Performance Improvement of X-ray CCDs by applying a Magnetic
Contents
1. LI H 11 a OCDE Ig m Tin U DR Ilu ET ELE UUOO0OO0OOUU000000000000000000000000000ccDOUOU000D0D IDUUUUUUUDDDUUUOUOUUUDDUOUUDUUUDUUDUUUUUDUDUDDUUUDI DO00000000000000000000 CCDOO0000000000000000000 Virtual Phase D 1 31000000000 n type 0 p typel Field Free Region O U JJ U D EL UO 0000 GE 0 BEBE EE DE 7L BEBE EE BE 0 E EI 83 2400 0 0 n typel O p type 0 Gate 0000000000000 00 Depletion Layer 0 0 0000000000000002000000 0 Field Free Region JJ J J J U U 00000000000000000000000000000000000000000000000000 000000 000000 2200000000 000000002. 0 0000000000000000000000000000 0 0000000000000000000 0 0000000000000000000000000000000000000 0 CCD 0 FIOUU 0 000000000000000000 14 low energy high energy low energy high energy X ray X ray X ray X ray Gate Backside Surface Insulator Depletion Region Field Free Region Insulator Gate Front Illuminated Back Illuminated 0 3 4 00000000 000000000 80 0000600 0000000000000000000000000000000000000000 0000000000 18 3 2 2 0000000 S21HUOUUUUUCCDOUUUUUUU 0000000 S 0 000 000 0 0 0 000 000000300000000000000000000000 0000000000500000000000 00000000000000000 wy 000000000000000000000000 0000000000 000 00000 000 0000 2100000000000000000000000000000 0 000000000000000000000000000 Ep Ex W W 3
3. 0 00000000000000000000000 pchannel 10000 00000 00 L 0 0 00000000000000000000000 414 000000000 00000 00 0000 00 0 0 0 0 0 19 0000000000000000000 00000000000000000000000000000000000000000 E 2008 0 00000000000000 2 0 0 3 88 10 ER ERR ro HAB EAH E 4 315 HB tH ERE EE E
4. XL LL a a p Ga 12 XU CCD J JI L Charge Coupled Device Willard S Boyle George E Smith 1000 1969 ET ET ECK EL EI ELE EL EIER HCH 000000000000000000000000000 000000000 19930 XO00000000000000000000000 0 000000000000 uuxuiumuuuullluuuuuitiiiiHtitltll tL AU 0 0 H B 00 0 0 0 L UL Photon counting HU 00000000000000 0 CCD Photon counting 0 00000000 0 0 0000000000000 10000000000 0 0000000000000000 0000000000 20130 1220000000000 1 1 0000000000000000000 201380 0000 1970 1971 1972 1974 1974 1975 1975 1977 1978 1974 1979 1983 1983 1987 1987 1989 1990 1993 1995 1996 1999 1999 2002 2004 2005 2009 2013 2014
5. 0000000000000000000000000000000000 H HERE ELLE ET KREE EVER ERE a mimpi COD EH D0000000000000000000 S REE t AE B i 2000000000 5 0 00000000000
6. 3 2 5 0000000 0 000000000000000000000000000000000000000 0 000000000000000000000000000000000000000 Virtual X0 000 0000 18000000 18 HN Chas Sel DE e Lu uu uu bian mul kal L IE mrA F hole c 300 00 000000000000000000000000000000000000 D Durban 0000 bl 0000 0 0 0 0 0 virtual phase 000 11 phase T 0000000000000000000 3700 Virtual phase UU 00000000 3 2 6 000000000 0 0000000000000000 Summing Gate SGC 5 000 000000000020000000 Output Gated 00000000000 MOS Field Effect Transistor MOSFET t H E H E B E E E E E E 000 Seuree 0000 00000 000000000002000000020000000000 0 00 0000020000000 0 Reset 0000000000000000000000000000 Floating Diffusion FDO 0 00 0 0 0 0 0 00 0 0 0000 00000 0000 100 00 MOSFET MOSFET FD 0 0 0000000000000000000 output amplifier M
7. LLL Es EE ET EE 18 9 2 00000000000 0 000000000000 0000000 50010 Ratio lo Ratio lo 3 31 0 05 3 19 0 05 3 99 0 07 3 46 0 07 0 08 0 01 0 08 0 01 0 05 0 01 0 07 0 01 5 14 0 06 4 88 0 06 5 37 0 09 9 19 0 09 20 13 0 13 20 32 0 13 22 48 0 20 23 00 0 20 20 47 0 13 20 39 0 13 17 94 0 17 18 20 0 17 1 45 0 03 1 38 0 03 1 32 0 04 1 19 0 04 44 21 0 21 44 29 0 21 44 54 0 30 44 13 0 29 0 22 0 06 5 46 0 06 4 70 0 08 4 81 0 08 0000000 0000000 50000 Ratio lo Ratio lo Y 129 192 193 256 Y 129 192 Y 193 256 3 35 0 05 3 21 0 05 3 42 0 06 3 31 0 06 0 10 0 01 0 07 0 01 0 09 0 01 0 06 0 01 5 20 0 06 5 03 0 06 5 22 0 07 5 26 0 07 18 30 0 12 18 40 0 13 21 55 0 16 21 76 0 16 22 06 0 14 22 20 0 14 19 40 0 15 19 40 0 15 1 46 0 03 1 37 0 03 1 49 0 04 1 53 0 04 48 69 0 21 43 93 0 21 43 88 0 25 43 34 0 24 5 85 0 07 5 79 0 07 4 94 0 07 5 33 0 07 Ct VS UN LE DUDU 20000 0 00 0 000 00 0 i 0 0 0 000 000 00 0 000000 Channel Stopp HH BD D HE UO WD UO D DO D HE DEO UO DU D DE 7E 7D UE UE 7 7
8. 46 Driver beard 0000000 000 0 00000000000000 5 00000 0000000000 Cold head 43 SpW2GbE board MIO board lt pev A 4 Video FPGA e Driver board 47 4 Video ASIC HEAD mini CCD 45 0 000000000 suis gt e x 46 44 Pch CCD with MNDO2 Osaka Univ 4 AL L lt LE AT S STAINLESS HARDEN Lt Il II H 4 20 30 40 50 60 70 80 00 120
9. 40 D41 0U0U00000000000000000D00D00000U00U00U0UU0UUUUD 510000 0000 Uma 00 00 00 00 A Wb 0 A m 0000 B T V V 00 0 F A unn R 0 000 H m 000000 G S 00000 P H E V m 00 A m 0 00000 Massaker ERU A UE DE ii hila hapiq Lift 0 000002 00 000 400000000000000000 pb 4 11 Ph DEC LED LI CI EE PET E E E ID LI 4 2 0000 0000000000000000 4 2 1 mini CCD 0 000000 200 0 00000000 XU CCD OOO Soft X ray Imager SCHO 0000000000000000 00000 mini CCD J J 0 0 4400 mini CCD D EL EL UL HL ELLO D D D mini CCD D EE EIE EI UU 421
10. ED PPE uut HOHUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUY 8 10 0 0000000000000 D Floating Level Signal Level 0000000000000 0 000 0 0 000 0 0 0 0 000 0 0 000 0000 0000000000000000000000000000000000000 4 000 00 0 00 0 00200000000000000000000000 00 00 Floating Signal Level H 0 hiiia it 00000 000000000000000000000000000800000000000 0000 00 1 000000000000000000 ER 00 Analog to Digital Converter E E E E EB E E E E E E E 00 Pulse Height Amplitude 0 Analog to Desital Uni
11. hiii LEES EE TH EFE EE 0000000000000000000 CCDUOOOO00000000000000000 0 000000000000000000000000 0000000 Grade 2x20000000 00000 0000 000 0 00000 00 6 0 0 0 22 000 binning 0 00000000000000 0 00000 00 0 0 0 0 0 0 0 pile up 0 UU 0 00000000000000000 000000000000000000000 Asa pile up 2x2 bianing A UU OU pileeup 40000000 KEE EE 3014311111 0 0000000000 2x2 000 Grade 00000000000000000 2x2 binning 0 000000000000000000 000000000000000000 binning On chip binning DH D D D D B LU L 35 140 UUUUUL 0 000000000 0000 POU 8 0 ET 2 11111 0 000 0000 0039340000000000000000000000000000000 000000000000000
12. E RE EPG 4300 0 0 00000000000000000000000000 41 ns 7 xD MT Z Jm JZ rill fe mee IN BJ wA mini CCD AZ 4 3 Hut HHI 111111111 lil ili a U 4 4 0 0000000 mini CCDI O O S11745 0637 42 4 2 0000000 mini CcD 20 00000 21 00 DDDDDDDDDDDD 00000000000000 24um H x 24um V 0000000000000 240 22um H x 16um V E E B LH 320 H x 256 V gogg 320 H x 256 V 21 21 MOSFETUUUUUD 43 High 0 D D LU LU U LU IV RG Reset Gate HI LO 5 0 5 0 SG Summing Gate HI LO 7 0 5 0 TG Transfer Gate HI LO 3 0 5 0 PH Horizontal clock HI LO 3 0 5 0 VI Vertical resister I clock HI LO 3 0 5 0 VS Vertical resister S clock HI LO 3 0 5 0 OD Output Drain 20 0 RD Reset Drain 12 OG Output Gate 5 0 BB Back Bias 30 0 4 2 2 00000000 HEAD Video ASIC Video FPGA O MIO board Driver board SpW2GbE board amp 500000000000000000000000
