Home

運用ガイド - アラクサラネットワークス株式会社

Contents

1. pss gt enable password Changing local password for admin New password New password 522 1111110011 H adduserggog0080000008000000000000000000000000000000 000000000 O 54 newuser gt enable 074 3 8 gt 23 adduser V eie LIN P HAU EEAZUEY 8 Retype new password ert lt 2 8 7 038 8 5 2 gt 3 Add user newuser y n y SEIT NKAH KENKEN E AU quit IFE EMS DAME X WRAALEBRIZI VEERLES EAJ LEBA HYRE nEtA OOO RADIUSQOOUOOOUO RADruvsSOOOOOOOOOOOOOOOOOOOOOOOOOOO 523 operator 524 41 5 0
2. STATUS O00000 Og pao pad0 000000000000 D LL 1 1 free standby 0000000000000 AX7800R J JOGO 1 11111111 OO JOO LEDOOOOOOOOOO STATUSOOOOOOOOOO 1111111111 1 813 000000000 AX7800R DoODoODo0 0000 0000000000000 000000000000 go 888 Hug 1 show systenOOOOOOOOOOOOOOOO duplexQO000000000000 simplexQOOO00000000000000000000000 auto_duplex 0 O0 duplex 20000000000 set mode auto_duplex O set mode duplex 1 E B UL E 2 080000000 skowsystemp00800000000000000 00000 3 D D D D U I U U U 2000000000000 OU 8 free standby 0000000000
3. po00000000000000freepodoo0000000000000000000000000 Nip 10 1 9 08000000000 10 Line 0 1000000000000000 00000 000000 test interfaces no test interfaces HH H1 B 1 D H D H D B D 0001 gt close nif 1 line O Enter Dun test interfaces nif 1 line 0 network line Enter 000 gt test interfaces nif 1 line 0 connector Enter 00100000 000010001 gt no test interfaces nif 1 line 0 Enter 000 gt free nif 1 line 0 Enter pod00000000000010NIFgo000000000000000000000000000 pod odo odo 0000000000000 00000000000 000000000000 0000000000 00000000000 4
4. Jal 000000000 0000000 000000 PRUD NIF O Linogn 000 D 000 00000 000000000000000 OD show ipv6 interface 0 00000000000000 up down 0 0000000000000000 0008 81 000000000000000 0000 Hea D 0b0 0000 DHCP O 1 1 lt show ipv6 dhcp server statistics D 0 OO O O O show ipv6 dhcp server statistics OOOO DO DO DD OD OD DO 00000000 00000 dhcp6 server 0 9 11 1110 11 110 0000 0000 gt show ipv6 dhcp server statistics gt lt show statistics gt dhcp6_server doesn t seem to be running 2 1 10111 00 0 1111 1 1 230 8 0000000000 show ipv6 dhcp server statistics OO ODHCPQOOUOOOUUU00000000000000 p00000000000000006 68 lt 0200000000 0000000000000000 podpo0 000000000 0000000000000000000 8192000 1 DACPPO 00000000000 0000000000000 show dhep6
5. 0000 0000 1 00000 0000000 MCO000000 MCO0000000000000 000 0 show 0000 0 0 00 000 00000 340 0 0 me connectO 0 DDD D D 0 0 0 0 00 0 0 0 0 60 0000000000000 1400 000 00 00 0 00 0 00 0 0 show 600000000000000 140000 100000000000000000 2 00000 0 00 MOCO 0000 000 00000 00 0 show 00 00000 0000 000000000 MODDDDDD meconnecth 0 0 0000000000 6 0 0 0 0 0 0 0 show mel 00000000 000000000000 815 MCOOOOOOOOOO 10 0900000000000000000000000000 1 pg000000000000000000000000000 0 100 00000 1175 6 3 00000000000099000000 2
6. 8 000000000000 00000000000 00000000 000000000 600 6 00000000 VRRP O 0 0 Advertisement 0 00 Advertisement 0 00000000 00000000000000000000000000000000 251 8 0000000000 O 00000000 DD O 7 00 00000 show tech support 0000000091 000000000000 00 000000000000 VRRPgo0g00000000000 show vrrpstatus detail 00000 show vrrpstatus statistics cat var log daemon log 0 O lusr local bin vrrpstat Z primaryMC usr var vrrp vrrpdump B DB D fusr local bin vrrpstat X QO 0 0 usr local bin vrrpstat X sendcmd dump portmap gt primaryMC usr var vrrp vrrpportmap 0000000 usr local bin vrrpstat X sendemd dump l2talk i gt primaryMC usr var vrrp l2talkdump 0000000 O 8 122 6 1
7. 00 000 Hayes D ATOOOOOOOOOOOOOOOOOOOGO AT amp F amp C1 amp D3E0 amp K3Q1S0 2 amp W0 amp Y0 amp V 1 000000 eRMpopb000000000000000000000000000000000000000000 4ro0000000000000 Ar000000000 podgo00004rg00 00000000000 000000000000000000000 000 Hayes D ATOOOOOOOOOOOOO 1245670000000 AT amp FE0 amp 81S0 0S2 255TD123 4567 1234570000000 AT amp FX3E0 amp 8180 082 255TD123 4567 0D 0000000000 124670000000 0000 AT amp FX3E0 amp 8180 082 255TD0 123 4567 122 al bb telnet OOO ftepg0000000000000000000000000000000000000 00 Windows Telnet O0 000000000000000 Windows Telnet 0 0 000000 Telnet 0 0 000000 D Windows Tenet 0 0000000000 Windows 0 O00 DO OFFONp000OCOCO0C0O00OOOD 1
8. 1 1 1 8 36 0 D 00000000 DD D 1 1 1 11 1 1 10001 00000 1 080 0 010 0 gd 10800000000000000 1 11 200 300 1 2 0000000000 1 snp 080000000 61 00100 000 00 0 8 IP v8p000000000 gado do 0000000000 0000000000000000 00000 000 0000 IPvenDna nDnD DD pmgipv6 0 0000000 080000000 400 1111111111 show vrrpstatus detal 0000000 0 0 0000 000000000 0 0 4
9. 48 QOOOO 36 37 49 O0000000 39 51 0000000000000000 40 41 00000000000000 52 41 521 Q00000000000 41 522 41 523 41 524 42 525 42 526 53 527 55 528 58 53 0D 58 53 1 58 532 5 4 59 54 1 16 48 0 0 0 00 59 55 000000000000 61 56 64 56 1 DD 64 562 00000000000 780080 64 66 57 66 571 58 AX7800R 67 581 67 59 0000000 P0000000 68 1111 1111 1 11 1 1 71 61 100 00000 000000000 0 72 614 72 612 72 6 13 POSOOOO0U00000000 75 62 000 3000000000000 77 621 IPv4D 00 0 0 0 0 updowng 0 D 77 622 6 00 0 0 0 0 updowng 0 0 0 77 623 LI HL 1011010100 000 77 63 IPvM4Q0000000000 79 634
10. 2 1 Flag 300 show ipv6 static route Flag BFDOOOOOOOOOOOOO 400 Flag Pol DUDU BFDOOOOOOOOOOOOOO 500 3 Status 1 UnReachable ICMP u 1 show ipv6 static gateway po0000000 4 Status 0 0 0 Down show ipv6 static gateway 1111 0 1 20000000896 B Dp0000 0000000 OP BFDITI Hl B B DL B D D Status 000 Refuse 0 1 B BED E D d t 5800 000000000 000000 8 dump protocols unicast all 11 1 000000000 0000000000000 primaryMC var rtm 000000 rt trace rt dump gz
11. IPN6DHCP ON 1111111111 cL DD 010 u pupnugupnupnupaspnungoungpnunupupnugaupnunupupnunupna ngapnapanpnanp 00001Pveg0000000000000000000000000000000000000000000 00000 1111 1110 110 06400000000000 D00000000000 0 IPve IPv6 00000000 I ve 000000 00 0000000000 640000 8 6400000000000 DO0D0000000000000 325 00A 0000 0 15 15 s sSOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO LLDP Link Layer Discovery Protocol MIB Management Information 58561 0 E MLD Multicast Listener Disco
12. 1111101011 0 1111111100 uu 922 zmodem H HH BLU HE BE HE BE BE HE HE DT 11 1 1 a 00 0000 1 0 0 0 0 0 0 0 0 0 0 00 00 0000 00 00 00 zmodem J ooooooooooooooooooooooooooooooooooooooooo 000000000 p18 00000000000 0000000 ues gg900000000000000000 gt cd var dump gt zmodem put rmdump amp 2774 VO 000000000000 gt 279 9 OOOO 020 O96 show logging gt log txt gt show logging reference gt log ref txt gt zmodem put log txt lt T 04D 7 4 VOS 0 lt zmodem put log_ref txt 000000000000 gt 9 7 0 e ees CC 27 AARET OT E ERR interfaceControl core nodelnit core 2774 VINE LE REIS MELETT gt zmodem put interfaceControl core IFA MOE 70 gt zm
13. OSPFv3g OSPF D D UU 000000 OSPFv3 D Ver 10 70000 000 888 01 0000000000 Line OOOO 10008 88 8110000000000 000 Ver 10 5 000 D Ver 10 4 000 Wm 00000000000 IEEE802 3ah UDLDQ 000000000000 IEEE802 3ab U
14. vi god0000000000000000000000000000 Tap 0 0000 0000000000000 4 pg0000 000000000000 00000000000000000000000000 po000000000000 39 0000000 0 37 pg00000000 config line line0 ehternet 1 0 line line0 ehternet 1 0 illegal parameter at marker config 0 3 8 00000000 200000000000 config line line0 ethernet 0 0 line line0 config type 10m full duplex type auto negotiation type 10m full duplex type auto negotiation illegal combination or already appeared at marker line line0 config 039 config line lineO ethernet 0 0 line line0 config type type A Incomplete command at marker line line0 config O40 00000000 0 510 00000000000 show interface 0 OO C D gt sh ip in Enter Tokyo flags 80e2 lt DOWN BROADCAST NOTRAILERS RUNNING NOARP MULTICAST gt mtu 1536 inet 10 1 1 1 24 broadcast 10 1 1 255 NIFO
15. 2 000000000000 show 1pv6 route s0 1 00000 show ipv6 dhcp server binding J 1 1010 0 0 8 25 1 oo 000 binding 0 OOOO D OOOO D OOOO DO 2 D OOOO DO 2 D OOOO DU 102 OOOOOOOOOOOOOOOOOOOO 826 0 1 Eo Jal ola Jo alo al a Uuuuuu 0 HET 01 ED JO ED LED TET 101 CI But ug Uu uut AX7800R pod0 0000 O O x A OOOO OOOO OL U LH U LI U AUgBDggaggagdggggBeupuggaggagpggagggagggaggaagagagagagu x000000 0000 0000000000000 000000000 000000000000 Dad 0000000 000 DHeP po 000000 000000000000000000000000000000000 po0000000000000000 show ipv6 route 00000000000 U88 gt show ipv route s Total l0routes Destination Next Hop Interface Metric Protocol Age 3ffe 1234 5678 48 tokyo 0 0 Static 45m lt Active
16. aos n0 Dun 317 9 OOOO 318 0 fret d 00d a fe 000400000000000100004000008000000 0 000 0000 UDDDDDDDDDDDUDDUDDDBDBDDDUDUDDDUDUDDDUDUDBDUDDDBDDUDUDUDUDUDU 000000000000 NIFDO 10 Lineh D 008000000000 NIFOO 10 Line 0 1000000000000000 test interfaces no test interfaces 00000000000 00001 gt close nif 1 line O Enter 0001 gt test interfaces nif 1 line 0 network line Enter 11 gt test interfaces nif 1 line 0 connector Enter 00100000 D 001100001 gt no test interfaces nif 1 line O Enter 00001 gt free nif 1 line O Enter 88 00000 11111 11 1
17. 3 CONFIG 00010005 0100 000000000000 There is mismatch between active and Standby configuration PRU 000000000000 swapbcu 5 CONFIG 00010001 0100 000000000000 BCU swap suppressed temporarily There is mismatch between active and standby configuration 000000000000 STATUS CODE 0 010 0 0 0 OO EMA SUPPRESS LED 1 B DL D D D O 0 0 STATUS CODE EMA SUPPRESS 12 swap buQlOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO save l copy startup configQ 0ODOD00000000000000000 000000000 44000000 D D copy startup configd YODO DUDU
18. NIFOO 10 Lmeg o 080000 100000000000 NIFDU 1 0 lineQ 000000 test interfaces no test interfaces 1 D H D B D 000 gt close nif 1 line 0 Enter 313 9 OOOO 00001 test interfaces nif 1 line 0 network line Enter 0001 test interfaces nif 1 line 0 connector Enter 0100000 0000110001 no test interfaces nif 1 line 0 Enter D free nif 1 line O Enter V mV v O Op pod00000000000 010 NIiFpo0 000000000000 00000000000000 000000000000 00000 04d 00000000000 0000000000 poda 0000 000000000000 000000000000 00000000000 00000000000000 0 80 fret d 00d 0000 0 0808 9009080080980080 980080 9 080 9 9 08
19. 0 8 34 1 OOOO unagmunp 1 D VPN D 811 2 VPNMPLSO OOO 8 11 3 2 5 EoMPLS L2 VPN O 000000000 0D000000000 0 8 11 4 EoMPLS L2 VPN y 0 dopo do 000000000000 8 112 VPN MPLS I LI O O LU O10 MPLS UI 0000000000 LSROGOOOOOOOOOOOO S 00000000 ping mpls traceroute mplsQ 0000000000 LsPOOOOOOO 000000 Dei O20 0 vVPNMPLSOOOOOOOOOOO VPNMPLSIJI 244 8 0000000000 8 9 D VPNMPLSU I Pv4 58 FJL gt 47 2 23 6 4 16 83 59 BBR 9 2 11 6 IPvARERE DAE US IPvVALT AR Y TOR IPVA Hfelkstatic 158
