Avian Diseases 45 2 321 329 Merck Manual 2008 Histomoniasis 2 reunion AECACEM Quer taro 2009 P g 33 16 17 18 19 20 Oyetunde OOF Thomson RG Carlson HC 1978 Aerosol exposure of ammonia dust and E coli in broiler chickens Canadian Veterinary Journal 19 187 193 Sheng H Davis MA Knecht HJ Hancock DD Van Donkergoed J Hovde CJ 2006 Characterization of a shiga toxin intimin and enterotoxin hemolysin producing E coli ONT H25 strain commonly isolated from cattle Journal of Clinical Microbiology 43 7 3213 3220 Stringham SM 1996 Using Larvadex Cyromazine for Fly Management North Carolina Pest News 11 18 http 1pm ncsu edu current_1pm 96PestNews News18 livestoc html Villarreal Chavez C and Rivera Cruz E 2003 An update on avian influenza in Mexico Avian Diseases 47 1002 1005 Wolfgang DR Biosecurity A practical approach Veterinary Science Information Penn State University http vetextension psu edu resources pdf biosecurity BiosecurityIRS pdf 2 reunion AECACEM Quer taro 2009 P g 34 USE OF THE INTESTINAL ECOSYSTEM TO REDUCE FOODBORNE PATHOGENS IN POULTRY T R Callaway Agricultural Research Service Food and Feed Safety Research Unit College Station TX 77845 Proprietary or brand names are necessary to report factually on available data however the USDA n
135. d and later isolated Rabbani and Naeem 1996 Voss et al 1996 Mazahen et al 1998 Singh et al 2002 The inclusion body hepatitis hydropericardium syndrome IBH HP has been reported to occur in both broilers and layers Cowen 1992 It seems that immunosuppression prior to or concurrently with a FAdV infections 1s necessary to develop IBH Infectious bursal disease virus IBDV chicken anaemia virus CAV and mycotoxins are known to increase the pathogenicity of FAV infections Fadly et al 1976 Bulow et al 1986 Rosenberg et al 1975 Toro et al 2000 Shivachandra et al 2003 However several cases of IBH occurred without obvious influence of infectious immunosuppression Reece et al 1986 Christensen and Saifuddin 1989 On the other hand Zavala et al 2002 infected 1 day old grandparent meat type chickens carrying maternal antibodies against FAV with a field isolate of FAV associated with inclusion body hepatitis in broilers avian leukosis virus subgroup J ALV J or both FAV and ALV J and they found no significant differences in the dually infected birds in comparison with chickens that received a monovalent challenge with either FAV or ALV J The infection 1s transmitted by vertical and horizontal means Vertical transmission 1s reported as an important feature of fowl adenovirus FAV to spread from parent birds to progenies Infected breeder shed virus to their progeny for three to six weeks until development of immunity occurs
136. d onto aluminium hydroxide from non encapsulated non proteolytic strain V770 NP R 15 used for human vaccination The UK vaccine 15 an alum precipitate of cell free culture supernatant of the non encapsulated toxigenic 2 reunion AECACEM Quer taro 2009 P g 74 strain 34F2 Sterne Vaccination consists in both cases of six initial doses followed by a yearly booster Present work aimed to develop alternative vaccines includes 1 production of purified antigenic polypeptides 11 attenuated strains 11 recombinant vaccine vectors and iv DNA vaccines 34 35 and 36 Ideally such a vaccine should be given orally or intranasally and should induce rapid immunity following a single dose The identification of immunological correlates of protection in the case of anthrax vaccines 1s difficult to obtain due to the low incidence of disease which hampers vaccine efficacy studies All data reported underline that the toxin neutralising antibody titre and possibly the titre of anti protective antigen PA are predictors of survival and could be used as surrogate markers for protection 29 37 38 39 40 and 41 Still 1t should not be underestimated that spore vaccines appear to be more efficacious than vegetative cell vaccines or rPA vaccines indicating that spore antigens contribute to protection 42 43 44 and 45 or that a spore linked physical characteristic targeting of antigens to immune cells enhancement of phagocytosis of vaccine by a
137. debido a enfermedades septic micas En verdad hay otros factores que interfieren con la severidad de las micotoxicosis en los animales Los m s importantes son malas condiciones de manejo e higiene Hay muchas evaluaciones pr cticas que sugieren que malas condiciones de manejo incrementan estr s y la mala higiene incrementa las exposiciones de los animales a pat genos Como estos animales ya presentan sistema inmune afectado aumenta la probabilidad de la aparici n de lesiones graves As que en casos de campo en muchas ocasiones se observa que el mismo alimento provoca casos severos de micotoxicosis en unos animales mientras que en otros casos las lesiones y signos son m s leves o no se presentan Por lo que en la producci n av cola es un sistema muy complejo donde condiciones de estr s mal manejo de campo y nutricional exposici n a pat genos pueden afectar el desempe o y la salud de los animales La combinaci n de los diferentes factores est directamente relacionado con la severidad de la micotoxicosis 2 reunion AECACEM Quer taro 2009 P g 69 Programa de monitoria para valorar el costo de las micotoxicosis en salud y desempeno animal El programa de monitoreo para valorar el costo de las micotoxicosis considera los efectos de las micotoxinas la salud aviar inmunosupresi n lesiones etc y la calidad de los ingredientes de la dieta El an lisis de micotoxinas en cereal y alimento es muy dif cil debido a dificulta
138. des en muestreo y metodolog a de an lisis Mientras tanto hay alta correlaci n entre granos da ados p rdidas nutricionales y niveles de micotoxinas Cuan alta es la cantidad de granos da ados m s alta la probabilidad de producci n de micotoxinas y bajos valores nutricionales del cereal De esa manera aplicando constante monitoreo del porcentaje de da os f sicos de granos quebrados con hongos quemados etc con elaboraci n de gr ficas van a permitir evaluar el periodo de mayor probabilidad de producci n de micotoxinas en alimento Gr fica 1 Siguiendo el ejemplo en gr fica 1 es posible observar un incremento de granos da ados y reducci n de l pidos en los meses de diciembre e febrero Para relacionar los resultados de calidad de granos y problemas con los animales es necesario se generar un mismo grafico que valore los ndices de performance de los animales en campo t tulos vac nales lesiones de matadero eclosi n de huevos medicaci n de las aves etc En la gr fica 2 comparada con la gr fica 1 es posible observar que la enteritis y otras lesiones est n asociadas a la misma poca del a o donde los granos disminuyen su calidad f sica y nutricional Gr fica 1 y 2 Gr fica 1 Porcentaje de granos da ados niveles de prote na y de l pido a lo largo del a o 14 1 e dereceersn 00 12 M protein fat content jee eS IA gt NEM dE E tee 4 E O O FF 4 4 2 reun
139. diferencias P gt 0 05 entre sexos y se increment al adicionar lt 0 05 En Pechuga los AGo3 y EPA no tuvieron diferencia entre sexos P gt 0 05 sin embargo al adicionar el AAT se incrementaron P lt 0 05 con 1 y 1 25 en relaci n al testigo 2 reunion AECACEM Quer taro 2009 P g 117 Cuadro 7 cidos grasos omega tres en pierna y muslo en pollos alimentados con diferentes niveles de AAT OMEGA 3 AAT 1 25 PIERNA Y AAT 0 AAT 0 75 AAT 1 0 Promedio MUSLO SEXO Promedio EEM Promedio EEM Promedio EEM EEM Promedio EEM 0 19 0 01 0 026 0 005 2 0 017 0 00 0 016 0 004 0 012 0 00 0 019 0 002 0 022 0 0 0 009 0 006 0 012 0 001 0 012 0 001 0 17 0 007 0 53 0 09 0 87 0 16 4 1 29 0 28 0 71 0 12 0 100 017 0 620 040 0 40 0 037 1 05 0 16 2 92 0 60 2 78 0 27 1 79 0 29 0 5440 131 0 65 0 06 2 54 0 34 2 99 0 63 1 6140 29 0 023 0 04 0 53 0 09 1 68 0 24 1 26 0 28 0 90 0 16 0 31 0 08 1 68 0 24 1 2340 17 1 44 0 34 0 80 0 14 a b c Medias con diferente literal son estad sticamente significativas P lt 0 05 EEM Error est ndar de la media Porcentaje del total de cidos grasos no se observ presencia de DPA 0 026 0 02 0 69 0 04 0 90 0 23 1 23 0 35 0 77 0 12 0 48 0 07 0 91 0 05 1 30 0 08 0 72 0 10 1120 09 1 31 0 06 2 0 78 0 12 Discusi n Los resu
140. difficult and time consuming currently little is known about the susceptibility of recent isolates Eradication of mycoplasma in breeder flocks through testing and slaughter is the preferred method to clean the production chain from the top and to prevent mycoplasma introduction through primary and commercial breeder flocks However in places with intensive continuous poultry production and in valuable pedigree lines it has been determined that this method is too expensive and impractical Ley 2003 Hatching egg treatments with antibiotics for the control of egg transmitted bacterial pathogens has been widely investigated and seems to be of great value Different methods of egg treatment have been used such egg dipping in antibiotics using pressure differential dipping or temperature differential dipping Olsen et al 1962 Hall et al 1963 These methods greatly reduce the mycoplasma egg transmission but do not always completely eliminate it 2 reunion AECACEM Quer taro 2009 P g 56 Dipping solutions can become excessively contaminated with resistant microorganisms such as pseudomonads and organic material To prevent bacterial contamination of the solution filtering with subsequent cool storage and or addition of disinfectants is the most effective method Thorough and continuous bacteriological monitoring of dip solution is also required The concentration of the antibiotics must be examined regularly and renewed routinely By using enr
141. do se llevara a cabo este procedimiento en animales se extremara el recurso de observaci n a fin de detectar el m s m nimo cambio en la actitud del animal experimentador Particularidades de la Homeopat a 5 6 7 y 8 Los conceptos que ha continuaci n se exponen no son los nicos en soportar el M todo Homeop tico sin embargo a consideraci n del autor del presente documento son los indispensables para hacer comprensible a un lector no adentrado en esta corriente el presente trabajo siendo estos conceptos La Ley de los Semejantes Similla Simillubus Curentur Experimentaci n Pura Potencia y dinamodiluci n La teor a del Semejante fue expuesta por primera vez por Hip crates y ya como concepto Homeop tico quiere decir la enfermedad solo puede ser curada en forma natural con el medicamento que durante la experimentaci n en el hombre sano produce alteraciones o s ntomas semejantes a los de la enfermedad entendi ndose por curar no solo la supresi n de los signos y sintomas Experimentaci n Pura es el m todo mediante el cual se realiza la indagaci n controlada en individuos lo m s sanos posible sobre los efectos que estos manifiestan por la administraci n de una droga o sustancia en su estado m s simple o puro de las experimentaciones se desprendo signos y s ntomas propios a cada remedio para ser recapitulados en las Materias Medicas Homeop tica La potencia o dinamodiluci n se
142. dual purposes of reducing the number of pathogens that may be present on the equipment as well as giving more time to monitor the farm from which the equipment came for signs of disease The same procedures should be followed if any used equipment is brought onto a facility In addition to equipment and people any livestock or pets should not be allowed onto a facility Both pets and livestock are capable of acting as vectors for disease In particular they have been known to harbor both pathogenic E coli and Salmonella sp Kunze et al 2008 Sheng et al 2006 Finely 2007 Both of these organisms are known to be potential pathogens for both people and poultry It is also not advisable to raise multiple poultry species on the same premises Raising turkeys nearby or in the presence of chickens often results in outbreaks of Black Head etiology Histomonass meleagridis in the turkeys Merck 2008 Helm 2004 Farms should practice all in all out poultry production whenever possible This means that all poultry on a farm should come onto a facility at the same time from a common source and them be marketed at the same time at the end of the laying period This will help eliminate the spread of disease from older to younger birds thus helping to break any cycle of infection on a facility This practice also allows farms to be completely depopulated for a time so they can be thoroughly cleaned Since many pathogens decline in numbers rather quickly after poultr
143. e campo con enrofloxacina Tecnolog a Avipecuaria en Latinoam rica A o 4 no 44 septiembre 1991 pp 43 45 2 reunion AECACEM Quer taro 2009 P g 156 CASO DE CAMPO EN POLLO DE ENGORDA MENINGOENCEFALITIS BACTERIANA M V Z Mario Cesar Gabilondo S Especialista en Producci n Animal Resumen En una granja av cola ubicada en el estado de Morelos M xico se presento en pollitos de engorda de 5 dias de edad un cuadro nervioso observ ndose en las aves la presencia de torticolis tremor e incoordinaci n con una morbilidad del 3 y una mortalidad acumulada durante la primer semana del 1 73 Las aves fueron vacunadas para prevenir la presencia de Enfermedad de Marek a los 18 5 d as de incubaci n por v a in ovo Al realizar la necropsia de las aves sacrificadas que presentaron los signos cl nicos se observaron lesiones granulo matosas y edematosas en enc falo y cerebro los dem s rganos internos no presentaron cambios patol gicos aparentes Se mandaron aves vivas con sintomatolog a nerviosa al laboratorio de diagn sticos para realizar pruebas encaminadas a descartar una contaminaci n bacteriana y mic tica as como pruebas serol gicas virol gicas y de histopatolog a para descartar la infecci n por virus de Newcastle y Enc falo mielitis Aviar Los resultados del diagnostico indicaron la presencia de lesiones microsc picas y microsc picas en cerebro y enc falo dichas lesiones se identificaron como piogranulomas en meni
144. e effect on national and international trade Several pathogens are incriminated as possible cause either alone mono causal or in synergy with different other micro organisms multi causal or accompanied by non infectious factors such as climatic conditions and management related problems Fig 1 Worldwide the emerging and re emerging respiratory diseases and or infections of poultry are Infectious Bronchitis IB Infectious laryngotracheitis Avian Metapneumovirus aMPV and Ornithobacterium rhinotracheale ORT infections In addition Avian Influenza AI Newcastle disease ND and Mycoplasma infections appear to causing problem in some countries The severity of clinical signs duration of the disease and mortality are extremely variable and are influenced by kind virulence and the pathogenicity of the infectious agent as well as by many environmental factors such as poor management inadequate ventilation high stocking density poor litter conditions poor hygiene high ammonia level concurrent diseases and the type of secondary infection The diagnosis of the disease complexes is usually not a straightforward business Basically the diagnosis consists of case history as well as management and environmental investigation on spot In addition clinical investigations and post mortem examination done on the farm is an important step toward disease diagnosis However clinical signs and necropsies are mostly not the final step of the diagno
145. e fowl typhoid which was resulted in morbidity and mortality amongst poultry flocks throughout the 1800 s and into the early 20 century meanwhile S Enteritidis was virtually unknown as a human pathogen The National Poultry Improvement Program NPIP was implemented in 1935 to reduce economic losses caused by fowl typhoid and it was successful since S Gallinarum Pullorum have only the reservoir of fowl By the 1970 s 5 Gallinarum was virtually eliminated yet as this incidence decreased human S Enteritidis illnesses increased S Enteritidis lived in poultry at low levels but can also live in rodents Human cases of S Enteritidis rapidly increased through the 1980s and 1990s peaking as the most frequently reported serotype isolated from human illnesses and it is still responsible for gt 15 of the reported human salmonellosis cases the U S CDC 2006 Again bacterial ecology is much like that of the macro world environmental niches are filled by a succession of species best adapted to each niche Salmonella Gallinarum and Pullorum 2 reunion AECACEM Quer taro 2009 P g 40 filled a niche in the microbial ecology of the gut of chickens and when it was eliminated that vacuum was filled by 5 Enteritidis When the national poultry flock was emptied of Gallinarum S Enteritidis was able to jump from its natural rodent reservoir into poultry The close relationship between these serotypes is demonstrated by the fact that t
146. e o cresol 4 choloro alpha phenyl propan 1 ol clorocresol acido salic lico y sal s dica de alcano sulfonato mientras que el producto que servir como comparativo ser un desinfectante elaborado a base de cidos org nicos y cido asc rbico adem s se ocupar agua destilada para el grupo testigo Dise o experimental Se colocaron 3 grupos de 6 cajas de Petry o r plicas cada uno en cada una se depositaron 1 6 ml con 488 000 ooquistes esporulados por ml y un volumen controlado de 1 62ml de desinfectante de acuerdo al rea de superficie por caja de Petry Los tratamientos fueron organizados de la siguiente manera Grupo A in culo de Eimeria desinfectante espec fico contra coccidias Grupo B in culo de Eimeria desinfectante a base de cidos org nicos Grupo C in culo de Eimeria agua destilada est ril Se dej actuar cada producto durante 4 horas y posteriormente se realiz el conteo de los ooquistes con la c mara de Neubauer cuantificando nicamente las coccidias con la pared integra Los conteos se realizaron para detectar diferencias entre grupos tratados El grupo no tratado con desinfectantes se incluy para descartar que la disminuci n se pudiera deber a que las muestras se mantuvieron a temperatura ambiente por 4 horas antes de su conteo Prueba in vivo Se realiz en el Centro de Ense anza Investigaci n y Extension en Producci n Av cola C E LE P Av de la FMVZ de la UNAM el cual se localiza en la c
147. e potentially useful in the near future for pathogen control and poultry performance improvement Our laboratory has evaluated a simple method to select for individual enteric bacteria capable of inhibiting Salmonella growth in vitro and the ability of selected oxygen tolerant bacteria in combination to protect neonatal poults from Salmonella infection following challenge Bielke et al 2003 We have also been working toward isolation selection and further evaluation of probiotic organisms to control food borne pathogens Tellez et al 2006 In the following papers data from the experiments using a lactic acid bacteria based probiotic and an organic acid mixture to treat and or prevent Salmonella colonization in broiler chicks Salmonella is a gram negative rod shaped bacterium It is classified as a facultative anaerobe and a member of the family Enterobactericeae All non typhoid Salmonella serovars including Salmonella enterica serovar Enteritidis Salmonella enteritidis SE are motile and have peritricious flagella Davis et al 1967 In poultry infection in young chicks with some SE isolates results in 2 mortality within the first 48 hours of life and up to 20 morbidity the first five 2 reunion AECACEM Quer taro 2009 P g 6 days Clinical signs of infection are anorexia depression ruffled feathers huddling drowsiness dehydration diarrhea and white pasted vents MclIllroy et al 1989 Salmonella enteritidis can be
148. ecnolog a de la pigmentaci n en la avicultura mexicana 126 base al uso de cempasuchil Juan Manuel Cervantes S nchez y Juan Jos Salda a Gonz lez 2 reunion AECACEM Quer taro 2009 P g 4 Evaluaci n de una vacuna oral contra influenza aviar y Campylobacter jejuni expresada 127 Cicotiana benthamiana Castellanos I Moreno E Del Rio JC G mez MA T llez G Hargis BM Layton S Evaluaci n de un desinfectante coccidicida sobre la viabilidad de ooquistes de Eimeria spp y los par metros productivos en pollo de engorda Ortiz Garc a Otilio Hern ndez Velasco X chitl Fuente Mart nez Benjam n Tejeda Gil Ruth Jasso Villazul Antonio La homeopat a en una experiencia en aves de abasto 145 Ma de Lourdes Gonz lez Anaya Caso de campo en pollo de engorda Meningoencefal tis bacteriana 157 Mario C sar Gabilondo S Micoplasmosis ocular en gallina de postura 158 Jim nez Ricardo Camacho Jos Angel Ju rez Mireya Experiencias de campo en crianza abierta vs crianza black out en aves reproductoras ross 15 Jim nez Ricardo Evaluaci n de la protecci n conferida por vacunas concentradas contra influenza aviar 160 Gabriel G mez Gabriela Ascenci n Javier Calder n Development and evaluation of a novel bacterial vaccine vector system against viral 161 bacterial and protozoal pathogens S L Layton Colel D Kapczynski M Cox Y M Kwon L Berghman W J Bottje D Swayne and B M Hargis
149. ected holding itself contained in a surveillance zone based on a minimum radius of 10 kilometres and if necessary by vaccination EC 2005 Once the presence of highly pathogenic avian influenza has been officially confirmed all poultry and other captive birds on the holding shall be killed without delay under official supervision The killing shall be carried out in such a way as to avoid the risk of spread of avian influenza in particular during transport In accordance with Directive 2005 94 EC vaccination against avian influenza is generally prohibited the EU However under certain circumstances a member state can introduce emergency vaccination as a short term measure or may also introduce preventative vaccination in poultry or other captive birds as a long term measure The Commission shall immediately examine and approve the vaccination plan The vaccination strategy should allow differentiation between infected and vaccinated animals Products of vaccinated poultry such as meat and table eggs can then be placed on the market in accordance with the relevant Community legislation Vaccination when used properly seems to be an effective tool to in prevention and control of Al Capua et al 2003 Capua and Marangon 2006 Swayne 2006 Currently several commercial and 2 reunion AECACEM Quer taro 2009 P g 50 experimental inactivated and recombinant vectored AI vaccines showed to be able to protect against clinical signs morta
150. ector 0 2 JSE Alpha Toxin 0 2 14 A 7 V 0 19 0 0 09 Day10 Day20 Day 20 2 reunion AECACEM Quer taro 2009 P g 196 Where to Now a Optimize the vaccine vector system to be used In Bacillus Spp a Explore the use of a Type Il secretion System to display large post translationally modified proteins as antigens a Engineer current vaccine strains to display short epitope sequences from several different pathogens multivalent le alpha toxin TRAP Cheryl Lester Holly Jackson Robert Brewer Noel Neighbor Howard Lester Acknowledgments The Poultry health Lab Gang Nell Pumford Amanda Wolfenden Marion Morgan Memo Tellez Guillermo Gaona Srichaitanya enivaramaian Ross Wolfenden 2 reunion AECACEM Quer taro 2009 P g 198 2 reunion AECACEM Quer taro 2009 P g 199 INFLUENCE OF DIETARY PROTEIN LEVEL ON BROILER PERFORMANCE DURING LIVE OOCYST COCCIDIAL VACCINATION David J Caldwell and Jason Lee Harry D Danforth Steve Fitz Coy and Charlie Broussard Texas A amp M University College Station TX USDA ARS Beltsville MD Schering Plough Animal Health Millsboro DE Influence of Dietary Protein Level on Broiler Performance during Live Oocyst Coccidial Vaccination David J Caldwell and Jason Lee Texas A amp M University College Station TA Harry D Danforth USDA ARS Beltsville MD oteve Fitz Coy and Charlie Broussard Schering Plough Animal He
151. either guarantees nor warrants the standard of the product and the use of the name by the USDA implies neither approval of the product nor exclusion of others that may be suitable Corresponding author todd callaway ars usda gov ABSTRACT The intestinal tract of poultry is filled with a diverse population of bacteria protozoa and viruses and this complex consortium exists a relatively harmonious ecological balance that affects the health and productivity of the bird as well as consumers of poultry products The ecology of microorganisms is similar to that of the larger world where environmental niches are filled by the most fit species Human illnesses from poultry products have increased in the past 5 years leading to the recent USDA FSIS Salmonella Attack Plan that targets reducing the incidence of Salmonella 1n the live bird In addition to Salmonella spp Campylobacter 1s the most common cause of bacterial foodborne illness and 1s commonly found in poultry and their products Anti foodborne pathogen intervention strategies for use in poultry must be coupled with knowledge of the intestinal microbial population Competitive exclusion sodium chlorate vaccination colicins bacteriocins and bacteriophage are all intervention strategies that can reduce foodborne 2 reunion AECACEM Quer taro 2009 P g 35 pathogenic bacteria in poultry but it is vital to understand how they function so that we do not produce unintended negati
152. embryos and some strains may cause inflammation of the joints but the organism appears to be rarely encountered since its eradication by the primary breeders Ley 2003 Diagnosis of mycoplasma on the basis of clinical features and pathological lesions is often difficult since these signs may be confused with other infectious diseases Proof of infection therefore must be confirmed by laboratory diagnosis either by direct detection direct isolation or indirectly using serological methods During the acute stages of infection the number of mycoplasma in the respiratory tract is very high In such cases 5 10 tracheal or chonal cleft cotton swabs are sufficient for mycoplasma isolation In chronic cases however a high number of samples is essential In dead birds culture of lesions should be carried out For culturing embryonated eggs samples of yolk and yolk membrane should be included The samples should be cultured immediately after sampling using liquid and agar Mycoplasma media Frey et al 1968 Bradbury 1998 The isolation 1s accompanied by several disadvantages as follows 1 the organism is relatively fastidious and slow growing and culturing requires about 21 28 days confirming a negative result 2 the growth of mycoplasmas may be inhibited by damage during sample transport to laboratory or by growth inhibitors in the medium 3 in some flocks several different mycoplasmas non 2 reunion AECACEM Quer taro 2009 P g 55 pathogenic c
153. en plantas tiene como otro beneficio el almacenamiento de estos ant genos en las plantas por un tiempo prolongado sin da o a estas prote nas como en semillas 30 lo cual elimina gastos de almacenamiento en refrigeraci n Actualmente se reportan varios m todos para la producci n de prote nas ex genos en plantas transformaci n del genoma nuclear transformaci n del cloroplasto e infecci n viral transitoria de los cuales solo transformaci n nuclear y sistemas virales han sido empleados para la expresi n de VLPs no as con transformaci n de cloroplastos 26 31 La transferencia de ADN dependa de lo que se busca mejorar en la planta as como la especie a la cual pertenece est 26 Los m todos directos van de la transfecci n del genoma de organelos por electroporaci n m todos qu micos micropuntura de l ser de c lulas aisladas Uno de los mas comunes es el bombardeo de part culas o biobalistica empleada en plantas en las que no es posible el empleo de Agrobacterium tumefaciens como m todo de transferencia de ADN En este m todo peque as part culas de oro tungsteno o platino son recubiertas con ADN desnudo y despu s son disparadas por pistolas g nicas en el tejido 26 2 reunion AECACEM Quer taro 2009 P g 131 En el caso de A tumefaciens un m todo indirecto se emplea la capacidad de esta bacteria para transferir ADN ex geno a las c lulas vegetales 48 Las plantas que de manera natural son
154. en together make spores interesting vectors for targeting vaccine antigens to the APC and the secondary lymphoid organs The capacity of recombinant B subtilis spores expressing heterologous antigens to induce an antigen specific immune response following subcutaneous injection and to prime the immune system also by the oral route are important further characteristics Taken together all these features propose recombinant Bacillus spores as vector for vaccine delivery References 1 Rosovitz MJ Voskuil MI Chambliss GH Bacillus In Balows A Duerden BI editors Topley amp Wilson s microbiology and microbial infections 9th ed London Arnold 1998 p 709 29 2 reunion AECACEM Quer taro 2009 P g 77 ded 12 13 14 15 16 17 18 19 20 216 22 23 24 J Pannucci Okinaka R Sabin and Kuske Bacillus anthracis pXOI plasmid sequence conservation among closely related bacterial species J Bacteriol 184 2002 pp 134 141 E Helgason O A Okstad D A Caugant et al Bacillus anthracis Bacillus cereus and Bacillus thuringiensis one species on the basis of genetic evidence Appl Environ Microbiol 66 2000 pp 2627 2630 A Cherif S Borin A Rizzi H Ouzari A Boudabous and D Daffonchio Chracterization of a repetitive element polymorphism polymerase chain reaction chromosomal marker that discriminates Bacillus anthracis from related species J Appl Microbi
155. enicidad de la aflatoxina tratada fue grandemente reducida o inactivada bas ndose en las reversiones his gt his en la cepa de Salmonella typhimurium TA100 Los estudios de toxicolog a y patolog a mostraron que la protecci n en los animales debido al procedimiento de acidificaci n de la raci n no fue completa En conclusi n los resultados indican que el cido c trico posee actividad destoxificante y ademas puede proteger a los animales de la toxicidad cr nica causada por las aflatoxinas Palabras clave Aflatoxinas cido c trico raciones contaminadas para aves destoxificaci n 2 reunion AECACEM Quer taro 2009 P g 103 EL AGUA EN LA AVICULTURA Juarez Mireya Tlacomulco Lorenzo Petrone Victor M Collins Division Veterinaria S A de C V En la industria avicola la calidad y cantidad de agua que se utiliza en toda la cadena productiva esta subestimada sin embargo es importante tener en cuenta que algunos problemas de desempeno productivo y productividad de las empresas avicolas pueden estar atribuidos a esos factores El agua es un requerimiento importante se dice que bajo condiciones normales los animales pueden consumir el doble de agua que de alimento esta cantidad varia con la edad estado de salud y poca del ano El agua no solo es un nutriente de vital importancia el agua es esencial para el funcionamiento del organismo es el principal componente de las c lulas y la sangre se encarga de transportar nutrient
156. ent clinical Eimeria challenge and promotes growth performance during a challenge period Data collected thus far does not include results from an entire growout period The forthcoming experiment was designed to investigate vaccine efficacy under similar conditions during a complete growout period compared to a common ionophore used to control coccidiosis 2 reunion AECACEM Quer taro 2009 P g 224 m 4 m m a J EN F 3 n 1 D 1 th j iy i mM 1 a La Li 1 1 n n 1 L L L d 9 x s 5 s r 1 171 1 y L L L bol 1 1 4 Ls i wan ur H wa i L LL wW s Design 2 x 2 factorial treatment by diet Animals 1 20 Cobb x Ross straight run chicks with standard vaccination and processing House design All treatments were blocked randomized into a total of 40 pens with 43 chicks placed per pen and 10 replicate pens per treatment a T 1 1 Ba E 7 1 m y E r r 1 4 1 7 r LR i j P a 1 p a e Ip xl L E kb L L n L 2 d Diets all diets were corn soy based rations and fed by the following schedule during grow out Starter placement to 14 days Grower 14 to 29 days Finisne
157. ente medica que l designo como HOMEOPATIA a este documento le siguieron numerosos t tulos resultado del trabajo que el mencionado medico desarrollo hasta su muerte Los cuales han servido a sus seguidores para continuar con la investigaci n homeop tica m s aun para buscar la explicaci n de las interrogantes cient ficas que desde sus inicios la Homeopat a genero Hahnemann y la salud animal 5 6 La interpretaci n que prevalecia en el mundo occidental con respecto a las causas de las enfermedades que afectaban a los animales era las mismas que se daban en el caso de los humanos por lo cual se les administraban los mismos tratamientos ejemplo de esto eran los enemas sangr as vomitivos laxantes dietaci n extrema etc teniendo los mismos resultados o sea la muy dif cil recuperaci n del paciente y con frecuencia la muerte del mismo Hahnemann se intereso tambi n por la salud de los animales y en particular por la de los caballos hay que recordar que en su poca el medio de locomoci n humana era provisto por los equinos Y asi en el a o de 1796 declara lo siguiente si las leyes de la medicina que yo reconozco y proclamo 2 reunion AECACEM Quer taro 2009 P g 146 son ciertas y naturales ellas deben poder ser aplicadas en los animales tambi n como en el hombre sin embargo l mismo desestima a la experimentaci n pura en los animales bajo las especificaciones establecidas para el ser humano Recomendando que cuan