13. 000 707 0000 0 000000000000000000000000000000000000000 00000000000000000000000000000000000000000 37 0 0000000000 Fuer B D D D UO D 7E U D UO D DE HEU D l mn E 0 viv qn E Vp m nvv 4 3 0 0 0000000000900000000009 000000090 0000000 20000000000000000000000000 ERR E EN EE 00 000000000 CCD 2 0 00 43000 0000000000000000 d E n D p E Vn n 3 2 38 ZE 0 Vv x B Vp mn 4 4 00000000 41000 00000 00 0 0 0 0 00 0 0 0 0 0 0 8 000 0
14. 81 OOO L 1 http www jrias or jp products cat3 sub3 01 2013catalog03 html 2 http henke 1bl gov optical constants atten2 html 3 Chandra X RayCentef CXC NASA SAO http asc harvard edu cal Links Acis acis Cal_prods qe 08_11_04 q 4 4 James R Janesick Scientific Charge Coupled Devices SPIE PRESS 2001 5 Knoll 0000000000 000 0000 2013 6 NASA CXC SAO http chandra si edu chronicle 0202 40years index html 7 0000000 5850000000 0000600 1993000000000 0000 ASTRO DOO 1 1995 8 Shutaro Ueda Kiyoshi Hayashida Hiroshi Nakajima Naohisa Anabuki Hiroshi Tsunemi Hiroaki Kan Takayoshi Kohmura Shoma Ikeda Kenta Kaneko Tatsuo Watanabe Koji Mori Masayoshi Nobukawa Hiroshi Murakami Kazuya Sakata Shotaro Todoroki Nobuyoshi Yagihashi Eiki Mizuno Masaharu Muramatsu Hisanori Suzuki and Shin ichiro Takagi Measurement of the soft X ray response of P channel back illuminated clear Instruments and Methods in Physics Research Section A Accelerators Spectrometers Detectors and Associated Equipment Vol 704 No 0 pp 140 146 2013 BEBE BEI E HIE 111111 e E 0000 No 17 2008 10 0000 000000000 CCDUUUUUUUD Masters thesis 1 1 2004 DD U t a E pa i ip p DEET ELE Master s thesis 2003 12 0
15. EEE EE E E 00000000000000000000000000000000000000000 0 00000 0 00000000000000000000000000000000 00 0 0000000000000000000000 3 65 0000000000000 000000000 00000000 3 65 0000 ASTRO H SXI D D U DU D D D U LU UI U 200 D BID 00 O 1 5 x 190000000 WM m a d a n a a a dn mI 3 3 4 Dark 0 D D LU LU U EEEEELO SD DE EE O E E UUU Ho b 0 4 CT Pai Za 3 18 0000000 le sec pixell D UU UI L evi ks 000000000 862x10 0000 E ERR AER OR 00000077 196 0000000000 00000000000000000 00
16. 90000000000 36 TIBIAORISA OB SEBES BERNS E Pe iB lI e lD I Fi q v x B 4 1 E D E OE RON db 000 010 0 00000000000 410 00000000 000 10 4400000000 dt dt 0 0 0 0 0 0 00000 02 00 0 s0000 0 0000 00 00 00 lu quB qu 00 SIN Wet C Vo Vo We We UU 0000000000000 0 0 000 000 0000 0 A T 1007 xaX 2 1 cosw T 4 2
17. E lli T E D DU UU U D D 0 event threshold 60 ADU DU 130 ADU D E U D D E UE UU D D LU UI e E EE E 0 0 0000 0 0 R 0 0 0 00 0 0 000 0 0 0 0 000 00 00 BEBE 64 26 mini CCD 00000 00000000000000000000000000000000 E 000 419 Eh 00000 0 00000000000000000 000 000 50000000000000 000000000 65175304 94 8 cm DIS Dh kee 45 00000000 000000000000000 4 5 1 X000000000000 421000000000
18. E E LLB 0 0000000000000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 0 0000020000000000000 00000000 0000000000 0 0000000000000 00000000000000000000000000 Nreadout OHOC X W 3 19 0 0000000 9 COOO000 120 CO00 30 Nreadout Apul G 0 eV ADUI Dark Shot Noise DDO000000U0UUDUUDDDDDDU0DU0U000000000UUUUUUUUD 001 3 20 e rest 000000000000 0 0 0 0 PIB 0000000000 00000 0 00 3 21
19. Performance Improvement of X ray CCDs by applying Magnetic Field UUUUUUU c5ugUL utl 00000 Uu X0 1993000000 0 00000000000000000000000 Backside Illumination BID 0000000000000 20150 0000000 00000 00 00000 200 um BI CCD D U U U LI BIOUUUU 00000000000000000000000 000000000000000000000000000000000 0000 0000 0000 00000000000000000 ale DES EEESENE 0 0000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000 00 000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000 LIT Ph 0 00000000000000000000000000
20. wh amp SLE 51 EE 52 AAS pr rp BEBE xe ace ow ee wee des Rho Oe ue Y Sue ARES s s XE S 53 AAG 53 st amp haba tery te Swe 55 4 18 L LL D LL OLOL DL UL DL CL EEL ET DL CELL D CE UU OOOO 500000000000000000 00000000000 Z 56 ER SIOR 57 EIER eer a ES 57 ERR EE SS 58 1 o 59 SS y ayq u A ip pa piti 60 Grade RE RR 61 SP PRREBEBEERBEEHHENRBERINZNIMES 62 4 20 ec 68 dee 214 30 SON S ok d 64 BOS TATE SO sede pul 64 AON 2 aux y oe su Ge _ 65 Ree 67 68 Asoo epp Grade o NAIA 69 Aas pp sedes Rp Bibi ax Soy aep e P En E E 70 21 9 4 D IC ek bore oe ees ee ee ral
21. EISEN Eh illul 720280057 Grade Error Lol Counts counts Ratio Error 190 Counts counts 0 3 92 0 05 5056 1 0 06 0 01 88 2 5 28 0 06 1988 3 22 2 0 14 32645 4 18 08 25980 1 26 0 03 1804 6 44 33 0 21 63709 7 4 76 0 06 6836 Count Rate 3 89 counts s Count Rate 7 97 counts s 4 6 2 0000000 HDD u YB H E 4800 49000 a ET BE DE DE EE 000 60000 4 30 0 000000000000000000 4311000 0000000000 490000 a i LA ade RAR RRE 4 6 3 00000000 0000 Grade 43200000000 Mok 0000 000 LU 0000000000 00000 mune 000 000 43300 00000 MiK OU OO DHL OEC 00 000 000 0 0000 0 T od 4100 D OLD HEB LO D 4 6 4 CTI 4110000 465 00000000000 43400 4 35 0000 0060 0000 00 0000 00 6000 0000 5000000 4 360 0 43700 438 00000000000 0 0000000 0 Grade 1 Grade 50 Grade 70 0 XD D UL UO D UU X DL UO UO U U D D L eg l EET BE 0 0000000000000
22. 0 000 000 5 9 0000 120 2 35 x G x ox 3 24 leV ADUU 0 0 000000000000 IADUJO OOO e x00000000000000000000000 0 0000000 0000000000000000000000 34 CCDUUUUUL EA EE ELI Ed 220 00000000 32 txt 2 subpauss Main Gaussia ei Sub Gaussian Counts PHAL ch 3 18 LO keV 00000000 Main Gaussian 0 DD D B D 7E EE 7E L 00 Sub Gaussian split threshold L HL B D DH UU B D E D UO D HU UU D LU L 000000000000000000000000000000000 O00 Main Gaussian i12 3 4 1 00000000 0 00000000000000 0000000000000000000000000 0 31800000 0 200 um 00001 0 keV DO D 0 00000000000000 000 270000000000000000000000000000000000000000 00 0000000000000000000000000000000
23. Event Threshold U 0000000 00000 0 000000000000000000000000000 Gg GOD TREE ED BRE E D s phi hihi E TAE EOD a 0 00000000000000000000000000000000000 3440000 de hk 0 000000000 000000000000000000 24 3 14 0000000000000 00000000 5 25 S L L Square 3 15 X0000000000000002x200000000000 7 000000000000000000000000000000000000000 hi a ai hui GR ABER 00000000 00000000
24. 0000000000 0 0 CCD J 0 0000000000000000000000000 0000 010mm 0 15 mm Be 0 00000000000000 10mmp 416000000000 Fe PSFeJU U 20130 90 1000000000 344 3 000 0 0 n 2230 0000 0000 0000 323 1 ol atl M Eug mo D E 130 4 14 00000 0 mmi 2015 100000 20130 20130 120 1 4 3 EE E 0 4 4 0000000