20. 00020000 BC40000000000 Be4p000000000000000000 100000000 80 1 1 0 0 0 000 freestandby 000000000000 gt free standby Enter poda 00000000000 000000000000 000000 0000000000 Main Menu gt gt Action gt lt ACTION gt gt FREE standby 000000 see goo000000000000000000000000000000000 set mode auto duplex Enter set mode duplex Enter show system 0 po000000000000000 Duplex ModeDOOOOOOOOOOOOOOOOOOOO 00 show system 0000000000000000 0 O 9 28 show system 0000000 show system System AX7808R AX P6544 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location Node Info uplex Mode gt EA Duplex CEE BCUO Active RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON O times restart BCUT 56 RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 43 Power ON O times restart 000000000 0000 00000 1000 MCpD0 00 Bego 0000000 298 9 0000 00000 og
21. 0 0 uui 0 0 0 1 1 10 Line 0 100000000000000000000000000000000000000000 00000 u uuu test interfaces no test interfaces gt close nif 1 line O Enter uude gt test interfaces nif 1 line 0 connector Enter 00100000 gt no test interfaces nif 1 line O Enter gt free 1 1 line O Enter 9 0000 00 0000 1 11 1 1 00 0 0 448 STM 16 POS 40km 00 19986 STM 64 POS 40km 00000000000 oepoepadga dao 0000000000000 00000000 0000000000000 111 1 00 OOOO 58 No pogo OOOO abri OC 48c STM 16 POS 40km 15 18 1 OC 192c STM 64 POS 40km 50 11 2
22. OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOAO gag RADIUS 5 11 RADIUS Qj Attribute Type Attribute Dna 25 Class Class 00 00 00000000000 0 root allcommand noconfig nomanage noenable 46 5 00000000 Type Attribute og 26 Vendor Specific ALAXALA Allow Commands uggggggga Vendor Id 21839 Vendor type 101 1 11110 1008 000000900090000000000000000 D 0 D ALAXALA Allow Commands show ping telnet O ALAXALA Deny Commands Vendor type 102 10000000000000000000 00000 1000000000 0 0 ALAXALA Deny Commands enable reload close kapmusSOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 11 dictionaryOOOOOOOOOOOOOOOOO 0 58 8 0 51110111 0 0 009 dictionary 0 000000 VENDOR Alaxala 21839 ATTRIBUTE A
23. 600 1 100000000000000000000000000000 6 ugaunarsiuguagdaaeatru dump protocols unicast all 1 1 ux U G primaryMC usr var rtm rt trace rt dump gz 8 6 6 8 0 1 1 I H OP BFDU cog0000000000 0000000000000 OSPF000000000000000 BFD 0 824 8 000000000 DD 1 Remote Address 200 show bfd session ip Remote Address lt 300 217 8 0000000000 00000000 od 2 0000000000000 0000000000000 D bfd all e O 3 c Sl S o ct o 6 gt m m 3 00000000000 DD Init OO AdminDownQ
24. 2000000000000 0000000000000000000000 D 9 13 000 SURGH SSBCUZR FICMS MCE GER 2 2 SANTOMEA LE IT Z S ESIC MS256 BCUR FOX y ESL 8 86 FOR Y ftit 000000 0Ng0000000000000000000000000 0040000000000 00000 00040000 Bcunpnann 000 80900 0000000000000000001M00 0 3070000000 BUD OD 00000 free standby 000000000000 gt free standby Enter go000 0000000000 000000000000 00000000 00000000000 Main Menu gt gt Action gt lt ACTION gt gt FREE standby 000 00000000000 se 0000000000000000000000000000000 show system 0000000000000 gt show system Enter show system 285 9 OOOO 9 14 show system 0000000 show system System AX7808R AX P6544 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location 8000 Active RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON O times restart 8001 EH 00002 80 l standby
25. 0000000000 084 podo0000000000000000000000000000000000000000 DO U Ppgo000000 0000000000 show mplsldpQ 000 detal 000000000 Basie LDPOOOOOOOOOOOOOOOGO po00000000000000000006 91 p VPNMPLSOOOOOOO D 60 Basic LDP policy base static LSPOOQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO po000000000000000000 show filterflw880000000000000000000 pog0000800000000000000000000000000000M06 91 D VPN MPLS 0 8 11 3 IP VPN 1 D D HH E 1111 O10 IPVPNgopo0000 000000 000000000000 0000000000000000000 247 8 0000000000 8 10 MPLS2 AIL SERES 6 8 11 3 2 BFR y MPLS S 7 2 FO 3885 8 7 8 EE A 838 2 16383 6 8 11 3 4 98 3EVPN MPLS3 E ERES 6 8 11 3 5 3EVPN MPLS3645S O eS Ae SIRI T HET gt 5 3EVPN 52515 AUI BT 3EVPN MPLS IE Id
26. 000000 ID MIBOOOOOOOOOO IDOOOrootaOOOOOOOOOOOOOOOOOOOOOOOMBOOOOOOOGO 328 00A 0000 1 0 1111111171 BE TH 0000 gapod0 000000 000000000000 1000000 1000000000000000000000 TOPIIPD 0 000000000000000000000000 88 00000000000000000 000000000000000 0000000008008000000000000000000000000000000000000000000 0 000000000000000000000000000000000 0 000000000000000000000 100000000000000000000000000000000000 0 00000000000000000000 1000000000000000000000000000000000000000000000000000 0000000000000000000 MCO00000
27. 0 O O O O 0 O O o oo Lr LE 0 00 a Ex D D D D D 199 8 0000000000 lt 22 LARA UEP TZ LAO show logging v 7 Feshow ip interface v v kick 5 DEE 4X gt 2 2 gt 3 5 50 5 5 KUA AL KARI pinga lt gt Kick 2 05 0 1272 ye NRE BX U T8 5 1 WESTER Etik IRT EEL 5 06 BERERA FZ THETH Jv 5 E CBE RT 2 L show ip arpa FI8 k BA show ip routen YY FIZ amp amp 7 ERE ROVER KDA kk EX PRS L Gees 500 4222 KI RIP OSPF 888 E ORS ARIE TIREN HERE OIPA REE ALTESO 4 TykR7 24253227r A0 HERE CEA G TEL 2 2 ZQoS DHCP BOOTPER HERO NFR LIE BED 1 ERE T ER OD MEAR L r ZzrzzFk7FL AOE D al c0000000000000000000 showipinterfaee 000000000 111101010000000 0000 000851 000000000000 O by UD
28. 1 e 0000000000000000 Port ID O00000 Port ID 8152 0 1 1 1 0000000000000 oADPpo 000800000000 0000000000 000000 00000000000000 00000000000 269 8 0000000000 8 39 00000000000 D 188 D 1 showoadp 0 00 0 00 OO OADP Enabled 0 0 0 00 200 Status DisabledQ OOO OADPOOOOOOO00000000000000 2 show oadp 0 0 0 0 000 Enabled OOOOOOOOOOOOOOOOOOOOOO3OO PortiQlOOOOOOOOOOOGO 00000000000000000 3 show interfaces 0000000 activeup 1 BH HH B 400 084 4 8 0 0891 00000000000 0000 now now now now now 7517 now now ES EE 1 1 1 ELIT OO pan L3 r3 r3 Eu 5 1 E r3 r3 r3 EME 270 8 0000000000 8 16 DI IL 8161
29. 3 show interfaces 000 0000000 DUDU 6000 80 40000000000000000 1 111 1 0 00 5000 8 1 400000 1 111 1 0 OOOO 1 111 1 0 RS 00000000000 nnnnmn D Uu 1000BASE TOH 00 000000 Down shift 4 show interfaces 000 0000000 00000 0000 Voll 4 2 1 10BASE T 100BASE TX 1 111 1 0 D 0000 1000BASE T 0000000000 11 111 1 0 11 111 1 0 MDI cross over changed 5 show interfaces O Line detail 00000 Lineg a mm E 0000500080 40000000000000000 1 SGB 00000000000 00 Line 0 00000000 0000000 0000000000 Enel typed 0000000 000 5 SER color 1528 81069 ESE ELE 000 D 000 D 00 OO 00 00 soo Pp o rrr 174 8 4 3 8 0000000000 1000BASE X 00000000000 1000BASE XQQOOOOOUU0000000000000000000000000000 1 00000 2
30. 90 Vol 2 14 00000000000000000 3 1 show ip showipd 80 0000 0000000000000 show ip interface Hl D D D D show ipv6 interface 1 D D 1 1 8 0000000000 83 DIDLUL 83 1 DODO DO DD 0000 00000000000 3000000 8 32 0000000000000 000 primaryMC var dump 0 RMO CPO PRUO NIFOOOOOOO pog0000000000 000000 00000000000000000000 primaryMC usr 0000000000000 00000000000000000000000000 10 0 0000000000000 5 00000000000000 GrimayMcooo MCO000 000000000000000 v2 1238 00000000 080 1 po0000000000000 show dumpfile JYDODODO00 0000000000 0000000000000 8 2 0 gt show dumpfile BCU0 Active MCO Primary Slot primaryMC var dump File Name cp00 000 Date 2005 08 03 15 52 2 Version AX P6544 11 9
31. 0 000000 1024000000000 1025 0000 00 0000 000000 000000000000 000000000000 uuu 2000000000000000000000000000000000 0 00000 oo OO Deny Commands 5 11 ALAXALA Deny Commands 7 ALAXALA Deny Commands free test Y 1024 CH LEFT AEE GC LELODeny Commands SB L 7 38 amp IX FIO K 5 BOT 00586 5 61706 FORICIYY NES Deny Commands close reload free test by 000000000 TAcacs p0000000000000000000Tacacs p0000000000000000 5 12 TACACS Attribute Value Service Attribute Value grlogin class d noconfig nomanage noenable B B 3 allow commands m OOO allow commands show sping telnet 48 Service Attribute deny commands un Un DIE E EEE 0500 01 L3 L3 r3 r3 L3 r3 r3 000d 512 user staff
32. 1 QOO0000000000 2 show ipv6 neighbors i 3 4 IP 1 00000000000 2 show ipv6 route O0 000800000000000000000000000000 3 podd0 00000 000000000000 000000000000 00000829 IPvego00800000000000000000000 DU DU a Lr or a D a a a a a DU 00000 ADD a DUUDUDDDDDDBDDUDUUDUDDDBDDUDUDUDUDDUDDDDDUDUUDUDUuDU a 0 O 0
33. vo 3 000000000 Dpu gnuugapnua anuunuaununnuapupnpnugapupnpnauaapupnpnagapgapnpaabou DO DO 10 BCU PRU I O l BCU PPRUD OD 0000000 show systempDO000 0000000000 61 5 00000000 1 20 pj 5 30 8 gt show system 2003 01 11 19 30 15 System AX7808R AC AX P6544 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location Node Info Duplex Mode Elapsed Time 00 01 35 PRU Resource router b1 IP Routing Entry Unicast current number 5 max number 256000 Multicast current number 5 max number 8192 ARP current number 2 max number 128000 IPv6 Routing Entry Unicast current number 2 max number 32000 Multicast current number 5 max number 8192 NDP current number 2 max number 32000 FAN Active No FANO 1 FANO 2 FANO 3 FAN1 4 FAN1 5 1 6 Speed Normal POWO Active POW1 Active POW2 Disconnect POW3 Disconnect BCUO Active RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON 0 times restart Lamp ACTIVE LED green READY LED green EMA SUPPRESS LED light off ALARM LED light off ERROR LED light off SYSTEM OPERATION PANEL No error Board CPU Intel Pentium 3 850MHz Temperature Normal 27degree RM Ether unused CP CPU Active Boot 2003 10 11 19 27 42 Power ON 0 times restart Board CPU RM
34. 8 11 11 10101 LU mii wll 00000 000000 00 mil Copyright c 2005 2011 ALAXALA Networks Corporation All rights reserved OOOO Ver 10 10 Rev 1 Uuuu 000000000 327 CHPODODO 000000000 000000 e 0000000000 0000000000000 0000000000000 D Ver 10 100000 lU 0000 cup 0 OSPFv8 PD D Ver 10 99 000 OSPFv3 0 0000 0 H H BB Bt t
35. 9 po000000000000000000000 show ip interface 0 0 D D D U Ddwnpn gpaugnugpnugnnugapupnnusse 0000000000 O D 1 0 O 0 O H O N ga Oo 0 bl d a et 5 4 1 E an E Oooo EJ Ed Er UEM up p ME OO oO Oooo rcr oO Oooo t EE KN E EE El S E Fede HH EE 0 O 0 0 oo cr Dg n po on oo gt ooo Pace l C ESI O O E EX E Ed 00 D D D DE 0000000pm800000000000000000DHcP pod000000000000000pm80000000000 000 raspod000000000000000000000 po0000000000pmg800 0000000000000 pod 000000 0000000000000000000 Oooo Oooo oO Oooo ET ET E Ooo oO Ooo eE 58 22 Ooo Lr 0 O 0 alt 0 01 EE o EI EJ ES E Ea q q oO OOOO a 1 5 Mg jen 00 0 50 08 oO 53
36. command 24 AAN OU 1 1 1111 111 O O OOOO ID ENTRO OO LI FWRD O i 0 0 00 BACK 11 0 OOO 0 lt Main Menu Action O00 lt ACTION gt Close NOOO OU UU OU UU L 0 OU L3 close ENTR 0000 O 0 0 UD 0 UD um OOOO 0000 OOOO OOOO 0000 41 0000 4 2 60 0 0 43 CPUDDDUDU 44 45 0000 4 6 0000 4 7 4 8 4 9 E tE ES El p E D D 0000 25 4 000000000000 4 1 DOUG lt Main Men gt OOUOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOG OOOOOOOOOOOOOOOOOOOOO ENTROOOOOOOOOOOOO Main Menu OOO Main Menu 0 00000 04 1 000000 lt INFORMAT I ON THEO XE EATS Line B R CPU FASE Memor y E HZ Version A 8 EFA DEIR lt ACTION gt 31150218 41 5