158. equipment and vehicles have recently been Prior to entry onto the facility vehicles and equipment should be thoroughly washed to remove organic matter and then 2 reunion AECACEM Quer taro 2009 P g 26 thoroughly disinfected While it is common practice for wheels and tires to be sprayed with disinfectant prior to entry onto a farm this practice is of limited benefit 1f built up dirt and organic matter is not first removed A high pressure washer capable of dispensing a disinfectant works much better than a standard water hose or pump sprayer although these are better than not washing and disinfecting at all Special attention should be paid to vehicles which visit multiple poultry farms or facilities daily feed trucks fuel trucks company service trucks etc as they pose a greater risk of carrying a disease It is a common practice for farm owners to share expensive pieces of equipment between facilities While this practice does save money on equipment the cost benefit of this practice must be thoroughly evaluated against the potential risk of spreading a disease If equipment 15 moved between farms steps need to be taken to thoroughly remove all dirt and debris that may be present A final disinfection after removal of all built up dirt and organic material may also lower chance of spreading pathogenic organisms If at all possible it is advisable to not bring the equipment into contact with the poultry for several days This serves the
159. er A D Brokat S and Hafez H M 2007b Pathogenicity of Mycoplasma lipofaciens strain ML64 for turkey embryos Avian Pathology 36 5 389 393 Lierz M Hagen N Harcourt Brown N Hernandez Divers S J L schow D and Hafez H M 2007c Prevalence of mycoplasmas in eggs from birds of prey using culture and a genus specific mycoplasma polymerase chain reaction Avian Pathology 36 2 145 150 Lierz M Jansen A and Hafez H M 2008a Avian Mycoplasma lipofaciens Transmission to Veterinarian Emerging Infectious Diseases 14 7 1161 1162 Lierz M Hagen N L schow D and Hafez H M 2008b Use of polymerase chain reactions to detect Mycoplasma gallisepticum Mycoplasma imitans Mycoplasma iowae Mycoplasma meleagridis and Mycoplasma synoviae in birds of prey Avian Pathology 37 5 471 476 Olson N O Heishman J O and Cambell A 1962 Dipping of hatching eggs in erythromycin for the control of mycoplasma Avian Diseases 6 191 194 Razin S 1992 Peculiar properties of mycoplasmas The smallest self replicating prokaryotes FEMS Microbiol Lett 100 423 432 Wang H Fadl A A and Khan M I 1997 Multiplex PCR for avian pathogenic mycoplasmas Mol Cell Probes 11 211 216 Whithear K G 1996 Control of avian mycoplasmoses by vaccination Rev sci tech Off int Epiz 15 1527 1553 Whithear K Soeripto G Harrigan K E and Ghiocas E 1990 Immunogenicity of a temperature sensitive mutant M
160. er chicks in the hatchery followed by administration in the first drinking water At the end of the grow out period processed carcasses coming from the treated broiler chickens had significantly less Salmonella from 41 in the controls to 10 treated Palmu and Camelin 1997 showed similar reductions of Salmonella 1n the processing plant neck and skin samples by treating birds with Broilact a commercial CE culture Nuotio et al 1992 used Broilact to protect newly hatched chicks against intestinal colonization and invasion by Salmonella enteritidis the treatment proved to effectively prevent both colonization and organ invasion by Salmonella enteritidis 2 reunion AECACEM Quer taro 2009 P g 12 In an experiment by Hume et al 1997 day of hatch broiler chicks were treated by oral gavage with PREEMPT a commercial CE culture At 4 hours one day or two days post treatment the chicks were challenged by oral gavage with either 10 or 10 Salmonella spp The results of the study showed an average reduction of Salmonella of 6 logio units and proved that chicks can be protected as early as 4 hours post treatment A study by Wierup and Wold Troell 1988 aimed to evaluate the effect of CE if adopted nationwide in the poultry industry and concluded that CE cultures reduce Salmonella contamination under field conditions in ways similar to those found earlier experimental studies Seo et al 2000 treated molting birds with antibio
161. es a una misma humedad etc y falta de visi n persona Intoxicaci n de preventiva e Falta de seguridad laboral animales por e Recepci n a destiempo de insumos equipos o presencia de hongos aves en alimento e Aplicaci n a destiempo de medicina preventiva Desarrollo e Almac n mal surtido deficiente de las e Fallas de inventario y medicamentos caducados parvadas e Departamento de compras poco gil e Compras por precio y diferentes a las requeridas e Desarrollo de reglas que no se cumplen e Falta de plan de contingencia y acciones correctivas e Nula o m nima investigaci n 2 reunion AECACEM Quer taro 2009 P g 106 Recientemente en diferentes paises y para los diferentes segmentos de produccion se han publicado una serie de normas recomendadas para la reingenieria de los procesos para la produccion de alimentos por ejemplo Manuales de buenas practicas Manuales HACCP Normas ISO Normas AIB Normas Eurep GAP etc Estas normas buscan una mayor integraci n de las pr cticas particularmente las relacionadas con la bioseguridad pr cticas administrativas operativas de capacitaci n bioseguridad etc pero desafortunadamente ha sido dif cil integrarlas al sector pecuario b sicamente por la falta de claridad sobre sus beneficios la falta de comprensi n sobre como integrarlas y o porque en la mayor a de las veces la evoluci n de los procesos parece implicar una reestructuraci n de la misma empresa con la finalidad de adecuar
162. es y desechos metab licos juega un rol importante en el proceso de digesti n y absorci n de nutrientes act a tambi n como reguladora de la temperatura corporal debido a su calor espec fico y caracter sticas de evaporaci n El agua es esencial para el mantenimiento de la homeostasis controlando el pH la presi n osm tica la concentraci n de electrolitos etc El agua en la avicultura es indispensable en toda la cadena productiva ya que forma parte de las aves es pieza fundamental en el proceso de desinfecci n del huevo incubaci n limpieza y desinfecci n de Instalaciones av colas vacunaci n medicaci n y desde luego es pieza clave a la hora del sacrificio y procesamiento de las aves Debido a todo esto el objetivo de este trabajo fue hacer una revisi n del uso del agua y la calidad de la misma 2 reunion AECACEM Quer taro 2009 P g 104 PRACTICAS ESTRATEGICAS EN EXPLOTACIONES AVICOLAS FUNDAMENTOS Manuel Quiroz Hoy en dia las empresas avicolas enfrentan retos particulares para satisfacer las demandas del mercado consumidor de alimentos cada vez m s exigente sobre los productos que adquiere Enfrentar estos retos es una tarea de por si complicada considerando que el proceso productivo de alimentos en este caso a nivel primario o de granja implica la presencia de peligros que pueden tener consecuencias de gran impacto a la salud econom a y medioambiente Entre los retos m s relevantes por enfrentar se encuentran los si
163. escence test or electron microscopy In the last years several molecular biological tools such as PCR Real time PCR and REA were developed allow the detection of the Virus DNA as well as the further identification and typing of adenoviruses Erny et al 1991 Raue and Hess 1998 Hess et al 1999 Raue et al 1999 Hess 2000 L schow et al 2007 However the isolation of the aviadenoviruses using chicken embryo liver CEL cell culture and chicken embryo fibroblast cell culture with further identification and determination of the pathogenicity seems to be very important since the pathogenicity of the isolates within the same serotype can be widely differ Cross neutralization tests are necessary to serotype the isolated virus and to determine a new serotype EDSV can be isolated in embryonated duck or goose eggs and in cell cultures Susceptible cell lines include duck and chick embryo liver duck kidney and fibroblast cells The virus may be isolated directly from the reproductive tract of affected hens Alternatively abnormal eggs may be fed to naive hens virus isolation is attempted from the shell gland of these hens when they produce abnormal eggs The most common serologic test 1s the immunodiffusion test that detects the group specific antigen This test is not sensitive enough A group specific ELISA and IIF tests are more sensitive The serum neutralization test has been used to detect serotype specific antibody but is labour in
164. f the 119 candidate genes were linked Figure 2 The six genes include five that were upregulated relaxin 3 RLN3 adrenergic receptor 2 ADRB2 neuropeptide Y receptor 5 NPYR5 glutamate receptor 8 8 and somatostatin receptor 5 SSTR5 One gene was associated that was downregulated by fasting proopiomelanocortin POMC Due to the differences all evaluated physiological indicators utilizing this model of fasting and refeeding we believe that the metabolic perturbance of fasting followed by refeeding did cause physiological changes which are likely a result of gene expression changes between treatment groups The differences in expression of 119 genes in the hypothalamus also confirm that this model results in differential gene expression http www biorag org pathway ph We have identified many new genes that are expressed in the hypothalamus in response to fasting or feeding of newly hatched chicks Some of these are likely to control feed intake or metabolism during this critical period of development The knowledge gained from this work will be valuable in future efforts to improve our understanding of appetite and metabolic regulation in poultry and in efforts to improve production performance Figure 2 Analysis of Candidate Genes with Pathway Miner REFERENCES 1 Batal A C M Parsons 2002 Effect of fasting versus feeding Oasis after hatching on nutrient utilization in chicks Poult Sci Jun 81 8
165. flora The control group that did not receive the CE was very susceptible to the Salmonella infection but in the CE group 77 of the chicks were protected against infection Other laboratories have extensively studied this concept In a similar study host specificity of the CE cultures was suggested because only chicken cecal microflora was able to protect chickens not horse or cattle feces Rantala and Nurmi 1973 The principle behind 15 based upon competition between normal non pathogenic gut microflora and pathogenic bacteria for colonization within the host gastrointestinal tract but the specific mechanisms are not well understood The World Health Organization 1994 defined competitive exclusion as follows In relation to the avian intestinal tract normal gut flora 15 an undefined preparation of live obligate and facultatively anaerobic bacteria originating from normal healthy adult individuals of an avian species which is free from specific pathogenic organisms and 1s quality controlled The purpose of such a preparation 15 to compensate for any deficiencies in the composition of the normal intestinal microbiota that relate to the natural control of undesirable micro organisms and arise from modern systems of poultry production 2 reunion AECACEM Quer taro 2009 P g 11 Mead 2000 proposed four ideas with regard to how CE is able to exclude pathogens The first is competition for receptor sites a niche where in the
166. formation of a mat of cells glycocalyx with inter connecting fibers formed by the microflora forms an effective physical barrier against Salmonellae The second is the production of volatile fatty acids VFAs by the normal microflora Volatile fatty acids are produced as the result of metabolism of some intestinal bacteria In an environment with a pH below 6 0 the VFAs are an undissociated state In this state the acetic proprionic and butyric VFAs are inhibitory to Salmonellae A third possibility is production of bacterosins but their mode of action and specific properties is still not completely understood The fourth is that there exists a competition between pathogens and native microflora for limiting nutrients The formation of healthy diverse and well established microflora is known to reduce susceptibility of poultry to infection with a variety of Salmonella serovars Baba et al 1991 Blankenship et al 1993 Hollister et al 1994 and Impey et al 1987 Anderson et al 1984 and Hollister et al 1999 showed that a culture of adult chicken cecal contents was protective turkey poults when the poults were challenge with Salmonella typhimurium Corrier et al 1993 obtained a reduction range of 30 to 90 on Salmonella enteritidis cecal and organ colonization in leghorn chicks when using a CE culture combined with dietary lactose Blankenship et al 1993 applied a CE culture in two steps first CE was sprayed on broil
167. gen Ridding the premises of the pathogen is often difficult to do without depopulating the facility The result of an infection varies by pathogen strain and overall health of the flock Consequences of infection can range from slightly elevated mortality and a slight decrease in egg production to loss of ability to export egg or chicks or in the case of a highly pathogenic avian influenza or velogenic New Castle complete loss of the flock to mortality or depopulation The amount of a pathogen be it bacterial viral fungal or protozoal an animal must be exposed to in order for that animal to become ill is known as infectious dose Typical infectious dose for most pathogens varies from 10 to 10 organisms but the infectious dose will vary from pathogen to pathogen and even from strain to strain within a single species The infectious dose curve is typically of a sigmoidal nature and is generally similar to that depicted in Figure 1 2 reunion AECACEM Quer taro 2009 P g 24 Effect of Challenge on Colonization by Salmonella Percent of Animals Infected Challenge Level Figurel Typical infectious dose response resulting from exposure to Salmonella When an animal or flock 1s exposed to few organisms the chance of infection is low but as the number of pathogens to which an animal flock are exposed increases the chance of infection will increase with the chance of infection approaching 100 at the highest levels of exposure
168. guientes 1 Desarrollar formas de producci n a gran escala de materia prima pollo pavo huevo etc para la elaboraci n de alimentos saludables demostrando un proceso acorde con est ndares de calidad sanidad inocuidad establecidos a nivel nacional e internacional como una forma de prevenir peligros principalmente enfermedades transmitidas por alimentos 5 durante la comercializaci n 2 La necesidad de alcanzar par metros de producci n competitivos que se reflejen en el precio del producto final 3 Demostrar un proceso productivo acorde con el cuidado al medio ambiente la comunidad y el propio personal de las empresas De acuerdo con los expertos esta tendencia hacia lo bueno bonito y barato hace necesaria la evoluci n de las diferentes pr cticas hasta ahora utilizadas en las explotaciones av colas Y cuando hablamos de pr cticas nos referimos literalmente a las pr cticas o actividades cotidianas que se realizan dentro de los diferentes ciclos productivos para alcanzar los objetivos o metas de producci n T cnicamente las diferentes pr cticas o actividades que el personal ejecuta son componentes de un procedimiento o proceso y la producci n av cola debe ser entendida como un conjunto de procesos que requieren de una sincronizaci n adecuada y un est ndar de operaci n para evitar variaciones que puedan alterar las caracter sticas del producto terminado ave huevo etc En la actualidad el desarrollo de
169. h C A Fritts F Yan H L Stilborn R C Crum Jr and V Raboy 2000 Nonphytate phosphorus requirement and phosphorus excretion of broiler chicks fed diets composed of normal or high available corn with and without microbial phytase Poult Sci 79 1451 1459 2 reunion AECACEM Quer taro 2009 P g 64 PATOLOGIA AVIAR DEBIDA A MICOTOXINAS Prof Elizabeth Santin PhD Profesora MV Ricardo Haiashy Estudiante de Maestr a en Medicina Veterinaria Leonardo Miglino Estudiante de Medicina Veterinaria Departamento de Medicina Veterinaria Universidad Federal do Paran UFPR Curitiba PR Brasil Introducci n Las micotoxinas son un grande grupo de productos t xicos para los animales plantas y seres humanos que ocasionan diferentes patolog as dependiendo de su estructura interferido en las diferentes v as del metabolismo de los animales Hasta ahora son conocidas cerca de 300 diferentes micotoxinas y estudios de la FAO mostraron que ellas est n presentes en m s de 30 de los cereales producidos en el mundo El grande desaf o de las micotoxicosis es la falta de un diagnostico preciso sabiendo los productores de aves que las micotoxinas est n ntimamente relacionadas con bajas de desempe o De esta manera grande parte de los casos de diagn sticos de micotoxicosis est n basados en la historia y signos cl nicos y principalmente lesiones hep ticas el rgano m s perjudicado Ya que no es f cil la detecci n de las micotoxi
170. h culture antigen Kleven et al 1996 The corresponding titres are 1 40 and 1 80 or above respectively The HI test appears to be more specific than SPA but still shows wide variations in results due to lack of uniformity between antigen preparations and that some isolates fail to agglutinate red blood cells and do not stimulate the production of HI antibody ELISA kits have also been developed for detection of antibodies against MG MS and MM These kits are commercially available ELISA 1s sensitive and specific but also can be prone to false positive and negative results Generally significant antigenic variability among strains also exists which could affect the sensitivity of serological tests Kleven et al 1988 2001 In all cases confirmation of positive cases can be carried out only by retesting the birds after about a month or by culture Treatment and control Several drugs have been found useful for reducing clinical signs and shedding in infected flocks However no known antibiotic regardless of dosage or length of treatment can eliminate the infection in birds and hatching eggs Among the more common antibiotics are tylosin spiramycin tetracycline quinolones enrofloxacin flumequin spectinomycin and lincomycin The drugs can be administered by numerous routes Injection feed water Treatment is able to reduce the losses but relapses may occur when treatment is discontinued Since the isolation of the causative agent is
171. he hemagglutinin cleavage site of avian influenza viruses Virus Research 49 173 186 Senne D A Panigrahy B Kawaoka Y Pearson J E Suss Lipkind J M Kida H and Webster R G 1996 Survey of the hemagglutinin HA cleavage site sequence of H5 and H7 avian influenza viruses Amino acid sequence at the HA cleavage site as a marker of pathogenicity potential Avian Diseases 40 425 437 Swayne D E and Suarez D L 2000 Highly pathogenic avian influenza Revue Scientifique et TechniqueOIE 20 463 482 Swayne D E J R Beck A Garcia and H D Stone 1999 Influence of virus strain and antigen mass on the efficacy of H5 avian influenza inactivated vaccines Avian Pathology 28 245 255 Swayne D E 2003 Vaccines for list A poultry diseases emphasis on avian influenza Dev Biol Basel 114 201 212 Swayne D E 2006 Principles for vaccine protection in chickens and domestic waterfowl against avian influenza Emphasis on Asian H5N1 high pathogenicity avian influenza Annals of the New York Academy of Sciences 1081 174 181 Swayne D E Garcia M Beck J R 2000 Protection against diverse highly pathogenic H5 avian influenza viruses in chickens immunized with a recombinant fowlpox vaccine containing an H5 avian influenza hemagglutinin gene insert Vaccine 18 1088 1095 2 reunion AECACEM Quer taro 2009 P g 53 32 Sylte M J Hubby B and Suarez D L 2007 Influenza neuraminidase antibodie
172. he changes that have occurred with intensive poultry production practices such as re using litter for several flocks breeders and broilers restricting food and water for specific periods using selective drugs for extensive periods due to cost and even removing the drugs from the feed for extended periods to control cost These practices may have facilitated some of the un characterized patterns or behavior of coccidia being observed in recent times It 1s for us to use all the past and new information about this dynamic and diverse disease for a better understanding and management Parasite development The intact sporulated oocysts enter the host via ingestion the gizzard and digestive juices aid in the rupture excystation and subsequent release of the sporozoites These sporozoites are the invasive units of the oocysts These protozoans enter the enterocytes of the intestines and or ceca where they develop and complete the asexual and sexual cycles The end products of these replications lead to unsporulated oocysts It is believed that these parasites develop only in the enteric cells but several endogenous stages meronts gamonts and oocysts have been found in non enterocytes epithelial cells in such places as the proventriculus and ventriculus Pathology and pathogenicity The pathology of coccidia is dependent on the species and strains involved dose level ingested and how deep in the tissues these parasites develop The most pathogenic is E
173. he effective 5 Enteritidis vaccines used in laying hens are actually made from attenuated strains of S Gallinarum The niche filling capacity of a complex microbial ecosystem poses a troubling concern for all foodborne pathogen reduction strategies because there are likely more potential pathogens lurking in the consortium that are present at very low populations This does not prevent the use of strategies in live poultry but merely suggests that repercussions should be considered during the early developmental process Removing a transient or endemic pathogen such as Campylobacter or Salmonella from the intestinal population will create a vacuum and at times the most fit successor could be another virulent pathogen Any strategy that eliminates foodborne pathogenic bacteria in the live animal should be coupled with a complementary strategy that provides an alternative bacteria or population or one that provides limiting nutrients that select for an already existing intestinal population to succeed in the niche occupied by a targeted foodborne pathogen CONCLUSIONS Foodborne pathogenic bacteria are widespread public health issues that are found in all phases of poultry production from the farm to the live animal to the slaughter plant Several intervention strategies have been brought forward that offer the possibility of reducing foodborne pathogens in poultry before they are slaughtered Many of these utilize aspects of the microbial ecology
174. hicks total which are described in Table 1 These groups were chosen in order to maximize the data obtained from chicks that were fasted and refed with minimal experimental groups The microarray analysis is very expensive and therefore the number of samples had to be limited 2 reunion AECACEM Quer taro 2009 P g 96 Table 1 Experimental Design Days of Samplin 1 2209 d4 Treatment Group do d mum ollected LT E Briefly eight chicks were sampled at hatch and on day both fed and fasted chicks were sampled On day 2 fed chicks fasted chicks and chicks fasted for 48 hours and refed for 4 hours were sampled Chicks fed ad libitum and chicks fasted and refed for 24 or 48 hours respectively were sampled on days 3 and 4 respectively All feed was provided to refed chicks at 8 am MICROARRAY ANALYSIS The microarray platform used for these experiments was the Chicken Oligo Microarray Operon containing 70mer probes which was printed at the University of Arizona This array contains 21 120 elements or spots and covers much of the chicken genome Prior to hybridization total cellular RNA was isolated from the hypothalamus tissue using the RNeasy Mini Kit Qiagen Valencia CA according to manufacturer s protocol Quantification of RNA was performed by measuring absorbance at 260nm and quality was evaluated using a bioanalyzer Agilent Technologies Palo Alto CA Due to the fact that the hypothalamus yields i
175. host bird in various ways including absorptive capacity Yokota and Coates 1982 protein metabolism Salter et al 1974 energy metabolism and fiber digestion 2 reunion AECACEM Quer taro 2009 P g 13 Muramatsu et al 1994 energy conversion Furuse and Yokota 1984 and gut maturation Furuse et al 1991 Balanced colonic microflora and immunostimulation are major functional effects attributed to the consumption of probiotics Isolauri et al 2001 Many probiotic effects are mediated through immune regulation particularly through balance control of proinflammatory and anti inflammatory cytokines Ghosh et al 1998 Neish et al 2000 The GIT serves as the interface between diet and the metabolic events that sustain life In poultry intestinal villi which play a crucial role in digestion and absorption of nutrients are underdeveloped at hatch Uni et al 1995 and maximum absorption capacity is attained by 10 days of age Noy and Sklan 1997 Understanding and optimizing the maturation and development of the intestine poultry will improve feed efficiency growth and overall health of the bird In the immediate post hatch period birds must undergo the transition from energy supplied by the endogenous nutrients of the yolk to exogenous carbohydrate rich feed During that critical time dramatic changes occur both in the intestinal size and morphology Uni et al 1995 Maturational changes also affect the epithelial cell membra
176. i E hagani E praecox E brunetti E mitis E maxima E tenella and E necatrix The process of immunizing the birds it 1s known that a single exposure does not confirm an immunity but what is critical the initial exposure As early as this can occur it should ideally from the immunization process and not from hatch mates The idea is to get as uniform an initial exposure as possible Misconceptions about vaccinations there 15 a belief that this practice of coccidia control is less ideal than using pharmaceutical agents In fact this practice of vaccinating birds is very effective It is no different immunizing your child against childhood diseases You would rather have your child immunized early in life against the disease than going to school and be exposed to these agents from classmates Misconceptions that the drugs are as effective as when they were first introduced years ago it has become more apparent that some of the commonly used anticoccidial drugs have lost some if not all of their effectiveness against some field strains Misconceptions about anticoccidial sensitivity tests AST there 15 a strong belief by some that these tests are not valuable Before each drug gets an approval from the federal government a series of the exact tests are conducted to demonstrate that these products are effective against field isolates Why then are these tests not valid Pullet house management lighting programs feed restric
177. i n de las plantas se empleo la cepa A tumefaciens LB4404 Las 2 reunion AECACEM Quer taro 2009 P g 134 plantas se agroinfiltraron con una soluci n conteniendo A tumefaciens t cnica de acuerdo a Huang et Las densidades opticas variaron de 0 02 a 0 04 Las hojas fueron colectadas a los 2 y 3 dias pos inoculaci n y posteriormente fueron liofilizadas Las muestras fueron pesadas y diluidas en buffer ELISA en una relaci n de 1 10 Se realizo la prueba de ELISA con un control positivo M2e con una concentraci n de 500 ug ml Resultados preliminares Los resultados preliminares al realizar pruebas de ELISA demostraron la presencia del epitopo M2e expresado en la superficie de las tres quimeras dise adas con VLP HBcAg Discusi n y conclusiones Los resultados indican que la expresi n de los pl smidos 1 2 y 3 fue elevada en los tres casos seg n los resultados preliminares de ELISA Se concluye que es posible la realizaci n de pruebas en aves para la evaluaci n de la inmunogenicidad de los VLP s HBcA g expresados en Nicotiana benthamiana Referencias l Conlan Coward C Grant AJ Duncan Gog DJM Gog JR Campylobacter jejuni colonization and transmission in broiler chickens a modelling perspective J R Soc Interface 2007 4 819 829 2 Beery J Hugdahl M Doyle M Colonization of gastrointestinal tracts of chicks by Campylobacter jejuni Appl Environ Microbiol 1988 54 2365 2370 3 Shane SM Campylobacter infe
178. ia y circulaci n de los agentes pat genos propios de las aves La siguiente tabla muestra algunos ejemplos de fallas operativas su origen y el peligro asociado Como podemos observar la magnitud de manifestaci n del peligro depende de su asociaci n a una o m s fallas operativas EJEMPLOS DE FALLAS OPERATIVAS Y LOS PELIGRO ASOCIADOS l e Falta de tiempo para el descanso de casetas Deficiencias en Mantenimiento je Falta de tiempo para el mantenimiento de una suministros de agua deficiente de caseta ventilaci n luz casetas e Fallas en limpieza y desinfecci n alimento etc e Nula coordinaci n entre el personal de limpieza y operativo e Falta de equipo e insumos para el mantenimiento e Falta de capacitaci n al personal e Fallas en el control de proveedores de insumos 2 Fallasenla je Ruta de comunicaci n larga o compleja comunicaci n y e Problemas con acceso a la informaci n o programaci n Falta de un plan de revisi n check list de actividades amp Falta de registros Enfermedades tardia mal e Falta de evaluaci n de procesos y desempe o asociadas a mala dirigida poco ventilaci n y clara Se favorecen ambientes propicios para el desarrollo de microbios Desarrollo de plagas vectores de microbios e Falta de procedimientos y guias o instructivos deficiencias en el 5 Fallas e Falta de organigrama control de operativas e Personal insuficiente temperatura administrativas je Exceso de responsabilidad
179. icoccidiano es bajo cuando este es permanente y las coccidias nativas han desarrollado resistencia a estos f rmacos El pigmento fue la variable mas afectada en el grupo sin coccidiostato y a pesar de que estas consumieron mayor cantidad de alimento pigmentaron menos que las que recibieron coccidiostato Sin embargo ambos grupos 2 10 11 presentaron niveles bajos de pigmentacion Es posible que a nivel de campo est sucediendo algo similar cuando un brote de coccidiosis es subclinico leve y pasa desapercibido debido a que no afecta directamente el peso corporal pero si se afecta el pigmento principalmente al final del ciclo lo que incrementa el costo de produccion y la calidad del producto final LITERATURA CITADA 1 McDougald LR Coccidiosis in Saif YM Barnes HJ Glisson JR Fadly AM McDougald LR Swayne DE Editors Disease of Poultry 11th ed Iowa State University Press Ames Iowa U S A 2003 974 990 2 reunion AECACEM Quer taro 2009 P g 123 10 11 Palermo J N Current and futures perspectives on the regulation of anticoccidial drugs and vaccines IK Internacional Coccidiosis conference 2005 September 19 23 Foz do Iguassu Parana Brazil Brazil Parana Fundac o de ciencia e tecnologia av colas AC 2005 19 23 Bermudez AJ and Steward Brown B Disease prevention and diagnosis in Disease of Poultry Edited by Saif YM Barnes HJ Glisson JR Fadly AM McDougald LR Swayne DE 11th ed Lowa St
180. ildebrand D G Page D E and Berg J R 1983 Mycoplasma gallisepticum MG laboratory and field studies evaluating the safety and efficacy of an inactivated MG bacterin Avian Diseases 27 792 802 Horrox N E 1987 Mycoplasma to dip or not to dip International Hatchery Practice 2 13 17 Kempf I 1998 DNA amplification methods for diagnosis and epidemiological investigations of avian mycoplasmosis Avian Pathology 27 7 14 Kleven S H 2004 Mycoplasma control in turkey flocks Proceedings of the 5 International symposium on turkey diseases Berlin ed H M Hafez German Veterinary Medical Socity Service GmbH Giessen ISBN 3 938026 15 4 p 297 306 Kleven S H 1975 Antibody response to avian mycoplasmas American Journal Veterinary Research 36 563 565 Kleven S H 1997 Changing expectations in the control of Mycoplasma gallisepticum Acta Veterinaria Hungarica 45 299 305 Kleven S H Jordan F T W and Bradbury J M 1996 Avian mycoplasmosis Mycoplasma gallisepticum In Manual of standards for diagnosis tests and vaccines 3 Ed Office International des Epizooties Paris p 512 521 Kleven S H and Levisohn S 1996 Mycoplasma infections of poultry In Molecular and diagnostic procedures in mycoplasmology vol Tully and S Razin eds Academic Press New York p 283 292 Kleven S H Morrow C J and Whithear K G 1988 Comparison of Mycoplasma gallisepticum strains by hemagglu
181. ility we have investigated the production of pro inflammatory cytokines such as TNF a and in human purified monocytes stimulated with B subtilis spores In vivo monocytes continuously exit the bloodstream and enter body tissues where they undergo differentiation 52 toward macrophages or dendritic cells according to the local cytokine environment and the presence of other stimulatory signals 53 Upon interaction with B subtilis spores the percentage of monocytes synthesising TNF a 13 3 or IL 1B 14 9 or both 20 7 was significantly higher than in untreated monocytes Interaction of monocytes with other non spore forming Gram positive bacteria such as Streptococcus gordon11 did not significantly stimulated IL 1f and only 4 8 of cells were positive for TNF a production data not shown 5 Engineering the B subtilis spore To obtain surface display of heterologous antigens on the spore of B subtilis 54 the spore coat protein CotB 55 was used as a fusion partner CotB 380 amino acids 1s the most abundant protein of the outer spore coat of B subtilis localised on the spore surface 54 Inactivation of the cotB gene with consequent absence of CotB from the spore does not yield any phenotypic variation 55 The genetic construct for display of a model heterologous protein is described in Fig 1 Recombinant strains are merodiploid for cotB since genetic constructs are performed in the amyE locus Fig 1 56 in