25. mme 4240000 60 45 000000000000000000 1 lol HUUUU odd E 0 0 LI even L 0000 000 5 20 0 01eV ADU 5 17 0 01 eV ADU 000000 IU 12 14 0 01 e 11 64 0 02 e LE EL EL B EE LH 11 30 0 01 e 9 70 0 01 e 00000 0 86 0 01 e rms 0 88 0 01 e rms LL EL EL EJ E LH 0 14 0 01 e rms 0 33 0 01 e rms 0 01 107 Counts sec ADU 107 800 900 1000 1100 1200 1300 1400 PHA ADU O 4 24 0000 Grade 00 00000000000 0 0 PHAD 000000000 TT counts sec ADU 46 000 00000 L LE LI Line Energy keV Gain eV ADU Resolution eV Error 9096 confidence eV MnK 5 9 5 18 249 5 4 0 3 9 6 5 0 16 262 8 11 5 11 3 61 20 30 10 2 4 6 Grade 4 25 0000000000000000 1 00 0 0000 0 Grade or 000 0 0 00000000000 Grade 20 3 40 6000 0000 0 Grade 1 50700 XU U U U U U 47 OL DL EEEL BL EE EE GO CE EE D DE EE 000 CE BE ET ET EI Grade Ratio Error 1o Counts counts 4 5 4 0000000 0 0 0 000000000000000000000000000000000000 4 25 47 LH 00 4 5 5 4 16 0 05 1926 1 0 22 0 01 426 2 5 37 0 06 10222 3 20 36 0 11 38731 4 19 41 0 11 36927 1 80 0 03 3431 37 84 71985 7 10 83 0 08 20607 0 0
26. 0 00000000 00000 00 00 0 0 0 000 0 00 ccDOO0000000000000000000 W i Srp AADC 0 5 0000000000 3 65 00 Sep Floating Diffusion 0 00 Floating Diffusion Amplifier FDAUU MOSFETQ OOO IV VID Ax 6 3 16 28 D DO D D D D Pre 1 0000000000 10000000000000000000 ELELEEE MATE EEEEB oo S uti pipi E EE EDS EE 3 3 8 000000 Charge Transfer Efficiency CTED 000000000000000 A4 0000000000000000 1000 999 00 000000 CTEQ 999 1000 0 9990 ie 9990 Carge Transfer Inefficiency CTIO O O O O CTI CTI 1 3 17
27. 33 3 5 0 UDDDUIUmini CCD D D UUuuuuubbbibLttltlmin CCDLDDDDLLtLttut 0 000000000000000 00000950 1 VID O UO U C C CE D D U D UID 12 0 20 00000000000000 DU 000000000000 423000000000000000000 edd 11 10x0 01 e even 9 70 0 01 e 0000000000000000000000000 0 20 00000000000000 59 OD 20V 47 X 8 12 0 Hi 31 33 OS 12 V OUT 47 kQ OD Al FASS RTN 55 XE 7 EE rr r rrt OD 20 V OS f 12 V 0 4 23 0000000000000000000000 000 0 000 CE BEL D lI 0 000000000000 1000000000 2000000000000 D LU 0 0 00000000000000000000200000000000000000 odd 0 86 0 01 e rms even 0 88 0 01 rms 00000000 le HL E E D I LU 0 00000000000000000000000000000000000000 83 3 5 00000 0 Spurious charge 0 0 0000000000000000000000 0 14 0 01 rms even 0 33 0 01 rms 00000000 le HL E E D I LU 0 00000000000000000000000000000 Spurious charge 0000 4 5 3 00000000 0000000000000000 460000000000000000 00000000000000 Grade Grade
28. 55000 554000 50 4 13 000000000000000000000000000000 4 2 7 0000000 1 0 4150000 14000000000000000000000000000 0 33 0000000000 12200000000000000000000000000 0 444000000 1300000000000000000000 0000 0 0 00000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000 0 000000000000000000000000000000000000 4 2 8 XII LU LI HILL 0000007 00000000000000000 Electron Capture 00 0 000000 0000000000000000000000 00000000000000000000000000 0000 Auger 00 000 MaKe OD UU U U C UO D U UE U U 5 9 keV 65
29. 0 0000000000000000000000000 0000 000000000 000000000000000000000000000000000 0 0000 0 0 000000000000 0 1 20 keV HU U B D LU LI U 21 0000 a e E E Hk Ph 0 00000000000000 0 000000 0000000000 000000 Pu 2 1 00 6 TDP TB IP P pi ROGER 0 00000000000000000000000000000000000 0 0 0 000000000000000000000000000000000000000 00000 000000000000000 duorescent yield 0000000000000 ii Di PELLE LEER 0000000000000000000000000000000 0 0 0000000000
30. v 3 6 0000 00000700000000000000000000 qT 3 7 00000000700000000 9000000000000000000000 ENE 3400 3600 ELE 2 EE EE BE 0 B 0 0 BL 0 00000 42 eNi a 2 ldep 3 8 00000000 O CCDUDUD 000000000000 200000000000 2002 9101 0000000000000000000 In 3 9 ep NI 2 H R DV n 3 10 31000000 X EL ECOL EE RER ESI LINDE 2000000000000000000000000 3 11 p DCH 3 12 ep DP NS 3 18 Ca m 3 14 mobility 00000 17 p 20 40 OHM cm 0 01 0 5 3 4 um Si 5102 INTERFACE Rss POTENTIAL I Vg 8 Gi INTERFACE TRAPS il ls lt COLLECTING PHASE Gi uil 1 SURFACE ofa lt A zi a SS W Vg 25V xl Zi S A gt INCIDENT a w
31. 000 0 0000 0 0 0 00 00000 Graade 30 Grade 40000000 0 0000 500000000 Grade 300000 Grade 40000 ND D HO BD HE UU Grade 3 HOU crade4000000000000000000000000000000000005 Grade OCDU UE a aE a ERR RAERGRZ HOUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUoo Grade 00 Grade 10 Grade 2 Grade Grade 7 O O Grade 4 Grade OU 0 Grade 00000 crade6U00000000 5 1 16 5 1 000 00000 0 00000 29 00000 0 0000 00000 00000 00000 0000000000000000000 0 20 000 20 000 20 mH 000000 500 0 0 0 0 5900 000000000000 0000000000 EEE ESET EEE dh ER 0 900000000000000000000 200 2820 0000000 Grade 10 Grade 50 Grade Pu L BOE EP DEEP 90
32. 00 00 000 000000080000000 000 4 Backside Illuminated BIQ 00000000000000000 340000 00000000 0 00000000000000000000000 0 00000000000000000000 000000000000000000000 0000000000 13 Effective Pixel Serial Shift Register GO Serial Shift Register a Full Frame Transfer Effective Pixel m Parallel Shift Register Serial Shift Register b Frame Transfer c Inter Line Axt 033 000000000000 000000000000000 0000 00000 0000000000 17 00000000000600000000000000 0 00000000000000000033 100000000 000000000000 0 000000000000000000000000 00000000000000 X 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 0 0000 00000000000000000000000000000000 0 0 000000000
33. 440000 441 00000000 000 0000000000000000 Peti HT U 00 miiCCD 120 1100000000000000000000 52 II UN A STUNLESS HARDENED 20 30 Jg 120 130 140 150 160 170 a E INN 4 15 000000000000000000000000000000 Fe 55 416 0000 D 53 4 4 00000000 000000000000000 000000 FeQOO0000 X 000 5 9 keV MnKs 6 5 D 00 0 120 00 00 o00000x0000 0000 6200000 0000 DUH 90 E 15 15 5 000 0 30 15 15 L 0 25 T ooo 000 ago 8000 057 44 2 X00 mintCCDOO00000 15 0000000000000 84 26 0 418000000000000 00000 000 00000 00 mimn CCD q EH EE E EG EN 4 4 3 DDD ENE BNR 4 20 000
34. NDSN 4 Sap Svoc x Noss 0000000 le rms 5 ADU 0 0 0 0000000000000000 gt 0000 leV ADUOWOO 000000000 0000 00000093340000000000000000000 1 sec 000000000 00 00 0 20 Spurious charge 000 4 Spurious charge 0 00000000000000000000 G Nvertical Svoc Suoc X W 3 22 Nvertica 0 UD DU DD U le mell 5 IADUDO D 000000000000000000 ADU 000 iev AbUIDn 000000000 0 0 Spurious charge 00000000000 a EDD mod 20Tnversion state 21 3
35. 000000000 Active Pixel 000000000000000000000000 00000 voco 0 0000000000 000 0 0000000 000000000000 42 200000 0 0000000 ASIC I odad HO DU DLE even UU0000 Full Frame Transfer D 00 0 D LU 0 000000000000000000000000000000 0 0000000000000 0000 0 0000000000000000 4095 0 0000000000000000 00000000 000000000000000000000 Hot Pixel 0 D 0 D 0 Hot Pixel 00 U U 0000030000000000000000000000000000000000000 00000000000000000 0000000000000000 422000000 Counts sec 0 0 0 00000000000000 99 4 18 000000000000000 00000000000000000000000 1500000000000000000 0000000000000 2 56 D E 4 3 00 CSUS 304 0 0 419 0000000000000000 0000000000000000 0 4 20 000000000000000000000000000 0000000000 D UDULL 57 D 408 817 1228 1637 2050 2458 2866 3278 3687 4095 4 21 00000000000000 000000000000000 000000000 Active Pixel D D D D D CE CE CE CE ELO DE EE CE DE D DE DE