37. po00000000000000000 fpO 000000000 9 2 3 show tech support O O D 9 1 show tech support 0000000000 minii 0000 Hunu O O 11111 11 O O 1111 1 1 O O 1111111111 1 1 O O MC 000000 QoS D O D show tech support OOOO 00 00008000000000000000 detal 11101 010000000000000000000000000 9311 O00000 00000000 000 0 0 019 00000000000 00000000 0 9 2 fpOOOO00000000 1 get E B DB B U 0 1 show tech show tech support LH 2 show tech detail show tech support detail 00 00 274 9 0000 091 client host ftp ax7800r te00000000 ax7800r ftp Connected to ax7800r 220 FTP server Version wu 2 4 1 Tue Apr 1 15 33 09 JST 2003 ready User ax7800r none 1 331 Password required for staffl Password 230 User staffl logged in ftp get show tech show tech txt show tech
38. show gt show system Enter 00 0 00 8 0 8 10 101000 uut O 9 34 show system 0000000 show system System AX7808R AX P6544 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location 8000 Active RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON O times restart BCUI HEROE FER i Dan 0000000000 Standby OOO po0000000000 0 p 0000000000 Fault ood poego00000000000 000000000000 BCU000000 STATUSLEDOODO0D po0000000000000000000000STATUSLEDO 000000000000 0000 p00000000000000000000showloggmgQ 0080000000000 BCUOOOO D eli 0000000000 Closed OOO 9 9 free standbyQOOOO0000000000 gt free standby Enter 306 9 0000 D dl 00000000 Disconnect OOO BcUOOOOOOO 0000 O Configuration Discord 0 el 2 000Ax780R0000
39. 8 co0g00000000080000000000000000000000008000000000 Nrgodo000000000000000 NFOOOOOOOOO 926 8887 3 27 3 VOR oo FIRI NIFzR FERM E 0 FIR NIFzR FOR UHL FEB 296 9 0000 000 1000000000000000000 9 000 0000 1 100000000000 0 090 cosenmfp0000000000000000 close f nif NIF No gt Enter NIF No 00 0 Main Menu 2 Action gt lt ACTION gt gt CLOSE NIFxx xx 00 0 0 8 00 u 30 NIF D U UI U CI C 00000 0 0 STATUS 0 1 STATUS
40. 81 0000000000000 82 000000000 83 84 0 00 0 0000000008 85 411100000 86 IPV4400000000000000000 87 411 110 01 00000 0 OP MLTO 88 6 89 810 OP MLTO 8 11 MPLSQ 0 0 OP MPLSD 812 8 13 SNMP OOOO 814 0000000000000 815 816 0000 161 8 0000000000 811111111 EL 1 D D 8 1 1 DODODO 000000000000 ALARM ERROREEDpp0000000000000000000000000000000 1 2 show logging 0 812 00000000000 BCU00 srarvsOOOOOOOOOOOOOOOOOOOOOOOOOOO po000000000000000000STaruspoo000000000000000 5 81
41. D D OL OE UI UI UI D 253 8 0000000000 O oo D udid detection count B HH HH 1 600 6 ue 7 IEEES02 3ah OAM IEEE802 3ah 0 0 IEEE802 3ah UDLD IEEE802 34h OAM 000000000 gt OOO0g 0000000000000 254 8 0000000000 8 13 SNMP 00000 8 13 1 2 0000000000000000 1 SNMPv1 SNMPv2c 000000 OOOOOOOOOOOOOO 000000000 00 0 SNMP 1 SSNMP UU config show snmp snmp
42. 0000000000000 OOOO 5 41 NE1G 48TO0O 000000000000000 NE1G 48T 944 DODODO 00000000 0Ngo 0000 000000000000000000 OFF 0000000000 000000000 odo 00000000000 0000000000 00000000000000 304 9 0000 95 U 0000 10000 00 0000000000000000 00 09000000000909 8 0000 00000000000 95 1 MCOOOOOOOOOOO 1 1 00000000000 0000 MCO 000000000 8 T 10
43. oO Co L1 00000 oO L1 Co 331 UU UD D 10008 88 800000000000 175 10BASE T 100BASE TX 1000BASE T 0 00 D 173 10GBASE RO 00 10GBASE W HL LB DD D D 000 176 10GBASE W 80 80 0000000 UD 179 0 324 ASOOOO00 324 ASOOOOOOOOOOO 324 5 Br p0000000000001Pv000000 00000000000 91 Br p0000000000001Pv6000000 00000000000 4 8 9 0090000 0 0 0 217 910 000 00 0 60 239 BGP4 0 00000 324 BGP4 0000000 238 BGP4 0000000000 324 BGP4 Q 000000000000 113 BGP40 00000 324 BGP40D00000 216 BGP40000000000000 89 BGPOD00000000 324 BPDU D 11 1 324 C CLI 16 1111000000 42 11110000000 21 111 1 DU 14 1111 011 23 CLIQQOOOO00000000000cCuO000 OO 4 CPUDOO000 000000000 29 cPOOOOOOOOOO 324 DHCP BOOTPO0O 0000000000000000 324 324 DHCP DHCPOOU IP28000000000000 IPA po0000000000 199 DHCPpo 000000000 324 Diff serv 1 O O 324 DNSOOOOOOOOO 324 BNspop000000000000000 IPv4 0 DSCPO 00000 325 psOOOOOOOOOO 325 DVMRPO 0000 325 DvMRPOOOOOOO 96 DVMRP0 0000000000000 222 E EFM 00000 325 F 98 00000 325 fpP 000000000000000 276 ICMPO 0 0 D 0 0
44. 000 4660 000 1000000000000000000 000000000 000000000000000088880000 1 000000000 set exec timeout set terminal pager set terminal help set terminal warning level set terminal command literal OOOOOOOOOOOOODO 0000000000000000 CHO po 0000000000000 000000000000
45. show oadp Date 2004 02 24 23 08 25 OADP CDP status lt Enabled Enabled Device ID AX7800R 1 Interval Time 60 gt Hold Time 1809 E LIABA ELSE ignore vlan 2 4 10 PAESE 1 2 4 gt Enabled Port Total Neighbor Counts 2 Local VID Holdtime Remote VID Device ID Capability Platform 1 2 0 35 2 1 0 AX7800R 2 RS AX7800R 1 3 0 71 3 2 0 1P8800 720 1 RTS 1P8800 720 1 4 0 9 4 3 0 2950 1 02950 Capability Codes R Router T Trans Bridge B Source Route Bridge S Switch H Host IGMP r Repeater gt O20 000000 LOO UOUUUUU 11 U D O90 show oadp detail 000000000000000 400000 00 O 1111 Device IDU DUYU 0000 0000000000000 Device ID HO000000 D B U Remote UDUD ut ut JUUDUD 1 DUDU JOUOUUdUU 1111111101 1111 1 111 UOUUUUU 1 1 111 1 11 11 11
46. u 59 00000000 7 og 0000 reload 00000000000 uu reload reload og 05 10 1 11111111 11 H BBB tut staff allcommand 000000000 og guest OO reload TT close TI enable TT test show ip IT 0000000000 show ipv6 0 000 m0000 000000000 00 show ip 1 O show ip route 0 0 T O20 00000000000 0000 0000000000000 pogo gd ag000 090000 000000000000 00RADIUS 0 TACACS 101100 0 0 110 0 1 1 1 10 0 0 logout exit quit disable end set terminal show whoami 000000000 1
47. mana E oo E EE Iz i Peang 173 8 0000000000 OOOO od 1000000000000000000000000000 0000000000000000000000000000 0000000000000000000000000000 0 0 0000 no test interfaces LL 00000000 UD 0000000000000000000000000000 00000000000000097 0000000000 2 show interfaces 1 5000 80 400000000000 a 00000000 MUN LE ERI E TPE SERE IUE 0000000000 Jooooooooooooooooooooooooooog UOI a CRC errors Cad T ah ari aka kan jen bayer Voll 4 2 1 10BASE T 0 100BASE TX 1000BASE T Layer 2 symbol errors MEN 110000 8 0000 0 00000 Voll notest interfaces DO cr E A E EJ oO Cd CI El l E E L A CO CO Co
48. 000000 O PoSOOOOOOOOOOOO 000000 000000000 NetFlow Version 9 0 0 0 NetFlow Version 9 000 OO JOGO DG 00800080000000000000000 0 POSO O NEJODO dpado0 000000 00000000 Ver 9200 00 0 0000 D 000000000 NetFlow Version 9 0000 e NetFlow Version 90 0000000000 DUDU 03 3 22 262 1119 OOO AX7800RO Ax7700R0000000000000000004X780R0000000 x710R000000000000 Ver 1010g400000000000000000000000 0 osRpgopo000000000000000000000000000000000 000000 Ver 1610900000000000000000000000 Ver 10 10 Rev 1 podd00 00000000 000000000000 000000000000 pod 000000000000 00000000 000000000 AX7800R AX770R0900000000000000000 E 01 40 40 40 J 1 Oooo Oooo OO OO Oooo ET LE EJ E Oooo 0 O a a uu 780081 780081 000000000 77
49. Nbr Count DVMRPOOOOOOOOOOOOOOOOOOOOOOOOOGO 6 po0000000000000 6 O 6 45 show ip dvmrp interface 1 D Component Vif show ip dvmrp interface Interface 1 Address 192 10 10 1 Multil DVMRP 192 10 20 1 Multi2 DVMRP 2 Multi 192 10 10 1 Multi2 192 10 20 1 Multi2 192 10 20 1 amp DVMRPJL 4 4 BBE LEU Nbr Count BE JL 4 B0 0 6 0 00000 0 00000 000000 Nbr Bad Bad Kind Count Pkts Pkts 2 0 0 0 0 0 1 1 192 10 10 1 DVMRPJL 4 22 Bt L C US 4 12 Nor Count RE 2 42 DVMRPJL DVMRPJL amp DVMRP Probe A show ip dvmrp neighbor 0000000000000 NeighborAddress IP 1B B UD O20 0000 DVMRPProbeQ 0000000 97 6 000000 00000 000000 O 6 46 show ip dvmrp neighbor D show ip dvmrp neighbor Address Interface Nei ghbor Address Uptime Expires GenID 192 10 10 1 Multi 192 10 10 3 00 05 01 40 898492808 192 10 10 5 00 10 01 35 741551062 Multi 192 10 10 1 amp DVMRP L 4 2 amp A 192 10 10 34192 10 10 5 SBE L CU 192 10 10 3
50. 2 show qos ip flow interface tokyo1 detail show qos ip flow interface tokyol detail QoS IP List No gt 1 max rate normal Using Interface tokyol in ip source 170 10 11 21 170 10 11 30 ip destination any protocol ip burst size 3000Byte packets of 100000kbps and under priority3 discard4 7021 packets of 100000kbps over drop 729 QoS IP List No 2 Using Interface tokyol out ip source any ip destination any protocol 6 tcp port destination 20 21 ack check off syn check off hit packets priority8 discard4 11568793 D00000000000 tokyo1 QoS IP List No2 000000 00000 lt QoS IP List No gt 10 000000 3000000000000 000000000000 0000000007 lt QoS IP List gt QoS IP List No gt 10 000000 0 0 0 0 170 10 11 21 00000 000000000000 195 8 0000000000 QoS IP List 0 gt 1 0000000 packets of 1000000bps over drop 00000000000 0 000000000000000000 0 1 p00000000000 2 show qos O0 000000000000000000000 GosOOOOOOOOOOO 00000 qosOOUOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 00000000 NIFOO op Line D 180000000000 4 Priority 4900000000 000000000 1
51. e0000 CRC J e 000000 e 00000 active up 2 20048 CE 00000 DUDU LI 937 OC 192c STM 64 POS NIF show nif 00000000 NIFZ active 00000 000000000 000000 LineO active up 80000 309 9 OOOO e JO RDIDOD e C2 9 37 OC 192c STM 64 POS NIF show nif OO gt show nif 2 active o CUYAS C 2004 02 23 12 30 00 NIF2 ctive gt 1 port 0C 192c STM 64 POS retry 0 Average 0 20Gbps Peak OMbps at 00 33 25 11080 active up 0C 192c STM 64 POS 6 652 single mode 40km Average out OMbps Average in OMbps 2 active up gt 08 TE 310 9 0000 9 7 1 1 1 97 1 0 9 38 ARE ERE ES 2 IJL WEH 2 2
52. 000000 o0Nngog000000000000000000000000 000 20 PRUQ00000000 0000 8 NFEQO0000000 000000000 0000 podd00000000000000000 PRU No 0000 Pru free pru lt PRU No gt Enter 300 9 0000 Main Menu gt gt Action lt ACTION gt FREE PRUx x 0000 D 8 0 000 000 0000000000000 0 9 0400000000 OO ONOOOU NFDOD0000000000000000000000PRU 00000000 9 31 NIFOOOOOdO NIFzR FORA FIR NIFzR FOARS 2 S OOOO 000 10 0D NIF po00000000000 IFDUDDUU 000000000000000 5 4 1 NE1G 48sT
53. 000000 MIB wa 330 00A 0000 P0000 950000 8 DsePpo0000000000000000000000000000 1 Co L1 Co Co o A O 51 51 3 1 00g CO 1 1 CO CO CO CI LI CI 1 CO 1 CO CO CO El E 1 1 CO 1 1 1 1 C L CO A 1 1 Lo AE CO O LI L1 000 200000000000 000000 0000000 Bay Co ooo LE 205 Co 53 LH m Ed o go H mad D Tr LI LI 1 CO ig TEA DIL El Ez F J ES 1 CO LI ta 1 LI E DIL ESA LI LJ LIT LIII unu