182. ily cellularly mediated with some secondary humoral responses Birds recovered from an infection will have some measurable immunity active however it has been demonstrated that passive immunity is also associated with coccidiosis A vaccine Coxabic is available in some countries using this methodology immunity is obtained through vaccinating the dam against coccidia and the protection is passively passed on to the off springs With this type of protection it is very possible that the broilers may obtain an active infection during the growing period with some parasitemia and eventually immunity develops Diagnosis The methods used for many years diagnosing and identifying coccidia species are oocysts morphology and parasite biology These methods are effective nine species of chicken and seven turkey Eimeria have been named and described via these methods However there are limitations such as there are overlaps in the size and shapes and regions of the intestines parasitized With someone skilled in the arts these limitations are miniscule but might be a challenge for the less experienced person In recent times enzyme electrophoresis the Polymerase Chain Reaction PCR methodology has become another tool in diagnosing and identifying the species coccidia These techniques are not without limitations It must be assumed that the standards used to develop these metrics for the described coccidia species were obtained from pure samples that conf
183. in 2000 It has become imperative that the commercial poultry industry develop effective and inexpensive methods or products to treat bacterial infections in sick birds in the event that antibiotic use is eliminated completely from animal production a trend which 1s currently being realized Europe Due to this emergence of microbes resistant to antibiotics antimicrobial resistance that are used to treat human and animal 2 reunion AECACEM Quer taro 2009 P g 10 infections the European Commission EC decided to phase out and ultimately ban since January 1 2006 the marketing and use of antibiotics as growth promoters in animal feed The use of antibiotics is only allowed by veterinary prescription for direct applications or as medicated feed These restrictions are deemed necessary as antimicrobials may lead to the selection of resistant bacterial strains in animals that could be transferred to humans by direct contact or via foodstuffs and subsequently lead to an impairment of the efficacy of antibiotics used in therapy of human infectious diseases Anadon 2006 Competitive exclusion CE was first described by Nurmi and Rantala 1973 and has been demonstrated to be an effective method of control of Salmonellosis commercial poultry flocks Nurmi and Rantala 1973 placed baby chicks in a clean environment and challenged them with Salmonella Some of the chicks then received CE a crude culture containing adult enteric micro
184. inferior to HA induced antibodies For both homologous and heterologous vaccines the degree of clinical protection and the reduction in viral shedding are improved by a higher antigen mass in the vaccine Swayne et 1 1999 For heterologous vaccines the degree of protection is not strictly correlated to the degree of homology between the haemagglutinin genes of the vaccine and challenge strains Swayne and Suarez 2000 Several novel vaccines either have been developed or are under development e g recombinant fowl pox viruses expressing the H5 or H7 antigen or other vectors such as infectious laryngotracheitis virus Beard et al 1992 Swayne et al 2000 Luschow et al 2001 The only field experience with a recombinant Poxvirus H5 to control AI has been obtained in Mexico Villareal Chaves and Rivera Cruz 2003 No such product has been licensed in the EU to date Additional Examples include DNA vaccines Subunit vaccines Vaccines based on reverse genetics Adenovirus vectored vaccine Newcastle disease vectored vaccine and Newcastle disease virus based bivalent live attenuated vaccine Lipatov et al 2005 Veits et al 2006 Gao et al 2006 Ge et al 2007 The effects of presence of anti vector and or anti Al active and or passive antibodies due to natural infection or vaccination on the efficacy of these vaccines required more investigation Generally the immunity induced by vaccination 15 of short duration and it is necessary t
185. ion This type of analysis 1s performed routinely the Porter laboratory see Ellestad et al 2006 The gene expression patterns observed by qRT PCR were compared with the patterns observed by microarray analysis to confirm the accuracy of the microarray data RESULTS Physiological Parameters In addition to gene expression differences the chicks for these experiments were weighed yolk sacs were weighed blood glucose triglyceride and non esterified fatty acid levels were determined These data indicate that there are significant physiological differences between groups due to fasting Mean body weight at hatch was 46 g and this did not significantly change within 24 hours in fed or fasted chicks Table 2 However by day 2 fed chicks were significantly heavier than chicks fasted or fasted and refed for 4 h On days 3 and 4 fed chicks were again heavier p lt 0 05 than their fasted and refed counterparts Remarkably by day 4 fed chicks had effectively doubled their hatching body weight When yolk sac weights were compared between treatment groups we observed that the weight decreased with time to less than 1g by day 4 in both fed and fasted refed groups 2 reunion AECACEM Quer taro 2009 P g 98 Table 2 Physiological parameters measured in fasted fed and delayed fed chicks Treatment Body Weight Yolk Sac Glucose Triglycerides NEFA g Weight g mg dL mg dL mEq L Hatch 40 15 3 88 4 66 0 382 221 15 56 021 0
186. ion beak trimming and transportation also may take considerable time 1t may be up to 2 days after hatch before a chick receives its first meal As described above delay in feeding for over 24 hours results decreased growth and performance over the life of the chicken The expression of genes regulating metabolism in the early post hatch time period are not well understood In these experiments our goal was to evaluate differences in gene expression in the hypothalamus of neonatal chicks after fasting post hatch and followed by delayed feeding Fertile broiler eggs Ross x Cobb were obtained from a local hatchery and were incubated in our laboratory at the University of Maryland The eggs were set immediately upon arrival at the laboratory Eggs were incubated under standard conditions 37 5 C and 60 relative humidity with turning every hour for 18 days On day 18 eggs were transferred to a hatching cabinet and were no longer rotated Male chicks were identified by feather sexing at hatching which was confirmed by visual inspection of the gonads at the time of dissection All chicks were brooded in cages with 24 hours light and continual access to water during this experiment Hypothalamus samples from 8 chicks were taken from each experimental group on the designated day and immediately snap frozen in liquid nitrogen for subsequent RNA isolation and microarray analysis Ten groups total are included in this experiment 8 chicks per group 80 c
187. ion AECACEM Quer taro 2009 P g 70 Grafica 2 Resultado del monitoreo de lesiones observadas en campo en pollos d Trerteslan 10 hee aus a mtiFic e SENEC Sa STILTS 8 EES E aerosaculites i IP IEEE A FFF 4 Prevencion de las micotoxicosis Una vez que se considera las micotoxicosis como importante en el costo de producci n animal es muy importante establecer un plan de control de esas micotoxinas para los pr ximos lotes una vez que nunca se puede recuperar las p rdidas referentes a las micotoxinas Ya que m s probablemente las micotoxinas se encuentran en granos da ados tambi n se tiene que considerar que esos granos tienen perdidas nutricionales As que el primer punto de prevenci n de las micotoxicosis es la correcci n de las f rmulas con la calidad de los granos no que se refiere a la energ a pero es necesario mucho cuidado con el uso de grasa oxidada que puede agravar los casos En caso de almacenamiento de granos es muy importante controlar la humedad actividad de agua temperatura y preferencialmente usar inhibidores de hongos a base de cidos org nicos Una pr ctica muy com n en casos de granos de mala calidad es hacer una diluci n de los mismos con granos de buena calidad sin embargo esta pr ctica es muy riesgosa porque no se sabe exactamente las cantidades de micotoxinas y puede suceder que toda la mezcla se torne peligrosa Durante el procesamiento del aliment
188. ios la manera de aplicar esta corriente medica en los animales existiendo al presente documentos Veterinarios Homeop ticos que refieren la terap utica correspondiente a la cl nica de los mam feros en la cual la individualidad cl nica puede ser hasta cierto grado respetada al prescribir el tratamiento homeop tico La avicultura al ser una actividad de poblaciones plantea el problema c mo respetar la individualidad cl nica o personalizaci n terap utica en un lote La prueba llevada a cabo en un lote de aves de abasto con el remedio Pulsatilla a la 6 y 30x expuso la incapacidad de las aves a mostrar signos espec ficos a este sin embargo puso de manifiesto la capacidad de los remedios homeop ticos para mejorar el funcionamiento del organismo de los pollos de abasto y de esta manera mejorar la producci n de ellas sin correr el riesgo de dejar residuos t xicos logr ndose esto con un costo inferior a cualquier aditivo en uso Introducci n La Homeopat a es una corriente medica creada expl citamente para el humano por el Dr Samuel Hanhemann siendo esta la raz n de poseer caracter sticas tan precisas en su m todo siendo estas caracter sticas inherentes al nivel de desarrollo evolutivo propio del hombre No obstante esto desde el origen de la Homeopat a se ha buscado la manera para soslayar las limitantes evolutivas existentes entre los animales y el hombre y permitir la aplicaci n de este m todo medico a estos Ya que l
189. ious Qocyst A swallowed enters gut Excystation Oocyst 8 WN Mie 0051 releases 7 sporocysts Sporulation occurs outside 1081 requires several days amp oxygen Sporocyst releases sporozoites Y Eimeria Life Cycle Male and Female EN Gametes Y Sporozoites invade AN di qut cells Merozoites released from schizont Trophozoite Schizont ill s usda him docid 1 1016 2 reunion AECACEM Quer taro 2009 P g 187 Eimeria RAP A TRAP thrombospondin related anonymous protein associated with parasite gliding motility that is highly conserved within apicomplexan microneme proteins i ids T yu Es Aikawa et al 1970 J Cell Biol 77 72 2 reunion AECACEM Quer taro 2009 P g 188 E maxima 00 homologue to lablyProGly Ser GlyPheProThrdladla E maxima Guelph Strain TRAP CET AT GlyClyGlyHheProThrAladla Sarcocystis muris putative m Pri Pro Thr la la E maxima M6 Strain TRAP CA ug HE Pro ro lyGlyPhe Pro ThrAladla E maxima TEP250 AA052676 1 CTT HE ai Hi Dro GlyclyclyHheProThriladlaValila GlyGly E tenella microneme protein HE Glyblydla GlyThelroThrAladlaval Gl E tenella micronene protein p KT GhyserGly Ser oer Ala GlyGl Alablytly 1 E LA
190. ive 2005 94 EC EC 2005 defined avian influenza as follows 1 Avian influenza means an infection of poultry or other captive birds caused by any influenza A virus a of the subtypes 5 or H7 or b with an intravenous pathogenicity index six week old chickens greater than 1 2 2 Highly pathogenic avian influenza HPAI means an infection of poultry or other captive birds caused by a avian influenza viruses of the subtypes H5 or H7 with genome 2 reunion AECACEM Quer taro 2009 P g 49 sequences codifying for multiple basic amino acids at the cleavage site of the haemagglutinin molecule similar to that observed for other HPAI viruses indicating that the haemagglutinin molecule can be cleaved by a host ubiquitous protease or b avian influenza viruses with an intravenous pathogenicity index in six week old chickens greater than 1 2 3 low pathogenic avian influenza LPAI means an infection of poultry or other captive birds caused by avian influenza viruses of subtypes H5 or H7 that do not come within the definition in paragraph 2 In addition RT PCR techniques on clinical specimens could result rapid detection and subtype at least HS and H7 identification Direct RT PCR tests may be useful for rapidly identifying subsequent outbreaks in flocks once the primary infected premises have been identified and the virus characterized Furthermore several commercially available rapid tests are available The
191. kcal kg 4 21 9 0 29 12 0 99 3080 2 reunion AECACEM Quer taro 2009 P g 228 Di letary Jmpone ent Total Protein Methionine Lysine TSAA ME kcal kg 20 0 0 99 1 14 090 9199 2 reunion AECACEM Quer taro 2009 P g 229 On day 14 oocysts isolated from loca commercial broiler farms were spray applied to the litter in each pen 40 000 oocysts chick E acervulina E maxima and E tenella present In inoculum Pen bulk weight and feed consumption was determined on days of dietary changes 2 reunion AECACEM Quer taro 2009 P g 230 Body Weight Day 14 Pre Litter Challenge 2 Means with different letters represent significant differences P lt 0 05 Body Weight Treatment 21 J E 2 91 0 c cnm pee LZ I L L J EN gt Day 29 Day 40 Day 50 reunion AECACEM Quer taro 2009 P g 232 Body Weight e M I Ld L gt i 0 0 Day 29 Day 40 Day 50 Main Effect Means with different superseript differ significantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 233 Dietary Feed Conversion Treatment 9 tes T gt 0 0 2 0 n Starter Grower Finisher Withdrawal Mam Effect Means with different superscript differ siomticantly P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 234 Dietary Feed Conversion
192. l 9 277 290 Das BB and Pradhan HK 1992 Outbreaks of egg drop syndrome due to EDS 76 virus in quail Coturnix coturnix japonica Vet Rec 131 264 265 Dhinakar Raj G V Thiagarajan and K Nachimuthu 2007 Detection of antibodies to egg drop syndrome virus in chicken serum using a field based immunofiltration flow through test Avian Diseases Digest Vol 2 No 3 pp 9 9 Durojatye OA Ahmed AS and Adene DF 1992 Egg drop syndrome 76 in poultry and other avian species in Nigeria Rev Elev M d Vet Pay Trop 44 37 38 Erny KM Barr DA and Fahey KJ 1991 Molecular characterization of highly virulent fowl adenoviruses associated with outbreaks of inclusion body hepatitis Avian Path 20 597 606 Fadly AM and Winterfield RW 1973 Isolation and some characteristics of an agent associated with inclusion body hepatitis hemorrhages and aplastic anaemia in chickens Avian Dis 20 139 145 Fitzgerald SV 2008 Adenovirus Infections In Diseases of Poultry 12th Edition Saif YM Fadly AM Glisson JR McDougald LR Nolan LK and Swayne DE eds Iowa State University Press lowa USA pp 251 266 2 reunion AECACEM Quer taro 2009 P g 88 20 2 22 23 24 25 26 2 28 29 30 3 32 33 34 35 36 37 38 39 40 4 Girshick Crary and Luginbuhl 1980 Serologic detection of adenovirus infections spe
193. l and J J O Brien 1989 Control prevention and eradication of Salmonella enteritidis infection in broiler and broiler breeder flocks Vet Rec 125 545 548 Molbak P Gerner Smidt and HC Wegener 2002 Increasing quinolone resistance in Salmonella enterica serotype Enteritidis Emerging Infectious Diseases 8 5 514 5 Muramatsu T S Nakajima and J Okumura 1994 Modification of energy metabolism by the presence of the gut microflora in the chicken Br J of Nutr 71 709 717 2 reunion AECACEM Quer taro 2009 P g 21 Neish A T Gewirtz H Zeng and A N Young 2000 Prokaryotic regulation of epithelial responses by inhibition of IKB a ubiquitanation Science 289 1560 1563 Nir L 1995 The uncertainties of the young broiler growth Page 19 28 In Proceedings of the 10th European Symposium on Poultry Nutrition European Federation of WPSA Branches Antalya Turkey Noy Y and D Sklan 1997 Post hatch development in poultry J Appl Poult Res 6 344 354 Nuotio L C Schneitz U Halonen and E Nurmi 1992 Use of Competitive Exclusion to Protect Newly Hatched Chicks Against Intestinal Colonisation and Invasion by Salmonella Enteritidis Br Poultry Sci 33 775 779 Olsen S E DeBess T McGivern N Marano T Eby S Mauvais V Balan G Zirnstein P Cieslak and F Angulo 2001 Noscomial Outbreak of Fluoroquinolone Resistant Salmonella Infection New England J Med 344 21 1572 1578 Palmu L a
194. l Agents and Cultured Cecal Microflora in Salmonella infantis Infections in Chickens Poultry Sci 58 1171 1174 Seuna E C Schneitz E Nurmi and P H Makela 1980 Combined therapy of Salmonella infection in chickens by anitmicrobial agents followed by cultured cecal bacteria Poultry Science 59 1187 1192 2 reunion AECACEM Quer taro 2009 P g 22 Smith H W 1965 The development of the flora of the alimentary tract in young animals Journal of Pathology and Bacteriology 90 495 513 Thompson J and M Hinton 1997 Antibacterial Activity of Formic Acid and Propionic Acids in the Diet of Hens on Salmonellas in the Crop Br Poultry Sci 38 1 59 65 Threlfall E J N G Powel and B Rowe 1997 Increasing incidence of resistance to trimethoprim amd ciprofloxacin in epidemic Salmonella typhimurium DT104 in England and Wales Eurosurveillance 2 81 84 Uni Z Y Noy and D Sklan 1995 Development of the small intestine in heavy and light strain chicks before and after hatching Br Poult Sci 36 63 71 Wierup M and M Wold Troell 1988 Epidemiological Evaluation of the Salmonella Controlling Effect of a Nationwide Use of Competitive Exclusion Culture in Poultry Poultry Sci 67 1026 1033 World Health Organization 1994 Report of the WHO FEDESA FEP Workshop on Competitive Exclusion Vaccination and Antimicrobials in Salmonella Control in Poultry WHO CDS VPS 94 134 Geneva World Health Organization Yokota H and M
195. lity as they come onto the facility If this is not possible a pair of clean coveralls again preferably laundered on site or a disposable coverall such as a Tyvec suit as well as durable shoe covers and a hairnet should be provided Any personal effects should be left outside the perimeter of the farm and any items which must be brought should be thoroughly disinfected While the above practices help to keep potential pathogens from being transferred into a facility by people it is also necessary to stop the spread of any known or unknown pathogens by people once they are on a facility All doors to barns should be locked to keep out unwanted visitors If an operation has multiple ages of flocks on a single farm it is advisable to move from younger flocks to older flocks as this decreases the risk of spreading disease When houses are entered it is good practice to use foot baths with a disinfectant capable of working in the presence of organic matter A brush used to remove organic material from boots prior to and after a visit to a barn will decrease the chance of moving around any potential pathogens If it is possible changing boots or boot covers upon entry into a barn is advisable As an extra precaution use of a sanitizing hand gel upon entry and exit may reduce the likelihood of spreading potential pathogens Equipment and vehicles are potential mechanical vectors As with people entering the premises it is advisable to know where
196. lity reduces virus shedding increases resistance to infection and reduces contact transmission of challenge virus However the virus is still able to infect and replicate in clinically healthy vaccinated birds and silent spread can occur after vaccination van der Goot et al 2007 In addition the circulation of the virus in a vaccinated population for a long period may result in antigenic drift away from the vaccine strain as reported for HSN2 in Mexico Lee et al 2004 and speculated for HSN1 in China Smith et al 2006 Wei 2007 Despite the above mentioned disadvantages in countries where H5NI virus infections are endemic vaccination may be helpful and can protect food supplies and economic well being of poultry owning families as well as industrial concerns OIE 2007 Generally the concept of vaccination against avian influenza is complex and there is no simple solution for all given epidemiological situations and differences existing in bird and poultry species Anon 2007 In most of countries inactivated adjuvanted homologous or heterologous vaccine vaccines are used The protection seems to depend to a large extent on antibodies which neutralise the virus and are predominantly directed against the haemagglutinin HA However also antibodies against neuraminidase may neutralise the virus McNulty 1986 On the other hand Sylte et al 2007 were reported that with NA alone multiple doses are needed to give protection and it is
197. logremos comprender esta informacion sera posible comprender desarrollar procesos con una vision clara de rentabilidad y dar a nuestra empresa respuesta a las necesidades actuales de eficiencia calidad y seguridad de la producci n al momento de su transformaci n alimento Considerando un ejemplo de procesos a implementar como lo es la instalaci n de un tapete sanitario y que aparentemente solo consiste en diluir desinfectante en una charola y pisar cada vez que se entra y se sale el proceso que se requiere incluye como primer paso la evaluaci n del desinfectante m s efectivo que dure que se pueda reconocer f cilmente el momento en que se inactiva la diluci n adecuada la cantidad de la soluci n recomendable el recipiente mas adecuado el tiempo de recambio condiciones de uso costo etc En el segundo paso y una vez que se define el proceso se debe generar un instructivo de trabajo para que independientemente de quien de mantenimiento a los tapetes sepa cuando y como debe hacerlo Este paso incluye tambi n la capacitaci n de los probables encargados de dar mantenimiento al tapete de tal manera que aseguramos que nuestro instructivo es simple y entendible y que el personal no tiene duda sobre el procedimiento El tercer paso consiste en verificar que el procedimiento realmente agrega valor al proceso productivo En el caso del tapete significa que realmente est contribuyendo al mantenimiento de la sanidad Este paso tie
198. ltados para pierna y muslo as como en la pechuga para AGP AGM AGS LA y AA fueron similares P gt 0 05 para sexos y disminuyeron P lt 0 05 al incrementar el de AAT a diferencia de los AG 3 DHA y EPA que se incrementaron P lt 0 05 con 1 y 1 25 de AAT DPA aumento P lt 0 05 en las hembras sin embargo adicionar m s AAT disminuy P lt 0 05 estos resultados concuerdan con Cherian 1996 que incremento los omega tres en el huevo Por otra parte los cidos grasos omega seis contenidos en algunos productos de origen animal y vegetal aceites y grasa disminuyen su concentraci n al adicionar fuentes de cidos grasos omega tres en la dieta y para este experimento al aumentar los niveles de cidos grasos omega tres los cidos grasos omega seis disminuyeron Trabajos realizados con AAT en dietas para gallinas de postura indican que los AGo3 en el huevo se incrementan al aumentar el AAT en la dieta pues tiene un alto contenido de EPA y DHA lo que concuerda con Castillo et al 2000 que incremento linealmente la deposici n de los dos cidos grasos Gonz lez y Leeson 2001 indican el AGo3 que m s se deposita en la yema de huevo es el DHA y en este estudio tambi n en la carne de pollo La reducci n en el contenido de los AGw6 fue proporcional al incremento de aceite de at n inverso los AGo3 Herber y Van Elswyk 1996 y Baucellis et al 2000 indican que esto puede deberse a la competencia entre los omega tres y seis Se cree q
199. lus are not part of the normal flora of humans and animals 23 and 27 3 Spore based vaccines against anthrax Anthrax is an acute infectious disease caused by the spore forming bacterium B anthracis Anthrax most commonly occurs livestock cattle sheep goats bison and other herbivores but it can also infect humans exposed to infected animals e g farmers or contaminated tissues e g mill workers Human anthrax has three major clinical forms cutaneous inhaled and gastrointestinal Pathogenesis of B anthracis depends upon three plasmid encoded virulence factors the anti phagocytic poly glutamic acid capsule and two proteinaceous toxins termed edema toxin and lethal toxin LeTx 1 and 7 It is over 120 years that the protection against anthrax conferred by spores of B anthracis has been described Greenfield 1880 and Pasteur 1881 Initially the vaccine schedule of Pasteur was adopted two doses of partially heat inactivated spores but variability in potency and virulence stimulated the search for a more effective and stable vaccine 28 The success of the attenuated Sterne veterinary vaccine in the 1930 determined a global reduction of anthrax cases in livestock in response to national programmes 29 This decrease in animal cases determined a consequent decrease human cases Unfortunately there are still regions were anthrax is endemic or hyper endemic This fact generally parallels the quality of publi
200. man R Ziprin R Beier and J DeLoach 1990 Biological Control of Salmonella typhimurium in Young Chickens Avian Dis 34 626 633 Hollister A D Corrier D Nisbet and J DeLoach 1999 Effects of Chicken Derived Cecal Microorganisms Maintained in Continuous Culture in Cecal Colonization by Salmonella typhimurium in Turkey Poults Poultry Science 78 546 549 Hollister A D Corrier D Nisbet R Beier and J DeLoach 1994 Effect of Cecal Culture Lyophilized in Skim Milk or Reagent 20 on Salmonella Colonization in Broiler Chicks Poultry Sci 73 1409 1416 Hollister A D Corrier D Nisbet R Beier and J DeLoach 1994 Comparison of Effects of Chicken Cecal Microorganisms Maintained Continuous Culture and Provision of Dietary Lactose on Cecal Colonization by Salmonella typhimurium in Turkey Poults and Broiler Chicks Poultry Science 73 640 647 Isolauri E Y Suitias Kankaanpaa and S Salmienen 2001 Probiotics effects on immunity Amer J Clin Nutr 73 4445 4505 Kobland JD GO Gale RH Gustafson and KL Simkins 1987 Comparison of therapeutic versus subtherapeutic levels of chlortetracycline in the diet for selection of resistant salmonella in experimentally challenged chickens Poultry Science 66 7 1129 37 Mead G 2000 Prospects for the Competitive Exclusion Treatment in Controlling Salmonellas and Other Pathogens in Poultry Vet J 159 111 123 Mclllroy S G McCracken S C Neil
201. mo T2 Toxinas como el acido ciclopiaz nico pueden tambi n causar necrosis en las mollejas Por otro lado las fumonisinas pueden afectar la resistencia entre las c lulas intestinales Bouhet et al 2004 disminuyendo la barrera intestinal contra los pat genos e regulaci n del equilibrio osm tico de las c lulas Todos esos eventos pueden ser cl nicamente presentados como una severa enteritis que tornase m s severa con la presencia de bacterias oportunistas Lesiones microsc picas pueden ser caracterizadas por reducci n de las vellosidades intestinales y con microscopia electr nica se observa extrusi n de las c lulas Muchas de las micotoxinas son liposolubles y r pidamente absorbidas por las c lulas intestinales Una vez absorbida llegan al h gado y circulaci n sangu nea sist mica La mayor parte afecta el metabolismo del h gado Pero cada micotoxina puede ter distintos mecanismos de acci n Aflatoxina y ocratoxina son las m s toxica para el h gado provocando de forma aguda alteraci n del color para roja intenso incremento del tama o del h gado y de la ves cula biliar La lesi n cr nica puede promover una disminuci n del h gado con coloraci n amarilla y la ves cula biliar disminuida o ausente donde en la microscopia se observa vacuolizacion de hepatocitos y proliferaci n de los ductos biliares Santin et al 2002 La ocratoxina OA tiene DL50 m s baja que la aflatoxina lo que significa que es m s toxica en niveles
202. moisture 60 and above and high levels of ammonia negatively affect the sporulation rate of the E maxima oocysts The E maxima oocysts also sporulate fairly well in new litter as compared to used litter during the same tme frame allowed The number of birds per unit area has a great influence on the number of oocysts per gram litter OPG A density of more than 22 birds per m for an extended time can increase the oocysts concentration in the litter to alarmingly high numbers to cause an outbreak Infectious agents such as IBDV and CAV affect bird health and immune status thus affecting host susceptibility to coccidiosis The selection and use of overly used anticoccidials can lead to poor coccidia control and outbreaks Improper mixing or improperly blending of efficacious compounds may contribute significantly to clinical coccidiosis It 15 extremely important for judicious use and calculated non use periods of these compounds to spare the effectiveness Immunogenicity and immunity The coccidia species are good sources of antigens when the host is exposed to the specific antigens approximately three week the host develops a solid immunity to those antigens The immunity to coccidia is stable but wane over time if the animal is maintained coccidia free environment This immunity is species specific that birds immunized against E tenella will not be protected against E maxima and visa versa The immunity to coccidiosis 1s primar
203. mors J Immunol 2004 173 3148 3154 Huang Z elkin G Maloney BJ Beuhner N Arntzen CJ Thanavala Y Mason HS Virus like particles expression and assembly in plants hepatitis B and Norwalk viruses Vaccine 2005 23 1851 1858 Sch del F Peterson D Hughes J Wirtz Milich D Hybrid hepatitis virus core antigen as a vaccine carrier moiety I Presentation of foreing epitopes J Biotechnol 1996 44 91 96 Koletzki D Zankl A Gerderblom HR Meisel h Dislers A Borisova Pumpens P Kr ger DH Ulrich Mosaic hepatitis B virus core particles allow insertion of extended foreign protein segments J Gen Virol 1997 78 2049 2053 Sh del F Peterson D Milich D Hepatitis B virus core and antigen immune recognition and use as vaccine carrier moiety Intervirology 1996 39 104 110 Ball JM Hardy ME Atmar RL Conner ME Estes MK Oral immunization with recombinant Norwalk virus like particles induces a systemic and mucosal immune response in mice J Virol 1998 72 1345 1353 Tacket CO Sztein MB Losonsky GA Wasserman SS Estes MK Humoral mucosal and cellular immune responses to oral Norwalk virus like particles volunteers Clin Immunol 2003 108 241 247 Kimchi Sarfaty C Arora M Sandalon Z Oppenheim A Gottesman MM High cloning capacity of in vitro packaged SV40 vectors with SV40 virus sequences Human Gene Therapy 2003 14 167 177 Frazer Quinn Nicklin JL Tan J Perrin LC Ng O Connor VM White
204. mostly shell less thin shelled discoloured or misshapen and have a poor internal quality It take mostly 4 10 weeks till the birds re start to produce normal At necropsy there is no specific lesion but a slight atrophy of ovary and oviduct can be observed Histopathological changes can be seen the oviduct and uterus shell gland There may be severe degeneration and desquamation of the epithelial cells atrophy of the uterine glands and infiltration of heterophils lymphocytes and plasmacytes Intranuclear inclusion bodies may be found in the epithelial cells of the uterus isthmus and vaginal gland region Adair and Smyth 2008 Smyth and McNulty 2008 Diagnosis of Adenovirus infections Basically the diagnosis of poultry diseases based on case history clinical signs and post mortem examination as important steps toward disease diagnosis but it should not be the final step In most cases clinical signs and lesions of many diseases are similar and laboratory tests are required to identify the specific cause Fig 1 The laboratory diagnosis can be applied to direct detection as well as for isolation and identification of the causative agent or indirectly to detect antibodies Hafez and Hess 1999 The diagnosis of adenovirus infection in poultry is in most cases based histological investigations and detection of intranuclear inclusion bodies hepatocytes or on detection of the antigen or virus particles using Immunofluor
205. mportante mencionar que la inestabilidad antig nica del virus de IA conduce a la imposibilidad de utilizarse como virus activo atenuado o modificado para la inmunizaci n de aves Por esta raz n es importante contar con vacunas que nos brinden la protecci n necesaria para minimizar los impactos que ocasiona la infecci n de este virus Desde hace m s de 10 a os se ha utilizado la vacuna emulsionada en aceite Sin embargo en algunas regiones del pa s se ha observado que no es suficiente la inmunidad conferida por una inmunizaci n y se ha adoptado la estrategia de administrar dos aplicaciones a lo largo del ciclo de vida de las aves Actualmente se cuenta con la tecnolog a que permite incluir dentro de una emulsi n mayor masa antig nica de esta forma se reduce la cantidad de emulsi n que necesita ser administrada Debido a lo anteriormente mencionado este tipo de vacunas pueden ser administradas incluso desde el d a de edad por v a subcut nea El presente trabajo tiene por objeto mostrar los resultados de la evaluaci n de la protecci n conferida por vacunas concentradas al ser aplicadas a los 10 y los 21 d as de edad como complemento al programa de vacunaci n contra IA 2 reunion AECACEM Quer taro 2009 P g 160 DEVELOPMENT AND EVALUATION OF A NOVEL BACTERIAL VACCINE VECTOR SYSTEM AGAINST VIRAL BACTERIAL AND PROTOZOAL PATHOGENS S L Layton K Cole D Kapezynski M M Cox Y M Kwon L Berghman W J Bottje