36. 9 7377 30000 0 0 0 00 0000 0000 0000 0000 99730 0000 00000 0000000 0 FITS LU 0 000000000000000000000000000 4 2 4 000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000 Pixel Level JU O OOOO 49 I KARA T n 4 44 55400 4 12 0000000000000000000000 000000 mmf 00 00 0 0 00 0 0 0 0 0 00 00 0 00 00 0 0 00 0 0 0 0 00 0 0 00 19 40x10 TorQ 8 0 10 7 Torr UU 42 5 DDD 20 00 00000000000000000000000000000000000000 0 0000000000000000 0 0000000000000000000000000 000000000000000000000000000000 300 mini CCD 000 120 124 4 2 6 OOO 412000000 1300000000000000000000 DEBE CO LI LI C 033 10000 0000 00 0 00 0 0 0 00 0 0 0 0 0 0 00
37. ASCAD ASTRO H 0 2000000000000000002000000000000000000000 0 20000 00000000000000000000000000000000000000000 ED OK OC IC 0 00000 0 0 000000000000000000000000000000 2014 84
38. BARRIER PHASE 4 2 gt 1 LIGHT 5 J 5 DISTANCE Z i CHANNEL INVERSION 4 DEPLETION DISTANCE SURFACE PINNED CH REGION f 23 I 8V l GE EPITAXIAL LAYER SUBSTRATE g 1 10 pm i 500um Z 0 36 CCDODDODODOODOODOODOODOODOODOODOOODOD Surface Channel O 0 O Buried Channel 4 0000 3 5 x 1012 3 5 x 101 EECH U DDD DD D D 90 C 180 KE 0 CCDO 70000 1 6 10 1 38 x 10723 m kgs GQ 0000000 1 04 x 1077 F m QD n n d X rn D D 00000000 2 20 2 46 um0 000 3 2 4 0 000000000 0 0000000000000000000000000000000000000000 0009 100000000000000000000000000000000000000 0 00000000 36 UD UU UD Surface Channel O 0000000000 Buried Channel 0 0 0 0 U U U U U U L hihi u hiii DESEE S E EP ETE EDI 00000000000000000000000000000000000000000 0 0 0 000000000000000000000000000000000000000 0 0 000000000000000000000000000000000000000 83 231
39. 30 Ges 41 42 DO000000 43 43 43 SC awa ua 54 A TV VATE UREN ELT 61 zo 61 izr BBBBBDBEB Ee cat o aban 62 AS TT Ta LN ee he ne Babee EE 66 P HR RR dest ta or oe ob ha qa 67 CI Meh Me EEN EIGEN SC ow a Geter 68 TIC Ok Saas a Gok eh Se et oe ee RS Be E 69 SS fr eege CEA EK REENEN 9 2 CE a ec 79 O L Er nin DR DS E e E E 8 Sus a Gee ser bw h ot dh 12 TA LB HN u sg sua g 13 o 14 oe PLA C Du 8 15 ou B 16 E EE HUE vg a es E Ee xS 18 Se s buy a 19 a TO hh ue dh s Sas tus s A aeu ES 21 0 ee 22 3 O E PASE RP PTH 22 NEN S
40. rS 50 dob Z metet 50 Z2 51 A iu a a a 51 Zo apa p 02 52 OS Ge ak 52 Zo pni SUS a tek es quere Se heat o 54 tee EEN E gt 54 EE 55 lp 9 55 dux CA 58 Beo e a a a a a a a e e a a a e a a 60 ro a el se E 62 O E se abies Llu A 62 0 eat es 63 63 LIPPE 66 se lt 66 I EE 66 A H Pm 66 050 76 S ME n Se 76 ET DE Z S S SSS W Ga ete Wi 76 5 3 Grade D Grade 00000000 78 ME ae 79 Do B se e eS 79 l 6 81 81 84 O L ENEEK REIR ae EE 7
41. x 24 ym 3 2 3 0 000000000 000000000000000000000000000000 00000000000 Nchannelt P channel 0 90000000000000000000000 d z qNi dz 32 9 1 00 D 00000 laep 0080 2 O 2 0 4 42 000000 2 Deg ldep 2 3 3 0 00000000000000000000 46 42 i B z 2 3 4 16 HHAH za ta os BP DE EET E E A RER 0 0 0 0 0 0 ENEN 0 0 0 0 0 0 0 0 0 0 000 a 0000000000 Inversion State
42. EEGEN HUH L m nvu qnk qnv B On m nvu qnE kgT B 20 lulii Ww Dn wiE w2kT10n S 2 nos PP v qBn Oy 79 w D n 2 w2 kT On puo 4 6 SC n Oy s k Um ES 0 0 0 00000000000 Dwe 4 i SCH E _ 47 14 1 4B E 4 8 144 1 38 u 500 cm V sec 1000 cm5 V sec 1500 cm 2000 cm V sec B T 4 2 DEDE Bl LOU 0000000000 0000000000 o 1 Vie p 20000000000 200 00000 00000000000000000 2 0 0 0 0000000000000000000000000000000000000 em V se 1 n 4 10 00400000000 00000 0 0 l cm3 0 D0000000000000000Si000000000000000X0 D000000000000000 T 300 K0 00000 1350
43. 2015 2015 2028 LUUD D LI Uhuru 050 7 Copernics ANS Ariel V SAS 3 OSO 8 HEAO 1 Einstein Ariel VI Hakucho Tenma EXOSAT Ginga Kvant Granat ROSAT ASCA RXTE BeppoSAX XMM Newton Chandra Integral SWIFT Suzaku MAXI NuStar ASTROSAT ASTRO H eROSITA ATHENA NASA NASA NASA NASA NASA NASA NASA ESA UU DI NASA ESA NASA ESA NASA NASA DI ESA 00000 HEAO 2 000000 MIL 000000 Ed WE LH 55000000000000 JE vir E he 1073 107 10 1072 lm lem 10 m 10 10 1 102 1074 fiui 11 00000000000000000000000000000000 i9 ODE 0 0 00 00 0 0600 0 0 DB 0 0 0 00 00 LL 00000 00000 0000 0 0 PhetencoutingD 0000000000000 0000 HUE ED ETE ir DESEN DEEL PI EE ETE EE ETE 120 AUUUUUUUUU
44. 450 cm V sec O T 153 Kf 0 0 JD J 6800 cm sec 1980 cm V sec HugHuuu 120 C 20000000017000000000000000000 9960 000000000000 00000 9000 000000000 247000000000000000000000000 44 2 000000000000000 39 0000000 69 44 144 E E 0 0 0 0 77 0 65 0 2780 000000000000 3 200000 26 00 0000 00000 0000 0 0 00 BEE E 4333 0000 10 000000 40 0000000 24 um x 24 um n channel FTD U U UU 0 6 2 2000000000000000000 Grade 200
45. J Video ASIC D 7000 Driver board Hl E H E EH DD DD House Keeping 0 0 47 4 10 Driver board SpW2GbE 4 119 O SBBW2GDbE board E E L1 L1 L1 L 0 Space Wire to Giga bit Ether Space Wire 0000000000000 0 0000000 Space Wire 00 D D D LU D OD 20 00000 00 00 0 2000000000000000000000 Space Wirel 0 0 LU SpW2GDbE board Space Wire Ether net 2 lH E DD E E E E E EE EL EE EL FD E 4 2 3 Ether net 0 0000000000000000000000 the Flexible Image Transport System 20 500000000000000000 0 0000000000 00000000000000000000000000000 0 2 0000000000000000000000000000000000000000 0 000 50000000000000000000000000 0
46. 0 0 000000000000000000000000000000000000000000 3 0 0000000000000000000000000000000000000000 000000000000000000000000000000000000000 22 311 CCDOUUUUUUUUUUDO READOUT lt 4 d 160 41 BLANK HORIZONTAL BLANK 4 160 4 3 12 000000000 l Over Clock Region 00000000000000000000000000 29 bixel level 0 Event Threshold Level pixel level Q0 gt pixel level 1 24 pixel level 0 pixei level 5 8 3 13 0000000000000000000 7 CODI O0 0 0 SRE EN 0 00000000000000000000000000000000000000000 0 000000000000000000000 0 0000000000000000 local maximum
47. OS 25 c ES E PURSE 2 RG 7V4 IC gt 3floating level I lt Z 2 floating level NN b is ij NAVV p 2 d SG Low P1H High RG High RD 12V OD 20V MOS FET 1 T OG 5 m MOS FET 2 10 OS 3 lC T gt SG DEF DASH WA fas 23 signal level lt Z gt e signal level A KS x Low SG High RG High 3 8 0000000000000 270000000000 P channel CCD 0 21 Reset iFloating Signal iLevel Level 3 9 0 0000950000000000 00000000000 P channel CCD OO 11 samp ing samp Ing 3 10 000000000000000 P channel 11 Horizontal Over Clock HOC Region O O O Over Clock Region Vertical Over Clock VOC Region D Hl E E E E E E E E HE III Active Pixel APU Region 0700 0 0 CCD 00 0 00 0000000 00 0 00 02002000200000000000000 AP Hd EB E E E HL UI Under Clock Region L 1 00000 Under Clock Region Horizontal Under Clock HUCT Region O O O Under Clock Region Vertical Under Clock VUC Region 0 0 0 0 31200000 CCD EI BL EL 7 B EE 7E D EE 7E BE 7E 7 IL 3 2 7 83 231