54. oooooooooooomss1 000800 8 080088 0009009000 0 0 ping 00000000000 RADIUS TACACS Q OOOOOU000000000000000 00000 2 0000000000000000 0 RADIUS radius 0000000000 RADIUSQ 0000000000000000 0 000000000 00x00000 RaDrsgo000000000 TACACs 00000000000000000000 tacacs 0 0000000000 TACACS 0 0000000000000000000 lt 00000000000 gt lt TACACS 8000080000000 000000000000000000000 telnet D poo000000000000000000000000000000000000RADIUSO TACACs pg 000008000 0000000000000000000000000000000 p000000000000000000000 RADIUSO TACACSs p 000000000000 000000000000000 telnetQ ftp 00080000000000000000000000 00 RADIOS o000000000 RADIUS O TACACS ND 000000000000000 po00g0000000000000000000000 RADIUS TACACS OO00000000000000000000000 0 000000000 000000000 8 2 5 RADIUS TACACS 1000000 000000000 RADIUS TACACS 000000 0000800000000000000000000000000 000000 000000000000 000000 00000000 1 show whoami QO 0000 show wham OOO0O0000000000000000000000000000000 RADIUS I TACACS HOOOOOOO0000000
55. 9 351000000000 LINELAN 00000000 3980000000000 000000000000000000000 810 1000BASE X0 00000000000000 una show interfaces LL ES Ea LE 0000 0000 OOOO 0000 0000 n ink down Signal detect errors 000 od 0000 0000 od Vol 1 4 2 21000BASE X 0000000000 10000000000000000 Voli 422 1000BASE XU 0000000000 10000000000000 0 00 LUUD UD 100000000000000000 00 8 8000 Voli 4 2 2 1000BASE X0 0 000000000 1000000000000000000000000000 1000000000000000000000000000 1000000000000000000000000000 1 0 0000 no test interfaces 0000000000000 10000000000000000000000000 0 00000000000000097 0000000000 175 8 0000000000 una od od c D N m 2 o interfaces D 0 D 1 Voli 4 2 2 1000BASE X 0000000000 111 11 1 1 E3 EJ E3 EJ
56. bfd all e drm o ct o 5 gt m 400 00000000 000 880000000000 0 00000000000 0000000000 dump protocols bfd all El Un Un 0 000000 ux 000000 primaryMC usr var bfd 000000 bfd trace bfd_dump gz 240 8 0000000000 8 10 OP MLTO 0000 show pru resources 1111111 00000000 0 0 routerbii 0000000 0000000 8 10 1 PIMSMPO000000000000 10 PIiMSMO 0 RARE Gl AS ARENA TI 2 ES k UBSR 0000 IPs PIM SsM00000000000000 8109 610000000000 00000 1 000000 show pru resources 00 000000PRU0000000000000 O 93 show ipv6 mld interface 0 40000000000 1000000000000000 1111 010000000000000000000000 O 3 show ipv6 mld group O0 0000006100000000 0000000000 p
57. 200 LSROOO Helen 0000000 2 uu Targeted LDPIJ 00000 Helo 0000000 P0000 LSR POO O Targeted LDPQOO OOOO 000000000000000000000000000000 Hello 000000000 TargetedLDP 0 D 1 00000000 000 show mpls ldp detail O O Last Configuration changed or unsupported hardware QO 3 E 1 1 down reason u 111 Hello expired 0 00000 LSROOO 8609000100 DU O Keepalive U Keepalive expired Hl EA Bh IA s Y LSROOOOOOOOOO 0 Illegal message received 00 0 01 0 0 1 1111 Notification message received 00 LSR Notification Targeted LDP 0000000 130 6 000000 00000000000 00000000 DD Unknown 000000000000 Targeted LDP D 0 0 0 0 D 0000000 TaergetedLDPOOD ODO 000000 00000000000 Targeted LDPOOOOOOO Targeted LDPOO O DD 000000 000000000000 000000000
58. 000 esgodo000000000000000000000000 0000000000000 618 O 0 0 show ipv6 pim interface QOOOOOOOOOOOOOOOOOOOOOOOO poda 0000000000 000000000000 000000000000 poda 000000000000 00000000000 O 0 0 show ipv6 pim interface QOOOOOOOOOOOOOOOOOOOOOOOO DU 000 sg0o000000000000000000000000 00000000 4 UU 0000000000 0000000000000000000000 8 0000000000 Pega d000080 000000 00000000000000000000000000 po00000000000000000 S000000000000000000S100000 OOOO p00000000000000000000000 8 BOO 1g0000000000000000000000000 10 netstat multicast 0 0 0 OOOOGO00000000000 0000000090000 0000 0 00000000 9 OOO 40 show ipv6 mld interface 0 0 0000000000 000000000000000 0 100000000000 MB 0000000000000 MDpo000000000000 11 000 40 show ipv6 mld group 0000000000 120000 11 000000 40 ssmjonQ 000000000000 0000000 0 show ipv 000000000000 610 00000000
59. 0000000 PRO 0000000 NFQo000000000000 000000000 0000000000000 000000 o0Ngo0000000000000000000000000 a 288 9 0000 000 8 0000000 00000 8 0 0 80800989 NEQOD0D00 0000000000 70 free pru lt PRU No gt Enter PRU B D O O 11 Main Menus gt Action lt ACTION gt FREE gt PRUx x 0000 PRU DOE OLD 040 00000000 OO ONOOOU 9 8 9 NIF J po0g0000800000000000000000000000000003000000000 ON NFgo000000000000000 D 917 NIFzR FOR LE too FIR NIFR ERU SL e 2 NIFzR FOR U ftit FIE NIFzR FOE MBAH 5 34 000 10NFo00000000 0000 100000000000 090 cosenmfp0000000000000000 close f nif lt NIF No Enter NIF No 0 0 00 NIF poda 000000 000000000 0000000000000000000000000 M
60. 127 6 000000 00000 000000 D 6 101 LSP 9 00 10111 10 DD L gt ping mpls 192 168 113 101 32 vpn Site B Route to 192 168 113 101 32 is via LDP FEC vpn Site B 9 from 192 16 seq 1 time 100 001ms code 3 0 8 0 7 from 192 168 0 7 seq 2 time 97 102ms code 3 0 from 192 168 0 7 seq 3 time 123 304ms code 3 0 from 192 168 0 7 seq 4 time 110 075ms code 3 0 from 192 168 0 7 seq 5 time 105 870ms code 3 0 sp ping statistics 5 packets transmitted 5 packets received 0 packet loss SCHOLCESHBLTCEEL p6 0000000000 MPLSQ 0000 IP YVPNO0000C 000000000000000000000 000 traceroute mplsQO 000 vapgoo 00000 000000000000 00000000000000 6 102 LSPtraceroute 0000000000 gt traceroute mpls 192 168 113 101 32 vpn Site B Trace to 192 168 113 101 32 is via LDP FEC vpn Site B from 492 168 7 7 Xime 100 001ms mtu 1500 Label 22 code 8 0 fron 192 168 6 7 thme 97 102ms mtu 1500 Label 21 code 8 0 from 192 168 5 7 tilme 123 304ms mtu 1500 implicit null code 8 0 8 0 7 1me 110 075ms code 3 0 A 5 E L C lt EEL 601008 S TODI ESL 6 9 3 EoMPLS L2 VPN 000000 O10 58 OO VPNMPLSO OOOO MPLS J 6 80 gt 0 0
61. 92 764 019 00000000000 0000 0000000000000 copy backup confis 0 O00D00000000000000000000000000000000 Mcpod 0 0000000000000 0 000000 0000000000000000000 O78 gt Is backup cnf gt enable backup 224 10 0 LU E copy backup config backup cnf primary amp 7 7 1 Caution All network interface ports will be reset at command execution Are you sure y n y 82 TA EME MORE quit gt 020 00000000000 000000000000 0000000000000 AX7800R 156 7T 000000 a 0 00000000000080080000800000008000080000 Gave D D D 000000000000000000000000000 Guto_duplex D 0 0000 podd0 00000 000000000000 00000000000000000000 00 set 8009
62. EE a a a a Oo r3 oo jama ST Era G Sag N EIS Og a a a o a og 1 a a 100 00 og a Es EL El dgg00008000000000 000 000000000000 000 0000 gg po 000000000000 000000000000 00000000 URL 8080880880080080080000000080 http www alaxala com 111111 1 1 1 1 0000 O0A EDITOB R S KUU 2 kI 7 0886 Y TUN ME Vol 1 AX 10 002 AEE Vol 2 AX 10 003 FULT ORBEA MRAKEH lt S AX7800R AX7700R nm 2 Y BRS AX 10 014 0e3 747v oza e0 ftRHZik REI LIYAN 4 AX 10 004 BIZ IIA IDA A EN SUPE Um Yay FL Z y Voll AX 10 008 aAw7Z4ZVw vaw FL Z y YA Vol
63. Send NG 1 ReceiveNG Y 00000 Send NG D ReceweNG Send NG 000 ReeiveNG 0 0Q000000000000000000000000000 OOO Voll no test interfaces POSOOOOOOOO000000000000000000 9 41 test interfaces no test interfaces 0000000 test interfaces nif 1 line 0 internal You have warning message Use show warning to see them no test interfaces nif 1 line You have warning message Use show warning to see them 2004 02 23 12 32 00 Interface type 1 686 CE 02c STM 16 POS G 652 single mode 40km Test count Ceo Send 0K 60 Send NG Recei ve OK 60 Recei ve NG e Data compare error 0 Out underrun 0 Out buffer hunt error 0 In CRC error 0 In short frame 0 In abort frame 0 In monitor time out 0 H W error none gt O20 0000000000000000000000 316 10110 11010 coseHOOOOHOU0000000000000000000000000000000000 free
64. MLD Report 6 ep pogo 9 0 e 0000 MLDv2 Quey00000000ML209000000000000000000 MLD 00000 10000000000 6 87 show 6 mid group 000000000 gt show ipv6 mld group brief Total 20 groups Group Address Interface Version Mode Source Count 15 100 50 Tokyo 1 9 ff15 100 60 Osaka 2 INCLUDE 2 ff15 200 1 Osaka 1 0 15 200 2 Nagoya 2 EXCLUDE 1 0000 gt 121 6 0 00000 0 00000 000000 6 9 MPLSO 0 0 OP MPLSE 6 9 1 O0 VPN U O10 MPLSU 1111101100 UI LDP O 0 O routingbase static LSPQ 0 VPNMPLSU 000000000000000 MPLSD 000000000000000 ping mps00 00000000000000 MPLSOO000000 000000000 000000000000000 688 LSP pingggo MPLspogo00g0000 0000000 pog0900900000900000 689 28870 MPLSsgo0 0000000 000 DOOD ping mps pg ng 0000 00000000000000000 690 LSPpingO 00 MPLS 0000000000 000 20000000 6 68 5 91 MPLSOOOOOOOOOO 000 gt ping mpls 192 168 113 101 32 Route to 192 168 113 101 32 is via LDP FEC from 192 168 0 7 seq 1 time 100 001ms code 3 0 from 192 168 0 7 seq 2 time 97 102ms 6006 23 0 from 192 168 0 7 seq 3 time 123 304
65. 0000 bfd all e drm o ct o 5 gt m 400 00000000 000 880000000000 0 00000000000 0000000000 dump protocols bfd all El Un Un 0 000000 ux 000000 primaryMC usr var bfd 000000 bfd trace bfd_dump gz 218 8 0000000000 87 IPvA OP MLTO Oooo show pru resources 0 00 0000000000000000000000 routerb10 0000000 0000000 871 PIMDMODODO DO 1 l KEEN 0544 KUA gt 5500 EOKBIMEOIP FDA 0000 IPv4 PIM DM00000000000000 s100 610000000000 O0000 1 0000 show pru resources 00 000000PRU0000000000000 40 show ip igmp interface 0 0 0000000000 0000000000 enable J 40 show ip igmp groups 00 OO000U0GlIOO000000 0000000000 0
66. 9 1 8 0000000000000 p00000000000000000 setmoepg0 0000000 MCOOOOOOOOOGO 00000 H set mode standby 810513 reload Enter 000 BcUOOOOOO 0000000000 BCcUOOOOOOOOOOOOOOOOOOOOOOOOOOOO gt reload dump image standby Enter 000 8 1 000008 B800000000000000000 show system 00000 0000000000 Duplex Moe 0000000000000000000 BCUOOOOOGO Standby O0 0000000000000000 show system 00000000000 928 show system 000000000000000 gt show system Enter 02000000000 ONOOOOOPRUOOOOOOOOO OO 8 0 09000 0 929 8 11010 PRUR FOHA EE NIFzR FOIA 5 PRUR 8 8 8 9 l l MS 11 000 000000 0Ngg000000000000000000000000 20NF000000 000
67. SOO 6 000000 1 1 dump protocols unicast all 1 1 G primaryMC usr var rtm trace rt dump gz 8 9 6 8 0 1 0 I OP BFDU 9 8 U 833 8 00000000 DD 1 BFDJo00000000000000 Remote Address IPO 00000000000 200 show bfd session ipv6 Remote Address IP040 000000000 300 239 8 0000000000 00000000 od 2 0000000000000 0000000000000 D bfd all e O 3 c Sl S o ct o 6 gt m m 3 00000000000 DD Init OO AdminDownQ 0000
68. 0Ax78s00RM0000000000000 44000 00000000000 77 3 1B B BO B D U W C D 7 U 0 00 000000000000000 0 00 0000 0000000000000 Vol2 10 6 156 7T 000000 1 10 101 9 0 MCOD 0000000 OO Mmepo 0000000000000 00000000000000000000000 6 0 44000 00000562 0 774 000000000000 ARPOOOOOOO NDPpo00 000000000000
69. 300 OOOO 0 BFDO0O00000000 BFDOO 1 1 show logging 1 O 11 eee B p0000 0000000 D OP BFDITI 0000000000 3 DROOOD 500 show ip ospf interface IP Address 11 1 0 BackupDR O DR Other L1 D U 400 pp4d0000000 300 4 Neighbor List 0 9801 10100 0 0 5 Neighbor List 00000000000 600 0000 FulOOO00d 700 215 8 0000000000 oo 0 6 700