206. mucho m s bajos y adem s de la lesi n de h gado causa incremento de tama o de ri ones Reducci n en la productividad incremento en el consumo de agua y de la humedad en la cama son las principales se ales de la ocratoxicosis Aflatoxina y ocratoxina causan lesiones hep ticas severas que incrementan los niveles de la enzimas AST y GGT en sangre con reducci n en los niveles de prote na y calcio s ricos Santin et al 2002b Tricotecenos son un gran grupo de m s de 100 metabolitos de hongos con la misma estructura b sica Las m s conocidas son T2 DAS y deoxinivalenol DON La lesi n oral es la m s com n asociada a los tricotecenos adem s de la diminuci n en el consumo producci n y calidad de huevos DON y T2 en la dieta disminuyen los valores de hematocrito leucocitos como linfocitos T CD4 CD8 y la concentraci n de IgA biliar Zearalenona tambi n es una fusariotoxina con potente acci n estrog nica La inducci n de se ales de anormalidades reproductivas en cerdas es mucho conocido como causa de esa micotoxicosis mas su efecto en aves no est muy claro Malekinejad et al 2006 informan que la zearalenona puede ser metabolizada en el h gado en dos diferentes metabolitos alfa o beta zearalenol Alfa zearalenol presenta alto potencial estrog nico y beta presenta poco potencial Los 2 reunion AECACEM Quer taro 2009 P g 67 autores informaron que el higado de aves diferente a lo que sucede con cerdos prod
207. n combination with the adjuvant CTA1 DD provides complete protection Vaccine 2006 24 544 551 Santi L huang Z Mason h Virus like particles production in green plants Methods 2006 40 66 76 Clarke BE Newton SE Carroll AR Francis MJ Appleyard G Syred AD Highfield PE Rowlands DJ Brown F Improved immunogenicity of a peptide epitope after fusion to hepatitis B core protein Nature 1987 330 381 384 2 reunion AECACEM Quer taro 2009 P g 136 28 29 30 31 22 33 34 35 36 37 38 39 40 41 42 43 44 Jiang Wang Graham DY Estes MK Expression self assembly and antigenicity of the Norwalk virus capsid protein J virol 1992 66 6527 6532 Wang KC Wu JC Chung YC Ho YC Chang MD Hu YC Baculovirus as a highly efficient gene delivery vector for the expression of hepatitis delta virus antigens in mammalian cells Biotechnol Bioeng 2005 89 464 473 Streatfield SJ Mucosal immunization using recombinant plant based oral vaccines Methods 2006 38 150 157 Walmsley AM Arntzen C Plant cell factories and mucosal vaccines Current opinion in biotechnology 2003 14 145 150 Grgaci EVL Anderson DA Virus like particles passport to immune recognition Methods 2006 40 60 65 Fifis T Gamvrellis A Crimeen Irwin B Pietersz GA Li J Mottram PL McKenzie IF Plebanski M Size dependent immunogenicity therapeutic and protective properties of nano vaccines against tu
208. n con iniciadores aleatorios el patr n electrofor tico de los productos de amplificaci n de las cepas fue comparado contra el patr n electrofor tico del DNA de una cepa vacunal y el resultado fue igual a la cepa vacunal cabe se alar que estas aves no fueron vacunadas Estas cepas clonadas fueron utilizadas para pruebas de concentraci n m nima inhibitoria los resultados est n expresados en ug ml y fueron los siguientes para lincomicina aves sanas 1 25 aves enfermas 2 5 eritromicina aves sanas gt 2 5 aves enfermas gt 2 5 tiamulina aves sanas 0 312 aves enfermas 0 625 enrofloxacina aves sanas gt 2 5 aves enfermas 2 5 tilosina aves sanas 0 039 aves enfermas 0 039 doxiciclina aves sanas 0 625 aves enfermas 1 25 Como podemos observar la cepa de Mycoplasma synoviae aislada de las aves enfermas requiere una mayor cantidad de ug ml de cada uno de los antibi ticos utilizados para inhibir su crecimiento a excepci n de la tilosina en donde la cantidad requerida es la misma que para las aves sanas En este caso aunque son pruebas in vitro es importante considerar los resultados cuando se pretende establecer un programa de medicaci n Palabras clave Mycoplasma synoviae gallinas de postura antibi ticos concentraci n m nima inhibitoria RAPD 2 reunion AECACEM Quer taro 2009 P g 125 SURGIMIENTO Y DESARROLLO DE LA TECNOLOGIA DE LA PIGMENTACION EN LA AVICULTURA MEXICANA EN BASE AL USO DE CEMPASUCHIL Juan Manuel Cervantes S n
209. n el caso particular de las gallinas de postura comercial se ha vinculado con decremento en la producci n de huevo Aunque estos problemas se manifiestan es m s frecuente que la infecci n por Mycoplasma synoviae se presente sin signos cl nicos ni lesiones como una enfermedad benigna de las v as respiratorias altas o como una condici n respiratoria grave en asociaci n con otros agentes El objetivo de este trabajo es mostrar la respuesta antibi tica in vitro de dos cepas de Mycoplasma synoviae aisladas en una misma granja de crianza de gallina de postura comercial provenientes de aves cl nicamente sanas y enfermas Los par metros que se consideraron para determinar que un ave era cl nicamente sana fueron la ausencia de signos respiratorios y la ausencia de lesiones articulares en el caso de las aves enfermas estas deb an tener signos respiratorios y lesiones articulares Las muestras para el aislamiento de Mycoplasma synoviae fueron hisopos traqueales provenientes de 10 aves sanas y 10 aves enfermas los cuales fueron remitidos al laboratorio para realizar el aislamiento Los resultados fueron los siguientes aves sanas 10 10 tubos positivos a Mycoplasma synoviae aves enfermas 9 10 positivos a Mycoplasma synoviae se selecciono un tubo de las aves sanas y uno de las enfermas para realizar una prueba de RAPD dicha prueba consiste en la clonaci n de las cepas de Mycoplasma synoviae aisladas con la finalidad de someter su DNA a una amplificaci
210. n separation of the male and female weights on day 28 indicate that the minimum level needed in males was the 0 35 level however the minimum level for females to maximize growth was slightly higher at 0 40 This observation was not detected in the floor pen broilers In combination these data indicate that the available phosphorus level needed for maximizing growth performance is dependent on rearing environment Table 1 The effect of calculated available phosphorus level on body weight through 28 days of age reared in floor pens 030 035 040 045 _ 0 50 055 females males Means in rows with different superscripts differ significantly at P lt 0 05 2 reunion AECACEM Quer taro 2009 P g 61 Table 2 The effect of calculated available phosphorus level on mortality corrected feed conversion ratio through 28 days of age reared in floor pens 0 096 0 35 040 045 050 0 55 a b Means in rows with different superscripts differ significantly at P lt 0 05 Table 3 The effect of calculated available phosphorus level on body weight through 28 days of age reared in battery pens 030 035 04 045 0 500 0 5590 females males a c Means in rows with different superscripts differ significantly at lt 0 05 Table 4 The effect of calculated available phosphorus level on mortality corrected feed conversion ratio through 28 days of age reared in battery pens 030 035 040
211. nalyzer Pulse oximeter 100 oxygen Results 100 hemoglobin saturation 1008 0 777 ow 02 birds D high O2 bids Hypoxemia Is eliminated inhalation of 100 oxygen HbO Saturation Sample interval 2 reunion AECACEM Quer taro 2009 P g 259 Results 2 e ji Mayangga a A apa L F 0y dj a a T n D _ SO 4 LL 4 l E de B x KE I kaa EN PE A EZ a F i do lt wh A eh c e oo Innaling 100 oxygen 9 OdH Increases arterial blood oxygenation after MP injection Sample interval reunion AECACEM Quer taro 2009 P g 260 23 Conclusion Blood flowing through preascitic and clinically healthy broilers Injected with MP 15 effectively exposed to ventilated gas exchange surfaces Third chapter Introduction Intravenous LPS Increases PAP Chapman el al 2009 In poultry houses LPS Is found In large Quantities on small size particles able to reach the respiratory parenchyma Respiratory surfaces are the most common route of entry Objective Development of a controllable model for exoosing the lungs of brollers to aerosolized LPS reunion AECACEM Quer taro 2009 P g 263 Materials and methods Birds aerosolized
212. nas en los alimentos para los animales que presentan problemas de supresi n inmunol gica mal desempe o o lesiones cl sicas de micotoxinas Se sabe que el muestreo inadecuado es la causa m s com n de la variable de los an lisis de micotoxinas Las micotoxinas nunca son distribuidas uniformemente en todos los cereales o alimentos almacenados ellas est n m s concentradas en reas con mayor humedad o con mayor nivel de oxigeno En la mayor parte de los casos la colecta de la muestra es realizada en una peque a porci n del silo Consecuentemente los resultados de los an lisis pueden ser negativos o con bajos niveles de micotoxinas dependiendo del lugar de muestreo Por otro lado en situaciones donde hay la notificaci n de micotoxinas de campo generalmente los animales ya consumieron todo el alimento no restando la cantidad suficiente para el an lisis Adem s de eso en situaciones de campo m s de un tipo de micotoxinas est n presentes en los alimentos al mismo tiempo y aunque los an lisis muestren bajos niveles de una determinada toxina en la misma raci n se podr a encontrar otra creando un efecto sin rgico Del punto de vista epidemiol gico el crecimiento f ngico puede ocurrir en diferentes fases de la explotaci n vegetal y animal Ellos pueden invadir las semillas antes de la retirada o se desarrollar en el almacenamiento de los granos Otro punto cr tico es el procesamiento de las raciones principalmente en la fase d
213. nciona como un canal de iones Este M2e es una prote na de 23 amino cidos altamente conservada en todos los VI tipo A este se encuentra presente en pocas cantidades en las part culas virales pero en abundancia en las c lulas infectadas 21 22 23 Investigaciones indican que mediante el uso de M2e es posible reducir la mortalidad y signolog a cl nica en infecciones de VI de alta patogenicidad 21 22 24 25 La expresi n de M2e en un sistema eucariota que permita su empleo como vacuna es el prop sito de la presente investigaci n 2 reunion AECACEM Quer taro 2009 P g 128 A diferencia de los virus con nucleocapsides de mayor complejidad como los pertenecientes a las familias Poxviridae y Retroviridae la mayoria de los virus cuentan con proteinas estructurales con dos simetr as b sicas helicoidal o icosah drica dando forma de vara esf rica al virus respectivamente 26 Estas prote nas poseen capacidad de organizarse por si solas en estructuras macromoleculares c psides llamadas tambi n part culas parecidas a virus VLP por sus siglas en Ingl s 26 las cuales se pueden encontrar en un rango de tama o de 22 a 150 nm similares al tama o observado en virus al ser expresadas de manera individual en diferentes organismos 21 22 27 31 estas prote nas no son infectivas ya que carecen de un genoma viral y no representan ning n riesgo a diferencia de las vacunas atenuadas o virus inactivados 17 18 21 25 26 32
214. nd I Camelin 1997 The Use of Competitive Exclusion in Broilers to Reduce the Level of Salmonella Contamination on the Farm and at the Processing Plant Poultry Sci 76 1501 1505 Persson U and 5 1 Jendteg 1992 The economic impact of poultry borne salmonellosis how much should be spent on prophylaxis Int J Food Micro 15 207 Rantala M and E Nurmi 1973 Prevention of the growth of Salmonella infantis in chicks by the flora of the alimentary tract of chickens British Poultry Science 14 627 630 Ricke S 2003 Perspectives on the Use of Organic Acids and Short Chain Fatty Acids as Antimicrobials Poultry Sci 82 632 639 Rozee K R D Cooper K Lam and J W Costerton 1982 Microbial flora on the mouse ileum mucous layer and epithelial surface Appl Environ Microbiol 43 1451 1463 Salter D N M E Coates and D Hewitt 1974 The utilization of protein and excretion of acid uric in germ free and conventional chicks Br J Nutr 31 307 318 Schneitz C and L Nuotio 1992 Efficacy of Different Microbial Preparations for Controllinf Salmonella Colonisation Chicks and Turkey Poults by Competitive Exclusion Br Poultry Sci 33 207 211 Seo K P Holt R Gast and C Hofacre 2000 Combined Effect of Antibiotic and Competitive Exclusion Treatment on Salmonella enteritidis Fecal Shedding in Molted Laying Hens J Food Prot 63 4 545 548 Seuna E and E Nurmi 1979 Therapeutical Trials with Antimicrobia
215. ne que ver con la documentaci n del proceso lo bueno y lo malo para fomentar una mejora continua con base en la experiencia adquirida 2 reunion AECACEM Quer taro 2009 P g 109 CONCLUSION Para la busqueda de estos objetivos es importante considerar los siguientes principios sobre la relaci n entre bioseguridad y los procesos una explotaci n que trata de ser productiva Primer principio Las condiciones sanidad orden capacitaci n etc en que se ejecutan los procesos en una explotaci n pecuaria determinan la probabilidad de ocurrencia riesgo de los peligros que pueden presentarse PELIGRO Y RIESGO NO SON LO MISMO Segundo principio Cada empresa cuenta con dimensiones particulares tama o de ato tecnificaci n organizaci n etc y la combinaci n de estas hace diferente y nica a una explotaci n en relaci n a cualquier otra aun y cuando pertenezcan a la misma empresa por lo que es posible que el peligro y el nivel de riesgo asociado al peligro hagan necesaria la implementaci n de pr cticas tan particulares como la explotaci n por lo que se debe considerar a los manuales hasta ahora existentes solo como una gu a Tercer principio La bioseguridad es un concepto y como tal no se puede traducir en procedimientos independientes a los procesos de producci n ya que su aplicaci n depende se incluye y se regula al trav s de los mismos O sea que no se puede apartar ni ver la bioseguridad como ente independiente a l
216. nes a major mechanical interface between the internal environment of the host and the luminal contents Rozee et al 1982 Studies on nutrition and metabolism during the early phase of growth in chicks may help in optimizing nutritional management for maximum growth Nir 1995 By dietary means it is possible to affect the development of the gut and the competitiveness of both beneficial and harmful bacteria which can alter not only gut dynamics but also many physiologic processes due to the end products metabolized by symbiotic gut microflora Additives such as enzymes probiotics and prebiotics are now extensively used throughout the world The chemical natures of these additives are well understood but the manner by which they benefit the animal is not Bedford 2000 Administration of CE has been tested using several mechanisms oral gavage in the drinking water and spray or lyophilized alginate beads Corrier et al 1993 reported that the methods of administration mentioned before have all proven to be effective in the control of Salmonella enteritidis in the cecal contents In the same study lyophilized alginate beads showed less 2 reunion AECACEM Quer taro 2009 P g 14 protection that the other methods of administration One method of application that can be easily adopted by the poultry industry is the administration of CE in the drinking water It was also described that chickens could be reinfected with Salmonella right after ce
217. nfermo as como su historia Son parte de un todo llamado enfermedad 3 Antecedentes de la Homeopat a 4 Esta fue desarrollada por el Dr Cristiano Federico Samuel Hahnemann medico alem n 1755 1842 el cual a partir de su propia experiencia y la de colegas que lo antecedieron as como la de contempor neos Concluyo en la inutilidad del m todo reconocido y usado en su poca Y gracias al hecho de haber tenido contacto con el documento escrito por el Dr Cullier qu mico se dio cuenta de que la Quina sustancia estudiada por el Dr Culler se correspond a en el cuadro cl nico por l referido con el que el Dr Hahnemann hab a observado en pacientes que sufr an de fiebres recurrentes A partir de este conocimiento Hahnemann inicia el estudio de numerosas substancias que en esa poca eran parte de los recursos m dicos lo primero que hizo fue administrarlas a individuos sanos bajo un estricto control A este procedimiento le llamo Experimentaci n Pura siendo l uno de los primeros experimentadores este procedimiento le permiti conocer los signos y s ntomas espec ficos de la sustancia ha prueba Ya para el ano de 1796 se encuentro en posesi n de una cantidad importante de informaci n te rica y practica que le permite publicar el ensayo Sobre un nuevo principio de descubrir las virtudes de las substancias medicinales en 1810 el Organ n de la Medicina Racional documento de presentaci n de la corri
218. ng litter feces and feedstuffs Rodriguez et al 2006 Fecal Salmonella shedding varies by season and there exists a correlation between fecal shedding and human outbreaks Fecal shedding approaches zero during the winter months and reaches its peak in summer and early fall McEvoy et al 2003 Fossler et al 2005 while human outbreaks peak 13 d after a spike in ambient temperature Naumova et al 2007 Although a correlation with environmental temperature exists the gut temperature 1s rather consistent so this is unlikely the proximal cause of seasonal shedding Salmonella 1s a serious threat to both broiler and egg production both as a direct food safety threat in poultry meat and eggs and via vertical transmission to a new generation of infected broilers or layers Since Salmonella can survive in the gut of birds or invade host tissues it can be transmitted to humans through various routes S Enteritidis for instance can invade the ovaries where it is enclosed in eggs or it can enter through shell cracks as the egg exits the cloaca Braden 2006 or can be transmitted through poultry meat Kimura et al 2004 Fertilized eggs can also be infected with Salmonella via semen Reiber et al 1995 If only 5 of chicks were Salmonella positive upon entry to the grower house the infected population will expand to 72 95 within three 2 reunion AECACEM Quer taro 2009 P g 37 weeks Byrd et al 1998 Thus intervention strategies tha
219. ng vertical transmission hens which become infected before the onset of laying tends to egg transmit at a lower rate than hens initially infected during egg production Generally egg transmission is intermittent and the rate is variable 1 10 and very low The spread of infection from bird to bird within one pen is usually rapid but it 1s rarely transmitted from one pen to another However in continuous production complexes multiple age with chronic apparent healthy carriers the spread of infection is difficult to control since the cycle of infection can not be broken without complete depopulation Yoder 1991 The agent also can be transmitted by other species of birds as well as mechanically by other animals and man Bradbury 1999 reported on the problems related to re emergence of mycoplasma infections For example In the past mycoplasmas appeared to have a restricted host range which should help to limit their lateral spread This does not seem to be true for MG or MS both of which have been found in a number of avian hosts A widespread epidemic of MG infection also occurred North American finches Ley et al 1996 In addition MM was isolated from raptors in Germany Lierz et al 2000 and MI from chickens and from wild and exotic birds Bozeman et al 1984 Recently Lierz et al 2007c isolated M lipofaciens from an egg of an imprinted 4 year old Northern Goshhawk Accipiter genitilis The pathogenicity of this strain to chicken
220. nges Las lesiones microsc picas observadas por histopatolog a indicaron la presencia de men ngeo encefalitis bacteriana Se procedi a realizar los cultivos requeridos para la identificaci n de la bacteria aislada determin ndose por pruebas bioqu micas la presencia de Pseudomona aureoginosa como el agente causal Las pruebas de diagnostico serol gicas y virol gicas e histopatolog a determinaron la ausencia de virus causante de la Enfermedad de Newcastle y de Enc falo mielitis aviar Las pruebas para la determinaci n de una contaminaci n mic tica fueron negativas Dado los resultados obtenidos por medio del diagnostico de laboratorio se concluyo que el cuadro nervioso fue ocasionado por una contaminaci n bacteriana a nivel de cerebro y enc falo que se debi a una falla en el proceso de bioseguridad implementado en la planta de Incubaci n al permitir por alg n descuido la contaminaci n bacteriana durante la preparaci n y aplicaci n de la vacuna de Marek in ovo a los 18 5 d as de Incubaci n 2 reunion AECACEM Quer taro 2009 P g 157 MICOPLASMOSIS OCULAR EN GALLINA DE POSTURA Jim nez Ricardo Camacho Jos Angel Juarez Mireya Victor M Petrone Asesor independiente Gigantes Tepatitlan S A de C V Collins Divisi n Veterinaria S A de C V La micoplasmosis aviar es una enfermedad de gran importancia particularmente cuando se habla de complejos respiratorios La aparici n de la enfermedad relacionada con My
221. nosilicate interaction on the tissues and humoral immune response of broilers Avian Pathol 31 73 79 2002 santin E Maiorka A Krabbe E L Paulillo A C Alessi A C Effect of hydrated sodium calcium aluminosilicate on the prevention of toxic effects of ochratoxin J Appl Poult Res 11 22 28 2002 Malekinejad Maas bakker R Fink Gremmels J Species differences the hepatic biotransformation of zearalenone The Veterinary Journal 172 96 102 2006 Pestka J J Zhou H R Moon Y Chung Y J Cellular and molecular mechanisms for immune modulation by deoxinivalenol and other trichothecenes unraveling a paradox Toxicology Letters 153 61 73 2004 Koutsos E A Lasing K C Interctions between the immune system nutrition and productivity of animals In Recents Advances in Animal Nutrition 2001 Nottinghan University Press 173 190 2001 Ledoux D R Brown T P Weibking T S Rottinghaus G E 1992 Fumonisin toxicity in broiler chicks J Vet Diagn Invest v 4 330 333 2 reunion AECACEM Quer taro 2009 P g 72 BACILLUS SPORES FOR VACCINE DELIVERY Guillermo Tellez and Billy Hargis JKS Poultry Health Research Laboratory Department of Poultry Science University of Arkansas Fayetteville AR 72701 1 The genus Bacillus Bacteria belonging to the genus Bacillus are Gram positive rods that form a single endospore spore The genus comprises 69 species approved in the International Journal of System
222. not effectively sanitize a facility To truly sanitize a poultry barn all litter and easily removable equipment including slats if present should be removed from the barn This is the only way to truly get to and remove all organic matter from a poultry house Equipment should be washed prior to coming back into the house It is a good practice to sanitize the equipment as it 1s brought in to kill any pathogens that may have been picked up while outside High pressure washers work very well to remove even thick layers of organic material from both housing and equipment As litter is impossible to sanitize 1 should be removed to either the bare concrete floor or the hard pack earth and replaced with fresh bedding material 2 reunion AECACEM Quer taro 2009 P g 28 between flocks Gas powered burners can be brought in to heat sterilize the clean floor in cases where disease is suspected Once the barn has been cleaned it is ready to be sanitized by a disinfectant Not all disinfectants are created equally and there is a wide range of both price and effectiveness Some disinfectants are dangerous to human and animal health and some may even damage housing and equipment It is important to evaluate all of these factors before deciding on a disinfectant to use table 2 As resistance may develop to antimicrobials after long periods of use rotating products every three to six months will help ensure continued effectiveness Chemical Gram Gram
223. ns between humans and animals 2 reunion AECACEM Quer taro 2009 P g 8 Therapeutic use of several antimicrobial compounds has greatly increased susceptibility of poultry to Salmonella infection following withdrawal of antibiotics Manning et al 1994 Manning et al 1992 The use of some antimicrobials such as fosfomycin can cause adverse effects in performance when used in uninfected birds Fernandez et al 2001 Seuna and Nurmi 1979 showed that combinations of neomycin polymixin or oxytetracyline neomicin or dihydrostreptomycin or furazolidone and trimethoprim sulphadiazine proved to be poor treating intestinal infections caused by the same strain of Salmonella Seuna and Nurmi 1979 also showed that after withdrawal of the drugs a rapid recolonization of Salmonella was observed The use of certain antimicrobial agents increased the number of Salmonella infected chickens Seuna and Nurmi 1979 Barbara et al 2000 a human study showed that antibiotic treatment does not affect Salmonella excretion and that persistent digestive symptoms are more common among patients treated with antibiotics Hunton et al 1990 associated the inclusion of penicillin in a broiler diet with an increase in Salmonella shedding Smith et al 1965 found that feeding avoparcin and lincomycin to chickens favored colonization of the alimentary tract by Salmonella typhimurium and also enhanced the spread of the organism to contact chickens
224. nsufficient mRNA for microarray analysis amplification of the mRNA was accomplished using Amino Allyl MessageAmp II aRNA Amplification Kit Ambion Austin TX Resulting aRNA was purified and quantified Samples were hybridized to the microarrays using a reference design Simon et al 2002 An internal reference standard was created by pooling aRNA from all samples within the experiment and labeling it with Alexa fluor 647 9 red Experimental samples were labeled with Alexa fluor 555 green and then hybridized to individual microarrays along with the Cy5 labeled reference pool Four arrays per group were utilized for this study 40 arrays total Labeling of cDNA with Alexa fluors microarray hybridization and image scanning was performed at the University of Delaware The data analysis was performed according to established protocols in the Porter laboratory as previously described Ellestad et al 2006 http physiolgenomics physiology org cgi content full 25 3 414 Data were initially processed in Dr Porter s laboratory using GenePix 6 0 software The data were then normalized using freely available software that 15 part of the TM4 suite of microarray data analysis applications from The Institute for Genomic Research TIGR Rockville MD The data were then analyzed statistically by determining the log ratio normalized Alexa 555 Alexa 647 for each spot Spots determined to be statistically significant p 0 05 One Way ANOVA SAS
225. ntigen presenting cells etc could enhance vaccine efficacy 4 Bacillus spores and the immune system Many studies of interaction between Bacillus spores and the immune system have been centred on B anthracis because of its pathogenicity and danger for human beings An early report 46 showed that spores have a high affinity for the regional macrophages and are efficiently and rapidly phagocytosed in vivo During the migration of spore containing macrophages toward lymph nodes germination occurs After spore germination and intracellular multiplication vegetative bacilli kall the macrophage and are released into the bloodstream where they live as extracellular multiplying pathogens These observations have been recently confirmed by studies of immunofluorescence staining confocal scanning laser microscopy and image cytometry 47 The efficient germination of B anthracis spores within phagosomes of the bronchoalveolar macrophages constitutes the strategy developed by the bacterium to exploit host immune cells to its advantage Alveolar macrophages play indeed a central role in the cell mediated immune response assuring the clearance of invading micro organisms from the lung alveoli Guidi Rontani et al 48 have investigated the fate of germinated spores Sterne strain and peritoneal macrophages using fluorescence staining techniques showing that the survival of spores accompanied loss of macrophage integrity and vitality The cytotoxici
226. nvironmental farm samples Journal of Food Protection 69 2576 2580 Smith H W and R B Huggins 1983 Effectiveness of phages in treating experimental Escherichia coli diarrhoea in calves piglets and lambs J Gen Microbiol 129 2659 2675 Stahl C H T Callaway L M Lincoln S M Lonergan and J Genovese 2004 Inhibitory activities of colicins against Escherichia coli strains responsible for postweaning diarrhea and edema disease in swine Antimicrob Ag Chemother 48 3119 3121 USDA ERS 2001 ERS estimates foodborne disease costs at 6 9 billion per year Economic Research Service United States Department of Agriculture Available at http www ers usda gov publications aer741 aer741 pdf Last accessed 16 October 2007 USDA FSIS 2007 Progress report on Salmonella testing of raw meat and poultry products 1998 2006 FSIS USDA Available at 2 reunion AECACEM Quer taro 2009 P g 44 Last accessed 18 June Zhang G L Ma and M P Doyle 2007a Potential competitive exclusion bacteria from poultry inhibitory to Campylobacter jejuni and Salmonella J Food Prot 70 867 873 Zhang G L Ma and M P Doyle 2007b Salmonellae reduction in poultry by competitive exclusion bacteria Lactobacillus salivarius and Streptococcus cristatus J Food Prot 70 874 878 Zhao C B Ge J De Villena R Sudler E Yeh S Zhao D G White D Wagner and J Meng 2001 Prevalence of Campylobacter spp Escheri
227. o 5 machos y 5 hembras obteniendo las muestras de pierna muslo y pechuga las cuales fueron almacenadas en un congelador a 20 C hasta su an lisis La extracci n de l pidos se realiz de acuerdo al m todo de Folch 1957 el extracto lipidico fue metilado de acuerdo al m todo de AOAC 2000 Los datos obtenidos en el laboratorio para el perfil lip dico se muestran como porcentaje de l pidos totales y para su an lisis estad stico se transformaron a la relaci n arco seno mediante un arreglo factorial 2 x 4 donde un factor fueron el sexo hembra y macho y el otro los niveles de AAT utilizando el paquete estad stico SAS Statystical Analysis System V 9 1 donde se obtuvo el an lisis de varianza las medias y cuando existi diferencia significativa entre ellas P lt 0 05 se realiz la prueba de tukey Steel and Torrie 1988 Cuadro 1 Dietas experimentales de iniciaci n 1 21 d as en pollos de engorda con niveles de aceite de at n 0 0 75 1 1 25 Aceite de soya 3 225 2 J 175 2 1 0 1 Ortofosfato de Ca 2 24 Carbonato de Ca 1 1 1 1 Analisis calculado EM Kcal Kg 3001 3007 3006 3005 Met Cis 7 Aceite de at n 0 os 33 CHdotod o 1 1 1 1 Fosforo disponible Requerimientos NRC 1994 2 reunion AECACEM Quer taro 2009 P g 114 Cuadro 2 Dietas experimentales de finalizaci n 22 49 dias en pollos de engorda con a
228. o la limpieza de los equipamientos es muy importante para evitar el desarrollo de hongos y la producci n de toxinas dentro de esos lo mismo se aplica para los equipos en las granjas como silos y comederos El uso de adsorbentes efectivos y de amplio espectro como los org nicos son una buena alternativa tambi n para reducir los niveles de micotoxinas a niveles non t xicos a los animales Pero esa adsorci n va ser limitada a la capacidad del adsorbente y la cantidad de toxina de la dieta Se hay gran niveles de micotoxinas muchas veces el efecto de los adsorbentes no es capaz de controlar micotoxicosis Lo mejor es un plan de prevenci n y control con base en los principios de HACCP que reduzca los riesgos de desarrollo de hongos en cereales y alimento adem s permita r pidas medidas correctivas cuando los problemas son detectados 2 reunion AECACEM Quer taro 2009 P g 71 Referencias 1 Bouhet S Hourcade E Loiseau N Fikry A Martinez S Roselli M Gaultier P Mengheri E Oswald I The mycotoxins fumonisin alters the proliferation and the barrier function of porcine intestinal epithelial cells Toxicological Sciences 77 165 171 2004 Dixon R C Hamilton Evaluation of some organic acids as mould inhibitors by measuring CO2 production from food and ingredients Poult Sci 60 2182 2188 1981 Santin E Paulillo Maiorka P C Alessi A C Maiorka A The effects of ochratoxin alumi
229. o sobre la reacci n adversa en pollos de engorda inoculados con una vacuna activa contra la enfermedad de newcastle Jes s Alejandro Castillo Contreras Ricardo Salado Carbajal lvaro Vera Noguez y Celestino Gallego Vargas Degradaci n de aflatoxinas en raciones destinadas para aves con un tratamiento de cido 103 c trico acuoso M ndez Albores A Del R o Garc a JC Moreno Ramos C Salgado Transito L Moreno Martinez E El agua en la avicultura 104 Ju rez Mireya Tlacomulco Lorenzo Pr cticas estrat gicas en explotaciones av colas Fundamentos 105 Manuel Quiroz Efecto de las ocratoxinas y las aflatoxinas sobre las variables productivas en pollos de 112 engorda vacunados contra la coccidiosis aviar Del R o GJC Rinc n Delgado JA Mart nez LJP Mendez Albores A Valdivia AG Morales AAE Moreno Ramos C y Moreno Mart nez E Inclusi n de aceite de atin como fuente de cidos grasos omega tres en dietas para pollo de 113 engorda E Morales B S Carrillo R M Castillo M J Gonz lez A O Prado R Efecto del uso permanente de un programa anticoccidial en los par metros productivos de 120 pollo de engorda desafiado con Eimeria spp Laguna Tamayo Leslie Asahetd Hern ndez Velasco X chitl Fuente Mart nez Benjam n vila Gonz lez Ernesto Respuesta antibi tica in vitro en dos cepas de Mycoplasma synoviae aisladas en gallinas de 125 postura clinicamente sanas y enfermas Camacho Jos ngel Ju rez Mireya Surgimiento y desarrollo de la t