48. 0 0000000000000000000 83 3 3 4260000000 Grade 0 00000000000 0000000 Stacking Plot 0 110000 13000 00 000000000000 0000000 5 Stacking 62 1500 1000 PHA ADU 150 200 250 RAWY 426 00000000000000000 Grade 0 Stacking Plot 100 4 26 00 0000 3 3 30 0000000 00000000000 H 42700 YUUU 2900000000000000000000000000000000 a x offset 4 12 000000000 fittngQOOO0O00000a000000 ADU 1 transfer O 0 D fitting a offset 0 0 00 1 9 0 7 0 10 0000 0 46 0000000 Do0000000000000000000000000000 4 6 1 X000 00000 4290000000000000 0000000000000000 0 000000000000000000000 428000000000000000 0 000000 0 00 00000000000000000000 0000000000 0 000000000000000000000000000000000000000 CCD 00000000000000000000000000000000000000000 0000000000000000000000 0 0000000000000000000 0000000000000000000
49. 000000000000000000000000000000000000 0 53 26 0 0 33 3 4 48 100180102 NI 30W N AVELLA WM 01099102 d d mm o ov d O N ASTRO H ISAS 4 11 SpW2GDbE board E 33 2 7 Event threshold Split threshold O LL B LH LU D DH LU D HH E DO D HE DL UO D D D U D Grade 00 Gerade 7 00000000000000000 Event threshold 0 00000000000000000 E E Til EET Phil nn 00000000000000000000000000 Split threshold BOCH DUDU 0 000000 000000000000000000000000
50. 1 0 00000000000000 0000000000000 00 XL 00000000000000000 50000 0 00000000000000000000000 0 000000000000000000000 00 00 0 0 i i 000 iL LAHR iphu 3 Multi pixel Event 000000 po MW 00000000 000000000 0000000000000000 Si Escape Event O 0 0 Si Event 00 0 0000000 00000000000 Si Escape Evet 0 000000000000000000000 0000000000000000000000000 SE E E E E 19 AG XUL 2 Si Escape SH A7 F 1 12 4 lt F 3 BE 3 S1 Escape 4 A v F 02 CCD t Si K 06 NS 35 00 000 23 hhi l I XII DD D D D D UO UU D LU 00000 0 0171 000000000 0000000000000006060 0 0000000000000000000000000059 keVU XUUUD 910000 0 38 CCDI LI UC LU LU 0000000 24
51. 130 140 150 ar Il 4 7 Video ASIC Video ASIC 4 7 0 Video ASIC Hl HH BH DDD E E Video FPGA 1 LU 000 AX ADC OO 0 O ADC Analog to Digital Converter CCD E E EH H BH EH E E EL E EE EL EE EL L 3 260000 000 0 000 0 0 0 00 0 0 00000 000000000 20000 DD Video ASICQG 00 00000 00 0 0 0 00 Application Specific Integrated Circuit ASICG E E E E E E E E 0000 0 0 0 00002000002000000000000 000000000000000000000CCDOO00000000 1000000 06300 Floating Level Signal Level L HH Hl B HH U D B DE U LH U LEE U 0 000000000000000000 Signal Level 00000000000000000 D000000000000000000000000000000 00000000 0 0 0 000 0 al 2000 0 D0000000000000000000000000 8326 0 00 00 0 0 0 00 00 000000000000000000 0 000000 000 0 0 00 0 0 00 0 0000000000000000000000000 oda 000 0 even 45 e 60 70 80 90 00 120 130 140 150 160 E ME STAINLESS HARDENED mI 4 8 Video FPGA odd even E E E 0 0 0 Floating Level S
52. 4 05 td Bie 72 4 307 d us 73 oC TG io i e t 74 goe ER U Z tases sar one 75 Du ete rr tm e 78 s EE 80 010 AUUUUU CCDUUL ADO OA RRE oO EE EE SET DES 11 PT EE EISE EE e 000 000 0 9 0 900 0 SR OD TH 1962 Riccardo Giacconi IU E E E E HE E E E EF EJ E EL E E E E E D Scorpius 1 19630 00000 XO00 0000000000000 000 60000 000 0 000 0 0 0 0 0 0 0 0 0 0 0 H 19700 000 00 00 0 0 000 Uhurull 0000 Ah EMOL LEE E BRECHT MERL EISE EC EA EEGEN E 1
53. 50000000000000000 19 1050 UL 00000000000000000000 51 8200 08 4900 4200000000000 390000000 2000 VIe 000000000 03700000000000000000000000 980 DE ET EE LEES HE 9 2 000 00000000 2 EP iB Ei n DU 11 a 510000000 S bo PER Een DESEE BYE Db U L 00000000000 0 0000000000000000 95 0 00000000000 EEE ETE 000 EE 26 AR ER RAR ERR EET ENCE 1 sto TT DB ET EE ET ET 40 0 0 0 0 0 0 0 0 0 0 00 00 H DLL hL
54. D LU UE L 000000 0 L Side split event O Grade 3 Grade 00 000000000000 9 4 sb eh EIE 55 ED T POETE E Charge Transfer Efliciency 79 Channel Stop READ OUT 5 2 00000000000000000000000 Channel StopD 00000000000 0 00000000 0000000000000000000000000000000 0 0 000000000000000000000000 0 4110000000000 0000000000000000000000000000 2 7 xlo O 000000000 22600 0 160 1 5 9 0000000 1130 ADU 0 0000000000000000000000 10 80 16
55. dom de dee ae e E A Bech 0 2 2 3 2 3 3 2 4 3 2 5 3 2 6 eebe Aaa EN REES HUGH GSN GN Tell sesh EME EMM HESE ERR oe 3 3 1 3 3 2 3 3 3 3 3 4 3 3 9 3 3 6 ol ee ws u wa a N ENE 3 4 1 3 4 2 M 25x ae 4 1 1 4 1 2 4 1 3 4 1 4 4 1 5 UU IIE ET ch ee EE eaves WIR bebe be EEN A TOE 2 41 Zo Z S S S e imm e 41 A ME ED PEPTIDE 43 dd PDC S ad boe nd fa 22 utes rs 48 Zo iei muu m e E hace divers 49 p EIE z
56. hd lll DEED DEE EE Abstract X ray CCDs are now regarded as the standard focal plane detectors of X ray telescopes since their first use in the X ray astronomy satellite ASCA launched in 1993 advantages of X ray CCDs are high spacial resolution high energy resolution and large field of view compared to conventional gas and scintillation counters Among various types of CCDs backside illuminated BI CCDs with a thick depletion layer are preferred because of their high efficiency in both low and high energy X rays ASTRO H Japanese X ray sattelite to be launched in 2015 also utilizes the BI CCDs with 200 um depletion layer Although the BI CCDs with a thick depletion layer are the best in terms of the quantum detection efficiency they have two problems One is poorer energy resolution and the other is lower rejection efficiency of the background events reasons may be as follows An electron hole cloud tends to extend largely while it drifts across the thick depletion layer toward the transfer channel This leads relatively large loss of electrons when we reconstruct the original size number of electrons of the electron cloud In addition largely extend electron cloud over 2 x 2 pixels is regarde
57. 0 120 CD D 00000 EP DIE EIER DUE EJ EP REPE 10 EP EU BE EE RED R D E B 200 0 0000000000 000000 0 00 5 10000 CCDUD eC EE TEE PB 5 9 keV 238 3 4 9 4 8 9090 confidence level 0 L 0 5 9 0000 00 00000 225 4 Grade 30 DH Grade 40000 00 0 D 0 0 0 DE CE DT 0 00000 EEE EEO GI EU EI N e E E HOO CO 00000008 Grade OOOO OOOO Ooo DI DD DIKEKEKE 0000000000000000 OI ET Ch EE wa E E
58. 0 UUUUUUUUO 0 0 2 0 3 200 p channel 0 00 5 9 00000000000000000000000000000000000000 000000090 20 00000 Grade CCD 00000000000000000000000000000000000000000 0 000000000000000000000000000 END PPTP Ili ae SEE