70. BackuppR 0 DROther O Neighbor List 0 0 0 DRIJ DO D UU 0 6 6 00000 0 00000 00 0000 priority priority O 6 33 show ip ospf interface gt show ip ospf interface 192 168 50 1 Domain 1 Index 2 Name Officel Address 192 168 50 1 State BackupDR Auth Type Simple MTU 1436 DDinPacket 70 LSRinPacket 117 ACKinPacket 70 Router ID 172 168 50 1 Network Type Broadcast Area 0 0 0 0 DR 192 168 50 2 Backup DR 192 168 50 1 Priority 1 Cost 1 Intervals Hello 10s Dead Router 40s Retransmission 5s Delay 1s Poll 120s Neighbor List 1 Address State RouterID Priority DR Backup DR 192 168 50 2 Full 192 168 50 2 192 168 50 2 192 168 50 1 OOOO 8 9 0 show ip ospf neighbor poo0oo0000B8r p0000000000000000000000 OP BFDII e lt 8890000008 00000 es BFDO0000000000000000
71. SimpeXpo0000000000000000000000 show 0000000000000 system 0 0000000000000000 0 294 9 0000 show system 0000000 9 23 show system System AX7808R AX P6544 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location Node Info CSimplex Mode EHE FA Simplex 54E BCUO Active RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON 0 times restart BCUI Gisconnect o lt HX RM CPU unused 02000000000 OO PRO ooo 0000000000000 D 924 PRUDOOOOOOOO PRUzR FORARE oos FIR PRUR FOR UAL co EZ 000 10PRUQQ0000000 OOOO PRUDHODDUUDUDDUUDU elosepruah PRUQOO NFpo0000000000000 close f pru lt PRU No gt Enter PRU No DD 0 Main Menu 2 Action gt lt ACTION gt gt CLOSE gt peux x 00 0 0 PRU D D D 000 2DPRUDDUDDUDD 00000 PRUDUUU STATUS LEDOOOOOOOOOOOOOOOOOOOOOOOO PRU
72. 0 300000000000000000000000 IPg000000000001P000000 00000000 0o pog00000000 0000000000000 Me000000000 qos 0 51 D 0 O 0 O 0 O 0 DU DU O00 DU DU DU DU E SE E 4 4 0 0 Ooo O 0 O DU 224 TL ELIAS 51 1274 3 LOWER show logging v 7 FPshow ip interface AVY RIERA E OMR ABE CREEL UL r Zzrz2k EER ARB TEESE L Bf ARB CHE j U 1 DHCP BOOTP Y 388 5 JL aSRLT lt C HEL gt gt OFLIPLYA 3 5 BE OO EE S lt D FEMI TAIA 27 0088 5E T SR OO TE se 4072 6 5 1 WEKTU ERIM SMTWSI REL IP0000000 1 DHcPOOOOOOOOOOOO 1P0000000000ragepo0 0000000000000 2 00 PCO IPgo00000000000
73. E Hm 000 0 0 0 0 0 0 0 000 00 000 0 0080 0 00 0000000000 00000000 o 7 ETA oO LI CI EJ al LY E Led ia LJ E Ed LEA 1 LJ I Lu OO MCO OO DD DDD 000000 ooo 8 OO 000000 000 0000 8000000000000 0000000000 000000000000 0000000 0000 El r3 r3 r3 r3 E113 Co Co nom 00000 oO L1 Co 1101000000000 B6P 0000000000000000000000000000 00000 OU 0 0 0 0 0 0 0 1 0 19 OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO
74. 000000 000000 du s primaryMC 3 4 54 ad 163 8 0000000000 82 1 ULU 821 DODO DO 00 0000000000000 OOOO 1 00000000000 0 8 2 1 1 0000000000 DUUDUDDDUDDDDUDUDDUDDDBDBDDUDUUID 82 go0000000000000000000 8 El Co Co LI moO CI Co Co 5 T gt YN CI ooooono LEES EE CIES 11 Oooo Oooo EJLI T3LJ LL 3L al EFE ELIT Oooo Oooo 1 2 2 oooO j ESE BS Eo 1 W PS V ES SY Sis N ES Gali 1 000 65 CS Ea cor 00040 0060 E 20103 22 3 1 2 A OO TEN 2 00000000000 El El Co E El Co E El El 00000000000 D Cri 0000000 00 20000000 EE EE oO oO 250
75. 0862 864 BGP000000000PB6Pp 000000000000 0 8 114 EoMPLS L2 VPN II EB B U DI 10 EoMPLS L2 VPN OOOOOOOOOOOOOOOO 812 EoMPLS L2 VPN 8 11 58 3EVPN MPLS 8 5 HERR 5 8 11 4 2 3EVPN MPLS O EEFE o T S T 3EVPN MPLSiB E AT JEVPN MPLSiE EIS FT aE veh Targeted LDP limas PLEDO 680008 Targeted Pty Ta 8 11 4 3 88 a 8 11 4 4 BRA 030075 A gt 500 LDPOD ifs CEA Targeted LDPE Vc ALE UTunnel Down ZA MERE 6 LSPS 60818 5 Se SD 8 11 4 D 88 static vc static FL 83 5 6 11 4 6 BBR 249 8 0000000000 020 00 58 OO VPNMPLSO OOOO EoMPLS L2 VPN 0 18800 0 0 00 0 08 1P0000 000 VPN MPLSOO0000000000000 00 69 3 EoMPLS 2VPNO 000000 01000 LSRO 00 5 sp000000008000000000000000 VPN D
76. pgoapo000g0000000000000000000000000000 RM CPU OHO 000000 1000 4000 8000 100 150 45 90 50 150 45 90 25 150 45 120 107 6 000000 00000 000000 RMCPUQOOO DACPOO OD 000 000000000000 000000000 00000000000 do0g000 000000000000 000000000000 00000000000000000000000 0008000000000 000000 00000000000 0000 static route setting host 81920 819200000000 DUIDII 000000 rapid commit 0 O OOO0g AX7808R AC 669 111001 1 L 000000000000000000000000000000000000000 01800000000 show ipv6 interface JO DODO 000000 00000000000000000000000000 e 00000 physical address i 0000000000000 0000000000000000000 0 00000 physical address 0p80000000000000000000000 vPgoddo 000000000000000 667 gt show ipv6 interface TokyoOsakaT TokyoOsakaT flags 80b1 UP POINTtOPOINT NOTRAILERS NOARP MULTICAST mtu 1280 inet6 3ffe 1234 5678 9abc 64 gt fec0 1234 5678 9abc 64 physical address inet 192 168 100 1 24 gt 192 168 100 2 gt 02000000 ping ping
77. 6 37 show bfd session ip 00000000 gt show bfd session ip 172 16 10 10 Local Address 172 16 10 9 Remote Address 172 16 10 10 Discriminator Local 10001 Discriminator Remote 10002 PRU No i3 State Up Operating Mode Asynchronous Echo off TxInterval 150 RxInterval 200 Real TxInterval 160 Real RxInterval 220 Detection time 600 RM packets counter Received packets 5 Transmitted packets 32 PRU packets counter Received packets 840 Transmitted packets 780 PRU packets counter since last Up Received packets 320 Transmitted packets 150 Last session up time 12 15 17 58 37 Last session down time 12 15 13 32 02 Last session down cause Administratively Down Up count since boot 2 Session Application OSPF Neighbor Router ID 172 17 1 1 Neighbor Address 172 16 10 10 91 6 000000 00000 000000 65 4 OP MLT 65 1 DOdO OO 0000000000000 IP v0000000000000000000000000U show ip mcache l 000000 000 000000000000000000000000000000000 downstream 0 0 0 0 0 0 T 6 5 2 PIM DMQ 0 0 0 0 6 5 4 6 38 show ip mcache 00000000 show ip mcache Total 1 routes Group Address Source Address Uptime Expires Upstream 225 10 10 1 172 10 10 1 01 00 02 00 192 1
78. 66 6 0 000000 00000 000000 64 GS EERE ENE NERS 641 OOOO 648 RIPQOOO 0000000000000 6 4 5 B6P4p00000000000000PBGP n000000000 00000 O 6 30 showip route 00000000 show ip route Total 10 routes Destination Next Hop Interface Metric Protocol Age 127 8 127 0 0 1 0 0 Direct 300 127 0 0 1 32 127 0 0 1 0 0 Direct 300 92 168 2 24 192 168 2 101 PAIRI 3 0 RIP 100 gt 5 7 EL SDE 5 DETIBLT lt 5 642 OOOO I show ip static e Flag PolQOO BEDO 0 StatusQ IFdown 0000000000000 e Flag 00000000000 Status 0000000000000000 00 Status Y UnkReachablep 0008000000000 0000000000000000000000000 O Flag Status Active 00 0000000000000000 Status 0000
79. 149 73 DOOOOOOOO 150 731 000000000000 150 732 00000000000000000 151 74 1 11101 152 75 0 000000 155 76 156 761 000000 156 762 000000000000000000000000 156 763 0000000000000000000000000 156 764 0000000000000000 156 77 0000000 AX7800Rp 158 771 000 158 772 0000 8 0000000 158 00 773 DOo0o000000000 158 774 0000000000000 159 100 1 1 1 161 162 811 0 00000000000000000 162 812 8 5000000000000000 162 8 13 000000000 AX7800rR 162 81 4 6 163 8 15 000000000 163 164 821 000000000000000000000 164 822 000000000000000000 165 823 00000000000000000 166 824 RADIUS 8 00 000 0000000000 167 82 5 RADIUS y 8 000000000000000 167 826 000000000000000 168 uuu 169 831 00000000000000000000000 169 832 000000000000000 169 833 00000000000000 171 172 841 0000000000000000 172 6 4 2 10BASE T 100BASE TX 1000BASE T 1 0000000000 173 843 1000BASE Xp 0000000000 175 8 44 10GBAS
80. 74 6 00000 0 00000 000000 000000000000 66 gt show link aggregation statistics lacp Date 2003 01 15 14 18 00 link aggregation Counts 1 LA ID 1 Port Counts 6 Port 1 1 TXLACPDUs 50454011 RxLACPDUS 16507650 TxMarkerResponsePDUs 10 RxMarkerPDUs 10 RxDiscards 8 Port 1 2 TXLACPDUs 50454011 RxLACPDUS 16507650 TxMarkerResponsePDUs 10 RxMarkerPDUs 10 RxDiscards 3 8 Port 1 3 TXLACPDUs 100 RxLACPDUs 100 TxMarkerResponsePDUs 10 RxMarkerPDUs 10 RxDiscards 8 0000 gt 6 1 3 POSQODDODOODODOD O 01000000 po000000000000000000000 OC 19 0 SIMe4 POSPOD0 00000000 show interfaces 00000000000 lt NIFOO gt 0 D active 0000 lt Line D gt 0000 0000000000000000000000C 192c STM 64 POS J OO D 6 7 Q OC 192c STM 64 POS 1 D D B C B D C show interfaces nif 0 line 0 2004 02 23 12 00 00 NIFO active 1 port OC 192c STM 64 POS retry 2 Average 700Mbps 20Gbps Peak 750Mbps at 08 10 30 Line0 active up OC 192c STM 64 POS G 652 single mode 40km 101 gt pog00000000000000000848 8 000990000 08 00 20 PPP PPPODOD0 000000 show interfaces NU D DD 00 0 NOPHHDD uw DU po00000000000000000000000000
81. 99 6 000000 00000 000000 O Notice 0000000000000 1eMPgo000000000000000000000000 6 48 show ip igmp interface D D 0 show ip igmp interface 5 Interfaces Total Address 192 10 192 20 192 30 202 30 210 40 gt O20 000000 show ip igmp groups O 0 0 O Group Address Y 100 elll 000 elll 000 000 DU 0 D Interface Multil Multi2 Multi3 Multi4 Multi5 Querier 192 192 192 202 210 0000000000 IGMP Repor D D IeMPpo00000000000000000 00000000000 IGMPv3 Query 0 0 16MPvw09000000000000000000 IGMP O 20000000000 O 6 49 show ip igmp groups 1 000000 show ip igmp groups brief Total Group Address 224 1 232 234 234 232 232 235 gt pbppBpmpndpnmn 7 groups 1 RW RENEW Interface Multil Multil Multi3 Multi3 Multi4 Multi4 Multi4 Version 2 Expires 02 30 00 50 03 15 Mode EXCLUDE INCLUDE INCLUDE INCLUDE EXCLUDE Version Group Count Source Count 2 2 9 5 WON OM Notice Ro
82. OO GL 6 L3 a a a a 336 00000 900000000 37 67 po00000000000000000 41 O DO IPv000000 214 IPv6 D 00000 236 D D 00 DU 00000 87 00 DU UD 330 a 00000 329 000000000 329 00000000 330 L3 L3 L3 L3 E E r p 4 1 oe L3 C3 0 O 0 O 0 O 0 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 4 440 4 EE 0 4 E L3 L3 L3 C3 L3 L3 L3 oOo L3 L3 C3 OO EJ ES san 6 41 36 0000000000 162 000 9 OOO 10 DO 160 40 ET ET El Ez ES Es o D 00 00 D D D D D 8 00000 0 3 23 1 0 po00000000000000 330 po0000000000000000000CL 0 0000 23 noo p o noong a a 191 3 Ooo L3 r3 a a 0000 3 0000 3 L3 L3 L3
83. sFlowQ LL D D B D D L slow UU 0000 sFlowOOOOOOOOOOOOOOOOOOOOOOGO 814 go0000000000000000000000 6132 58 000000000 0000 2 1111111011110 110010 000100 000000 410 sFlowOO 0000000 show sflow 00000000 sFlwOOOOOOOOO sFlowOOOOOOOOOOOOOOOOOO 0 O 6 116 show OD 0000000 show sflow sFlow service status enable sFlow service version 4 Progress time from sFlow statistics cleared 8 00 05 Received sFlow samples 385737 Dropped sFlow samples 2093 LC Uit Collector exported sFlow samples 385635 Couldn t exported sFlow samples 0 Collector IP address 192 168 4 199 UDP 6343 Source IP address 130 245 34 23 Send FlowSample UDP packets 15267 Send failed 0 CATAR O20 1 ooo show cpcpul 00000000 CPO 0090000000 090 136 6 0 00000 0 00000 000000 D 6 117 showcpepu D n DU D D gt show cp cpu minutes eee minute date time cpu peak cpu average buffer peak buffer average Apr 02 18 19 33 18 19 59 12 10 0 0 Apr 02 18 20 00 18 20 59 73 33 0 0 Apr 02 18 21 00 18 21 59 90 0 0 Apr 02 18 22 00 18