230. o 3 con un n mero de 15 integrantes pareados Primer grupo recibi Pulsatilla a la 6x sexta potencia Segundo grupo recibi Pulsatilla a 30x treinta potencia Tercero el control La administraci n del medicamento se inicio a la 4 semana de edad y se prolongo hasta la 5 semana de edad la frecuencia de administraci n fue de 2 gotas gotero est ndar de uso homeop tico tres veces al d a directo al pico Condiciones de la segunda vertiente de la investigaci n 14 Estas se obtuvieron en raz n del seguimiento Zoot cnico el cual se soporta en par metros establecidos que son e Precocidad 53 56 d as e Mortalidad 2 e C parvada 2 0 e C anualizado 1 95 La Hip tesis establecidas fue La Pulsatilla es capas de desarrollar en pollos sanos de 4 semanas de edad el cuadro correspondiente a la Enfermedad Cr nica Respiratoria Complicada La parvada se obtuvo de la Empresa Incuoax cuya planta de incubaci n se encuentra establecida en Xoxocotlan Oaxaca el pollito 50 en la parvada inicial pertenece a la L nea 500 Broiler Performance 15 cuyo peso inicial promedio fue de 40 gr El manejo desde la recepci n como ya se dijo fue el establecido para las explotaciones comerciales y fue el mismo hasta la conclusi n de la 3 semana de edad el alimento fue de tipo industrializado y su administraci n se limito a la restricci n preventiva al S ndrome Asc tico SA 16 el agua provino del pozo de la Escuela
231. o alpha phenyl propan 1 ol clorocresol acido salic lico y sal s dica de alcano sulfonato mientras que el producto que servir como comparativo ser un desinfectante elaborado a base de cidos org nicos y cido asc rbico que se utiliz 10 veces mas concentrado a lo recomendado para su uso en las instalaciones en la etiqueta del producto Eimeria spp Se utilizaron cepas vacunales de las especies Eimeria tenella 24 E maxima 19 E mivati 17 and E acervulina 40 Coccivac B Shering Ploug S A de M xico El in culo se titul en c mara de Neubauer y 3 840 000 ooquistes esporulados fueron administrados por cada corral en ambos tratamientos Conteo de ooquistes Se realiz el conteo de ooquistes de acuerdo con la t cnica de McMaster a partir de muestras de heces Long y Rowell 1958 que fueron semanalmente colectadas y conservadas con dicromato de potasio al 2 5 para su an lisis cuantitativo posterior 12 horas despu s Severidad de lesiones macrosc picas en intestino Se realizaron cada semana inmediatamente despu s de sacrificar por dislocaci n cervical 1 ave por r plica de cada tratamiento Las lesiones fueron evaluadas de acuerdo a la escala de Johnson y Reid 1970 en una escala de 0 a 4 donde 0 corresponde a la ausencia de lesiones y 4 al grado m s severo o la muerte del ave Pigmento cut neo La deposici n de xantofilas amarillas en la piel fue evaluada al d a 49 de edad de 20 pollos por grupo a
232. o apply the vaccines several times during one rearing period There are little or no data available about the frequency of the vaccinations require keeping the breeder and layer flocks protected during the entire production period Vaccination strategies alone are not sufficient to stop farm to farm spread of HPAI Furthermore emergency vaccination is also hindered by practical difficulties related to the administration of the vaccine each single bird must be injected Generally the efforts to control the disease by vaccination alone without depopulation of affected birds to reduce the virus load in the environment will probably not be successful Vaccinal breaks were observed in some vaccinated flocks some countries Aly et al 2008 Vaccinal break defined as sub optimal vaccinal protection of a flock and can have several causes The efficacy of vaccine is very much dependent on the quality of the product as well as the quality of the manufacturing process and quality control procedures In addition the antigen concentration is very important According to Gardin 2007 The reduction of the antigen content leads to a reduction of the capacity of the vaccine to prevent the shedding although antibody response to 2 reunion AECACEM Quer taro 2009 P g 51 vaccination remains almost identical within a certain range of concentrations and although the monitoring of antibody response in the fields 16 useful to check the quality of the vaccinati
233. of H5 influenza vaccines produced by reverse genetics in a lethal mouse model Journal of infectious Diseases 191 1216 1220 Liu J Xiao H Lei F Zhu Qin K Zhang X w Zhang X 1 Zhao D Wang G Feng Y Ma J Liu W Wang J and Gao 2005 Highly pathogenic 5 influenza virus infection in migratory birds Brevia Science 309 5738 1206 2005 Aug 19 L schow D Werner O Mettenleiter T C and Fuchs W 2001 Protection of chickens from lethal avian influenza A virus infection by live virus vaccination with infectious laryngotracheitis virus recombinants expressing the hemagglutinin H5 gene Vaccine 19 4249 4259 McNulty M S Allan G M and Adair B M 1986 Efficacy of avian influenza neuraminidase specific vaccines in chickens Avian Pathology 15 107 115 OIE 2005 Manual of diagnostic tests and vaccines for terrestrial animals avian influenza Chap 2 7 12 May OIE 2007 Recommendations from the Scientific Conference Vaccination a tool for the control of Avian Influenza Verona Italy 20 22 March 2007 http www oie int verone Recommendations pdf accessed 13 April 2007 Olsen B Munster V J Wallensten A Waldenstr m Albert J Osterhaus D M E and Fouchier Ron A M 2006 Global patterns of influenza A virus in wild birds Science 312 5772 384 388 21 April 2006 Perdue M L Garcia M Senne D and Fraire M 1997 Virulence associated sequence duplication at t
234. off J Mayo McGeoch DJ Pringle CR Wickner RB eds Virus taxonomy Seventh report of the international committee on taxonomy of viruses Academic Press San Diego 585 597 Kilbourne ED Influenza 1987 Plenum NY 1 359 Lamb RA Krug RM Orthomyxoviridae The viruses and their replication In Field BN Knipe DM Howley PM eds Fields Virology 1996 Lippincott Raven NY 1353 1395 Saif YM Banes HJ Fably AM Glisson JR McDugald LR Swayne DE Diseases of poultry 2003 11 edition CD ROM Iowa state press A Blackwell publishing company Franklin RM Wecker E Inactivation of some animal viruses by hydroxylamine and the structure of ribonucleic acid Nature 1959 84 343 345 Laver G The structure of influenza viruses II Disruption of the virus particles and separation of neuraminidase activity Virology 1963 20 251 262 King DJ Evaluation of different methods of inactivation of Newcastle disease virus and avian influenza virus in egg fluids and serum Avian Dis 1991 35 505 514 Swayne DE Senne DA Beard CW Influenza In Swayne DE Glisson JR Jackwood MW Pearson JE Reed MW eds Isolation and Identification of Avian Pathogens 4th ed American Association of Avian Pathologist Kennett Square 1998 150 155 WHO Expert Committee 1980 A revision of the system of nomenclature for influenza viruses A WHO memorandum Bull WHO 585 591 Halvorson DA Karunakaran D Abraham AS Newman JA Sivanandan V Poss PE Efficacy of v
235. ofloxacin the pH value of the dipping solution can be corrected during storage The use of egg dipping in antimicrobials should be critically evaluated because of the irregular uptake of dip solution uneven distribution of active substance in the egg compartments and lack of standardization in dipping technique Additionally it is known that different disinfectants used for washing can influence negatively the antibiotic uptake of hatching eggs Hafez 1997 Therefore it is recommended that the compatibility of different disinfectants used for egg washing and or used in dipping solution has to be examined before application Bickford et al 1973 Horrox 1987 As the uptake of active substance by the hatching egg can be very irregular during dipping individual egg injection with accurate delivery of the proper dose is preferred in elite and grandparent stock breeding Automated systems for in ovo drug disposition before hatch are being developed Ghazikhanian et al 1980 Froyman 1996 Generally in commercial flocks kept in endemic area application of vaccines against MG and or MS may help prevent clinical disease The subject of MG vaccination has been reviewed by Whithear 1996 Vaccination against MG infection using inactivated culture was attempted in the early 1950 s without success until oil emulsion inactivated vaccine bacterins were introduced The inactivated bacterins came into wide spread use in the early 1980 s and were primarily
236. ogburn J Saliba F McCarthy and Porter Animal and Avian Sciences Department University of Maryland College Park MD Animal Science Department University of Delaware College of Veterinary Medicine Mississippi State University INTRODUCTION The availability of chicken genomic data and the significant number of chicken expressed sequence tags EST s entered into GenBank 599 383 entries as of 2008 http www ncbi nlm nih gov dbEST dbEST summary html has provided new opportunities to understand the gene networks utilized in chickens Further the application of microarray technology allows for a transcriptional snapshot of gene expression which genes are on and which genes are off a nearly genome wide basis Exploration of differential expression of genes in this experiment using a strong metabolic perturbation fasting and refeeding 1s contributing to our understanding of how the interactions of genes contribute to hunger and satiety in the chicken This experiment evaluated the gene expression of 20 120 genes in chicks during feeding fasting or delayed feeding over the first four days of life FASTING OF NEONATAL CHICKS When chicks are hatched they are commonly held from 24 up to 72 hours for many reasons including accumulating a large enough population to be shipped administration of vaccinations beak trimming and decombing and transportation particularly international shipping In
237. ol 93 2002 pp 456 462 Okinaka Cloud O Hampton et al Sequence and organization of pXOI the large Bacillus anthracis plasmid harboring the anthrax toxin genes J Bacteriol 181 1999 pp 6509 6518 C Berry S O Neil E Ben Dov et al Complete sequence and organization of pBtoxis the toxin coding plasmid of Bacillus thuringiensis subsp israelensis Appl Environ Microbiol 68 2002 pp 5082 5095 Mock and A Fouet Anthrax Annu Rev Microbiol 55 2001 pp 647 671 R B Parker Probiotics the other half of the antibiotics story Animal 29 1974 pp 4 8 R Fuller Probiotics in man and animals J Appl Bacteriol 66 1989 pp 365 378 L Morelli Probiotics clinics and or nutrition Dig Liver Dis 34 2002 pp 58 511 Joint FAO WHO group Guidelines for the evaluation of probiotics in food 2002 p 1 11 ftp ftp fao org es esn food wgreport2 pdf D H Green P R Wakeley A Page et al Characterization of two Bacillus probiotics Appl Environ Microbiol 65 1999 4288 4291 N T Hoa L Baccigalupi A Huxham et al Characterization of Bacillus species used for oral bacteriotherapy and bacterioprophylaxis of gastrointestinal disorders Appl Environ Microbiol 60 2000 pp 5241 5247 S senesi F Celandroni A Tavanti and E Ghelardi Molecular characterization and identification of Bacillus clausii strains marketed for use in oral bacteriotherapy Appl Environ Mi
238. omm 26 577 585 Smyth JA and McNulty MS 2008 Adenoviridae In Poultry Diseases 6 Edition Pattison M McMullin PF Bradbury JM and Alexander D Butterworth Heinemann Elsevier pp 367 381 Smyth JA and Adair BM 1988 Lateral transmission of egg drop syndrome 76 virus by the egg Avian Path 17 193 200 Smyth JA Plattern MA and McFerran JB 1988 A study of the pathogenesis of egg drop syndrome in laying hens Avian Pathol 17 653 666 Toro H Gonzalez C Cerda L Hess M Reyes E and Geissea C 2000 Chicken anemia virus and fowl adenoviruses association to induce the inclusion body hepatitis hydropericardium syndrome Avian Dis 44 51 58 Toro H Gonzalez C Cerda L Morales MA Dooner P and Salamero M 2002 Prevention of inclusion body hepatitis hydropericardium syndrome in progeny chickens by vaccination of breeders with fowl adenovirus and chicken anemia virus Avian Dis 46 547 554 Toro H Gonzalez O Escobar C Cerda L Morales MA and Gonzalez C 2001 Vertical induction of the inclusion body hepatitis hydropericardium syndrome with fowl adenovirus and chicken anemia virus Avian Dis 45 215 222 Toro H Prusas C Raue R Cerda L Geisse C Gonzalez C and Hess M 1999 Characterization of fowl adenoviruses from outbreaks of inclusion body hepatitis hydropericardium syndrome in Chile Avian Dis 43 262 270 Van Eck JHH Davelaar FG Van den Heuvel Plesman TAM Van Kol N Kouwnhoven B and Guldie FHM 1976 Dro
239. ommonly classified as orexigenic increasing feed intake and anorexigenic decreasing feed intake The ARC orexigenic neurons produce neuropeptide Y NPY and agouti related protein which have increased expression in response to fasting and decreased expression response to leptin a hormone produced by adipocytes Anorexigenic neurons in the ARC include pro opiomelanocortin POMC and cocaine and amphetamine regulated transcript CART neurons These genes have decreased expression as a result of fasting and increase expression in response to leptin from adipocytes Coll et al 2007 Other neurons that play a part in regulation of feed intake include corticotropin releasing hormone CRH and thyrotropin releasing hormone TRH which are anorexigenic hormones in the PVN and also the orexigenic neurons containing melanin concentrating hormone and orexin ORX in the lateral hypothalamic area Remmers et al 2008 EXPERIMENTAL DESIGN This experiment used the metabolic perturbation of fasting in order to disrupt the gene pathways associated with metabolism and nutrient utilization Perturbation is a method that 15 used widely for modeling of functional networks of genes Wagner 2001 de la Fuente et al 2002 Additionally fasting during the neonatal period is common in poultry production due to the fact that many chicks may spend extended periods of time the hatching cabinet prior to removal As hatchery processing vaccinat
240. on but is not a very accurate and sensitive way to evaluate the level of protection Inappropriate storage handling and improper administration are further factors The quality of the vaccines application 15 crucial since all non injected chickens are not protected and improperly injected chicks will be poorly protected Using post vaccination necropsy residue of oil at the site of injection or serological testing demonstrated that 1 15 not uncommon to see as much as 20 or 30 or even more of chickens that were not injected Gardin 2007 In conclusion avian influenza infections in poultry are associated with severe economic losses early recognition and monitoring programmes are essential managing the infections and a universal solution for prevention and control of avian influenza does not exist Generally one of the above mentioned measures alone is of little value unless they are accompanied by improvements in all aspects of management and bio security In countries in which the infection become endemic and when other control measures such as stamping out movement restriction of poultry and bio security cannot stop the spread of the infection poultry flocks should be vaccinated using a vaccine of high quality Finally since the success of any control program depends on the hygiene practices of the personnel it is essential to incorporate education programs about micro organisms and their modes of transmission as well as awareness of
241. onde la temperatura y humedad est n elevadas Y por ltimo el crecimiento f ngico y las micotoxinas son presentes en locales de la f brica de raci n silos de granjas y comederos donde no hay higiene y limpieza adecuadas En realidad las perdidas provenientes del crecimiento f ngico sobre el desempe o animal no son solo debido a la producci n de micotoxinas Los hongos tambi n causan da os f sicos y p rdidas en la calidad nutricional de los granos siendo un efecto aditivo a la severidad de las micotoxicosis La actividad metab lica de los hongos est asociada a la respiraci n aer bica a si la deterioraci n del grano de una reacci n de oxidaci n de gorduras y hidratos de carbono en la presencia de oxigeno dando como resultado un acido carb nico agua calor y estructuras f ngicas Dixon amp Hamilton 1981 Adem s de eso el nivel de l pidos es muy reducido en los granos infectados por los hongos y eso esta relacionado con la reducci n de energ a disponible Esta situaci n podr a tener una gran influencia sobre la gravedad de las micotoxicosis en los animales especialmente si este nivel de energ a no sea corregido por un nutricionista Considerando este panorama sobre los problemas del crecimiento de los hongos y micotoxinas se torna claro que para comprender esa tem tica en la producci n av cola es necesario 2 reunion AECACEM Quer taro 2009 P g 65 ampliar el conocimiento sobre su epidemiologia Con base en este
242. onella Pseudomonas or other potential pathogenic organisms It is a good practice to send water samples to a qualified lab for analysis of bacterial levels and identification of potential pathogens To lower the level of bacteria in the water a water disinfection system such as a water 2 reunion AECACEM Quer taro 2009 P g 30 chlorinator 1s often of substantial benefit These systems 1f operating properly can dramatically lower the level of bacteria within a water system To ensure that the system is working properly water should be monitored for bacterial level before and after the disinfection system If chlorinators are used testing the level of free chlorine is also a good indication that the system 1s functioning properly Chlorination systems work best if water 1s acidic and quickly loose function as water becomes more basic Poultry watering systems may also pose a biosecurity hazard Open systems are hard to maintain a sanitary manner Closed systems such as nipple drinker lines are usually preferred Even closed systems are capable of harboring bacteria as biofilms can grow unseen inside the pipes of the system Fairchild 2006 Daily or weekly flushing of the lines as well as a good water disinfection program can help keep these systems free of biofilms and lower bacterial levels within the system Resistance to Disease The resistance of poultry to disease 1s an often overlooked component of a biosecurity program As
243. orables de pigmentaci n y eliminaci n de opgh A 25 352 B 9 2277 con respecto al grupo sin coccidiostato sin embargo estos no fueron los esperados en aves tratadas con f rmacos anticoccidiales Lo anterior puede relacionarse a disminuci n de la efectividad de un compuesto o ambos por la adici n permanente en la dieta durante varios anos Lo mismo puede suceder en granjas av colas donde no se realizan pruebas de eficacia anticoccidial previo a la planeaci n de los programas o despu s de varios anos de uso continuo y pueden pasan desapercibidos por semanas o parvadas antes de afectar en forma evidente la pigmentaci n u otros par metros productivos menos susceptibles Palabras clave coccidiosis aviar pigmentaci n cut nea pollo de engorda Eimeria 2 reunion AECACEM Quer taro 2009 P g 120 INTRODUCCION La coccidiosis aviar CA es la enfermedad parasitaria m s com n importante a nivel mundial r r 6 1 2 porque genera enormes p rdidas econ micas debido a su prevenci n y tratamiento Lo Con el descubrimiento y desarrollo de los productos 10n foros el control de la coccidiosis en pollo de engorda se mejor Sin embargo incluso el producto mas efectivo no puede eliminar todas las coccidias por lo que el riesgo de que se presente la enfermedad siempre estar latente m Por otro lado el periodo de uso de estos f rmacos inevitablemente favorece la selecci n y desarrollo de poblaciones de coccidias resisten
244. order to permit easy selection and to guarantee the expression of wild type cotB from its original locus As a model system we analysed the surface display of the 459 amino acid long fragment C of tetanus toxin TTFC 57 a well characterised and highly immunogenic 51 8 kDa peptide encoded by the tetC gene of Clostridium tetani Display of CotB TTFC fusion proteins on the surface of recombinant spores was confirmed by FACS Dot blot and Western blot with specific antibodies Growth sporulation and germination parameters were comparable to wild type cells for all recombinants The system described 54 1s the first evidence that a heterologous A insertion plasmid recipient chromosome Fig 2 Schematic representation of the genetic constructs for display of heterologous proteins on the surface of B subtilis spores A Gene fusions of fragment C of tetanus toxin white to the 5 part of the cofB gene are constructed on E coli plasmids carrying cofB sequences black and a marker chloramphenicol acetyl transferase grey within sequences of the amyE gene a amylase genome location at 327 20 kb AL009126 striped B Recombinant plasmids are then transformed into the B subtilis chromosome by natural transformation Integration by double crossing over is guided by the homologous amyE sequences flanking the recombinant insert 56 The gene coding for a protein of unknown function is located in a putative transcri
245. ormaci n contenida en cada uno de los trabajos es responsabilidad de los autores Patrocinador de las memorias y7 ME rel Y DIVISI N VETERINARIA 2 reunion AECACEM Quer taro 2009 P g 3 LISTA DE CONTENIDOS Pagina Directorio 2 Cr ditos 3 Lista de Contenidos 4 Control tools of Salmonella infections in the U S A 6 A D Wolfenden B M Hargis G Tellez Biosecurity for Broiler Breeders and Primary Breeding Stock 24 Ross Wolfenden Use of the intestinal ecosystem to reduce foodborne pathogens in poultry 35 T R Callaway Diagnosis and Control of Respiratory Diseases of Poultry with special attention to Avian 47 Influenza and Mycoplasma spp Hafez Mohamed Hafez Phosphorus an expensive necessity is phytase the answer 60 J T Lee L Oden S Pohl J Coppedge and A Klein Patologia Aviar debida a micotoxinas 65 Elizabeth Santin Bacillus spores for vaccine delivery T3 Guillermo T llez and Billy Hargis Avian Adenoviruses infections with special attention to Inclusion body hepatitis 81 Hydropericardium syndrome and Egg drop syndrome Hafez Mohamed Hafez Coccidiosis What do we truly know about this disease 9 Steve Fitz Coy Gene Expression in the Hypothalamus of Fasted and Fed Neonatal Chicks 95 S E Higgins L E Ellestad N Trakooljul L A Cogburn J Saliba F McCarthy and T E Porter Determinaci n del efecto de la administraci n en aerosol de una mezcla de cidos org nicos 102 etanocarb nico f rmico y l ctic
246. ormed to the species not based on one criterion but several criteria Control Pharmaceutics During the early years of trying to control coccidsiosis there have been many unsuccessful attempts For example the use of whey milk by products and home remedies were used the early years of coccidiosis control These attempts paved the way for the sulfa based products However toxicities became an issue with the sulfas synthetic anti parasitic agents replaced the sulfas Early synthetic anticoccidials were highly efficacious the mindset was to 2 reunion AECACEM Quer taro 2009 P g 92 eradicate coccidia Resistance to anticoccidial became a major problem with the highly effective products The next group of products discovered was the forgiving ionophores These products became the primary method for coccidiosis control with a slower rate for drug resistance to develop To reduce or delay the onset of resistance shuttle programs and rotation of anticoccidials have been used in coccidiosis control programs Recently vaccinating birds with drug sensitive strains of coccidia has shown great promise This practice also enables the addition of drug sensitive organisms to the coccidia population These drug sensitive organisms have shown to enhance the efficacy of the anticoccidials Mathis et al 2003 demonstrated that there are benefits for using Coccivac B a rotational program with Clinacox diclazuril to restore the sensitivity of
247. os celulares de mam fero a pesar de permitir las modificaciones apropiadas y un correcto ensamblado de las prote nas al ser sistemas menos manejables y de mayor costo su empleo no es una opci n a gran escala 32 Desde hace aproximadamente 10 anos la ingenier a gen tica ha permitido el uso de las plantas como biofabricas o biorreactores mediante el empleo de t cnicas con el objetivo de generar plantas con caracter sticas como la resistencia a insectos virus hongos y herbicidas as como la expresi n de prote nas de valor comercial para la industria como anticuerpos biofarmac uticos y vacunas 26 31 El uso de la gen tica aplicada a plantas es cada vez mas extendido debido a las ventajas potenciales para generar compuestos 26 30 En primer lugar los sistemas vegetales son m s econ micos que la infraestructura industrial que se basa en el uso de sistemas de fermentaci n o en biorreactores En segundo lugar ya est disponible la tecnolog a para cosechar y procesar plantas y sus productos a escala industrial En tercer lugar el requisito de la purificaci n del compuesto puede ser eliminado cuando el tejido de la planta que contiene la prote na recombinante se utiliza como alimento como en el caso de las vacunas comestibles En cuarto lugar se puede dirigir a las prote nas recombinantes a determinados compartimientos intracelulares o expresarlos directamente 2 reunion AECACEM Quer taro 2009 P g 130 en esos comp
248. oxina y ocratoxina es muy probable que la interferencia con la s ntesis proteica sea la principal causa de la inmunosupresi n La respuesta inmune necesita de intensa s ntesis de prote na y si hay algo que no permita esto el sistema inmune reduce su funci n En un estudio con aflatoxina y ocratoxina se observ reducci n en la cantidad de c lulas en mitosis en la bolsa de Fabricio y reducci n en los t tulos vacunales contra enfermedad de Newcastle en pollos Santin et al 2002 Eso sugiere que hay reducci n en la eficacia de las vacunas lo que en caso de reproductoras puede reducir la inmunidad pasiva y afectar la viabilidad de pollitos en la primera semana Las fumonisinas por su lado son potentes inhibidores de la enzima sphinganine N acyl transferasa La actividad biol gica de la enzima est relacionada con la integridad de las membranas celulares que parecen ser el principal tejido blanco de las fumonisinas in vivo Ledoux et al observaron disminuci n en inmunidad humoral y supresi n en la proliferaci n de linfocitos y en la eliminaci n de bacterias Sin embargo la inmunosupresi n es la forma m s com n de efecto de micotoxinas en el sistema inmune pero un estudio de Petska et al 2004 encontraron que DON y otros tricotecenos 2 reunion AECACEM Quer taro 2009 P g 68 pueden exacerbar la respuesta inmune En el estudio bajos niveles de tricotecenos incrementaron la expresion de las citocinas y genes inflamatorios que e
249. phosphorus requirements for floor and battery reared broilers In floor reared broilers growth depression was observed at 7 days of age with the lowest percentage yielding the lowest average body weight Table 1 This trend continued through day 28 with the 0 30 level yielding the lowest body weight At the conclusion of the starter diet Day 14 the 0 45 diet appeared to be the minimum available phosphorus level needed to maximize growth being significantly higher than all of the lower levels However this trend did not continue once the dietary change was made The broilers fed the 0 40 dietary treatment had similar body weights compared to the 0 45 level at 21 and 28 days of age Differences feed conversion ratios were only seen cumulative ratio for the starter period and for the duration of the study Table 2 At both of these time periods the 0 40 and 0 45 level performed similarly Upon separating sexes at day 28 data did not indicate any differences among sexes Battery Reared Broilers Similar to floor reared broilers battery reared broilers fed the lowest level of available phosphorus 0 30 yielded the lowest body weight throughout the duration of the study Table 3 Through day 21 the minimum available phosphorus level needed to maximize growth appeared to be the 0 40 level however continuation of the study through day 28 resulted in similar body weights for 0 40 and the 0 35 levels at the conclusion of the study Upo
250. plasma gallisepticum gallinas queratoconjuntivitis panuveitis concentraci n m nima inhibitoria 2 reunion AECACEM Quer taro 2009 P g 158 EXPERIENCIAS DE CAMPO EN CRIANZA ABIERTA VS CRIANZA BLACK OUT EN AVES REPRODUCTORAS ROSS Jim nez Ricardo Asesor independiente RESUMEN El xito en la producci n de pollito ross de excelente calidad depende de la combinaci n exitosa de varias t cnicas de manejo interrelacionadas durante el periodo de crianza de las aves Una de estas t cnicas clave de manejo esta relacionada con la duraci n del fotoperiodo y la intensidad de la luz que les proveemos a las aves durante su vida La luz juega un papel determinante no solo por el hecho de que las aves necesitan luz para ver encontrar comida agua y el nido si no tambi n porque es indispensable para el optimo desarrollo de su aparato reproductor En este punto debemos mencionar que la diferencia entre la duraci n del fotoperiodo y su intensidad durante la crianza y la producci n controlara y estimulara el desarrollo ov rico y testicular De la respuesta a los incrementos en el fotoperiodo y la intensidad de la luz depender el lograr el perfil correcto en el peso corporal y uniformidad Considerando las condiciones ambientales y el tipo de instalaciones con las que se cuente se han considerado tres posibles combinaciones de Iluminaci n del ambiente tales como crianza y postura en ambiente controlado crianza oscurecida black out y
251. polymerase chain reaction for specific detection of pigeon adenovirus Avian Path 31 95 99 Reece RL Grix DC and Barr DA 1986 An unusual case of inclusion body hepatitis a cockerel Avian Dis 30 224 227 Rosenberger JK Klopp S Eckroade RF and Krauss WC 1975 The role of the infectious bursal disease agent and several avian adenoviruses in the haemorrhagic aplastic anemia syndrome and gangrenous dermatitis Avian Dis 19 717 729 Schl r GM 1980 Frequency of antibody to adenovirus 127 domestic ducks and wild waterfowl Avian Dis 24 91 98 2 reunion AECACEM Quer taro 2009 P g 89 42 43 44 45 46 47 48 49 50 5 52 53 54 55 56 Senne DA Panigrahy B and Morgan R 1994 Effect of composting poultry carcasses on survival of exotic avian viruses highly pathogenic avian influenza HPAI virus and adenovirus of egg drop syndrome 76 Avian Dis 38 733 7 Shane SM 1996 Cited from Balamurugan V and Kataria JM 2004 Shivachandra SB Sah RL Singh SD Kataria JM and Manimaran K 2003 Immunosuppression in broiler chicks fed aflatoxin and inoculated with fowl adenovirus serotype 4 FAV 4 associated with hydropericardium syndrome Vet Res Comm 27 39 51 Singh A Oberoi MS Grewal GS Hafez HM and Hess 2002 The use of PCR combined with restriction enzyme analysis to characterize fowl adenovirus field isolated from Northern Indian Vet Res C
252. postura abierta crianza y postura abierta El objetivo de este trabajo es mostrar los resultados obtenidos en dos parvadas manejadas con crianza oscurecida y abierta dentro y fuera de estaci n Palabras clave Crianza abierta crianza cerrada black out reproductoras ross fotoperiodo 2 reunion AECACEM Quer taro 2009 P g 159 EVALUACION DE LA PROTECCION CONFERIDA POR VACUNAS CONCENTRADAS CONTRA INFLUENZA AVIAR Gabriel G mez Gabriela Ascenci n Javier Calder n Avicola ALCER Lab Boehringer Ingelheim INTRODUCCION La influenza aviar es una enfermedad viral que afecta a un amplio rango de especies aviares entre ellas a las aves dom sticas En estas ltimas puede ocasionar infecciones inaparentes ligeros cuadros respiratorios hasta una severa enfermedad sist mica con cuadros de alta mortalidad Esta enfermedad fue reconocida en Italia en 1878 y se le denomin como Peste Aviar Fowl Plague La Influenza Aviar fue identificada hace m s de 100 a os y actualmente est en todo el mundo Es una enfermedad con un alto impacto econ mico para la industria av cola mexicana debido a las p rdidas asociadas a mayor mortalidad menor peso corporal incremento de la conversi n alimenticia y aumento del costo de producci n En 1994 fue reconocida la presencia de Influenza Aviar de alta patogenicidad en parvadas comerciales en M xico Actualmente el virus de baja patogenicidad est ampliamente difundido en el pa s Adem s es i
253. pped egg production soft shelled and shell less eggs associated with appearance of precipitins to adenovirus in flocks of laying fowl Avian Pathol 5 261 272 Voss M Vielitz E Hess M Prusas CH and Mazaheri A 1996 Aetiological aspects of hepatitis and HPS caused by pathogenic adenoviruses in different countries Proceedings of the International Symposium on Adenovirus and Reovirus Infections in Poultry Rauischholzhausen pp 75 78 Zanella A Di Donato A Nigrelli A and Poli G 1980 Egg drop syndrome EDS 76 Ethiopatogenesis epidemiology immunology and control of the disease Clin Vet 103 459 469 Zavala G Dufour Zavala L Villegas P El Attrache J Hilt DA and Jackwood MW 2002 Lack of interaction between Avian Leukosis virus subgroup J and Fowl Adenovirus FAV in FAV Antibody Positive chickens Avian Dis 46 979 984 2 reunion AECACEM Quer taro 2009 P g 90 COCCIDIOSIS WHAT DO WE TRULY KNOW ABOUT THIS DISEASE Steve Fitz Coy Intervet Animal Health Salisbury MD 21801 Summary The coccidian parasites invade the intestines and cecas of the host Birds of all ages are susceptible to one or more species of coccidia unless immunized Eimeria species have had predictable behaviors or patterns which were described and accepted but recently un characteristic patterns such as cryptic and variant organisms are being observed Is it then that these observations were not recorded or they are new and now being recorded The p