59. 00 0000 0 00 0 0 0 0 0 00 00 060 0 0 00 0 0 0 0 0 lil 90 CIIII 120 C D U LU U U D 20 31 API DI UUU HUU FF T UUUUUUUD VOCI HU e 00000000 00 0 0 00 0 0 0 0 20000 0000 7 3 9 9 OUUU CCD B 83 2 6 Clock 0000000000000000000 Over Clock 0 00 Active 0000000000000000 1000000000 0 0 000 00000000000000000000000000000000000 OAD H A EL EE EREECHEN HEB 0 192 x 544 14 4 0000 144 192 544 158 000 PES ER ENKER NERA
60. 000 000 4000 H 0 000 12900 0000 63 Gaussian Center 5 9 x 1144 5 3 1142 lt 5 t O S 1140 5 1138 1136 120 140 160 180 200 220 240 260 RAWY 4 27 00000 0000000000000000000000000000000000 Ab CCD 7 7 m mini CCD 4 28 0000 0 0000000000000000000000000000000 64 0 0025 260 Hil 2 240 240 0 002 220 220 200 0 0015 200 180 180 160 160 0 0005 140 140 120 0 120 0 20 4 60 B 100 120 140 160 0 20 4 60 100 120 140 160 4 5 260 0 002 260 0 0018 240 240 0 0016 220 0 0014 220 200 0 0012 200 0 001 180 DCH 180 160 0 0006 160 0 0004 140 140 0 0002 120 0 120 0 20 40 60 80 100 120 140 160 0 20 40 60 80 100 120 140 160 0 0018 0 0016 0 0014 220 0 0012 200 0 001 180 0 0008 0 0006 160 0 0004 0 0002 120 0 0 20 40 60 80 100 120 140 160 4 29 000000000000 0 000000000 Counts sec 0 0000000000000000 000000000 44000 00 0 0 0 000 0 00 0 00 00 0 0000 000 0 0000000000000000 0 0025 0 002 0 0015 0 001 0 0005 0 0025 0 002 0 0015 0 001 0 0005 0
61. 000 Soft X ray Response of Soft X ray Imager onboard ASTRO H 120 XO 00 EL EISE nig 11 2013 13 2 NEW COSMOS SERIES 1992 14 DO00 CCDQOOQ000000010 Masters thesis 0 0 0 1997 15 0000 Master s thesis O O 2005 82 16 000 0000 0 00 John Doty 0000000000000 ASIC MND02 00000 2009 17 00000 0000000000 0 0000000000 Master s thesis nn 2000 18 0000 00000000000 Master s thesis D 2001 19 0000 ASTH SXI E 0004C SXI VideoFPGA 0 1 D 0 0 2012 a0ggagmumuuuu rrmsuuuu tu 5 30 1 2013 21 0000000 511745 06370 00000 22 0000 0000000 0 0000000000 Master s thesis 0000 1995 23 0000 00 XIS 000000 0 Master s thesis 0 0 1999 2 0000 0000000000000000000000000 0 00000 Master s thesis 10000 2013 83 00 00O 00000000000000000000000000000000000000000 0 000000000000000000000000000000000 0 CODI UU EE BB ERE BB B Bc B E E E E EL 00000000000000000000000000000000000000
62. 000 Ais UI Sub Gaussian 0 0 Constant O0 I 000000000000000000000 0 split threshold 0 0000000000000000000000000000000 00000000 0 00000000000000000000000000000 Sub Gaussian O 0000 LJ 0 0 000000000000000000000000000000000000000 Constant 0000000000000 80000000000000000000000 Sub Gaussian 0 00000000000000000000000000000000000 e 00 0 33420 00000 2 2 DH D DO D 00006 00 00000 0 0 0 00 0000 32012 0 10000000000000000 000 33 single pixel event 4 ES fn gt UN SS Q E Multi pixel event Split threshold 4 EO f tH L Single pixel event 5 7 JLEX 73 Split threshold A FO 3 19 00000000000000 split threshold 00000000000000000 0 0 0 000000000000000600000000000000 vm 24 pm x 24 00 14000000000 5 71 2 0000000000000 24 ump 2x2 binning 0 000000000 48 um x 48 um D 000000000000000000 1 20 00000000000 2x2 bining D B0 BU B D D OD U C DEO 00000 D 00 7 DI D D UO D D 4x4 H D D O UO D DEL UL O DULCE UO D FEE D DEO 00060 DO 7E DEO 00 0 U LU D DID D
63. 00000 66 4 9 200080001 Grade lo Counts lo Counts lo Counts 0 3 25 0 03 9133 3 27 0 03 9055 3 36 0 04 6907 0 08 0 01 221 0 08 0 01 234 0 07 0 01 153 5 01 0 04 14077 5 11 0 04 14134 9 24 0 05 10753 20 22 0 09 96813 18 35 0 09 90717 21 65 0 11 44461 20 43 0 09 97391 22 15 0 10 61160 19 40 0 11 39846 1 41 0 02 3974 1 40 0 02 3893 1 51 0 08 3107 44 26 0 15 124330 43 81 0 15 121098 43 60 0 17 89529 0 94 0 04 14993 0 82 0 04 16096 9 15 0 05 10568 Count Rate Count Rate Count Rate 5 33 counts s 6 88 counts s 4 40 counts s NO Ct VS C2 FH without magnet test_magnet Difference of Ratio 0 2 4 6 Grade 4 30 9000000000000000000 12 67 dummy magnet 1 Looking at N Looking at S z se Difference of Ratio 96 2 0 2 4 6 Grade 43 le 410 00 0000 000 000 Energy keV Gain eV ADU Resolution eV Error 90 confidence eV nog 5 9 5 24 238 3 49 4 8 6 5 5 23 234 0 17 1 16 2 nog 5 9 5 23 225 4 D T 6 5 5 25 235 2 09s 915 nog 5 9 5 22 234 1 eds 6 5 5 22 247 4 149 14 6 no
64. 00000 0 RER ERR RE SEHR H 0000000000000000000000000000000000000000 E ID EP E LY 12 H 22 REI BIET DES UE SECH ER EK EECH B PET 0 0000000000000000000000 00000000000000 0 0 0 0 000000000000000000000000 3 2 XU CCD J UU 0 00000000000000000000000 3 2 1 SDT 0 0000000000000000000000000000000000000 0 TT Frontside Illuminated
65. 0000000 000000000000000000 22 0000000 0 0 000000 0000000000000000000000000 0000000 EE EE EET llullu 0 0 000000000000 23 00000 OS BE ET B ETE ETHIC EE E 0788 CFEC E E E E 000000000000000000000 1 022 MeV I TEL D EL BEBO EE BLU DL OL OL EE BEL O HE DL 00 1 022 0000000000000 00000000000000000000000000000000000000000 10 130 CODIITI l 0000000000000000000 00000000 0 0000000 0 BE LIO JE ET ERES 0 0 000000000000000000000000000000000000000000 0 000 0 0000000000000000000000000 31 000000000002000000000000000000 0000 0 Metal Oxide Semiconductor O0 0 5 00000 MOSI DD 0000000000000000 CCDO 000000000 depletion layer MOS 000 ELO 0 00 0 0 0 0 0 SiO EE 0 0 BU H EE EELER E KE KLEER ENKER EL E ERT ECKER EK H
66. 00000000000000000000000000 41 000000000 EET ELDER BR DB SET ET IDE uni rin EE EE EE DE OE BELT EE EE CE ET DE BE DAD 4 1 1 0 00000000000000000000000000000000000000 0 00000000000000000000000000000000000000000 a BERE 00000000000000000000000000000000000000000 5 9 4 0 0 1 AELK EH 000000000000000000000000000 0 CCD IE BI I S u TIPY 0 0 000000000200000000000000000 27 000000000000 20000 00000000000000000200 0 0 00000000000000000000000000000000000 EG EE GEELEN E E DER EL HR E DOS 00000000000000000000000000000000000000000
67. 000000000000000000000000000 11 Gate Nitride Oxide n type Insulator Depletion Layer Y Field Free Region TA pixel pixel 0 3 1 CCDD D D B D D E E E E E E E EE E Gate 0 00 O 0 0 00 Depletion Layer Field Free Region Hl HH H1 DD 15 OB OUI Ga 0000 10 0000 06000 6000 0 000 0 Substrate substrate HU BD HH HU OU DO D BD 3100 00000 000 Channel Stop 0000000000000 3 200 ae HK 59 90 E ET EU 0 0000 CCDI 0 00000
68. 000000001000000000000000 0 0 000000000 319500000002 20000000000 40000000 0 000000000000000 000000000000000000 8x 38000 0 000000000000000000000 Grade Grade 0000 3 1600 00 9 00000000000000000000000000000 00000000000000000000000000000000000000000 ELE EP ELE SET EE EE ED ON Split Threshold 00000000000 31300000000000000 Grade HL B D DH D UH 0 0 0000000000000000000000000 0 00000000000000000000000000000000 XU Grade D D LU 0 000000000000 93 ULL UL 0 0000000000000000000000000 3 9 1 0000 0 0000 Quantum Efficiency QEL 000000000000 E H 0000 CCcDOO000000000 10070 000000 QE UO EI U 00 0 0000 100 000000 26 Grade definition examples 5 Perfect Single Grade 0 5 S Detouched Corners Grade 1 Vertical Single Sided Split Detouched Corners Grade 2 L Left Single Sided Split Detouched Comers Grade 3 R Right Single Sided Split Detouched Corners Grade 4 P Single Sided Split