84. 165 8 0000000000 817 1 0 OG OG 1 show interfaces O00 nep 0000000 Dodo 00000000 11 1 1 1 1 11 1 Dodo 00000000 0000 4 000000000000000 independentOOOOOOOOOOOOOOOOOO TTT external 0 0 0 0 0 DDD 0 80 000000 1 1 1 10 000000000 00000000 Voll 5 POS PPP Over SONET SDH e LOS ag ALOR 8280 P LOP B2EBER S BIP8 L BIP384 L BIP1536 P BIP8 noo noo noo oo oo ESKE noo z Ol ge a d g HO lt Y o ZO Y 2 H a oo oo oe on s 00 Co ooo ooo 00000 gO on YN 0 1 H Hu b no so U2 r3 e e e e e arg a d o Y A d d ine Or a
85. 275 9 OOOO 92 DODODDOODODO ftpOO 000 zmodemQ 0000000 showtech suppot 100000000000 0000000 podd0 000000000000 0000000000 0000 9 3 od od primaryM C var dump rmdump 0000000000 000000 D 1 CP PRUD NIFO OO primaryMC var dump cp00 2 000000000 IsecondaryMC var dump cp00e1 p 00 lt 111110 ePp000000 1110 1 ngagagi primaryMC var dump pru 000 PRUQ OO secondaryMC var dump pru el 00 PRUOOOOO primaryMC var dump nif NIFO OO O0000000 00000 emd IprimaryMC var dump mdinfo primaryMC var dump plndump P NQODODOD primaryMC usr var evtdump cpevt 0000000 00 86 O00000000000000000 gt 00 000000000 3 OOOO 11 10100 93 0000000 0000 log txt OOOO leg ref txt 1 1 config system cnf DUDU primaryMC var core core 000000 1 OO 102000 5000000 fpOOOO00000000
86. OO 10 show ip mroute 00000000000 8100 681000000000000000 pog000000000000000000000000000008100 PmM SMOOOO 000000 emalego000000000000000000000000000000 po000000000000000000000 show ip pim neighbor 00 20000 30 O O show O show ip pim bsr show ip pim rendezvous point mapping 000000000000 BSR I HL DE U D BS00000000 0 1191500100 GIOOO000000000000000000 e0000 10 54 ich ey jp EJ ED E E 0 O D O 0 0 O 11 00000 00000000000 BSRpg000000000000000000000000000 2 show ip mroute O0 000000000 S100 61000000000000000 000000 PmM SMOOOOOOOO 300 000000 enable 000000000000000 000000000000000000 1 1100100100 dud Bb D Ll show ip pim neighbor 000 10000 30 podd0000000000000000000 30 show ip pim bsr O 0 show ip pim rendezvous point mapping DO 0 0 8 8 1 1010010100 00 01 7 0 0000 200000 8 0000000000 PIM SSMDI TD DLD Gl 0000 IPv4 PM SSMOOOOOOOOOOOIPv4PM SSMOOOOOOOOOO S100 6100 1 10 11 a 60 E 4 0 814 0400 BE 4 0 6 611 a ESL l P
87. O Network Type OSPFvy3Q 00000000000000 OSPFv8GOOOO000000000 Full DD DROOO PtoPQ Neighbor 6 0 Other O Neighbor List 1 08110 UU 0 11111 0 0 BackuppR e DBRgp00000000000000000000 priority priority O 6 72 show ipv6 ospf interface U gt show ipv6 ospf interface Office00 Domain 1 Area 0 0 0 0 Interface ID 2 Link Local Address fe80 1000 00ff fe00 000120ffice00 IPv6 Address 3ffe 501 ffff 1 64 MTU 1460 DDinPacket 70 LSRinPacket 117 ACKinPacket 70 Router ID 172 16 1 1 Network Type Broadcast State Backup DR DR 172 17 1 1 Backup DR 172 16 1 1 Priority 1 Cost 1 Instance 0 Intervals Hello 10s Dead Router 40s Retransmission 5s Delay 1s Neighbor List 1 Address State Router ID Priority fe80 1000 00ff fe00 2002 Full 172 16 10 11 1 0000 00000000
88. 0 dump protocols unicast all 8 900 00000000000000000000000000000 9 000000 0000000 dump protocols unicast all primaryMC var rtm rt trace rt dump gz 000000 894 8684 0000000 OP BGP pOdg gn 00 00000000000 B6P 0000000000000 0000000000000 poddo0 000000 0000000000 86 4 1 000000 831 oo 1818878918 1 8 000000000000 1 0 0 Established 0 00000 200 show ipv6 bgp neighbor 00000 Established 00000 30 D 2 BGP4 D D U 300 0 0 00000000000000000000000000000 3 64 9 p4d0 0000000000 400 uu show ipv6 bgp received routes 1 dump protocols unicast all 4 paa 0800000 000000000 500 10000000000000000000000000000
89. 1P0000000 00000 OO 00 DU 00 O 5 33 show sessions 00000 show sessions gilbert console 0 Aug 6 14 16 05 john aux 000 1 Aug 6 14 16 45 ppp0 200 10 10 2 aux G IPF FvANEAXSANES 0000 O40 0000 1Pg00000000000000 1 11 100 00000000000 rmserQooOoo000000 000 lt 6 OOOO ax0000000000000000000000 69 6 1 po0000000000000000 62 000 3000000000000 63 IPMQO000000000 64 IPVM4QO000000000000000 65 IPw4pg00000000000000000 OP MLTO 66 6 1110100000 67 6 68 IPepgo00000000000000000 OP MLTQ 6 9 MPLS 00000 OP MPLS 6 10 QoSOOOOO 61 po00000000 612 613 0000000000 614 000000000 71 6 000000 00000 00 0000 61 1 11111 1 1 1 01 0 611 00000000000000000000000000000 01000000 po00000000000000000000 1000BASEX000000000000 show interfaces 0 00000000000 lt NIFOO gt D 0 0 active 0000000 lt Linep D gt D 000 actives 8 000
90. MIBOOOOOOOO 255 SNMPOOOOOOOOOOOOOOOOO 256 SNMPOOOOOOOOOOOOOO 137 00000000000000 162 TACACS 0 0 327 Tag VLAND 0 327 Tag VLANOOOOOOOOOOOOOO 77 Tera Term Pro Version 2 35 0000000000 3 U UDLDD 0 328 9 00000 8 UPCH 0 0000 328 V VRRPO O 328 VRRPp00000000001Pv40000000 00000251 VRRPp00000000001P v80000000 00000 252 134 VRRPOOOOOOOO VRRPOOOOOOOO HPv6 JU DDD 134 00 zmodem 00000000000000 279 O 87 116 92 00000000 80000 3 100 00 00 000000 000 0 172 00 72 00 000000000 00 0 328 00000000000000 8 100 00 00 00 328 000000000000 8 00000000000000 328 100 00 0000 0 00 8 000000000 HEEE802 3ah UDLD 135 0000000000 8 000000 00 00 000000000 0 0 274 000000 0 00 00 000000 0 0 281 164 4 0 150 0 po00000000000000 8 po0000000000000000 328 8 000000 ID000000 8 0000000 311 D00000000000000000 262 0000000000 9 32 0000000
91. show dns relay gt Can not execute this command No DNS relay configuration pe 00000000000 show dns relayQ 0 000 DNSpg0000000000000000000000000000000 0 211 8 0000000000 D ct show dns relay Primary NameServer 192 168 0 1 Secondary NameServer 192 168 0 2 FLUARRAETRLTC PEEL Error Statistics Over max capacity 0 Lack of memory 0 Communication error 0 Communication status lt source IP address gt destination IP address gt status 51 111 00 5 20000 0000000000000000000000000000000 pNspopg 0002000000000 0000000000 000000 000000000000 O a a a a a a a a OO a L3 L3 L3 L3 a a a L3 L3 L3 E r KN EST 3 L3 L3 L3 L
92. 1 2 how ip interface 00000000000000000000 Up Doa 0000000000 0 000000000 Down 84 O00000000000000000000 po0000 0000000000 n Oooo 1 2 00000000000 p00008000000000000000000000000000pm800000000 poo0000000000000000000000000000 631 ping IN 000000000000000000000M50000000 ARPOGOOOOOGO 00 04d 000000000000 0000000000000 1 2 9
93. 943 OFFOOOOGO D u 0100000000000000 824000000 AX7800R 8 10000000000 000000 000 932 D RS U 2 HE ABCUOIE ARAS GHARA 556 model v v KET tor 4 000 100000 OFF 0002000 86 093 2 0000000000000000 OFF00 000010000 Bougoddgo D 000 3000 000300000 000000 0Ng000000 302 9 0000 000000 0N0000000000 ONg0000 poda 000000000000 0000000000 00040000 Bcunpnann 0000000000000000 Bug 000000000 cog00000000 000 300000000 B8e4po00000000000000000 podd0 0000000 000000000000000 set mode auto duplex Enter OOO set mode duplex Enter podd0 00000000000 00000000000000000000000 show system o0000000000000000 Duplex Model o0000000000000000000 O show system 000000000000000000 show system 0000000 9 33 show system System AX7808R AX P6544
94. ppupdateQ 00 ooo L3 r3 r3 C3 EI 541 1 5 1 E EST EI EI ooo L3 L3 r3 C3 p Oooo ooo E El Oo a E a a a 2 1 320 10 OOOO000000000 102 DU 0180000000000 1 000 00000 O pod 000000000 000000000000 000000 pod 000000000 000000000000 000000 pod 000000000 000000000000 000000 D 000 DU 000 000 000 000 000 ooo L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 0 0 Oooo 3 000 020 00000000000000009 0000 000 321 00A 000 D
95. 10 8 25 0 config show netflow netflow yes sample 2048 00000000000000 entries 0 4000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 1 2 config 1 11 00000000 NetFiow0 000000000 263 8 0000000000 826 11 config show netflow netflow yes sample 2048 entries 0 4000 lt 00000000000000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 1 2 config O20 000000000000 NetFlow0 008000000000000000000 showinterfaee 000000000000 000000000 up dowa0 00 activeup 8 00000000000000000000 00000000000 827 gt show interface nif 0 line 0 2003 04 02 12 00 00 NIFO active 1 port 1000BASE SX retry 2 Average 700 2000Mbps Peak 750Mbps at 10 10 12 Line0 active up 1000BASE SX full 00 12 E2 45 0a 01 Protocol up IP address 10 0 0 2 Broadcast IP address 10 0 0 255 Gua gt 00000000 DOWN000000 8 5 1 p0g000000000000000000000 00000 O30 0000000000000 NetMow000008000000000000000000000000000000 penat DD 828 000000000000 gt ping 192 1 1 1 pinging 192 1 1 1 with 32 bytes of data reply from 192 reply from 192 reply from 192 reply from 192 1 bytes 32 time lt 10ms TTL 128 1 bytes 32 time lt 10ms TTL 128 1 bytes 32 tim
96. 209 9 OOOO 10 0000 341 NE1G 48T 0N00000000000000000000000000 podd00000000000000000 P 000 freeprugOOOOOOOOOOOOOOOO 0000 000000000 0 PRU No 1 0 D D Pro D D free pru lt PRU No gt Enter UUDDDDDDDDUDUDDDDDDBDDDUDUDDDBDBDUDUDUDUDDUDDDDDUUDUDDUDDDBDUD x 00000 pro OQ Main Menu gt gt Action gt lt ACTION gt gt FREE PRUx 400000000000000 9 O30 00000000 ONOOOOOPRUOOOOOOOOO ONOOOO 9 30 PRUDOOOOOOOO PRUA RE AER ANIFAR FORA IBY PRUA RESE FNIFzR FOS ABANG FE I I v 000 8 0000000
97. 2 E E o ct o 1 1 1 o DU 00 a a EE ET ET TT L3 r3 rrr Oo L3 r3 L3 Oooo L3 r3 00 00 DU OOO esu H 00000000 4sg0000000000000000 o H 1 Oo O7O 00000000 DU 00000 0000000000000 DU po00000000000000 qosun podo0000000000000 GosOOOOO 000000000000 69 EEE 3 EPEA E 0 O Oooo Of D D 000 O D 000 O 000 00 000 00 000 O DU 0 D 000 D DU D D 00000 D 00000 00000 D 00000 00000 00000 D 00000 E E els Gl 2 O D 00 O 00 O D O D 00 E E E O DU DU 0 DU DU O DU O DU D aD 1 p00000000000 2 show filter flowQ 000000000000000000000000000000000 0000 00000 IP00000 170
98. 51 52 0000000 53 54 NFOD000000 55 56 57 58 000000000 AX7800R 59 0000000 P0000000 39 5 00000000 5 1 40 itl 0000000 show version 000 000000000000000000000000000000 O51 Ax7800R 1 D Show version software S W AX P6544 11 Ver 9 1 OS R Routing software 0 Ax7700RQ 00000 gt show version software S W AX P6543 11 Ver 9 4 OS R Routing software gt U 92 pg0000000000000000 D AX7800R gt show version BCUO MCO AX F6244 66 MC256 256MB compact flash memory card 00070000 AX P6544 11 Ver 9 1 OS R Routing software BCUO MC1 BCU1 MCO AX F6244 66 MC256 256MB compact flash memory card 00070000 AX P6544 11 Ver 9 1 OS R Routing software BCU1 MCl gt 5 00000000 52 11111 0 521 DODODO 000000 000000000 enbego dd 0000 0000000000000 enbego do 000000000 0000000000000000000 0000000000
99. 6 0 000000 00000 000000 66 6 D L ipo 650 1 111111111 11111 111 111111111111 1 1 1 rvpgop000000000000000000000000000000000000000000 00000000pingipvss gogo 00 000000000000 6 50 pingipv6 BODO0 000000000000 gt ping ipv6 3ffe 501 811 ff01 1 PING6 56 40 8 8 Bytes 3ffe 501 811 ff01 10 gt 3ffe 501 811 ff01 1 16 bytes from 3ffe 501 811 ff01 1 icmp seq 0 ttl 255 time 0 286 ms 16 bytes from 3ffe 501 811 ff01 1 icmp 866 1 ttl 255 time 0 271 ms 16 bytes from 3ffe 501 811 ff01 1 icmp seq 2 ttl 255 time 0 266 ms C 3ffe 501 811 ff01 1 ping6 statistics 3 packets transmitted 3 packets received 0 packet loss round trip min avg max 0 266 0 274 0 286 ms gt 6 6 51 gt ping ipv6 3ffe 501 811 ff01 1 PING6 56 40 8 8 bytes 3ffe 501 811 ff01 10 gt 3ffe 501 811 ff01 1 26 3ffe 501 811 ff01 1 ping6 statistics 12 packets transmitted 0 packets received 100 packet loss gt 6 52 gt ping ipv6 3ffe 501 811 ff01 1 PING6 56 40 8 8 bytes 3ffe 501 811 ff01 10 gt 3ffe 501 811 ff01 1 ping6 UDP connect No route to host gt