254. procesos en la industria particularmente en la industria alimentaria es un tema que ha recibido gran impulso tanto en el sector primario granjas incubadoras plantas de alimento etc como a nivel de planta de proceso rastros plantas de empaque etc ya que la organizaci n que se logra permite alcanzar los est ndares de calidad sanidad inocuidad requeridos para un comercio globalizado elevando la eficiencia de sus procesos generando valores agregados reconocidos certificaci n ISO HACCP etc y contribuyendo al desarrollo de empresas eficientes que pueden competir incluso con las reconocidas como l deres Una de las pr cticas que m s ha requerido evolucionar es la bioseguridad Esta evoluci n del concepto se hace necesaria conforme se ha confirmado que el 80 de los peligros asociados a la producci n de alimentos tienen su origen en fallas de tipo generalmente operativo y que estas fallas impactan a la sanidad de la explotaci n con la consecuente entrada de pat genos que ocasionan enfermedades manifestaci n del peligro 2 reunion AECACEM Quer taro 2009 P g 105 EVOLUCI N DEL CONCEPTO Y PR CTICA DE LA BIOSEGURIDAD Acciones para el MANEJO DE LOS PELIGROS propios de cada proceso IDENTIFICANDOLOS CONTROL NDOLOS y VERIFICANDO LAS ACCIONES en funci n de los par metros de productividad que se requiere alcanzar Adquisici n de insumos y ejecuci n de acciones sanitarias aisladas en funci n de limitar la presenc
255. produced by bacteria may be of use against foodborne pathogens in poultry which include colicins and bacteriocins These proteins function by opening channels m the bacterial cell membrane killing the bacterial cell Jack et al 1995 and some of these proteins have been scaled up for production in quantities necessary for use in animals Early studies using these natural proteins in food animals demonstrate that pathogenic E coli populations in the gut of swine were reduced by colicin treatment Callaway et al 2004 Stahl et al 2004 Cutler et al 2007 The colicins have subsequently been effective against Listeria spp further studies Patton et al 2007 Sodium chlorate is a chemical that can reduce Salmonella in poultry that is currently under regulatory review for use as a feed additive Chlorate 15 toxic to some bacteria because of the action of the intracellular enzyme nitrate reductase but chlorate does not kill all bacteria Anderson et al 2000 Anderson et al 2001 Salmonella spp are equipped with nitrate reductase and are therefore killed by chlorate treatment Campylobacter populations are not as significantly affected by chlorate treatment Anderson et al 2006 Bacteriophage are viruses that are natural members of the microbial ecosystem of the gut of food animals and act as bacterial predators Callaway et al 2007 Oot et al 2007 They can be quite specific which makes them attractive smart bombs for use
256. ptional unit together with amyE shown for completeness only Putative terminator hairpins are shown Representative transformants carry the cofB ifC gene fusions which are transcribed by the cofB promoter P integrated on the chromosome within the interrupted gene a anrylase deficient clones appear blue on starch contaming plates flooded with iodine solution protein can be expressed on the surface of a bacterial spore and points to this peculiar cell form as a novel and potentially powerful system to display bioactive molecules 2 reunion AECACEM Quer taro 2009 P g 76 6 Immune response to recombinant spores The possibility of using recombinant spores as vaccine vectors was investigated using a recombinant strain of B subtilis engineered to express TTFC on the spore surface Expression of the heterologous protein on the surface of recombinant spores was demonstrated by flow cytometric analysis and the amount of TTFC expressed was 2 2 ug 1010 spores as quantified by Dot blot assay Subcutaneous injection of BALB c mice with recombinant spores 1010 per mouse induced high levels TTFC specific IgG serum The concentration of antigen specific antibodies was 8 22 ug ml of serum with controls showing levels of 0 0042 0 0007 ug ml 54 The neutralising ability of the antibodies was verified in vivo by challenging mice with lethal tetanus toxin When mice were injected with 10 times the 1 050 of soluble tetanus toxin LD5
257. pueden incluir equipos materiales instalaciones sanidad capacitaci n orden documentaci n administraci n etc asegurando la productividad del sistema y posteriormente se puede ya trabajar en programas espec ficos desarrollo de procedimientos emergentes para puntos cr ticos tanto en granja como durante la transformaci n del producto en alimento En esencia las Buenas Pr cticas de Producci n Primaria son un conjunto de t cnicas y procedimientos desarrollados con la finalidad de reducir controlar y o evitar los riesgos predecibles durante la producci n y el transporte del producto Estas pr cticas promueven Procesos definidos Verificaci n de procesos Sanidad Orden Documentaci n 2 reunion AECACEM Quer taro 2009 P g 108 En todas las areas y actividades de una explotacion para lo cual se requiere iniciar una serie de ajustes que permitan a una empresa trabajar con esquemas como el que se ejemplifica en la siguiente figura Los objetivos valor agregado de implementar un sistema de buenas pr cticas de producci n primaria son Alcanzar los par metros productivos proyectados Evitar el rechazo del producto en el rastro y o planta de proceso 3 Facilitar la obtenci n de los par metros de calidad sanidad inocuidad en el producto durante el su transformaci n en alimento 4 Que los procesos no tengan un impacto negativo al medio ambiente Competitividad de la empresa la medida en que
258. r La influencia de la Pulsatilla sobre los par metros zoot cnicos hace suponer que otros medicamentos puedan tener un efecto m s importante esto llevar a a la comprobaci n del grupo de medicamentos homeop ticos designados como constitucionales Literatura citada 1 10 Tejeda C A Estudio Bibliografico de la Homeopatia en Medicina Veterinaria Memorias del Seminario de Introducci n a la Homeopat a en Veterinaria Oaxaca M xico 1995 EMVZ UABJO pp 11 63 Hamlyn Edwaed Fundamentos de la Homeopatia en el Organon de Hahnamenn Ed Albatros TE 981 1161 Buenos Aires Rep Argentina pp 15 90 Silva Cabrera Enedina Homeopat a Veterinaria Taller de Dise o y Comunicaci n 19 de febrero 1994 Tel693 4061 Dise o y Producci n Gerardo L pez Buend a 595 2645 Calle 15 No 47 Col Valent n G mez Farias M xico DF CP 5010 Rodr guez Gallardo Jos E HAHNEMANN su vida y su obra Fundador de la Escuela Medica Homeop tica M xico 1943 p 75 Briones Silva Flavio Manual de Medicina Veterinaria Homeop tica Teor a y pr ctica de la aplicaci n de la homeopat a en la Medicina Veterinaria Ed B Jein Publishers P Reprint Edit 1997 pp 11 92 Briones Silva Flavio Manual de Veterinaria Homeop tica Teor a y Pr ctica Ed Propulsora de homeopat a SA Div Edit M xico 1996 pp 3 70 Hahnemann Samuel Organ n de la Medicina Editorial Porr a SA 3 ed pp 157 178 Rodr guez Hern ndez Araceli y Dar o Sol
259. r 29 to 40 days Withdrawal 40 to 30 days Starter grower and finisher diets contain growth promoters similar to Industry standards Starter Salin 000001 BMD 30g ton Grower Salin 60g ton BMD 23g ton roxarzone 490 01 Finisher Salin 0g ton BMD 29g ton roxarzone 349 01 Chicks in Coccivac B groups did not receive Salinomycin In diets 2 reunion AECACEM Quer taro 2009 P g 226 Diet A Starter 21 9 Protein and 3080 Keal Kg Grower 20 0 Protein and 3129 Keal Kg Finisher 16 9 Protein and 3190 Keal Kg Withdrawal 15 75 Protein and 3245 Kcal Kg Diet B Starter 22 0 Protein and 3080 Kcal Kg Grower 19 6 Protein and 3129 Kcal AQ Finisher 17 8 Protein and 3190 Kcal Kg Withdrawal 17 9 Protein and 3245 Kcal Kg k i n L E al 1 os T a Lam EM OU LI b 1 q 1 L L 1 1 1 ii i 1 Ld i E b d 4 r Ld HAHA I a B D 1 57 1 4 A 1 i j M F J Na 1 i gt B a ee L L E NET a L E M E sg y i E i i 0 1 mm Ld j uu P EN ig AT E LH Dietary A T Vom 4 a 1 A 41 Piaf D Diet D ponent Total Protein Methionine Lysine TSAA ME
260. r C H Stahl L Wagstrom R C Anderson K J Genovese J L McReynolds R B Harvey and D J Nisbet 2007 Isolation of Salmonella spp And bacteriophage active against Salmonella spp From commercial swine In 7th International Symposium on the Epidemiology and Control of Foodborne Pathogens in Pork Verona Italy p 275 279 Callaway T R Stahl T S Edrington J Genovese L M Lincoln C Anderson S M Lonergan T L Poole R B Harvey and D J Nisbet 2004 Colicin concentrations inhibit growth of Escherichia coli O157 H7 in vitro J Food Prot 67 2603 2607 2 reunion AECACEM Quer taro 2009 P g 42 CDC 2006 Salmonella annual summary 2005 Centers for Disease Control and Prevention Available at www cdc gov ncidod dbmd phlisdata salmtab 2005 SalmonellaTablel 2005 pdf Last accessed 18 June 2007 Collins D M and G R Gibson 1999 Probiotics prebiotics and synbiotics Approaches for modulating the microbial ecology of the gut Amer J Clin Nutr 69 1052S 1057S Connerton P L C M Loc Carrillo E Dillon A Scott C E D Rees C E R Dodd I F Connerton C Swift and J Frost 2004 Longitudinal study of Campylobacter jejuni bacteriophages and their hosts from broiler chickens Appl Environ Microbiol 70 3877 3883 Cutler S A S M Lonergan N Cornick A K Johnson and C H Stahl 2007 Dietary inclusion of colicin el is effective in preventing postweaning diar
261. r an underlying disease problem leads to immunosuppression or respiratory damage Oyetunde 1978 2 reunion AECACEM Quer taro 2009 P g 31 Conclusion A sound biosecurity program is a must to protect not only the substantial investment made to produce a flock of pullets or hens but also to protect against the potential harm to company reputation and the monetary loses incurred from loss sales of final product The potential costs of a biosecurity program must be weighed against these losses Even the cost of an extensive biosecurity program usually amounts to pennies on the dollar when compared to the costs of a serious disease outbreak Gifford et al 1987 From 1999 thru 2004 over 200 million poultry world wide were infected with avian influenza Capua and Marangon 2007 During the 1994 2003 outbreak of low path avian influenza in Mexico over 1 4 billion turkeys and chickens were vaccinated and millions were tested before the outbreak was stopped Capua and Alexander 2004 Villareal Chavez and Rivera Cruz 2003 The more recent outbreaks of avian influenza in Asia have led to the destruction of millions of poultry and have resulted financial losses in the billions As evidenced by the above figures inadequate biosecuity can lead to serious financial consequences At a minimum a biosecurity program for poultry breeders must contain several fundamental components focusing on traffic control and isolation sanitation and disease resist
262. r confundida con otras patolog as aviarias En algunos casos el principal efecto de la micotoxinas es la inmunosupresi n que resulta en infecciones bacterianas secundarias La mayor parte de estas lesiones est n relacionadas a las infecciones secundarias con E coli como aerosaculitis y celulitis El efecto de las toxinas sobre el desempe o animal depender del tipo y de la cantidad y su asociaci n con factores externos como malo manejo de las aves Las micotoxinas de mayor importancia y gravedad son las aflatoxinas y ocratoxinas Ellas causan disminuci n en la pigmentaci n del pico y patas bien como reducci n en el crecimiento Como gran parte de las micotoxinas afectan el sistema digestivo y absorci n de nutrientes la presencia de los alimentos no digeridos en las heces puede ser un s ntoma cl nico com n Lesiones renales promovida por ocratoxina patulina y citrinina tambi n pueden resultar en heces liquidas con aumento de humedad y presencia de urato caracterizada por heces blancas lo que puede resultar en lesi n de patas por la mala calidad de la cama 2 reunion AECACEM Quer taro 2009 P g 66 Efecto de las micotoxinas en el tracto gastrointestinal y renal de aves Logo de la ingestion de las micotoxinas con el alimento contaminado las c lulas epiteliales del intestino son expuestas a gran cantidad de esos metabolitos de hongos Algunas micotoxinas pueden causar necrosis por contacto como es el caso de los Tricotecenos co
263. r of influenza viruses The currently circulating H5N1 appears to be virulent for a variety of wild bird species Chen et al 2005 Liu et al 2005 Olsen et al 2006 Studies on the nucleoprotein and other gene lineages avian species show separate sublineages of influenza in Eurasia and the Americas indicating that migratory birds moving between these continents latitudinal migration have little or no role in the transmission of influenza while birds that migrate longitudinally appear to play a key role in the continuing process of virus evolution Webster 1998 The continuing spread of 5 appears to be related to two factors spread through movement of poultry legal as well as illegal and spread through wild migratory birds FAO 2006a b Liu et al 2005 Free ranging backyard chickens illegal transportation of domestic birds and cockfighting also have been shown to contribute to spread of the virus Tiensin et al 2005 Kilpatrick et al 2006 investigated the pathways by which the virus has and will spread between countries They integrated data on phylogenetic relationships of virus isolates migratory bird movements and trade in poultry and wild birds to determine the pathway for 52 individual introduction events into countries and predict future spread The results show that 9 of 21 of HSN1 introductions to countries in Asia were most likely through poultry and 3 of 21 were most likely through migrating birds In contras
264. ra las empresas productoras de alimento que toman el producto primario y lo procesan hasta llevarlo al producto final por lo tanto no es estrictamente un sistema aplicable al sector productivo pecuario primario aunque sus principios si lo sean e Su objetivo principal es la producci n de alimentos seguros inocuos e EI opera bajo los siguientes principios o Eval a los peligros Identifica los puntos cr ticos de control PCC diferenci ndolos de los puntos de control PC Establece l mites de tolerancia para los 5 Monitorea PCC s Toma las acciones correctivas Establece un sistema de registros Verifica que el sistema este funcionando O O O O O De estos principios uno de los m s relevantes para la producci n pecuaria es el segundo que corresponde a la diferenciaci n de puntos de control Lo que nos dice el HACCP a este respecto es lo siguiente 4 Si es mas probable que SE DETECTE UN PELIGRO cuando el sistema no esta operando por ejemplo falla en el sistema de calefacci n presencia de plagas fallas en el suministro de agua 2 reunion AECACEM Quer taro 2009 P g 107 etc en un punto fuera del proceso vigilancia perimetral SE DEFINE entonces como punto de control PC 4 Si es mas probable que se DETECTE UN PELIGRO hasta que el sistema est operando brote de una enfermedad entonces este paso deber a considerarse como un Punto de Control Cr tico PCC ESTRICTAMENT
265. ration drugs could lead to major human health consequences After the approval of enrofloxacin a flouroquinilone for use in food animals in the United Kingdom Salmonella typhimurium DT104 R type ACSSuT isolates resistant to flouroquinolones quickly emerged mainly among Salmonella typhimurium isolates with existing resistance to other antimicrobials In 1994 none of the Salmonella typhimurium DT104 R type ACSSuT isolates were resistant to flouroquinolones but by 1996 14 of the isolates had a decreased susceptibility Threfall et al 1997 The CDC found that there was little correlation between the antimicrobial agents used in persons with Salmonella infections and development of antimicrobial resistance among human Salmonella isolates The majority of antibiotic resistant Salmonella infections are acquired from ingestion of foods contaminated with antibiotic resistant Salmonellae Angulo et al 2000 It was also proposed by Angulo et al 2000 that there are three ways to support the theory that antimicrobial resistance among Salmonella isolates in humans results from the use of antimicrobial agents in food animals The first is tracebacks of resistant Salmonella in foodborne disease outbreaks to antimicrobial use on farms The second is increased resistance to flouroquinolones by Salmonella typhimurium in the United Kingdom since the approved use of enrofloxacin in veterinary medicine in 1993 The third is similar antimicrobial resistance patter
266. ration of muscle satellite cells as compared to fed control chicks Halevy et al 2000 Early fasting also affects development of the gastrointestinal tract Delayed feeding for 24 hours caused a decrease in villus surface area a decrease in enterocytes and an increase in intracellular mucins in the intestinal tract Uni et al 2003 Gonzales et al 2003 also observed reduced villus height along with reduced weight and reduced length of intestine in fasted neonatal chicks Another study examined the effects of delayed feeding for 48 hours post hatch and observed reduced body growth enterocyte proliferation and expression of the transcription factors cdx A and cdx B in the small intestine of broiler chicks Geyra et al 2002 2 reunion AECACEM Quer taro 2009 P g 95 HYPOTHALAMUS AND FEED INTAKE The hypothalamus is part of the brain that is recognized to play a major part in regulation of feed intake in animals However genome wide evaluation of the hypothalamus has not previously been evaluated The hypothalamus is responsive to both neuronal and endocrine signals within the brain and is responsible for stimulation of the pituitary gland to produce and release many endocrine hormones Regions of the hypothalamus that have been determined to participate in regulation of feed intake include the arcuate nucleus ARC paraventricular nucleus PVN and lateral hypothalamic area LHA Neurons in these areas associated with feed intake are c
267. rbosap J Appl Microbiol 93 2002 pp 117 121 A Fasanella S Losito T Trotta et al Detection of anthrax vaccine virulence factors by polymerase chain reaction Vaccine 19 2001 pp 4214 4218 Misra RP Manual for the production of anthrax and blackleg vaccines Food and Agriculture Organisation of the United Nations FAO Animal production and Health paper 87 199 http www fao org DOCREP 004 T0278E T0278E00 HTM E D Williamson A M Bennet S D Perkins R J Beedham J Miller and L W J Baillie Co immunisation with a plasmid DNA cocktail primes mice against anthrax and plague Vaccine 20 2002 pp 2933 2941 F Brossier M Mock and J Sirard Antigen delivery by attenuated Bacillus anthracis new prospects in veterinary vaccines J Appl Microbiol 87 1999 pp 298 302 L Baillie The development of new vaccines against Bacillus anthracis J Appl Microbiol 9 2001 pp 609 613 P S Brachman H Gold S A Plotkin F R Fekety M Werrin and N R Ingraham Field evaluation of human anthrax vaccine Am J Public Health 56 1962 pp 632 645 K Fowler B W McBride P C B Turnbull and L W J Baillie Immune correlates of protection against anthrax J Appl Microbiol 87 1999 p 305 M L M Pitt S F Little B E Ivins et al In vitro correlate of immunity in a rabbit model of inhalational anthrax Vaccine 19 2001 pp 4768 4773 s Reuveny M D White Y Y Adar et al Search for correlates of pro
268. recent years it has become more apparent that the first few days of life are potentially the most important for poultry a production setting Research has shown that withholding nutrients for more than 24 hours can have lasting negative effects on both broilers and turkeys Tarvid 1994 Knight 1998 Noy et al 2001 Batal and Parsons 2002 Juul Madsen et al 2004 Delaying access to feed and water causes hatchlings to be more susceptible to pathogens causes weight loss and restricts the development of critical tissues Early research focusing on glucose metabolism in the fasted chicken indicated that after 24 or 72 hours of fasting glucose utilization was reduced and chickens appeared to efficiently reutilize glucose carbon sources to maintain blood glucose levels during fasting Belo et al 1976 Noy and Sklan 1999b observed a rapid yolk weight decrease in both fed and fasted chicks with the fed chicks showing a more rapid decrease Another study comparing chicks provided feed water or both revealed that by 21 days of age chicks that received feed and water or feed alone for the first 34 hours post hatch showed weight increases of 5 and 8 respectively compared with fasted controls However fasted chicks lost 15 20 of body weight Geyra et al 2002 Importantly delay of feeding newly hatched chicks for 48 hours not only decreases body growth but also breast muscle weight over a 6 week period potentially due to reduced prolife
269. rell et al 2001 Proper disposal of mortality 1s necessary to control the spread of disease as well as to control pests Mortality should be picked up at least daily from poultry houses as they are both potential reservoirs of disease and a food source for pests Once mortality is removed from a poultry house the best method of disposal is incineration This effectively destroys all pathogens that may be carried in a carcass as well as removing a potential food source for pests Perhaps the worst option for mortality disposal is open pits as they are a potential reservoir for poultry pathogens and a food source for pests Open pits are dangerous not only to the facility they are located on but also to any nearby poultry farms as pets pests and wild animals may carry infected carcasses or pathogenic organisms to nearby facilities One of the most often overlooked factors a biosecurity program is the source of water for the flock It is often taken for granted that the water source is free of pathogens and contaminants In many areas this 1s not so Open water sources such as ponds or rivers are often contaminated with high levels of bacteria These open water sources may also contain poultry pathogens such as avian influenza as water fowl which may frequent these water sources are a reservoir for this disease Closed water sources such as wells or municipal water systems also may be contaminated with high levels coliform bacteria E coli Salm
270. res y c ncer de c lon Ayerza et al 2002 Van Elswyk 1992 pues la disminuci n del colesterol de los productos av colas a tenido poco xito para el consumidor Avila et al 1997 Estudios sobre la grasa de la dieta se han centrado en la manipulaci n de cidos grasos espec ficos por ejemplo los AGw 3 eicosapentaenoico EPA decosahexaenoico DHA de productos marinos Carrillo et al 1999 2 reunion AECACEM Quer taro 2009 P g 113 Castro 2002 son compuestos antitromb ticos que contribuyen en la disminuci n de agregaci n de plaquetas y subsecuentemente la formaci n de placas arteroescler ticas Ayerza et al 2002 Baucellis 2000 La presente investigaci n se realiz con finalidad evaluar la adici n del aceite de at n en la dieta de los pollos y su enriquecimiento con omega tres as como conocer el perfil lip dico de la carne de pollo Material y M todo Se utilizaron 192 pollos de la l nea Ross x Ross de 1 a 49 d as de edad colocados en piso de cemento en un dise o completamente al azar en 4 tratamientos con 4 repeticiones de 12 pollos cada una mitad hembras y machos Las dietas se elaboraron a base de sorgo y pasta de soya con 4 niveles de aceite de at n AAT a 0 0 75 1 0 y 1 25 que a expensas de aceite de soya se fueron adicionando hasta un nivel de 3 Las dietas fueron elaboradas para iniciaci n 0 a 21 d as y finalizaci n 21 a 49 d as A los 49 d as se sacrificaron 10 aves por tratamient
271. resistant species of chicken Eimeria to Clinacox The mode of action of the anticoccidial compounds allow the products to be used primarily as prophylactics and or therapeutics The ionophores are primarily used as prophylactics and products such as amprolium and azauridines Baycox may be used as prophylactics and therapeutics To maintain the efficacy of the anticoccidial drugs a more judicious use of these products is required This should include the incorporation of the biological systems such as the host and vaccines into the strategies for coccidiosis management Biologics From the early work of Johnson and Edgar many years ago immunizing chickens against coccidiosis eventually lead to the first commercial coccidiosis vaccine Coccivac During the early years the acceptance of vaccine usage was inconsistent probably due to application issues However in recent years the acceptance has grown considerably probably because of the methods of applications These vaccines can be applied to the host a variety of ways feed water eye nostril injection coarse spray that encourages preening and in ovo application There are several types of products such as killed products subunits GY and recombinants and live products Two types of live products are available non attenuated Coccivac Immucox Eimeria Advent and Inovocox and the attenuated Paracox Livacox Eimeria Pty Hipracox and Hatch Pac Specific claims are made for ea
272. retera M xico Texcoco Km 38 5 Texcoco Estado de M xico CP 56230 4 Universidad de Colima Facultad de Medicina Veterinaria y Zootecnia Autopista Colima Manzanillo km 40 Crucero de Tecom n Col CP 28100 Resumen Con el objeto de adicionar cidos grasos omega tres 93 en la carne de pollo se adicion aceite de atun AAT en la dieta de 192 pollos de engorda de la l nea Ross x Ross de a 49 dias de edad colocados en piso de cemento en un dise o completamente al azar en 4 tratamientos con 4 repeticiones de 12 pollos cada una mitad hembras y machos Se evaluaron 4 niveles de AAT a 0 0 75 1 0 y 1 25 A los 49 d as se muestrearon 6 machos y 6 hembras por tratamiento para pierna muslo y pechuga Se evalu el perfil de l pidos de cidos grasos poliinsaturados AGP monoinsaturados AGM saturados AGS omega 6 linoleico LA y araquid nico omega tres AGo3 eicosapentaenoico EPA docosapentaenoico DPA y docosahexaenoico DHA como porcentaje de l pidos totales Para su an lisis estad stico se transformaron a la relaci n arco seno y se analizaron mediante un arreglo factorial 2 x 4 donde un factor fueron el sexo hembra y macho y el otro los niveles de AAT Los resultados para pierna y muslo de AGP AGM AGS LA y AA fueron similares P gt 0 05 para sexos y disminuyeron P lt 0 05 al incrementar el de AAT para los AGo3 DHA los sexos fueron iguales P gt 0 05 y se increment P 0 05 con 1 y
273. rhea caused by f18 positive Escherichia coli in pigs Antimicrob Ag Chemother 51 3830 3835 Doyle M P and M C Erickson 2006 Reducing the carriage of foodborne pathogens in livestock and poultry Poult Sci 85 960 973 Ebel E and W Schlosser 2000 Estimating the annual fraction of eggs contaminated with Salmonella Enteritidis in the United States Int J Food Microbiol 61 51 62 Fossler C P S J Wells J B Kaneene P L Ruegg L D Warnick J B Bender L E Eberly S M Godden and L W Halbert 2005 Herd level factors associated with isolation of Salmonella in a multi state study of conventional and organic dairy farms Salmonella shedding in calves Prev Vet Med 70 279 291 Goode D V M Allen and P A Barrow 2003 Reduction of experimental Salmonella and Campylobacter contamination of chicken skin by application of lytic bacteriophages Appl Environ Microbiol 69 5032 5036 Higgins J P L Higgins W Huff A M Donoghue D J Donoghue and M Hargis 2005 Use of a specific bacteriophage treatment to reduce Salmonella in poultry products Poult Sci 84 1141 1145 Huff W E G R Huff N C Rath J M Balog H Xie P A Moore and A M Donoghue 2002 Prevention of Escherichia coli respiratory infection in broiler chickens with bacteriophage spr02 J Poult Sci 81 437 441 Jack R W J R Tagg and B Ray 1995 Bacteriocins of gram positive bacteria Microbiol
274. rientes cubrieron las necesidades recomendadas por el manual de la estirpe El alimento y el agua se ofrecieron a libre acceso durante toda la prueba En el grupo tratado el alimento iniciador se les proporcion desde la 2 reunion AECACEM Quer taro 2009 P g 121 llegada hasta los 21 d as de edad y se le agregaron 125ppm de nicarbazina mientras que el alimento finalizador se dio del d a 22 al 49 de edad con 100ppm de monensina s dica Pigmento Todas las aves recibieron en la dieta de finalizaci n 80 ppm de xantofilas amarillas A partir de la tercera semana se realiz semanalmente la lectura del pigmento cut neo en la zona apt rica costal izquierda con el color metro de reflectancia Minolta CR400 Minolta Co Osaka Japan En 10 pollos por cada r plica de ambos tratamientos In culo de desafio Se elabor con cepas vac nales de E acervulina 46 E maxima 18 E mivati 14 E tenella 22 La dosis infectante por pollo fue de 60 400 ooquistes esporulados por ave y fueron administrados por v a oral por medio de una c nula esof gica a los 21 dias de edad N mero de ooquistes por gramo de heces Se tomaron muestras de heces frescas de 5 pollos por r plica en cada r plica se mezcl el contenido y 2 g se conservaron en relaci n 1 2 5 en una soluci n de dicromato de potasio al 2 5 para su posterior examen cuantitativo mediante la t cnica de McMaster El numero de ooquistes por gramo de heces fue calculado
275. rupo tratado con el desinfectante coccidicida Figura 2 Ooquiste normal en el grupo testigo Con respecto a la prueba in vivo solo se encontr diferencia entre ambos grupos en el grado de pigmentaci n en piel siendo superior P lt 0 05 en el grupo criado en la secci n tratada con el desinfectante especifico con valores de 27 69 4 89 y 23 56 3 42 respectivamente Cuadro 1 2 reunion AECACEM Quer taro 2009 P g 142 Cuadro 1 Variables productivas a los 49 dias de edad en pollos de engorda criados en casetas tratadas con dos desinfectantes Desinfectante especifico Desinfectante general Media Media desviacion estandar desviacion estandar Ganancia de peso g 2 929472 9 2 911 67 8 Consumo de alimento g 5 431 191 5 5 482 174 7 Conversion alimenticia 1 85441 1 884 1 kg kg Mortalidad 10 545 7 10 2 4 3 Pigmentacion de la piel 27 69 4 89 23 56 3 42 Valores con diferente literal dentro de la misma fila son estad sticamente distintos P lt 0 05 DISCUSION y CONCLUSIONES Lo anterior sugiere una accion eficiente del producto sobre Eimeria spp in vitro que concuerda con un menor desaf o y por lo tanto a una mejor integridad intestinal y capacidad de absorci n de pigmento La diferencia entre el grupo b y el testigo en la prueba in vitro pudo deberse a que el desinfectante elaborado a base de cidos org nicos y cido asc rbico se utiliz 10 veces mas concentrado de lo recomendado para su uso en
276. rus envoltura Pr55gag del virus de la inmunodeficiencia adquirida humana VIH glicoprote na GP y matriz VP40 del virus del Ebola c pside del virus Norwalk VP2 VP6 y VP7 del rotavirus y el conformado por las prote nas S E y M del SARS coronavirus 32 Existen varios tipos de VLP s en los cuales es posible mediante la combinaci n de las secuencias codificantes para estos epitopos 21 26 32 34 37 o por su combinaci n qu mica la creaci n de la VLP s quimeras 26 32 Los VLP quimeras consisten de una plataforma proteica unida a epitopos de uno o varios virus con el n cleo estructural del VLP 41 la cual puede presenta prote nas de pat genos epitopos espec ficos de c lulas T prote nas de anclaje y entrada de virus a c lulas permisibles prote nas de las c lulas hospederas 42 como el caso del virus del VIH el cual presenta mol culas como CD55 CD59 y CD46 que le confieren la capacidad de evadir lisis por el sistema del complemento 43 Entre los virus quimera reportados se encuentran el HBcAg 2 reunion AECACEM Quer taro 2009 P g 129 Woodchuck nucleo proteico hepatitis B WHBc HBsAg HPV L1 papilomavirus bovino BPV Yeast Ty VIH virus de inmunodeficiencia de simio VIH SHIV gag hepatitis B de patos DHBV y HEV 32 En algunos casos es posible el empleo de VLP s en combinacion con adyuvantes como los oligodesoxinucleotidos cortos con motivos de CpG CpG s DNA para la estimulaci n de las c
277. rways after exposure to vaporized red 3 PC Number Proportion 2 reunion AECACEM Quer taro 2009 P g 275 Materials and methods Bird vaporization with Rea 3 and PG 40 min 24h period Birds were bled under deep anesthesia Lunas were lavaged with 60 mL of saline Red and white cells were counted hemocytometer White cells were classified in mononuclear cells heterophils basophils and eosinophils differential cell counting with Wright stain Blood differential cell counting reunion AECACEM Quer taro 2009 P g 276 results The number 763 2 198 a and 402 9 62 60 but not the proportion of leukocytes was higher in the lavage fluid of broilers from the Red 3 PG group compared to broilers from the control group respectively Blood lymphocytes were lower In broilers from the Red 3 PG group compared to birds from the contro group 93 142 8a and 60 2 3 20 respectively Discussion We propose that the number of leukocytes present within the always Is one of the components that enable pre treated broilers to exhibit pulmonary hypertension in response to intratracheal LPS However the lavage fluid of control birds also contained a significant amount of leukocytes reunion AECACEM Quer taro 2009 P g 278 Conclusions We support the existence of a mechanism of immune tolerance within the mucosa of the airways We propose that a multiple interaction between componen
