pNY326 DNA - Clontech Laboratories, Inc.
Contents
1. eV gc7 Brevibacillus Competent Cells HB116 0 10mM Tris HCl pH8 0 1mM EDTA OE 3 438 bp2. OnE Brevibacillus pNY326DNA CAGGGGAATATACTAGAGATTTTTAACACAAAAAGCGAGGCTTTCCTGCGAAAGGAGGTG 60 P5 68revibacil us P5 35 P5 10 SD1 SD 2 ACACGCGCTTGCAGGATTCGGGCTTTAAAAAGAAAGATAGATTAACAACAAATATTCCCC 120 SD1 SD2 BspH AAGAACAATTTGTTTATACTAGAGGAGGAGAACACAAGGTCATGAAAAAAAGAAGGGTCG 240 The P5 promoter has relatively fM SD 2 MK K R R VV weak promoter activity in Breviba cillus cells The two SD sequences SD1 and SD2 in the P5 promoter Apal t ibed atidenticalf TTAACAGTGTATTGCTTCTGCTACTGCTAGCTAGTGCACTCGCACTTACTGTTGCTCCCA 300 0 at identica trame N S V L L L L L A 5 A L A L T V A POM sec signal peptide Cloning site Nco Pst BamHI Sal Xba Xhol EcoRI Kpnl Smal BstBl 0 es TGGCTTTCGCTGCAGGATCCGTCGACTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGA 360 A F A Signal cleavage Clal Hind Ill pa es AATCGATAAGCTTAACAGGATGCGGGGGAGCCGCCGCTCCGTCGCCCCCTGCGGGGGGCT 420 v201305 uaz o F TaKaRa FB B
3. Brevibacillus Expression vector pNY326 DNA Code No HB111 Size 10 ug 0 2 OD Shipping at 20 C Store at 20 C 2 years from date of receipt under proper storage conditions Lot No Concentration 0 2 ug l Volume 50 ul Description Map of pNY326 DNA pNY326 can replicate in B choshinensis cells and its size 3 4 kb is much smaller than that of pNCMO2 5 2 kb In addition the promoter activ P5 promoter sec signal peptide ity of the vector is substantially weaker than that of pNCMO2 Taken together it can be maintained stably even if it expresses rather toxic proteins to the host cells and in some cases higher protein production can be achieved using this vector because of the more stable growth of C X terminator the transformants i pNY326 exhibits stable productivity and is especially suited to large scale culture The expression plasmid must be constructed in one step using B multiple cloning site choshinensis as the host the vector can be maintained only in B choshi pNY326 nensis Because the transformation efficiency must be sufficiently high the use of Brevibacillus Competent Cells 105 transformants u g DNA 3 4 kb Cat HB116 is recommended Form 10mM Tris HCI pH8 0 Nm 1mM EDTA Base pairs 3 438 bp Usage This is a vector for protein expression using Brevibacillus Expression System Protocols License agreement R L39 Brevibacillus Expression Syst
4. em Regarding protocol please refer to the product manual supplied with Pe Brevibacillus E ion System II Cat HB200 1 Brevibacillus Expression System related products were developed and TEV ee mee pram a ene yee i manufactured by Higeta Shoyu Co Ltd and sold by TAKARA BIO INC 2 The use of this product is allowed for research use only 3 All rights of intellectual property related to this product are owned by Higeta Shoyu Co Ltd Cloning sites of pNY326 DNA Please refer other side of this sheet Note This product is for research use only It is not intended for use in therapeutic or diagnostic procedures for humans or animals Also do not use this product as food cosmetic or household item etc Takara products may not be resold or transferred modified for resale or transfer or used to manufacture commercial products without written approval from TAKARA BIO INC If you require licenses for other use please contact us by phone at 81 77 543 7247 or from our website at www takara bio com Your use of this product is also subject to compliance with any applicable licensing requirements described on the product web page It is your responsibility to review understand and adhere to any restrictions imposed by such statements All trademarks are the property of their respective owners Certain trademarks may not be registered in all jurisdictions v201305 pNY326 DNA C
5. ode No HB111 Size 10 ug 0 2 OD Shipping at 20 C Store at 20 C 2 kot No EE TRS Gs Brevibacillus Expression System II HB200 we 5 Ba pNY326DNA L39 Brevibacillus Expression System 1 pNY326 DNA Brevibacillus 2 3 4 kb pNCMO02 3
Download Pdf Manuals
Related Search