100. OU show ipv6 dhcp server statistics Y O D 661 gt show ipv6 dhcp server statistics lt DHCP Server use statistics gt prefix pools 40 automatic bindings 50 manual bindinqs 10 gt 0800000000000 show ipv dhcp O 662 gt show ipv6 dhcp binding lt Prefix gt lt Lease expiration gt lt Type gt 3ffe 1234 5678 48 infinity Automatic 3ffe aaaa 1234 48 03 04 01 11 29 00 Automatic gt 6 63 gt show ipv6 dhcp binding detail lt Prefix gt Lease expiration lt Type gt lt DUID gt 3ffe 1234 5678 48 infinity Automatic 00 01 00 01 55 55 55 55 00 11 22 33 44 55 3ffe aaaa 1234 48 03 04 01 11 29 00 Automatic 00 01 00 01 aa bb cc dd ee 66 77 88 99 aa gt 000 dhep6 server static route setting 1101 0 00 00 0 00 105 6 000000 00000 000000 U 664 DOOOOOOOOOOOOO
101. go 00000000000 0000000000000 Voll set me disable OOOO O20 0000000000000 6 000000000000 OOO secondaryMC usr home operator 000000 MC I LH 1 110 0 0 9 edo 1000 00000 primaryMC usr home operatorl D L1 0 D 0H D U D U C D U 952 MCODODODODODO BCUOOOOOO showmcOOOOOOOOOOOOO 1 111110000000 0000 0 0 01000000000 8 MCODO 0 00 00 00009080 1000 OO McOOOOOOOOOOOOTO set me disable 111 111 000000000 305 9 OOOO 96 ID LIU D DEO EL 1 D D 96 1 11 1 BCUN OO O AX7800R 8
102. 1 020 0000000000000000000 show 0 logging grep Unknown host address QJOOOUOOOOOOOOOOOOOOOOOOOOOOOO 07 3 po0000000 gt show logging grep Unknown host address EVT 08 19 10 41 52 E3 ACCESS 00000001 0201 000000000000 Unknown host address 172 16 251 69 2 150 0 0 0 08 show logging grep Login incorrect U74 000000000 gt show logging grep Login incorrect 0000 EVT 08 01 10 38 40 E3 ACCESS 00000002 0201 000000000000 Login incorrect user2 000 pod 0 ooo go 0000000000000 00000000000 000000000000 7T 000000 godgo0000000000000000000000000000 823 00 2 0 show logging 0008080000000000000000000000000000000000 0000 O75 gt ls l PrimaryMC etc passwd rw r r 1 root wheel 342 Aug 1 10 34 primaryMC etc passwd gt show logg
103. PRU 1 PRU B2 connected average 0 Corrected RCAM data 0 Corrected FCAM data 0 PRU 2 disconnected PRU 3 disconnected 6 D D D 1 show flow used resources shared qos 8 37 config show flow used resources shared qos Used resources in system Total 16000 Free 4000 NetFlow tit CHA L C LYS T gt EY RE Used resources in PRU DIY gt 4 0 0 PRU No qos NetFlow free 0 0 10000 6000 PRUE J 2 2 F A PRUIERNIC EB TL F U 1 20004000 10000 grata gL UA AN 2 0 0 16000 3 0 0 16000 config 267 8 0000000000 268 8 38 OOOOOOOOOOOOO 18 config show netflow netflow yes sample 2048 entries 0 10000 entries 1 4000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 1 2 config Used resource in system JOB ODO 00D 00000 BCO po 0000 0000000000 DD Voll 3 2 1 AX7800R 00000 AX7800R TI 00000 voli 8 2 1 4 000000000000000000000000 AX7700R 0 Voll 3 2 2 AX7700R 0 00000 AX7700RIT Voll 3 2 24 000000 Used resource in PRUD DOC OO0000 000000000 78008 0 m0000 Vol 1 3 2 1 AX7800R 000000 78008 0 Voll 8 9 1 12 9 NetFlowQG 00000
104. DO Down 0000647 BFDO00000000000 00 10000000 0 ies 6 34 show ip ospf neighbor D 000000 gt show ip ospf neighbor Domain 1 Area 0 0 0 0 Address State BFD RouterID Priority Interface 158 214 10 1 Full DR 158 214 10 1 1 158 214 10 105 T 72 16 1011 Full BackupDR D TZZ2 T16 1 1 1 172 16 10 10 172 16 10 12 Full DR Other JU 172516 4 2 1 172 16 10 10 172 126 110 111 Exch Start BackupDR D 172 126 123 111 1 172 126 120 130 gt 645 64 OP BGP 0000 0000000000000 4 D D 8 D D D 0 show ip bgp neighbors Established 0 D 010101 O BGP Status Established ping 49 gt OO B6P00000000000000 poego00000 000000000000 B6 Ppg0 000000000000 6 BGP Status EstablishedQ 0000000 B6 Ppg00000000000000000000 89 6 000000 00000 000000 000000 BGP4Q000000000000000 8 40 0000 000090900000 0 0000000 show ip bgp route 000000000000 6 35 show ip
105. DUDO MC 0000000 Dal DUID D D D 000 DUID PrimaryMC primaryMC usr var dhepo dhep6s duid 0000000 bg DUIDO D 000 DHCP I DUD J show ipv6 dhcp server statistics DO 0 H1 UD 0 6 65 0 DUIDO J D gt show ipv6 dhcp server statistics lt Server Duid gt 00 01 00 01 3e 00 2e 5e 11 22 33 44 55 66 gt USU Den 00000 DHCP po NUDUDDD 000000000000 0000 000000000000 106 6 0 00000 0 00000 000000 0 00 O b copy 00000000 6 O erase ipv6 dhep server duid 1
106. podd00 000000000000 Naigodo00000000000000000000000 00000 Xaipgo 000000000000 000000000000 226 lt Null4 VE 26 83 5 0 ISAO show ipv6 interface ipv6 unicasta v Y FIz amp 601 1 VR 2 8 07 VE 1 7 23 28 57 WAYANG show ipv6 route v 7 F 8 show ipv6 interface RCA vy FANE ENT S ANE show ipv6 interface ipv6 unicast O00000 1111110101 10 10 0 Nui O 000000 vPgo0 00000000000 2 080000000 000000000000 Naigo do 000000000000000000 3 show ipv6 route 0 00000000000000 show ip interface 0 000000 8 0000000000 000 190 go0000 000000000000 00000000 000000000000 0000000000 go000 0000000000000 00000000 000000000000 0000000000 0000000000000 00000 go0000 000000000000 00000000 000000000000 0000000000 000000 1 000000000000 2 show ipv6 policy JO 0 0000000000000000 0000000000000000000 00000
107. 000000 000000000000000 0Ngg000000000000000000000000 podd00000000000000000 E O 295 9 OOOO 030 00000000 ONOOOOOPRUOOOOOOOOO NFOOOOOOO PRUQO0O0000000 D 925 PRUDOOOOOOOO PRUPA AR FNIF F 0 IE IB PRU Ale 2 a BER ANIFAR FOERY SEL FE 000 1 8 0000 PRUIIIDDDDDDD elsepruD D D 0 7 D U NIFD OU po000000 close pru lt PRU No gt Enter PRU No 000000 PRULCI LU 9 Main Menu 2 Action gt lt ACTION gt gt CLOSE peux x 00 0 PRU D I D 000 00000 8 01000 0000 NIFOOOO STATUSLEDOO 0000000000000 9 podd0 000000 000000000000 000000 po0000000000000 0Ng0000000000000000000000000 podd00000000000000000 0400000000 ONOOOO
108. setterminalpager QOOOOOOOOOOOOOOOOOOOOO 0000000 You have warning messages Use show warning to see them 0 show warning i 000000000 0800000 000000 000000 000000000000 set terminal warning level I ODO BO DO DO DO DDD 000000 00000000 login Dodd 000000000000 0 3 3 000000000 unu 0000000000000MCc00000000 mc0 is disable o Co Co Co mc1 is disable Lt This System is restarted by pressing default restart switch gjo gt m 5 1 3 DES C2 CI Version mismatch between active and standby software detected 0000 Date mismatch between active and standby configuration files detected NIF lt NIF No Line Line No 0000 is under line test lt NIF No NIF OO
109. 1 000000000000000 2 00000000000 3 DHCPOOOOOO OO 20000000000000000000000000000000000000000g po Doo 000000000000 po0000000000003 00000000000000000000 00 DynamieDNS 00000000 000000000000000 pog0000000 0000000000 4espg0000000000000 Ooo Lr O O b D 0 O 1 DS EHTNE 1274 3 VNR show logging v 7 FX show ip interface a gt Fi k SMEREOHR L 0 5 7 0 7 M TRA BS 9 5 7 L HIRE OMS E 6608 L ESUO HERE P gt L 2 gt OPLIPLYA 3 iB BERE g IS E JS KUT ALY FEMI 2 2 065585 8 8 8 K U 6 5 1 8152 68 0 FLEUR MITE REM 208 all 5 et D dl 8 0000000000 DHcPOOOOOOOOOOO DNSgo00000000000000 DynamicDNSQ 000 9 1 000 DNSOOOOUO 00000000000000000 00 00000900 8000000000000 000000000000000 200 000000000 2 DNSU
110. 100000000000000000000000000000 5 000000 BGP4OOOOOOOOOGO dump protocols unicast all 216 8 0000000000 ux G primaryMC var rtm rt trace rt dump gz 865 15450 00 0 OP SIS 0 88 0 8 23 IS4S LH H1 C1 D D DO 000000000 DO 1 8 00 00000000 10000 200 show isis adjacency 00000 Upoooooo 400 2 00000000 008 0000000000000000000 300 000000000000 Dg po 0000 0000000000000 0 Active LLL 400 D Passive DD O ISISOOOOOOOOO 5 3 show isis interface InActiveQ 0000000000000 500 5 4 000 show ip route all routes OOO Active ti D 0000 00000000000 dump protocols unicast all 5
111. UnReachable O Flag BFD Status Reachable 0 0 0000000000000000 Status Status Active 0 0000000000000000 0 Status 000000000 po000000 06 7 7 BFDO0O000000000 00 0 000000000 OP BFD 0000000 show bfd sessionQ 0000000000000000 6 000000 00000000000 O 6 70 show ipv6 static route 00000000 show ipv6 static route Status Codes valid active Destination Next Hop Status Flag 0 3ffe 10b8 1 1 2 Active gt 3ffe 2db8 1 1 64 3ffe 811 20 2 2 Active 3ffe 2001 2 1 64 3ffe 811 201 1 2 Active Up BFD 3ffe 24a1 21 1 64 3ffe 811 2001 1 24 InActive Down BFD 3ffe 2001 db8 3 64 3ffe 811 d01 3 201 Active Reachable Poll 3ffe 2001 db8 4 64 3ffe 811 d08 4 301 UnReachble Poll 673 1110101101 1 L 0000 IPvsgo0000000000000 RIPsgD 000000000 0 show ipv rip gateway podo00 000 000000000000 O Gateway Address DO00000000000000000000000000000000000 00000000 Riesgo 000000000 000000000000000000000 podd00 00000000000 e Age 3p00000000000000000000309000000000000000000 0000 podo000
112. 0 9 7 pg000000000000000000 umana 000000000 000000 NIF 1101010000 0000000 dopo 000000000000 NFpoO0D 0000000 OOOO ana ee p0000000000 0000000000000 Voll test interfaces POST n HH DD UU D 00 po0ogo0000000000000000000000cosep8000000000000000000 odd9000000000freepga00 0090000 000000000000 00000000 0000000000 000000000000 000000000000 NIF OO 100 0 000 0 DODODODONIFOO 10 10 000000 test interfaces no test interfaces 1 D B H D H D B D close nif 1 line O Enter gt test interfaces nif 1 line 0 internal Enter 00100000 gt no test interfaces nif 1 line O Enter gt free nif 1 line O Enter 315 9 OOOO 0000000000000 941 testinterfaces no test interfaces 1 100
113. 2 Flag 300 show ip static route Flag BFDOOOOOOOOOOOOO 400 Flag Pol DUDU BFDOOOOOOOOOOOOOO 500 3 1 1 1101000000080 Status O0 UnReachable ICMP u 1 show ip static gateway po0000000 4 Status DUDU DownQ 9 0000000000 0 show ip static gateway 866 B p0000 0000000 OP BFDITI Hl B B D B D UO Status 700 Refuse 0 0 0 B BFDOOOO0OO000000 5800 000000000 000000 5 dump protocols unicast all 11 1 000000000 0000000000000 OG primaryMC var rtm 000000 rt trace rt dump gz 8 6 2 RPOOOOOOO 8 20 0 00000000 od 1 1
114. UPC Usage Parameter Control 110 0 00000000000000000 VRRP Virtual Router Redundancy Protocol 1 0000008000000800008080000808080000080800 000080 0 000000 00000 0 1 0 0000000000000000808000008080 000080800 000080 0 000000 00000 0 1 0000000000000000080800000808080000080800000080 0000000 000000 0 po 209008808000008080000080000008000000000000000000000000000 000000060 po ASU 0 00 0000 000 BGPOOOOOOOOOOOOOOOOOOOOOOOOO 120000 0000000 D000 2800000000000000 uuu 81000000000000 000000060 08 DscPOOOOO000000000000000 Bo Bl 00000000000800008080000808080000080800 0000800 000000 00000 0 111 01 000000000 0 0000 1 0000000000000800080000008080000080000000000 00 0 B6Pg000000000000000000000000 1P000000000000000 Co L1 Co L1 Co L1 Co L1 1 11 000000000000