69. 1 0 0000000000000000000000000000 Channel stop O 0 0 D D LJ e ili Spurious 3 3 6 00000000 0000000000000 0 00000000000000000000000000 0 000000000000000000000000000 0 e 20 Full Width of Harf Maximum OO0000000000000000 0 0000000000000000000000 00000000000000 0 00000000000000000000000000000000000 FWHMIT 00000 2 20820 235 0 000000000000008000008000000 Dc ERES E iq B 1 1 Es AE 24 21og2 x W x tM 9 23 00000000000 leV e 0 Ex Qt X trat t 09335000000000000000000 le 8 0000000070000 0000 Fano factor BH LB U HE BL OE BE BE OE EE EE EE 0 0 EE 0 0 0 0 0 0 0 0 0 0 0 0 0000 0 0 0000000000 000000000000000000000000000000 01000000 510000
70. 200 1400 4 36 0000000000000000000000 73 0 01 0 01 lt 103 lt 103 9 9 10 4 5 10 4 Q 107 107 300 1000 1200 1400 300 1000 1200 1400 PHA ADU PHA ADU Grade 3 0 01 0 01 A lt 10 lt 10 5 107 5 104 107 107 300 1000 1200 1400 300 1000 1200 1400 PHA ADU PHA ADU Grade 4 Grade 5 0 01 0 01 lt 10 lt 10 2 2 107 107 Q 107 107 800 1000 1200 1400 800 1000 1200 1400 Grade 6 7 0 01 0 01 lt 10 lt 10 5 10 4 5 10 4 Q 107 107 300 1000 1200 1400 300 1000 1200 1400 PHA ADU PHA ADU 4 37 000000000000 74 0 01 O lt 10 9 10 107 300 1000 PHA ADU Grade 2 0 01 O lt 10 5 S 104 107 300 1000 PHA ADU Grade 4 0 01 lt 10 9 d EL y E 10 4 ER N 8 107 300 1000 Grade 6 0 01 lt 103 2 5 107 107 300 1000 PHA ADU 1200 1200 1200 1400 1400 1400 0 01 O lt 10 9 5 107 Q 107 300 1000 1200 1400 3 0 01 O lt 10 2 S 104 107 300 1000 1200 1400 Grade 5 0 01 lt 10 9 10 Q 105 800 1000 1200 1400 PHA ADU Grade 7 0 01 lt 10 2 5 107 Q 107 300 1000 1200 1400 0 4 38 00000000000
71. A ADU Grade 6 Grade 7 0 01 0 01 2 2 lt 103 A lt 103 5 W 5 E Mt 5 10 4 5 10 4 Q 10 gt 105 800 1000 1200 1400 800 1000 1200 PHA ADU PHA ADU 4 34 0 00000000000000000000 71 1400 1400 Grade 1 0 01 0 01 lt 10 lt 10 9 9 104 5 10 4 Q 10 5 107 300 1000 1200 1400 300 1000 1200 1400 PHA ADU PHA ADU Grade 2 0 01 DD a e lt lt 10 Aun 107 300 1000 1200 1400 300 1000 1200 1400 0 01 A A lt 107 lt 9 5 E H Titit 2 5 107 Wr 5 107 800 1000 1200 1400 800 1000 1200 1400 PHA ADU Grade 6 0 01 A lt 103 m 5 m p 5 2 2 8 s 10 2 10 gt 800 1000 1200 1400 800 1000 1200 1400 0 4 35 000000000 50000000000000000 72 Grade 1 0 01 0 01 lt 103 lt 103 9 9 10 5 10 4 QO 107 10 800 1000 1200 1400 800 1000 1200 1400 PHA ADU PHA ADU Grade 2 Grade 3 0 01 0 01 lt 10 lt 10 S 104 S 104 107 10 gt 300 1000 1200 1400 300 1000 1200 1400 PHA ADU PHA ADU 0 01 0 01 lt 10 lt 10 2 2 107 107 QO 107 105 800 1000 1200 1400 800 1000 1200 1400 PHA ADU Grade 7 0 01 0 01 lt 10 lt 10 2 2 5 10 4 5 10 4 107 105 800 1000 1200 1400 800 1000 1
72. CD h BER DE REI ra u Se call ear N 23 _ ___ _ 23 1 a CER ERE mm at be E XX 24 3414 Z Se Sd oh E wwe k kapun 25 SB EST 26 E SP a 27 3 17 Chandra ACIS 28 x18 L0 keV J J E CV de ak ake rem aoe NE ced ne me e SG 33 TE PPPRP EVN s s w cheese D ys 34 y y D 37 CN Yas pn E 39 ss a se a Su 2 SS 42 Zob OD Pp Ae 42 07 EN Eh 44 Ao E Wel muy And aims s EENEG 44 Ae Video SiC G s let A suu 45 Ae gt AN Sua aen E ey ee 46 AD MIO S k US Z Elak 47 A WO Driver DOSE d ede S 48 MIE SW 2G EA B amp D kaq BS Q 49 J Ae E SE e a e e e d 50 KEE
73. D D D ADbUIDDUD 4 5 2 00000 0 000000000000032220000000000000000 000000000000000 00000000000 0000000000 00000 000000000000000000000 000000000000000000000000393320000000 000000 LECT DUBIE BEBE ETE DD KD OI DEE EP EE ET DE BITE I 990 000000000000000000000000 00000000000000000000000000000000000000000 even 1 58 260 0 009 0 008 0 007 220 0 006 200 0 005 180 0 004 0 003 160 0 002 140 0 001 120 0 20 40 Du 80 100 120 140 4 22 0000000000000000 mimni CCD min CCDD Counts se 000000000000000 83500000000 HOCOOUUUU 000 12 14 0 01 e even 11 64 0 01 00000000000000 00 5 1 5 ASTRO H SXI 0 000000000000000000000000000000000
74. D banne 0 0 000000000000000000000000 00 split threshold O D E U D L LU Grade 00000 00000000000 0000 00 0000000000000000000000000000000 3 4 2 2 2 binning 0000000000000000 binning EI 00000000000000000000000000000000000000000 00000 split threshold 0000000000000000000000000 binning DU 0 000000000000000000000000 On chip binning 00000 LU 0000000000000000000000000 Off chip binning D D D D U D U l 00000000000000000000000 binning On chipt HH D D D U LU LU U U L 2 0000000000000000000000 2x2 On chip binning 534 200 um 00000000000000000 OUOU UAG G O UOU GOOO OOE Z um 24am 24 ASTRO H 000 XO CCDOOO Soft X ray Image SI HH 00 200 um 1 binning 00000 24 um x 24 34 Gnade bimnngt
75. OSFET O 00 000 FDU output amplifer MOSFET Gate IDD E E E E ED E E 00 output amplifier MOSFET Source Output Source OS Hl EB DU E E E O5 CCDD D DU DO00005000000000000000000000000000000000000 Source Floating Sense Node Output diode 0000 Diffusion Amplifier FDA DA 0000 38000800000000 390 0 00 Reset MOSFET Gate Reset Gate 00000000000 Reset Drain Reset PR B BOE E E BE E a LE E H 950000 0 Floating Level H I 5G BU DE B D U U 0000 FEDOUUOOOUFEDOUUOOOOOUU osU0000000000000 OS 00000 Signal Level 0 000 000008000000000 000000000000 CCD Hl HE HH 0 U Floating Level Signal Level H1 EB EH E E E E E E H ED D E E E E O EP EIE EHNEN E EP ED EH ETH Floating Level Signal Level Floating Level Signal Level O 00
76. SE 47 NC XT Leer ze d i SS J gi s 8446 4 4 9 MIO board HOU Driver board D D U D DL UU D U UD HU U D U 0 00 Video board O 12 bit digital 000000000 0 Space WireD 0 Driver board D 00000000 UO0000000000 090000000000 HOU MIO User SW HH D 0 FPGA T H D B HE D HU User 0 000000 Spw 0 Sacep Wire 0 0000000000000000000 Driver board 4 10 Diver board 0 MIO HL HH BL HL BHL BH DH BE 7B EO CE DO CT UU CEDI 0 000000 Video 000000 HEAD 0 0 00 0000 Video ASICQ Vide FPGAT D DH OU B B B UO W 7B BD B U DT D D D HK I MIO board
77. ation Length 77 Densitv z 593 Energy 2900 eV aD 20 Atten Length microns 1d 0 20 4t BU 80 Grazing Angle deg 5 1 Attenuation Length I 000000009000000 15 P LB P iB 2 5 3 Grade Grade 1 LH E EL EJ EJ ET ET E O0 Garade 0 00 00000000000 mini COD DET EDU Grade Grade HL BU B D HL E D LU D D D EE D D HEU KD DE L Grade 3 Grade 40 0000000000000000 40 7979 00 00 40 8070 0 D 40 66 0 0000 40 48210 0000 41 05 00000000000000000000000 Grade AU Grade 000000000000000000000 0000000000000000000000912000000000000000000 00000000000000000000000000000000000000000 hhi EH 0 0 00000000000000000000000000000000000 52000000000000000000000000000000000000 HIHI ER E Le ENED ENE LL