278. ry and essential step to prevent the infection Proper management cleaning and disinfection of premises and equipment restricted entry of visitors and vaccination crews in the poultry houses play a significant role in prevention of the disease However countries with high infectious pressure the disease has been brought under control by formalin inactivated vaccines prepared from liver homogenates from infected birds or by inactivated cell culture derived vaccines The vaccines are effective the face of natural outbreaks or experimental challenge and significantly reduce mortality Balamurugan and Kataria 2004 In general the control can be achieved by the use of an autogenous inactivated vaccine prepared from a homogenate of an infected liver or inactivated cell culture vaccine Balamurugan and Kataria 2004 Balamurugan and Kataria 2004 review the experiences of several authors using the vaccines to control HPS in poultry In two field trials involving 570 000 birds on 128 farms the overall mortality ranged from 0 77 to 3 8 in vaccinated and from 11 11 to 30 in unvaccinated birds Ahmad et al 1990 In another trial the mortality in vaccinated birds was 0 52 compared to 5 34 in unvaccinated birds kept on the same premises Vaccination was also effective when carried out in the face of an outbreak mortality in the vaccinated infected birds being 2 33 compared with 10 27 in unvaccinated infected birds Afzal and Ahmad 1990
279. s Commun 28 127 148 Benk M Harrach B Russell WC Adair BM d m E De Jong JC Hess M Johnson M Kajon A Kidd AH Lehmkuhl HD Li QG Mautner V Pring Akerblom P and Wadell G 2005 Family Adenoviridae In Virus Taxonomy Classification and Nomenclature of Viruses The 8 Report of the International Committee on Taxonomy of Viruses Fauquet CM Mayo MA Maniloff J Desselberger U Ball LA Eds Elsevier Academic Press London pp 213 228 Z Lojki I Mikec M and Pokric B 2007 Naturally Occurring Egg Drop Syndrome Infection in Turkeys Acta Vet Brno 76 415 421 B low von V Rudolph R and Fuchs B 1986 Folgen der Doppeltinfektion von K ken mit Adenovirus oder Reovirus und dem Erreger der infektidsen An mie J Vet Med 33 717 726 Christensen NH and Saifuddin MD 1989 A primary epidemic of inclusion body hepatitis in broilers Avian Dis 33 622 630 Cook JKA and Darbyshire JH 1980 Epidemiological studies with egg drop syndrome 1976 EDS 76 virus Avian Pathol 9 437 443 Cook JKA and Darbyshire JH 1981 Longitudinal studies on the egg drop syndrome 1976 EDS 76 in the fowl following experimental infection at l day old Avian Pathol 10 449 459 Cowen B 1992 Inclusion body hepatitis anemia and hydropericardium syndromes aetiology and control World s Poult Sci J 48 247 254 Darbyshire JH and Peters RW 1980 Studies on EDS 76 virus infection in laying chickens Avian Patho
280. s from colonizing the gut Nisbet 2002 Zhang et al 2007b a The addition of a microbial supplement called a probiotic or a direct fed microbial DFM that improves gastrointestinal health and the diversity of the intestinal microbial ecology is another pro commensal technique Collins and Gibson 1999 Probiotics DFM are often a single organism bacteria or fungi or products of their fermentation that alter the microbial ecology of the gut when fed to food animals An exciting concept that is migrating from human to animal health involves the addition of a limiting nutrient or prebiotic that allows an existing microbial population to expand its current niche or increase populations 2 reunion AECACEM Quer taro 2009 P g 38 Other strategies have focused on working directly against the pathogens themselves Vaccination of poultry can be used against 5 Enteritidis however vaccinated birds are indistinguishable by serum tests from birds infected by Salmonella which poses significant concerns for epidemiological monitoring Antibiotics have been suggested to be potential methods to reduce specific pathogens such as Salmonella or Campylobacter however due to fears of antibiotic resistance the use of antibiotics as anti foodborne pathogen strategies is actively discouraged In future it is likely that the prophylactic use of antibiotics in poultry will become more closely regulated or eliminated Some natural antimicrobial proteins
281. s investigations on isolation and development of a real time polymerase chain reaction for specific detection Avian Path 36 487 494 Malkinson M and Weisman Y 1980 Serological survey for the prevalence of antibodies to egg drop syndrome 1976 virus in domesticated and wild birds in Israel Avian Pathol 7 483 490 Mazaheri Prusas C Voss and Hess M 1998 Some strains of serotype 4 fowl adenoviruses cause inclusion body hepatitis and hydropericardium syndrome in chickens Avian Path 27 269 276 Mazaheri A Prusas C Vo M Hess 2003 Vertical transmission of fowl Adenovirus serotype 4 investigated in specified pathogen free birds after experimental infection Archiv fur Geflugelkunde 67 6 10 McFerran JB 1979 Egg drop syndrome Vet Quart 1 176 180 Olson NO 1950 A respiratory disease bronchitis of quail caused by a virus Proc 54 Annual Meet US Livestock Sanit Assoc 171 174 Rabbani M and Naeem K 1996 In vitro and in vivo evaluation of avian adenovirus isolates from outbreaks of hydropericardium syndrome Proceedings of the International Symposium on Adenovirus and Reovirus Infections in Poultry Rauischholzhausen Germany pp 26 31 and Hess 1998 Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus J Virol Meth 73 211 217 Raue R Hafez HM and Hess M 2002 A fiber gene based
282. s a diferentes niveles de aceite de at n 23 29 1 91 10 54 1 39 12 37 1 54 15 27 3 00 15 37 1 47 17 28 1 55 13 53 0 54 13 48 1 09 15 97 40 36 15 06 0 59 20 29 1 53 12 03 0 86 12 93 0 91 15 62 1 43 DE 22 51 2 19 9 73 1 61 14 01 2 174 15 21 3 13 15 36 1 50 14 69 1 42 6 62 0 85 16 27 1 30 18 44 2 26 13 77 1 24 18 60 1 79 8 17 1 00 15 14 1 25 16 64 1 97 DEN a b c Medias con diferente literal son estad sticamente significativas P lt 0 05 EEM Error est ndar de la media Porcentaje del total de cidos grasos AAT aceite de atun Para pierna y muslo los AGS tampoco tuvieron diferencia P gt 0 05 entre sexos y disminuyeron P 0 05 en relaci n al testigo al aumentar el nivel de AAT Para pechuga no hubo diferencia P gt 0 05 entre sexos pero con 0 75 disminuyeron P lt 0 05 en relaci n a los dem s tratamientos Para los omega 6 los resultados se muestran en el Cuadro 6 2 reunion AECACEM Quer taro 2009 P g 116 Cuadro 6 Acidos grasos omega 6 en pierna muslo y pechuga en pollos con dietas a diferentes niveles de aceite de atun OMEGA 6 AAT 0 AAT 0 75 AAT 1 0 AAT 1 25 PIER Y MUSLO SEXO Promedio EEM Promedio EEM Promedio EEM Promedio EEM Promedio EEM 24 12 1 97 9 844 1 57 11 18 2 12 13 22 2 62 14 59 1 61 17 15 1 85 13 84 0 90 12 04 0 61 14 57 0 91 14 40 0 68 1 02 0 11 0 94 0 05 65 0 14 0 59 0 10 0 92 0 18 1
283. s litter environmental chambers Non Aerosolized brollers NA 11 LPS Red Dye 3 PG Aerosolized broilers RD 3 Red Dye 3 PG 0 04 q mL PG i t LPS reunion AECACEM Quer taro 2009 P g 271 PAP mm Hg Results Experiment 3 NA Non Aerosalized brollers nz 12 ROM Red Dye 3 Aerosalized broilers nz 12 8 4 iit TUN T T AA 3 Tx d U 0 o bbb b bb D pp Sample Intervals 2 min each 2 reunion AECACEM Quer taro 2009 P g 272 Conclusion Treatment with aerosolized Red Dye 3 and PG appears to constitute a non pathogenic controllable experimental model for deducing the mechanisms by which alr pollutants can enhance pulmonary hypertensive responses of broilers reunion AECACEM Quer taro 2009 P g 273 Fourth chapter Introduction inhaling low doses of toxins and pathogens or primers such as Red Dye 3 and PG may induce sub clinical levels of lung inflammation unbalancing the mechanisms of tolerance Red Dye 3 and PG may unbalance the system by Increasing the number of leukocytes in the airways onifting the proportion of different populations of leukocytes within the airways Activating leukocytes from the airways Changing the chemical structure of surfactant proteins 2 reunion AECACEM Quer taro 2009 P g 274 Objective Evaluate possible changes In the cellular components of the chicken ai
284. s provide partial protection for chickens against high pathogenic avian influenza infection Vaccine 25 3763 3772 33 Tiensin T Chaitaweesup P Songserm T Chaising A Hoonsuwan W Buranathai C Parakamawongsa T Premashtira S Amonsin A Gilbert M Nielen M Stegeman J A 2005 Highly pathogenic avian influenza H5NI Thailand 2004 Emerging Infectious Diseases 11 1664 1672 34 Van der Goot J A van Boven M de Jong and M C M Koch G 2007 Effect of vaccination on transmission of HPAI 5 The effect of a single vaccination dose on transmission of highly pathogenic avian influenza H5N1 in Peking ducks Avian diseases 51 323 324 35 Veits J Wiesner D Fuchs W Hoffmann Granzow Starick E Mundt Schirrmeier Mebatsion T Mettenleiter T C and Romer Oberdorfer A 2006 Newcastle disease virus expressing H5 hemagglutinin gene protects chickens against Newcastle disease and avian influenza Proceedings National Academy of Sciences of the USA 103 21 8197 8202 36 Villareal Chavez and E Rivera Cruz E 2003 An update on avian influenza in Mexico In Proceedings of the 5th International Symposium on Avian Influenza Georgia Center for Continuing Education The University of Georgia Athens Georgia USA April 14 2002 Avian Diseases 47 1002 1005 37 Webster R G 1998 Influenza An Emerging Disease Emerging Infectious Diseases Vol No 3 Special Issue h
285. s reacciones post vacunales si no son controladas causan grandes perdidas economicas en la avicultura especialmente en granjas con parvadas de edades miultiples y diferente estatus inmunol gico stas asociadas a pat genos oportunistas y al ambiente Por tanto se determin el efecto que tienen estos cidos org nicos mediante la administraci n en aerosol evaluando la severidad de las reacciones adversas por medio del grado de severidad de los signos cl nicos y mortalidad Se usaron 160 pollos de engorda de un d a de edad l nea cobb y se dividieron en cuatro grupos de 40 pollos cada uno control negativo un grupo vacunado y con tratamiento un grupo vacunado y sin tratamiento y un grupo sin vacunaci n y con tratamiento de cidos org nicos Se corrieron pruebas de aglutinaci n r pida en placa para detectar micoplasma en los pollos llegados de incubadora y pruebas de inhibici n de la hemoaglutinaci n despu s del tratamiento en aerosol de cidos org nicos el tratamiento con los cidos no demerito la respuesta inmune a la vacunaci n los grupos de aves tratadas con los cidos mostraron una severidad y frecuencia menor en las reacciones posvacunales que los pollos sin tratamiento y el grupo control Palabras clave cidos org nicos reacciones post vacunales enfermedad de newcastle aerosol terapia pollos de engorda 2 reunion AECACEM Quer taro 2009 P g 102 DEGRADACION DE AFLATOXINAS EN RACIONES DESTINADAS PARA AVE
286. se positives Therefore it 15 important to confirm key findings by a second technique Two step quantitative reverse transcription real time polymerase chain reaction qRT PCR was performed for at least 16 genes to confirm expression patterns in this experiment All 8 samples for all treatment groups were assayed using qRT PCR due to the fact that the cost and time required are much less for qRT PCR than for the microarray analysis An oligo dT primer was combined with lug of total RNA for the RT reaction A negative control for genomic DNA contamination was performed without the addition of reverse transcriptase PCR primers were designed utilizing Primer 3 freely available at http fokker wi mit edu primer3 input htm based on the full length mRNA sequence predicted from the chicken genome sequence available through ENSEMBL http www ensembl org Gallus_gallus index html mRNA levels were quantified using MyiQ Single Color Real Time PCR Detection System Bio Rad and the 2X Quantitect SYBR Green PCR Master Mix Qiagen Cycles were performed as follows denaturation at 95C for 15 min to activate the polymerase followed by 40 cycles of 95C for 15 s and 60C for 60 s Data were transformed using the equation 2 where Ct represents the fractional cycle number when the amount of amplified product reaches a threshold for fluorescence Results were analyzed statistically ANOVA to confirm reciprocal effects of fasting or refeeding on gene express
287. se a los diferentes requerimientos planteados por las nuevas normas teniendo que absorber los costos que esto implica Sin embargo tenemos en la actualidad casos de pa ses donde su implementaci n sido exitosa como Chile por mencionar alguno La experiencia de las empresas chilenas ha de mostrado que para la implementaci n de estas nuevas formas de producci n es de gran relevancia contar con personal suficientemente documentado y entrenado sobre los principios y aplicaci n de estas normas y reglamentos de impacto en el sector La gesti n para el desarrollo e implementaci n de estas normas y el personal encargado de gestionarlas ser n valiosos en la medida en que contribuyan con el an lisis de los procesos para modificar incluir y o desarrollar los que agreguen alg n valor y faciliten el alcance de los objetivos de la empresa y evitar aquellos que no aporten al sistema productivo Dado el avance en que se encuentran estos conceptos creo importante repasar algunos principios y t rminos con el objetivo de documentar al principiante medico encargados de granja etc sobre la raz n y alcance del manejo de la bioseguridad mediante procesos e instructivos acordes con sistemas como las Buenas Pr cticas de Producci n Primaria o Buenas Practicas Pecuarias Para comenzar es importante destacar que estos conceptos parten del sistema conocido como HACCP del cual podemos puntualizar lo siguiente e HACCP es un sistema desarrollado pa
288. se was firstly described in 1976 by Van Eck et al 1976 in The Netherlands Then after the disease was observed in several countries around the world The initial outbreak in chickens was probably caused by a contaminated vaccine grown in duck embryo fibroblasts McFerran 1979 In addition the EDS outbreaks observed in the quail flocks which were reared together with infected chickens resulted the fall of the egg production and in the increase of number of soft shelled eggs Das and Pradhan 1992 In spite of the fact that the disease outbreaks were mostly recorded in laying hens only and some time in quails EDSV or the antibodies against the virus have been detected in ducks and geese Schl r 1980 pheasants guinea fowls Zanella et al 1980 pigeon Durojaiye et al 1992 and in wild birds Malkinson and Weisman 1980 In 2001 EDSV showed to cause a severe acute respiratory disease of the young goslings in Hungary The disease affected goslings between 4 and 20 days of age The symptoms included anorexia depression sneezing coughing dyspnoea and rales Ivanics et al 2001 Recently Bidin et al 2007 reported on a naturally occurring EDS turkey breeder flocks in Croatia which were accompanied with a significant decrease both egg quality and production The disease caused is by duck adenovirus a member of genus Atadenovirus The virus has haemagglutination activity and has its reservoir in ducks and geese The
289. sis The final diagnosis can be reached by laboratory diagnosis 2 reunion AECACEM Quer taro 2009 P g 47 Fig 1 Some possible cause of respiratory disease in poultry Management Viral agents Litter quality IB ILT ND Influenza A aMPV Stocking density PMV3 Pox Ventilation rate Bacterial agents Temperature ORT P multocida Mycoplasma High ammonia level Chlamydia E coli Haemophilus High dust concentration Bordetella avium Streptococci Staphylococci Feed Mycotic agents High dust content Aspergillus fumigatus Vitamin A deficiency Parasites Syngamus Cryptosporidium In the space available it 1s not possible to review extensively the entire field of respiratory diseases Instead this paper is limited to Avian influenza and Infectious bronchitis AVIAN INFLUENZA Al viruses are members of the Orthomyxoviridae family Influenza A viruses can be divided into subtypes on the base of the antigenic relationships of the two surface glycoproteins haemagglutinin HA and neuraminidase N The haemagglutinin and neuraminidase are respectively important in the attachment and release of the virus from the host cell At present 16 H subtypes and 9 N subtypes are known All subtypes can infect wild waterfowl Anon 2000 Fouchier et al 2005 In poultry the most virulent form of avian influenza was designated as fowl plague Recently the term highly pathogenic avian influenza HPAI based on the results of different laboratory
290. smo de recombinaci n no homologa el cual consiste de la reparaci n de doble hebra de ADN roto independiente de la secuencia el cual aparenta ser el medio de inserci n del T ADN en los sitios de reparaci n del ADN gen mico 48 Desde los primeros experimentos para la elaboraci n de plantas transg nicas mediante el empleo de Agrobacterium en 1983 26 se han logrado grandes avances en el entendimiento del proceso de inserci n del T AND La transformaci n del genoma de organelos como el cloroplasto ofrece ventajas para la expresi n de ant genos incluyendo alta expresi n debido a la gran cantidad de cloroplastos presentes en las hojas de las plantas y la gran cantidad de copias de genoma de cloroplastos presente en ellos disminuye el silenciamiento de los genes y reduce la contaminaci n de las poblaciones de plantas locales al no estar presente el ADN ex geno en el polen de las plantas 30 31 La transformaci n del cloroplasto se encuentra limitada a pocas especies de las cuales la m s estudiada es el tabaco El empleo de estas plantas no es recomendado para la administraci n oral otra desventaja es que la expresi n en estos organelos no permite la glucosilaci n de las prote nas lo cual su empleo puede ser enfocado para prote nas bacterianas o prote nas eucarioticas no glucosiladas 30 2 reunion AECACEM Quer taro 2009 P g 132 El empleo de virus activos de plantas provee una alternativa para la transformaci n par
291. stimulan la respuesta inmune Sin embargo las mismas toxinas en altas dosis resultan en apoptosis de leucocitos resultando en inmunodepresi n Estos resultados deben ser evaluados mas cautelosamente En realidad que bajos niveles de tricotecenos causen estimulaci n inmune no significa que sea bueno para la salud y desarrollo animal Koutsos y Klasing 2001 demostraran que cada vez que la respuesta inmune es estimulada se torna muy costoso para el animal adem s se pueden desarrollar muchas formas de alergias Casos de campo de micotoxicosis est n relacionados con reducci n de t tulos vac nales y aparici n de infecciones oportunistas como E coli o Clostridium sp as como el incremento de p rdidas en la planta de proceso debidas a lesiones septic micas Asimismo incremento de lesiones no espec ficas en las mucosas orales e intestinales as como en el ndice de conversi n alimenticio Estos trastornos pueden estar asociados a la estimulaci n de la respuesta inmune Costo de las micotoxicosis en aves Es muy dificil de calcular los costos de las micotoxicosis en aves principalmente debido a diferentes condiciones ambientales y de manejo En reproductoras el principal impacto econ mico de las micotoxinas es calculado con los ndices de viabilidad producci n de huevos incubabilidad y calidad de pollitos En pollos micotoxicosis afectan su desarrollo incrementan la medicaci n y principalmente disminuyen la calidad de canales
292. t spread to most 20 23 countries in Europe was most likely through migratory birds Spread in Africa was likely partly by poultry 2 8 introductions and partly by migrating birds 3 8 The obtained results predict that HSN1 1s more likely to be introduced into the Western Hemisphere through infected poultry and into the mainland United States by subsequent movement of migrating birds from neighbouring countries rather than from eastern Siberia These results highlight the potential synergism between trade and wild animal movement in the emergence and pandemic spread of pathogens and demonstrate the value of predictive models for disease control The diagnosis of poultry diseases is based on the case history clinical signs gross lesions and laboratory diagnosis In case of the avian influenza in the EU the diagnosis of primary infection with highly pathogenic avian influenza HPAI outbreak must be carried out in accordance with the Council directive 2005 94 EC of 20 December 2005 on Community measures for the control of avian influenza and repealing Directive 92 40 EEC EC 2005 The confirmation of avian influenza should be carried out with appropriate laboratory tests in accordance with the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals OIE 2005 This include samples collection and the primary outbreak given country virus isolation and identification and assessment of the pathogenicity The Council direct
293. t 1958 7 515 519 12 Ungar LP Comparison of sequential random hemacytometer methods for counting Crytosporidium oocysts J Parasitol 1994 80 816 819 Johnson J Reid WM Anticoccidial drugs Lesion scoring techniques in battery and floorpen experiments with chickens Exp Parasitol 1970 28 30 36 Garcia OO Hernandez VX Fuente MB Tejeda GR Jasso VA Evaluacion in vitro de dos desinfectantes sobre la viabilidad de Eimeria spp Proceedings of the fifty seventh western poultry disease conference y Memorias de la XXXIII convenci n annual de la Asociaci n Nacional de especialistas en ciencias av colas Puerto Vallarta Jal M xico Del 9 al 12 de abril de 2008 Laguna TL Efecto de un programa anticoccidiano permanente en pollo de engorda desafiado con eimeria spp Tesis de Licenciatura Facultad de Medicina Veterinaria y Zootecnia Universidad Nacional Aut noma de M xico M xico D F 2008 18 25 2 reunion AECACEM Quer taro 2009 P g 144 LA HOMEOPAT A EN UNA EXPERIENCIA EN AVES DE ABASTO Ma de Lourdes Gonz lez Anaya Catedr tico de la Escuela de Medicina Veterinaria y Zootecnia de la UABJO lugoay Oyahoo com mx Resumen La Homeopat a es una medicina desarrollada para los seres humanos sin embargo las posibilidades que tiene hacia el paciente al conseguir la curaci n de los enfermos sin producir efectos indeseables Ha hecho que desde el inicio de est se halla buscado por parte de los veterinar
294. t are used early in the grow out period must be complemented by interventions aimed at reducing horizontal Salmonella spread in a growing flock FOODBORNE PATHOGEN REDUCTION STRATEGIES PROS AND CONS Many different strategies have been used epidemiologically over the years to reduce pathogen both Salmonella and the ubiquitous Campylobacter populations in poultry A test and slaughter flock depopulation of farms positive for Salmonella approach may be effective for eliminating S Enteritidis from parent and grandparent breeder flocks and layer flocks because it can be vertically transmitted between generations However horizontal transmission of other Salmonella serotypes within houses or flocks remains a problem so this proven method is not likely to be a panacea for Salmonella Reduction strategies that are likely to be successful and acceptable to producers consumers and regulatory bodies include a group of pro commensal treatments probiotics prebiotics and competitive exclusion cultures All of these techniques utilize a non pathogenic microbial species or consortium to establish a stable intestinal environmental ecosystem Callaway et al 2002 Doyle and Erickson 2006 The best understood pro commensal strategy is that of competitive exclusion CE where day of hatch chicks are treated with a defined pathogen free mixture of normal intestinal bacteria to establish a mature intestinal population that can exclude pathogen
295. taci n cut nea p lt 0 05 Lo anterior muestra una acci n eficaz del producto sobre Eimeria spp que se relaciona a un menor desaf o y por lo tanto a una mejor salud intestinal y capacidad de absorci n de pigmento Palabras clave Desinfectantes Eimeria pigmentaci n cut nea pollo de engorda INTRODUCCI N La coccidiosis aviar es una enfermedad parasitaria com n entre las especies domesticas que ocasiona grandes gastos a nivel nacional e internacional siendo esta enfermedad de las principales causas de productividad y pigmentaci n deficiente actualmente se sabe que los desinfectantes comunes no llegan a afectar a los ooquistes de all el surgimiento de nuevos desinfectantes m s potentes y espec ficos contra coccidias y la necesidad de evaluar su desempe o tanto in vitro como campo 2 reunion AECACEM Quer taro 2009 P g 139 MATERIAL Y METODOS Prueba in vitro Este experimento se llev a cabo el rea de parasitolog a del laboratorio de diagn stico del Departamento de Producci n Animal Aves DPA Aves de la FMVZ de la UNAM M xico D F Eimeria spp Se utilizaron cepas vacunales de las especies Eimeria tenella 24 E maxima 19 E mivati 17 and E acervulina 40 Coccivac B Shering Ploug S A de C V M xico El in culo se titul en c mara de Neubauer Desinfectantes Se usaron dos productos desinfectantes El desinfectante especifico contra Eimeria spp que se compone principalmente d
296. te al epitopo ser accesible a la superficie pero no resulta en una inmunogenicidad tan alta como la observada en las otras dos posiciones 35 La inserci n en la parte interna entre el 75 aa s y 81 aa s resulta en una mayor inmunogenicidad y antigenicidad contra el epitopo insertado 35 50 Se reporta que dentro de la parte interna de la secuencia de HBcAg es posible acomodar secuencias de hasta 45 aa s La fusi n con los C terminal N terminal de HBcAg permite la uni n de secuencias mayores seg n reportes de 90 144 y hasta 720 aa s 36 sin embargo no se alcanzan los mismos niveles inmunog nicos y antig nicos como se observa en la parte interna de HBcAg 35 50 No solo se debe de considerar la capacidad de inserci n de HBcAg para su empleo si no tambi n la secuencia primaria del epitopo insertado ya que se reporta que insertando dos secuencias peque as en HBcAg una de ellas aparentemente desestabiliza el VLP y resulta en una degradaci n proteol tica de HBcAg 35 El virus de hepatitis B expresa dos polip ptidos en el gen codificante para su n cleo Al iniciar la traducci n en el primer cod n de iniciaci n el resultado es una prote na denomina HBeAg en el segundo codon de iniciaci n se codifica una prote na de 183 aa s de un peso de 21 kDa con un tama o de 30 a 32 nm 35 el cual corresponde a HBcAg 50 HBeAg y HBcAg se encuentran ligados en su estructura primaria 51 La elevada inmunogenicidad de HB
297. tective immunity conferred by anthrax vaccine Infect Immun 69 2001 pp 2888 2893 S Welkos S Little A Friedlander D Fritz and P Fellows The role of antibodies to Bacillus anthracis and anthrax toxin components inhibiting the early stages of infection by anthrax spores Microbiology 147 2001 pp 1677 1685 C Pezard M Weber J C Sirard P Berche and M Mock Protective immunity induced by Bacillus anthracis toxin deficient strains Infect Immun 63 1995 pp 1369 1372 A V Stepanov L I Marinin A P Pomerantsev and Staritsin Development of novel vaccines against anthrax in man J Biotechnol 44 1996 pp 155 1060 F Brossier M Levy and M Mock Anthrax spores make an essential contribution to vaccine efficacy Infect Immun 70 2002 pp 661 664 S Cohen I Mendelson and Z Altboum Attenuated nontoxinogenic and nonencapsulated recombinant Bacillus anthracis spore vaccines protect against anthrax Infect Immun 68 2000 pp 4549 4558 J M Ross The pathogenesis of anthrax following the administration of spores by the respiratory route J Pathol Bacteriol 73 1957 pp 485 494 C Guidi Rontani M Weber Levy E Labruy re and M Mock Germination of Bacillus anthracis spores within alveolar macrophages Mol Microbiol 31 1999 pp 9 17 2 reunion AECACEM Quer taro 2009 P g 79 48 49 50 51 32 53 54 35 56 34 58 C Guidi Rontani M Le
298. tensive and expensive In general the interpretation of serologic tests is difficult because antibodies against AAVs can be found in both healthy and diseased birds 2 reunion AECACEM Quer taro 2009 P g 85 In addition for the detection of antibodies against EDSV haemagglutination inhibition using fowl RBC can also use Dhinakar et al 2007 developed immunofiltration flow through test to detect the presence of antibodies to egg drop syndrome 76 EDS virus in chicken sera and compared it with and ELISA In total the immunofiltration test could detect EDS antibodies with a sensitivity and specificity of 90 14 and 92 86 respectively as compared to the HI test Compared to ELISA the sensitivity and specificity of the developed immunofiltration assay was 79 45 and 94 58 respectively The disadvantage of this test is the qualitative detection of antibodies in the serum which may not be highly informative on all occasions and this test can be used as a preliminary test before confirmation can be done by another more sophisticated laboratory based assay Fig 1 Laboratory diagnosis of poultry diseases Agent Detection Detection of antibodies Histopathology IF EM PCR AGP NT ELISA Chicken embryo Tissue culture Experimental animals Identification IIF NT PCR 2 reunion AECACEM Quer taro 2009 P g 86 Control of Adenovirus infections of poultry Control of IBH HPS Biosecurity practices are the prima
299. tes por lo que causan serias limitaciones y la efectividad de estos productos disminuye consideradamente 04 Debido a que en ocasiones se mantiene en una granja la misma formulaci n anticoccidiana durante varias parvadas a os sin evaluar su efectividad en este estudio se evalu un programa anticoccidiano dual permanente de nicarbazina en el alimento iniciador y monensina en la finalizaci n y su efecto en aves desafiadas con Eimeria spp OBJETIVO Identificar y analizar el efecto de un programa anticoccidiano dual permanente nicarbazina monensina sobre los par metros productivos pigmentaci n cut nea grado de severidad de las lesiones intestinales y numero de ooquistes en heces en pollo de engorda desafiado con Eimeria Spp MATERIAL Y METODOS Instalaciones Las aves fueron alojadas aleatoriamente en dos tratamientos con cuatro replicas cada uno A Dieta sin coccidiostato y B Dieta con el programa permanente de coccidiostatos Los pollos se distribuyeron en corrales dentro del centro de Ense anza Investigaci n y Extensi n en Producci n Av cola CEIEPAv de la FMZV de la UNAM Animales de experimentaci n Se utilizaron 240 pollitos mixtos provenientes de una incubadora comercial de la estirpe Ross 308 de 1 d a de edad Las aves fueron criadas de manera comercial bajo sistemas convencionales de manejo hasta el final del experimento Alimento Se utiliz una dieta a base de sorgo pasta de soya Los niveles de nut
300. tests and pathotyping is suggested to be used Anon 2000 Currently only the viruses of H5 and H7 subtype have been shown to cause HPAI in susceptible species but not all H5 and H7 viruses are highly pathogenic However it has been proven that highly pathogenic avian influenza HPAI viruses emerge in domestic poultry from low pathogenicity LPAI progenitors of the H5 and H7 subtypes Garcia et al 1996 Senne et al 1996 Perdue et al 1997 It was recently shown that H5N1 influenza can also infect pigs cats leopards tigers civets dogs mink and a stone marten Since December 2003 epidemic influenza due to a highly pathogenic H5NI virus strain has devastated the poultry industry As of q January 2009 H5N1 virus infection mainly due to direct transmission from birds have been confirmed in 395 humans of whom 249 had died WHO 2008 Recent genetic characterization of HSNI viruses has demonstrated two distinct phylogenetic clades Clade I viruses have circulated primarily in Cambodia Thailand and Vietnam and clade 2 2 reunion AECACEM Quer taro 2009 P g 48 viruses have circulated primarily in China and Indonesia and have spread westward to the Middle East Europe and Africa Six different subclades of clade 2 have been recognized Webster 2006 The disease can be transmitted directly through contact with infected birds or indirectly through contaminated equipment Wild and domestic waterfowl are the major natural reservoi
301. the posthatch poult Poult Sci Jul 80 7 912 9 11 Noy Y and D Sklan 1999b Energy utilization in newly hatched chicks Poultry Sci 78 1750 6 12 Remmers F L A W Verhagen R A H Adan and H A Delemarre van de Waal 2008 Hypothalamic Neuropeptide Expression of Juvenile and Middle Aged Rats after Early Postnatal Food Restriction Endocrinology 149 3617 3625 95 2 reunion AECACEM Quer taro 2009 P g 100 15 14 15 16 Simon R M D Radmacher Dobbin 2002 Design of studies using DNA microarrays Genet Epidemiol 23 21 36 Tarvid I 1994 Effect of early postnatal long term fasting on the development of peptide hydrolysis in chicks Comp Biochem Physiol A 1992 101 1 161 6 Uni Z A Smirnov and D Sklan 2003 Pre and post hatch development of goblet cells in the broiler small intestine effect of delayed access to feed Poult Sci 82 320 327 Wagner A 2001 How to reconstruct a large geneteic network from n gene perturbations in fewer than n easy steps Bioinformatics 17 1183 1197 2 reunion AECACEM Quer taro 2009 P g 101 DETERMINACION DEL EFECTO DE LA ADMINISTRACION EN AEROSOL DE UNA MEZCLA DE ACIDOS ORGANICOS ETANOCARBONICO FORMICO Y LACTICO SOBRE LA REACCION ADVERSA EN POLLOS DE ENGORDA INOCULADOS CON UNA VACUNA ACTIVA CONTRA LA ENFERMEDAD DE NEWCASTLE Jesus Alejandro Castillo Contreras Ricardo Salado Carbajal Alvaro Vera Noguez y Celestino Gallego Vargas La