78. d as background based on the grade scheme In order to overcome these drawbacks we try to suppress the extension of the electron cloud by applying a magnetic field perpendicularly to the CCD surface Because the electrons tend to move along the magnetic field it is expected to reduce the extension of the electron cloud We estimated magnetic field strength required to affect significantly in the extension of the electron hole cloud with the parameters of CCD used for the current experiment We found that magnetic field of 2 4 T is necessary to reduce the size of the cloud by 1096 As it is not easy to apply such strong magnetic field to the CCD we manufactured a simple magnetic circuit using permanent magnets It turned out that only 0 3 T could be applied to the CCD with the magnetic circuit We used a BI CCD with a depletion layer of 200 similar to those used for AS TRO H and applied magnetic field of 0 3 to see how it affects the energy resolution and grade branching ratio using the radio isotope Fe We found that the energy resolution improved marginally from 238 3 4 9 4 8 eV without magnetic field errors are in 90 confidence limit to 225 4 5 7 eV with magnetic field if we take only the single pixel events We also found that grade branching ratio of Grade 3 and Grade 4 both are horizontal split event symmetrically changed depending on the direction of the magnetic field This effect was different from what w
79. e expected but was certainly caused by the magnetic field Because the ratios of grades 3 and 4 did not depend on the number of vertical transfer we excluded the possibility that the changes of grades 3 and 4 are produced by charge spill during the vertical transfer However they may be produced in the final transfer from vertical register to the horizontal one where channel stop is not effective No significant change was recognized in the grade branching ratios of Grade 6 and Grade 7 the former has smaller charge extension than 2 x 2 pixels while the latter has larger extension and these two grades are sensitive to the size of the electron clouds Though the experiments we demonstrated that the externally applied magnetic field can suppress the diffusion of electrons in the CCDs and can improve the energy resolution Moreover we found clear evidence that the magnetic field affects the movement of electron clouds in the CCDs This method may be useful to develop future X ray CCD cameras O 10 1 1 12 U 20 21 2 2 2 3 0 3 1 3 2 3 3 3 4 O 40 4 1 CCDU utl gt quiu HN cede Bie ee eh SCC aes qe Gc de 000000000 a D LS S ok EE BETAINE vee hase eee ee 5 asun 3 2 ERS EE p AS eS SS Pse XU CCDUUU GOD cca seme ectetuer
80. ee D ERE E 1400000000000000000000000 1 40 0 00 Grade 1 Grade 0000000000000000000 0 CCDUUUUUUD L BHI As 0000000000000000000000000 00000000000000000000000929 70000000000000000 EE DEDE EGET Grade 11 Grade 50 Grade 70 00000 Grade 20000 Grade 4 0 0 0000000000000000000000000000000000000 0 000000000000000 8380000000000 ES 000000000000000000000000 FADE CDO BEES 0 000000000000000000000000 Grade Grade 50 Grade 70 D I 000000 Grade 40 Grade 0 0000000000000000000000000000 40 0000000000 0 0000000000000000000 BIR AR 2 ee e ED EP EDDIE EET ET 1000 Attenu
81. g 5 9 5 23 227 8 IS 6 5 5 23 235 3 14 6 14 7 nog 5 9 5 21 236 3 LAG 4 5 5 6 5 5 21 224 3 4215 3 68 107 107 Counts sec ADU 107 500 900 1000 1100 1200 1300 1400 PHA ADU Au Bg T Pep Counts sec ADU 800 900 1000 1100 1200 1300 1400 PHA ADU 0 4 32 0000 Crade 00 000 00 00 000000000000000 000000 PHAD counts sec ADU 4 11 0000 CITT lo CTI Error lof Unit nog 0 3 0 5 107 nog 2 7 1 1 1079 I 0 1 3 0 7 107 Um 0 8 0 7 107 nog 1 1 0 7 107 69 Counts sec ADU 800 900 1000 1100 1200 1300 1400 PHA ADU yw 107 lt 3 104 3 e 800 1000 1100 1400 PHA ADU 102 D lt 10 5 3 105 800 900 1000 1100 1200 1300 1400 433 0000 Grade 00000000000 O0 PHAN ADUNO lcounts sec ADUID 0 01 0 01 lt 10 lt 10 5 10 4 5 10 4 Q 10 gt 10 gt 800 1000 1200 1400 800 1000 1200 PHA ADU Grade 3 0 01 0 01 a lt 103 lt 103 2 y P t S 104 S 104 3 5 10 gt 10 gt 300 1000 1200 1400 800 1000 1200 PHA ADU PHA ADU Grade 4 Grade 5 0 01 0 01 a lt 10 lt 10 107 107 Q 10 gt 10 gt 800 1000 1200 1400 800 1000 1200 PHA ADU PH
82. ignal Level ED E E E D 0 155 bit DOO00000000000000000000000UDOD VideoFPGA 0 0000 00000000 00000000000 ASIC MNDO2 O O O O MND02 Floating Level Signal Level 0 0 35000 000000000000000 7000000000000000 1 odd even 000000000000 Video FPGA 1 0000000000 board Video FPGA 4800 Video Field Programmable Gate Array FPGA TD D DU D U UU HU 7 HU Video ASIC 00001 0000 4095 0000 digital 0 00000000000000000000 MIO i19 MIO board 0 4 9 MIO board D D 0 0 0 0 12 bit digital 000000000 Mission I O board MIO board O 0 0 0 0 0 MIO board 0 0 0 0 0 0 0 Video beard I 000 00000 0 0 000 00 0 0000000000000000000000000000000000 46 111111 2 CS Bigi s e 1 7 4 i 2534 j 5 gag ES
83. ti ADUD PD 0 0 0 ADULI LLL CCI ER ET EE DEP EB ER EDI ED HEUTEN CCD EE HE TITI T IIUDDUDUDUDUDUUDUDUDUUDUDUUDUDDUDUDUUDUDUDUDDUDUDUDUDUDUDUUDUUDUDUDUUDUDUUUDUI Over Clock Region UU Over Clock 838000 uuusiingugececbiiuuiuutututLlutlituu OUUUUUUU Over Clock Region Floating Level 0 Signal Level 0 UD h 0 400000000 0 00000000000 1 Digital Number DN DDDDDDD 4 0 0 0 channel 0000 0 L 000000000000000000 L LU LI L LU LI 20 OG Output Gate voltage RG Reset Gate clock RD 12V qui ge RD Reset Drain voltage P OD Output Drain voltage Si 2 20 OS Output Source t JI 052 9 SOC MOS FET 1 Ai u Source Follower SG CDN E MOS FET 2 gt Lu OS 1 RG zu 3 2 Floating diffusion WERT Vy RD 2 4 GER SG Low RG Low P1H High RD 12V OD 20V MOS FET 1 PIH SG OGC5V MOS 2 x lll
84. with Touched Corners Grade 5 L Q L Shape and Square Shape Detouched Corners Grade 6 maximum level pixel larger than an event threshold A pixel larger than a split threshold which is included for the pulse height computation a M A pixel larger than a split threshoid which is not included for the pulse height computation 3 16 00000 00000 0 0 0 00000000 ASCA FEE B BE EL LE UI D 0 00000000000000000000 Grade Grade OU 20 30 40 600 5000 000 0000 22 7 27 ACIS Flight Chip Filter Transmission vs Energy Solid 15 Dot S3 0 5 ACIS QE 0 1 0 1 1 10 Energy keV 317 CCD QE Chandra ACIS 0000000 BIOUUU FID EL U U 7 7 D U U U 0 0000000000000000000 0 000 0 000 i3 3 1700 NASA 0 0000 Chandra CCD ACIS QE QE D 3 3 2 UUU uggugagagaggaugugugapuunuuggadggudggdgududtuatutau G eV ADU GS 3 15
Download Pdf Manuals
Related Search