302. tics and then applied CE reducing this way Salmonella shedding In the same study CE alone failed to provide reductions in Salmonella shedding In order for CE cultures to be safe they cannot contain antibiotic resistant organisms Antimicrobial residues present problems with establishment of any effective CE product Bailey et al 1987 suggested that the effect of CE is reduced when feed additives that contain antimicrobials such as bacitracin and nicarbazin are used Other studies have also supported this finding Anderson and co workers 1984 showed that antibiotic treatment before administering CE reduced the effectiveness in poults McReynolds et al 2000 found that enrofloxacin residues decreased the establishment of PREEMPT while tylosin tartrate in contrast increased the effectiveness of the CE microflora in chicks through an unknown mechanism while sulfadimethoxine residues had no effect Nurmi in 1974 found that the use of bacitracin had no effect in the level of protection of a CE culture Some antibiotics and their residues can have adverse effects on CE cultures while other antibiotics may have no effect therefore considerations should be taken with the use of antimicrobials in conjunction with CE treatment A probiotic is defined as a live microbial food supplement which benefits the host by improving its intestinal microbial balance Isolauri et al 2001 The presence of normal gut microflora may improve the metabolism of the
303. tination inhibition and restriction endonuclease analysis Avian Diseases 32 731 741 Kleven S H Rowland G N and Kumar M C 2001 Poor serological response to upper respiratory infection with Mycoplasma synoviae in turkeys Avian Diseases 45 719 723 Lauerman L H 1998 Mycoplasma PCR Assays In Nucleic Amplification Assays for Diagnosis of Animal Diseases ed L H Lauerman American Association of Veterinary Laboratory Diagnosticians Auburn AL p 41 52 Ley 2003 Mycoplasma gallisepticum infection In Diseases of Poultry 11 Edition Saif Y M Barnes H J Glisson J R Fadly A M McDougald L R and Swayne D E eds lowa State University Press Iowa USA p 722 744 2 reunion AECACEM Quer taro 2009 P g 58 27 28 29 30 31 32 33 34 35 36 37 38 39 Ley D H Berkhoff J E and Mclaren J M 1996 Mycoplasma gallisepticum isolated from house finches Carpodacus mexicanus with conjunctivitis Avian Diseases 40 480 483 Lierz M Schmidt R Brunnberg L and Runge M 2000 Isolation of Mycoplasma meleagridis from free ranging birds of prey in Germany Journal of Veterinary Medicine B 47 63 67 Lierz M Stark R Borkat S and Hafez H M 2007a Pathogenicity of Mycoplasma lipofaciens strain ML64 isolated from an egg of a Northern Goshawk Accipiter gentilis for chicken embryos Avian Pathology 36 2 151 153 Lierz M Deppenmeier S Grub
304. tions keeping pullets for 20 22 weeks before transferring to layer house and re using litter these management tools have added new variances to the already complex issues These management practices do impact bird behavior which consequently influence coccidia ingestion References 1 2 Personal data Cantacessi C et al 2007 Genetic characterization of three unique operational taxonomic units of Eimeria from chickens in Australia based on nuclear spacer ribosomal DNA Vet Parasitol 152 226 234 Chapman D H et al 2002 Sustainable coccidiosis control in poultry the role of live vaccines International J of Parasitol 32 617 629 Davis S W et al 2003 XIII Congress of the World Veterinary Poultry Assn Edgar S A 1958 Species identification of coccidian affecting poultry Proceedings of the Bear Mountain Cenference Oct American Cyanamid Johnson W T 1930 Directors Biennial Report 1928 1930 Oregon Agricultural College Experiment Station Mathis G and C Broussard 2003 XIII Congress of the World Veterinary Poultry Assn 8 Shirley W M 1975 Enzyme variations in Eimeria species of the chicken Parasitology 71 369 376 Tyzzer E E 1929 Coccidiosis in gallinaceous birds The American Journal of Hygiene 10 1 115 2 reunion Quer taro 2009 P g 94 GENE EXPRESSION IN THE HYPOTHALAMUS OF FASTED AND FED NEONATAL CHICKS S E Higgins L E Ellestad Trakooljul L A C
305. troying the normal bacterial flora in the gastrointestinal tract that serve as a natural barrier to Salmonella infection Also Kobland et al 1987 and Gast et al 1988 have recovered antibiotic resistant Salmonella from experimentally challenged birds treated with antibiotics An intense search 15 currently underway for efficacious non antibiotic treatments to control bacterial diseases Immediate concern arises from the significant increase antibiotic resistant bacteria in the medical environment rendering even some of the newest anti microbials ineffective This increase 15 attributed to over prescribing of antibiotics by physicians antibiotic abuse in hospitals and use of therapeutic and subtherapeutic levels of antibiotics in commercial animal production to promote growth Brundtland 2000 Increased political and consumer pressures have resulted in a significant reduction of drug use in the animal industries with potential for completely eliminating the use of antimicrobials animal production during the next decade The United States Food and Drug Administration FDA has already proposed the withdrawal of flouroquinolones in poultry production because of the increase in flouroquinolone resistant Campylobacter infections in humans Schwetz 2002 Additionally Melbak et al 2002 reported an increase in flouroquinolone resistance in foodborne illnesses caused by Salmonella enterica serotype enteritidis SE from 0 8 in 1995 to 8 5
306. try production and high levels of supplementation can be used to gain greater that a 0 10 phosphorus release if cost effective 2 reunion AECACEM Quer taro 2009 P g 63 Table 6 Body weight mortality corrected feed conversion tibia weight and tibia ash of straight run market broilers fed diets containing selected concentrations of available phosphorus and supplemented with one of three commercially available phytase enzymes m Body Weight Feed Gain Body Weight Feed Gain Tibia Ash Day 14 g Day 1 14 35 kg Partas 35 Weight g 209 209 77 447 41 NE aS 272 85 a 1367 MOD UN a NE OM 8 12 40 57 3 aT 954 4279 309 57 053 4420 2072 8327 1122 31005 8587 4098 719 3944 8 3050 135 138 1645 892 4256 e 3105 1329 137 165 977 4254 775 41 0 a f Means in rows with different superscripts differ significantly at P lt 0 05 References Leeson S and J D Summers 2005 Commercial Poultry Nutrition 3 edition University Books Guelph Ontario NRC 1994 Nutrient Requirements of Poultry 9 revised edition National Research Council National Academy Press Washington DC Powell S S Johnston L Gaston and L L Southern 2008 The effect of dietary phosphorus level and phytase supplementation on growth performance bone breaking strength and litter phosphorus concentration in broilers Poult Sci 87 949 957 Waldroup P W J H Kersey E A Sale
307. ts of the mucosal immune system may be needed before an inflammatory response to aerosolized LPS can be elicited reunion AECACEM Quer taro 2009 P g 279 Future research to solve remaining questions Assess the activation of the immune cells present within the respiratory airways LPS Induced nitric oxide production LPS Induced IL 6 production Replace surfactant proteins after Inhalation of Red 3 PG reunion AECACEM Quer taro 2009 P g 280 Future research practical approaches Vaccine design Evaluation of molecules that the mucosal pulmonary Immune system can detect reunion AECACEM Quer taro 2009 P g 281 The big picture ourfactant layer immune cells from the airways epithelial cells macrophage interaction reunion AECACEM Quer taro 2009 P g 282 Thank you Dr R Wideman Dr G Erf Dr N Rath Dr N Anthony
308. ttp www cdc gov ncidod eid vol4no3 webster htm 38 Webster R G 2006 WHO Global Influenza Program Surveillance Network WHO Antigenic and genetic characteristics of H3N1 viruses and candidate H3N1 vaccine viruses developed for potential use as pre pandemic vaccines http www who int csr disease influenza surveillance en 39 Wei R 2007 Field trials with chimera vaccine Abstract book of the Scientific Conference Vaccination a tool for the control of Avian Influenza Verona Italy 20 22 March 2007 p 42 40 WHO 2008 Updates of Cumulative Number of Confirmed Human Cases of Avian Influenza A H5NI Reported to WHO http www who int csr disease avian influenza country cases table 2008 01 11 en index html AVIAN MYCOPLASMOSIS Mycoplasmas have affected the industry for many years and effective control of Mycoplasma infection has been a fundamental milestone to improve performance and productivity However infections appear to make a comeback Kleven 1997 Bradbury 1999 Hafez et al 2006 Numerous species of mycoplasmas have been isolated from avian sources Two species are recognized as predominantly pathogenic to chickens and turkeys Mycoplasma gallisepticum MG affects the respiratory system and is referred as chronic respiratory disease CRD in chickens and infectious sinusitis in turkeys Mycoplasma synoviae MS may cause either respiratory diseases and or joint diseases Two additional species are known to
309. ture the feed is a still under research evaluation A spray method works well while the birds are small or right after hatch as a prevention measure but this method poses potential biological hazards and requires significant skill The third disadvantage is that the data on CE and OA treatments is somewhat inconsistent no two studies have produced the same results Also the effects of the environment are not fully known The effect of temperature variations in feed and feed type changes and the impact of different profiles of native microflora still need further research The use of OA can help to create the right acidic environment for some CE cultures to proliferate OA also inhibits or kills several pathogenic bacteria The problem with OA is its non selectivity foul taste 1n certain instances and it can also cause harm to beneficial bacteria or to the host 1f used inappropriately The intense pressure on the poultry industry and the scientific community to find alternatives to antibiotics for food producing animals is the driving force behind this research The use of CE probiotics either alone or combination with organic acids could be a viable alternative for antibiotics 2 reunion AECACEM Quer taro 2009 P g 18 Reference Angulo F K Johnson R Tauxe and M Cohen 2000 Significance and sources of antimicrobial resistant nontyphoidal Salmonella infections in the United States Microbial Drug Resistance 6 77 83
310. ty is a result of the activity of the lethal factor LF a zinc endopeptidase that is synthesised within the macrophage upon spore germination and is released by lysis of the infected cells 48 As demonstrated by Hanna et al 49 macrophages serve as cellular mediators of the action of lethal toxin PA LF LeTx in vivo They also observed that at sub lytic concentrations LeTx stimulated the release of proinflammatory cytochines such as TNF a and IL 1 that declined at higher lytic concentrations of LF Their conclusion was that death from systemic anthrax can be directly attributed to the effects of these cytokines especially IL 1 produced by LeTx stimulated macrophages 49 A completely opposite result has been recently obtained by Pellizzari et al 50 and Erwin et al 51 They found that sub lytic doses of LF cause a reduction in the production of TNF a and NO suggesting that this reduction of the inflammatory response would permit growth and diffusion of the bacterium during the first stages of B anthracis infection 50 Besides anthracis spores there are many other spore forming Bacillus spp showing immunostimulating and immunomodulating activity which are however devoid of pathogenicity The mechanisms responsible for their immunomodulatory properties are still not clear and few data are available 18 2 reunion AECACEM Quer taro 2009 P g 75 Since cytokines constitute important soluble mediators with immunomodulatory ab
311. ty normally ranges from 2 40 percent especially when birds are lt 3 weeks of age However there have been outbreaks in which mortality has reached 80 depending on the pathogenicity of the virus immune status of the chicks and concurrent secondary infections Mortality generally peaks within three to four days and ceases within 9 14 days Clinically the birds showed lethargy huddling with ruffled feathers inappetence 2 reunion AECACEM Quer taro 2009 Pag 83 and yellow mucoid droppings may be seen The infection can be accompanied with bad feed conversion and a reduced weight gain Gross lesions include an enlarged pale friable liver sometimes with necrotic foci also haemorrhages may be present in the liver and muscle The heart can be flabby with a mild hydropericardium In case HPS a straw coloured transudate is present in the pericardial sac In addition nephritis enlarged spleens and thymus atrophy could be observed in most dead birds Histopathological lesions include necrotic focal lesions and some of the livers had basophilic intranuclear inclusion bodies Haemorrhages under the epicardium with multifocal necrosis in the myocard are the major findings in the hearts and lymphoid depletion of spleen thymus and bursa of Fabricius could be observed Egg drop syndrome EDS EDS 15 a disease characterised by a drastic drop in egg production as well as the production of abnormal eggs in apparently healthy chickens and quails The disea
312. uce mas beta zearalenol y por eso serian necesarios niveles mas altos de esa toxina para causar efectos delet reos en aves Por lo que en aves el efecto de la zearalenona as como su efecto sin rgico con otras toxinas est muy poco esclarecido De facto se sugiere que la detecci n de esa toxina en alimento de aves solo puede servir de biomarcador para otras fusariotoxinas Fumonisinas son las micotoxinas asociadas primariamente a leucoencefalomalacia equina y el edema pulmonar porcino En aves puede causar severa diarrea hepatomegalia alta mortalidad y reducci n en la productividad Ledoux et al Estas toxinas han sido muy encontradas en varias materias primas y el conocimiento de los problemas que causan no han sido esclarecidos por completo sin embargo sus efectos en el sistema inmunitario de los animales han sido muy informados en varios estudios Los alcaloides de ergot son otra clase de micotoxinas producida por Claviceps sp y causa isquemia necrosis y gangrena de las extremidades Los alcaloides son muy comunes en sorgo y trigo Adem s todos los problemas relatados en estudios con toxinas purificada el efecto de la asociaci n de las toxinas son muy variables y pueden dificultar mucho el diagnostico sobre todo cuando hay interacci n con otras enfermedades infecciosas Efecto de las micotoxinas en la inmunidad de las aves Las micotoxinas causan regresi n y despoblaci n celular en los rganos linfoides En el caso de aflat
313. ue los AGw3 son preferentemente incorporados en las membranas biol gicas a expensas de los AG 6 y ambos est n implicados en la producci n de eicosanoides como las prostaglandinas tromboxanos y leucotrienos Sin embargo los eicosanoides derivados de la familia de AGw6 tienen efectos opuestos los derivados de la familia de AGw3 y existe una competencia entre las enzimas involucradas en la desaturaci n elongaci n del LA a ALA Por lo tanto un balance adecuado es importante para mantener la salud 2 reunion AECACEM Quer taro 2009 P g 118 Los cidos grasos EPA DHA son los que mayores efectos ben ficos aportan a la salud su consumo recomendado es de 650 mg d a en una dieta de 2000 kcal diarias Simopoulos 2000 Los resultados de este experimento indican que el aceite de at n adiciona cidos grasos omega tres eicosapentanoico y docosaexanoico a la carne Se concluye que el mejor nivel de inclusi n del AAT es con 1 25 1 2 10 1 2 13 Simopoulos A P A Leaf and N Salem Jr 2000 Workshop statement on the essentiality 15 16 17 Bibliografia AOAC Association of official analytical Chemists 2000 Official methods of analysis 17th ed Association of official analytical Chemists Washington DC pp 556 Avila C A Shamah L y Chavez VA 1997 Encuesta nacional de alimentaci n y nutrici n en el medio rural 1996 Resultados por entidad Vol 1 nstituto Nacional de la N
314. unda comparaci n son tl 2 2431 y el valor critico 0 6671 con lo cual queda comprobada la hip tesis nula M1 M2 La mortalidad se excluyo ya que desde el principio de la prueba esta se debi principalmente al efecto del S ndrome Asc tico y Muerte S bita ambos problemas tienen su origen en los llamados Desordenes Metab licos tambi n estuvo involucrado el Buche P ndulos En ning n caso las perdidas se origino por da os del Aparato Respiratorio o por efecto de la comprobaci n de la Pulsatilla objetivo de la investigaci n La precocidad quedo igualada en la parvada por haberla liquidado en el mismo momento CONCLUCION DEL AN LISIS ESTAD STICO 8 e a hip tesis nula fue aceptada lo que implica la nula significancia estad stica entre las diferencias de los valores considerados 2 reunion AECACEM Quer taro 2009 P g 153 CONCLUCIONES DE LA INVESTIGACION 8 La Pulsatilla a la potencia 6x y 30x administrada directamente al pico en dosis de dos gotas por ave tres veces al d a a partir de la 4 semana de edad a la 5 semana el pollo de abasto no es capaz de reproducir el cuadro clinico de ECRC De lo anterior se concluye las aves no tienen la posibilidad de manifestar signos utiles o referentes para a partir de ellos desarrollar la Materia M dica Homeopatica Av cola La Pulsatilla administrada de la manera descrita genera modificaci n en los par metros zoot cnicos establecidos para la avicultura con un costo meno
315. used in Europe and the U S however a revised nomenclature system has been published Benk et al 2005 that if adopted will clarify matters Table 2 2 reunion AECACEM Quer taro 2009 P g 81 Table 1 Classification of adenoviruses from birds Smyth and McNulty 2008 Fowl adenovirus Aviadenovirus Fowl adenovirus E Goose adenovirus Pigeon adenovirus B Turkey adenovirus B Table 2 Classification of fowl adenoviruses Jensen and Villegas 2005 Species A l B 15 8 5 30 2 a 5 4 2 reunion AECACEM Quer taro 2009 P g 82 Inclusion body hepatitis IBH Hydropericardium syndrome HPS IBH was first described 1963 in the USA Helmboldt and Frazier 1963 Then after the disease has been reported in many countries worldwide It is a sporadic disease condition caused by several serotypes of fowl adenoviruses Fitzgerald 2008 Smyth and McNulty 2008 In 1988 a new broiler disease was reported in Pakistan and called Angara Disease The clinical signs and the course of the disease are similar to IBH The main pathological finding is the accumulation of a clear straw coloured fluid in the pericardial sac wherefore the disease was called hydropericardium syndrome HPS At the same time several outbreaks of HPS were reported from Asia central and South America e g Mexico Ecuador Peru and Chile with severe losses Toro et al 1999 An adenovirus was detecte
316. ute 1s considered safe due to the widespread consumption of Bacillus spp through many foods Alkaline fermented foods achieved by mixing bacterial cultures including B subtilis are widely consumed in Southeast Asia and African countries It is the case of natto a popular fermented soybean food used as a condiment in Japan obtained by using B subtilis var natto 15 Also in Western countries Bacillus spp are 2 reunion AECACEM Quer taro 2009 P g 73 frequently ingested as demonstrated for white and wholemeal wheat bread produced without preservatives and a variety of other foods 16 The effects of these spore preparations on well being of humans or animals are not clearly established An immune stimulating activity has been reported 17 and 18 but the mechanism of stimulation is not fully explained The lack of information on the biological background for the spore based probiotic phenomenon is due to the fact that it is generally perceived that probiotics act upon the host organism through metabolic products or cell components of actively multiplying vegetative cells In the case of Bacillus spore probiotics this aspect is more complex since no unequivocal data on the growth of bacilli in the human and animal gut are published 19 20 21 22 and 23 It should be noted that Bacillus spores are part of the normal intake of food and feed 24 25 26 and 27 Despite this daily uptake of spores vegetative forms of any Bacil
317. utrici n Salvador Zubir n M xico D F 93 pp Ayerza R Coates W and Lauria M 2002 Chia Seed Salvia hispanica as and omega 3 Fatty acid composition cholesterol and fat content of white and dark meats growth performance and sensory characteristics Poultry Sci 81 826 837 Baucellis M D Crespo N Barroeta A C Lopez F S Grashorn M A 2000 Incorporation of different poliinsaturated fatty acids into eggs Poultry science 79 51 59 Castillo D R M Carrillo D S Perez Gil R F Avila G E Cassis N L 2000 Efecto del aceite de sardina sobre la concentraci n de cidos grasos omega 3 en huevo y sus caracter sticas sensoriales Libro de res menes del XII congreso latinoamericano de nutrici n Buenos Aires Argentina del 12 al 16 de noviembre 32 pp Carrillo S Carranco M E Castillo D M Castro M I P rez Gil F Avila E 1999 El huevo como fuente de cidos grasos 03 y al incorporar harina del crust ceo langostilla en raciones para ponedoras Memorias XVI Congreso Latinoamericano de Avicultura Lima Peru pp 338 342 Castro G M I 2002 cidos grasos omega 3 Beneficios y fuentes Editorial Interciencia 27 3 128 136 Cherian G Wolfe F W Sim J S 1996 Dietary oil with added tocopherols effects on egg or tissue tocopherols fatty acids and oxidative stability Poultry sci 75 423 431 Folch J M Less and G H Sloane Stanley 1957 A simple method for the 1solation
318. ve consequences that compromise the safety of our food supply INTRODUCTION Human foodborne illnesses occur around the world and the most common and serious food borne pathogenic bacteria are Campylobacter spp and Salmonella enterica Mead et al 1999 In the U S each year these bacteria strike an estimated 3 3 million people cause gt 500 deaths and cost the U S economy more than 3 6 billion each year Mead et al 1999 USDA ERS 2001 Salmonella enterica alone are estimated to cause over 30 of all bacterial food borne deaths in the U S Mead et al 1999 While recent 2008 widespread human salmonellosis cases have been linked to vegetables and fruits the most common route of foodborne pathogenic bacterial infection remains via foods of animal origin especially from poultry Braden 2006 Chickens Zhao et al 2001 turkey Berrang et al 1998 and eggs Braden 2006 can all be contaminated with Salmonella and or Campylobacter Salmonella and Campylobacter frequently live in poultry as a transient member of the intestinal or crop microbial population without causing any visible disease or impacting animal production These pathogens are widespread in the environment and within poultry Rodriguez et al 2006 thus attempts to control them must be diverse and complex In order to be able to target these pathogens we must understand their role in nature and in the gut of food animals as well as the functioning of the microbi
319. vel de AGP fue mayor P lt 0 05 para 1 1 25 en relacion al testigo Para los acidos grasos monoinsaturados los resultados se muestran en el Cuadro 4 2 reunion AECACEM Quer taro 2009 P g 115 Cuadro 4 Acidos grasos monoinsaturados en pierna muslo y pechuga en pollos alimentados con dietas a diferentes niveles aceite de atun 35 9941 74 14 30 1 70 16 33 1 51 20 10 3 92 21 49 2 18 22 86 1 65 18 57 0 56 17 89 1 24 22 22 1 09 20 39 0 74 29 04 2 35 4 16 44 1 10 17 11 0 96 21 16 1 95 30 75 3 65 13 17 1 87 20 4322 10 18 9443 79 20 82 1 99 20 61 1 81 10 33 0 95 20 68 1 42 93974331 18 48 1 45 25 68 2 55 4 11 75 1 09 20 55 1 192 20 86 2 53 2 b c Medias con diferente literal son estadisticamente significativas lt 0 05 EEM Error estandar de la media Porcentaje del total de acidos grasos AAT Aceite de atun Para pierna y muslo entre tratamientos las hembras disminuyeron lt 0 05 los niveles de AGM y para efectos principales no hubo diferencia P gt 0 05 entre machos y hembras pero disminuyeron P lt 0 05 en relaci n al testigo similar a AGP En pechuga no existi diferencia P gt 0 05 para sexos pero con 0 75 de AAT hubo diferencia P lt 0 05 con los dem s tratamientos El efecto de la adici n de aceite de at n sobre los cidos grasos saturados se encuentra en el Cuadro 5 Cuadro 5 cidos grasos saturados en pierna muslo y pechuga en pollos con dieta
320. vel of 0 45 was used as the reference diet Available phosphorus levels in all grower diets were decreased by 9 from the initial level present in the starter diet This level also corresponds to Leeson and Summers 2005 which is being used as the control diet Chicks were reared in floor pens with fresh pine shavings as litter material given age appropriate supplemental heat and given access to feed and water ad libitum In a parallel study this entire experimental design was duplicated in battery cages There were five replicates of each of the six dietary treatments Ten birds pen were placed in battery units and 2 reunion AECACEM Quer taro 2009 P g 60 identical to that of the chicks raised floor pen Chicks for both studies were obtained from the same source and fed the same dietary treatments Weigh days and dietary changes corresponded with the floor trial as well On day of placement chicks were weighed banded and randomly placed in treatment groups Bulk pen weights and feed consumptions were determined on day 7 14 21 and 28 for the calculation of average bird weight and feed conversion ratios On day 28 broilers in each pen were separated by phenotypical differences on the basis of sex to determine the minimum available phosphorus level needed to maximize growth for each sex Results Floor Reared Broilers Body weight tended to be a more predicted factor than feed conversion ratio when determining minimum available
321. vy H Ohayon and M Mock Fate of germinated Bacillus anthracis spores primary murine macrophages Mol Microbiol 42 2001 pp 931 938 P C Hanna D Acosta and R J Collier On the role of macrophages in anthrax Proc Natl Acad Sci U S A 90 1993 pp 10198 10201 R Pellizzari C Guidi Rontani G Vitale M Mock and C Montecucco Anthrax lethal factor cleaves MKK3 in macrophages and inhibits the LPS IFNy induced release of NO and TNFa FEBS Lett 462 1 2 1999 pp 199 204 J L Erwin L M DaSilva S Bavari S F Little A M Friedlander and T C Chanh Macrophages derived cell lines do not express proinflammatory cytokines after exposure to Bacillus anthracis lethal toxin Infect Immun 69 2001 pp 1175 1177 R van Furth and Z A Cohn The origin and kinetics of mononuclear phagocytes J Exp Med 128 1968 pp 415 435 K A Palucka N Taquet F Sanchez Chapuis and J C Gluckman Dendritic cells as the terminal stage of monocyte differentiation J Immunol 160 1998 4587 4595 View Record in Scopus Cited By in Scopus 249 R Isticato G Cangiano and H T Tran Surface display of recombinant proteins on Bacillus subtilis spores J Bacteriol 183 2001 pp 6294 6301 A Driks Bacillus subtilis spore coat Microbiol Mol Biol Rev 63 1999 pp 1 20 A M Guerout Fleury N Frandsen and P Stragier Plasmids for ectopic integration in Bacillus subtilis Gene 180 1996 pp 57 61 D Medaglini
322. without disturbing normal physiological or biochemical functions The definition was later revised as a live microbial feed supplement which beneficially affects the animal host by improving its intestinal microbial balance 9 This revised definition stressed the need for the probiotic to contain live micro organisms The benefits on human health include antagonistic activity against pathogens antiTallergic and other effects on the immune system More recently the concept of probiotics evolved from food with beneficial even if not clearly established effects on well being to the new area of functional foods and biotherapeutics 10 and 11 Probiotic micro organisms in use licensed for human and veterinary applications as prescription and non prescription products comprise a wide variety of micro organisms including members of the genus Bacillus Lactobacillus Streptococcus Enterococcus and yeasts 11 In this group the position of members of the genus Bacillus is unique since they are delivered as spores This feature makes them of particular industrial interest due to the long shelf life of the respective products and the uncomplicated conditions for storage and transport The use of Bacillus spp as probiotics is not restricted to a single species of this genera but includes B subtilis B cereus B coagulans clausii B megaterium and B licheniformis 12 13 and 14 The administration of many spore based products by the oral ro
323. y are removed from an area table 1 the simple fact that the farm is empty for period of time will allow the numbers of pathogens to decline thus lowering the probability of infection for the next flock 2 reunion AECACEM Quer taro 2009 P g 27 Disease Life Span in Environment Table 1 Life span of important poultry pathogens the environment Jeffery 1997 If replacement poultry must be brought in while the farm 15 already populated 1 replacement males or replacement pullets these animals should only come from sources that have been extensively tested for common poultry pathogens just prior to shipment If possible these replacements should be quarantined away from existing flocks for a period of 2 3 weeks and then tested again prior to housing Extra care should be taken with the movement of spike males between facilities of flocks as they are usually placed into multiple flocks Sanitation While isolation and traffic control helps keep disease off the premises proper sanitation will both control and destroy any pathogens that may already be present on a facility Sanitation can be broken down into three main categories cleaning and disinfection pest control and facility and grounds maintenance The actual removal of dirt debris and organic matter from equipment and housing will eliminate 95 of pathogens present a barn Wolfgang Without first removing this material even the most powerful disinfectants can
324. ycoplasma gallisepticum vaccine Australian Veterinary Journal 67 168 174 Yoder H W jr 1991 Mycoplasmosis Mycoplasma gallisepticum infection In Diseases of poultry 9th Edition Iowa State University Press Ames Iowa pp 196 212 2 reunion AECACEM Quer taro 2009 P g 59 PHOSPHORUS AN EXPENSIVE NECESSITY IS PHYTASE THE ANSWER J T Lee L Oden S Pohl J Coppedge and A Klein Department of Poultry Science Texas AgriLife Research Texas A amp M System College Station TX 77843 2472 Introduction Phosphorus is an essential nutrient for growth development and maintenance of the skeleton of animals Because of the demands for adequate skeletal development of rapidly growing birds and the sensitivity to deficiencies of phosphorus it 1s necessary to provide an adequate margin of safety for this nutrient in broiler diets Waldroup et al 2000 However there 1s a concern worldwide regarding the quantity of phosphorus that is released into the environment generated from land application of poultry litter from commercial houses Powell et al 2008 The environmental concerns in combination with the increase in cost of supplemental phosphorus have led to the inclusion of phytase enzymes into poultry diets Published reports indicate that the minimum level of non phytate phosphorus needed a starter diets range of 0 37 0 39 Waldroup et al 2000 which is higher than 0 45 which 1s recommended in the NRC 1994 and Lesson
325. ypothesis A Hypothesis B PVH PAP LWP TPG TWP TPG reunion AECACEM Quer taro 2009 P g 253 iad Pressure mm Hc c on results 15 line sex o susceptible 40 V Resistant 7 Relaxed U d 1 2 gt s gt d 5 n 5 2 reunion AECACEM Quer taro 2009 P g 254 Conclusions Increase In PAP it is not due to increased CO e Increase PAP Is due to increased PVR Due to the large TPG measured PVR Is conclusively increased up stream 2 reunion AECACEM Quer taro 2009 P g 255 second chapter Introduction Arterial blood of pre ascitic and micro particle MP Injected birds 15 not fully saturated with oxygen lt 80 Diffusion limitation blood flowing too rapidly through the gas exchange area does not achieve full saturation of hemoglobin with oxygen Arterial venous shunts a proportion of blood would leave the lungs without exposure to the gas exchange epithelia reunion AECACEM Quer taro 2009 P g 256 Objective To define the cause of low arterial oxygenation In preascitic and In clinically healthy broilers injected with MP Hypothesis If blood Is not 100 exposed to the gas exchange area arterial blood will not be 100 saturated with oxygen If blood 15 fully exposed to the gas exchange area arterial blood will be 100 saturated with oxygen reunion AECACEM Quer taro 2009 P g 257 Material and methods Blood gas a

Download Pdf Manuals

image

Related Search

Related Contents

(仕様書図面)PDF版  product announcement  MA 3288N.indd  Sony MHC-RG550 User's Manual    règlement intérieur centre de loisirs  Dispos/177r et  manual capta flex 8106 (extensao).qxd  平成19年11月導入情報系パーソナルコンピュータ機器賃貸借  Bedienungsanleitung  

Copyright © All rights reserved.
Failed to retrieve file