115. gt show ip interface summary nagoya 0 0 UP 158 214 179 30 25 osaka 0 1 DOWN 158 214 180 30 25 fukuoka 0 2 UP 158 214 181 30 25 sapporo 0 3 DOWN 158 214 182 30 25 gt 00000000 851 00000000000000 0000000000 00000 6 2 2 IPvV6Q D up down O O bv6Q 000000000000 show 6 ipv6 interface 0 IPv6 updownQ 00 UP 0000000000 00000 611 6 gt show ipv6 interface summary tokyo UP 3ffe 1 1 64 nagoya UP 3ffe 1 1 64 osaka DOWN 3ffe 2 1 64 fukuoka UP 3ffe 3 1 64 sapporo DOWN 3ffe 4 1 64 gt 00000000 DOWND 881 0000000008000000000000000 00000 623 TagVLANDODODOOO U 0180000000 show interfaces 0 0 0 Tag VLANgO0000800000000000000000000000 0000000000000 lt NIFOO gt 0000 active 0800000 sine 1 gt 0000 active 000000000000000 00000000000000000000000 vlan 0000 Tag VLAND0000C 0000000000000000000000 77 6 000000 00000 000000 O O VLAN summary 6 12 gt show interfaces nif 0 line 0 2003 02 23 12 00 00 NIFO active 12 port 10BASE T 100BASE TX 1000BAS
116. 0080 dog00 00000 000000000000 1 10 8 0 0 0 000908 NIF O 5 fault Du show logging i 0000000000000 Line 8000 M0000000000000 OO gt dog00 0000 0000000000000 13 8 0000000000 od NIF O DD OO 6 initialize OO 00 7 locked NFO Oooo 009009000 000000000 0000000000000 00000000 O 20 Line 0 J 000 show interfaces 00 0000 oo 8 15 OOOO00000 Line oo 1 active up DO 2 active down show logging 0 0000000000000 Line 0840 M000 000000000 OO 3800000000000000000 3 unused 00000 Lineg0000000000 0000000 0000000000 1111 4 closed OO time 000000000 111 1 tine 8000000000000 LineQ 484000000000 5 test test interfaces
117. 300000000 6 initialize DL DD 7 locked 0000000000000000 10000 20 Line 0 J 000 show interfaces 00 0000 Eme 000000000000000 LinegOOOOOOOOOO 8 8 D Line J oo Od D DO active up 1 172 8 0000000000 O Line O og OU o 2 active down 0 LinenOOOOOOOOOO show logging 0000000000000 Line D 00 OOO 1 111111 800000000 111111 000 00000000000 000000 po 1 3 unused 1 1 1 1 LinegnOOOOOO 111101 01 4000000000 000000 OOo 4 closed close 000000000000 0000000 free DJ ODODDDOD Line DUDU 00000000 5 test test interfaces HH 0000000000 no test interfaces 0000000 6 fault
118. 47 7 FRA OFP7ObLES EC ABO SER OFF ZART 2 gt 38 gt 2 H 1 000000 12 11 1 111 11 1 11 121 Ul cog0000000000 000000 0000000000000000000 RS 232C0 0 00 pod 000000 000000000000 0000000 01800000000 O Tera Term Pro Version 2 30 0 0 20000000000000000000000000000 O 020 00000000000000 pogo 000000 000000000000 codo 000 000000000000 000000 e 9600bit s 11 1 5 6 epcg000001000 6 DADO Do DO 96008 Y O 1900 24000 48000 1920087 0000000000000 00 0809 9008000980080 098080 9 080 9 9 000 09 000900 e 9600bi s
119. 24 2 0000 21 1 D D21 EU 10 63 H 38 FH BRA PET E Bre S Du 7 2507 CE 6 2 0000 22 7 podd0000000 0000000000000 D21 UU 00000 00 0000 1 gO 0 00000 000000 7 00000000 0000000000 DD 2 0000000000 000000080000000000000 000000000000000 00000000 00 3 000000000 00000000000000000000 read000000 00000 00000 000000000 0000000 0000000000 FWRDD D 22000008 000000000000 BACKDDODDUUUUD oan EY ATA AAA AAA AA 0000000000000 000000000000000 srarosgoo00 0000000000812 STATUSU DUDU t Dpo0000000000 0000000000 2 0000 23 II l e 000000 0 0000090000009090 8 Meg 00000 O0FFO000000LED000
120. 6 125 gt show 0800 port 1 2 detail Date 2004 06 24 23 11 52 OADP CDP status Enabled Enabled Device ID AX7800R 1 Interval Time 60 Hold Time 180 ignore vlan 2 4 10 Enabled Port 1 2 4 CI Oo L1 jam CI a Oo Total Neighbor Counts 1 Port 1 2D VLAN ID Holdtime Port ID Device ID amp X7800R 2 Capabilities Router Switch Platform AX7800R Entry address es EE OT IP address 192 7 IPv6 address fe80 200 4cff fe71 5d1c fSpeed 100M Duplex FULL Version Routing software AX P6544 21 Ver 9 1 OS RE 145 11 1 1 1 4 00000 0000940 0 0 000000 0 40000 9 00 0 00 0 08 1 1 71 72 73 000000000 74 SNMPOOOOOOOOOOO 6 75 76 7 7 1 AX7800R 78 Mmepo0000000 147 7T 000000 1 148 ONO podd0000000000000000000000000000000adduserpo000000 00000 ete passwd 8000000000 0 71 po0000000000000 gt cat etc passwd grep tcsh operator 100 100 usr home operator bin tcsh ugerl 101 100 usr home user1 bin tcsh uger2
121. EDO 00000 ut 11111111 10101 1010 1 1 EB lU 1 E EL EL E E D D 1111 1 1 1 000000000000 2 ping ipv6 o jg nut 111111 11 1 1 ping ipv6 0000 1 661 gado poo 00000000 0000000000 224 8 0000000000 D ID 3 pingipvy8 00 80000000000000000000000000 ping ipv6 000000 4 pingipv6Q 00 00000000000000000000040000000 NDPg00000 podd000 000000000 m0s000000000000000000000000000 D podd000000000000000000000 1 000000000 pmgipve UN DU 00000000000000 2 pingipy8p O0 DUDU 000000000000000000000000000000000 3 pingipv6Q 00 000000000000000000000000 pnsipve go 0000000 poda 000000000000 0000000000000000000 4 pingipvy8p 008000000000 0000000000000000000000000000 pod 000000 000000000 00000000000000 04000000 pingipv8 0000000 000000000000000000000NDP00 000000000
122. poog0000000000 000000 0000000000000 ARPQO000000 NDPDDU 159 7T 000000 78 11101010 0 0 11 UI MCI MH 0000 O72 000000 6 0 00000 000000 00000000 0000 1 copy me 000 000 000000000000 000000000000 2 synchronize 000000 000 0000000000000 1000000000000000000 00 100000000000000000 00000000000 0 1000000000000000000 00000000000000000 100000000000000 00000000 00000000000000 Voi synchronize Hl I B 3 copystartupconfg 0000000000000000000 0000 340000000000000 000000 0000000000000000000 copy backup config unu 000 160 0000
123. 100000000000000000000 O O O test interfaces no test interfaces L3 El gt E E E tE 311 9 OOOO gt close nif 1 line O Enter gt test interfaces nif 1 line 0 internal Enter 00100000 gt no test interfaces nif 1 line O Enter free nif 1 line O Enter 0000000000000 9 39 test interfaces no test interfaces 1 1 B 1 DH D H D 0 0 10100 Send NG 1 ReceiveNG Y OO 00000 Send NG D ReceweNG pj 0400 00000000000000 0 Send NG 000 ReeiveNG 0Q0000008000000000000000000000 000 Vol 1 no test interfaces QOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO O OO Receive NG 0 0Q00000000000 000000 Send NG 0 Receive NG 0 0Qg000000000000000000000 po000000000000000000000 Voll no test interfaces 00000000000 10GBASE R 10GBASE W Send NG 9 39 test interfaces no test interfaces 1 UU U test interfaces nifl line internal You have warning message Use show warning to see them no test interfaces nifl line You have warning message Use show warning to see them 2003 02 23 12 32 00 685 5 gt Interface type Test count Send 0K S
124. EX E E 34 E E uu 0000 OO up 0000 0000 0000 HO Er a EEE GE 0 0 O 0 n 00 UU OO UU OO a OO Ea Oo a CJ CI CJ a a 0 0 0 0 0 ping 6 81 000000000000 ping 3 4 pingOOOOOOOOOOOOOOOOOOOOOOOGMaAOOOOOOO 09000 0 to 200 8 0000000000 podd00 00000000 med 00000000000000000 000000000 000000000000000 1 000000000 pago 000000000000000 2 000000000000 0000000000000000000000000000 3 pmgd00000000000000000000000000 pms00000000000000 pogo 000000 000000000000 00000000 4 pag 0000000000000 00000000000000000000000000000 1 000000 0000000000 00000000 ARPD000000 ping I 00000000 0000000000000004rRPpo0000 000000000000 podd0000 000000
125. 00 00000000000000000 00000 NOOO IP 12000000 000000 0 0 0 orepggo00 000000000000 CoreQG 000 100 0000 ping 00 mplsQOOOOOO 10 traceroute 0 OOO mpls trt 11 0 MPLSOOOOOOOOOOO D V PNQO 1 0 VPNOOOOO 0 00 0 IPv4Dn 000000000 e 000000000000 VPNO D 0 00 0 MPLSU 1 0 OOO e traceroute O00 mplsQOOO0000 000000 0000 8 traceroute 0 0 0 0DO0 0000000000000000000000000000000000000000 MPLSO0OO00O0O0 QO tracerouteQ DD wplsQOOOOOO OOOOOOOOOOOOOOOOOOOO lt 40 To 2 2 O 0 O 0 O 0 Ooo 00 DO
126. L3 L3 L3 L3 L3 L3 C3 L3 L3 OO Er EL EN L3 OO L3 L3 L3 oO au ET E kran E ran E a a 00 41 294 110 0000 00 330 00000000000 po0o000000000000000000U0 IPv6 253 110 100 00 0 00 234 000000 000000000 33 U 000000000 DUDO 302 64 00090000 0 297 OND O0 00 2 00000 4 110 000 16 276 0 72 1 330 172 0 156 3 66 0 uult 331 00000000 000000000 31 331 DODo0000000000000 330 uua uggaddgecumummnug 19 DO O 331 0 331 0000000 MC 5 331 1111001 0 0 18 DODo0000000000 331 MIBO 1
127. UUDUDDDDDDBDDDUUDDDBDDDDUDUDDUDDDDDNIF J Lmego00000000000 00000 O10 show interfaces 00 0000 NFO000000000000 D 087 NFDU UD DO D 1 active 00 DD 88 166 00000000000000 Lien DD D 2 mismatch NIFO 1680 O00000 NIFDUDDDDDDDDDDDD Line 0 D 00000000000000000000000000 10 100 system 000000000 system 00000 0000 16k interface mode DD 0 0 0000000000 10000090000000088 O00O000000000000000000000000 0000000 0000000000 M0000000 00000000000 000000 511NE1G 8T0 00000000000 NEIG 48T 000000000000 3 unused 10 6 NIFO DO 4 dosed close 00000000 OOOO 080800008000080080800 00000000 O0000000000000000 00 free 00000 100 5 fault OO 00000000000 showlogging 0000000000000 Line D D D
128. 79 6 3 2 00 79 633 000000 79 634 80 6 35 0000000000000000 80 636 Null 000 00000000 2 637 82 638 0000000000000 82 639 DHCP 860000 00000000000000 83 6310 08 0 000 000 84 63 11 0 80000000000 65 64 4 87 641 87 642 87 643 88 644 OSPFOOOOOOOO00000000 88 645 86 4 0000000000000 6 89 646 5450 0000 0 0 op isisg 90 647 8 0 000 0 0 0 OP BFDO 91 65 IPvW4000000000000000000 0 OP MLTO 92 651 0000000000000000000 92 6 5 2 PIM DMI PIM SM0 000000 92 6 5 3 DVMRP 000000 96 6 5 4 IGMP IEI D 99 66 8 00000 00000 197 661 0 000000000000000000 101 662 000000000000000000 101 663 000000 101 664 0 0000000000000 102 665 00000000000000000 102 666 Nul 00 000000 193 667 104 668 6 0000000000 104 669 00
129. 6 6 2 6 tracerouteipv 6 O 6 53 traceroute gt traceroute ipv6 3ffe 501 811 ff01 1 numeric traceroute6 to 3ffe 501 811 ff01 1 3ffe 501 811 ff01 1 30 hops max 40 byte packets 1 3ffe 501 811 ff03 10 0 612 ms 0 541 ms 0 532 ms 2 3ffe 501 811 ff02 5 0 905 ms 0 816 ms 0 807 ms 3 3ffe 501 811 ff01 1 1 325 ms 1 236 ms 1 227 ms gt 663 O00000 NDP 000000000 rvpop00000000000000000000000 bv6qQ 000000000000 show ipv6 neighbors 0D0000000000000000000000000000NDPO000000 8 000000000 101 6 000000 00000 000000 podo00000 000000000000 664 0000000000000000000000000000000000000 0180000000 Den 0000000 show filter flow I 0800000080 000000000000000000000000000000 654 gt show filter flow interface tokyol detail lt Filter IPv6 List No gt 40010 Using Interface tokyol in ip source any ip destination 3ffe 501 811 ff00 0 3ffe 501 811 fffe ffff protocol 6 tcp port source 80 forward packets 7469982 lt Filter IPv
130. B DU D no test interfaces Lmep 000000000 1 6 fault 00 00000000000000 8840 M000 000000000 OO 800000000000000000 7 initialize OO tine 0000000000000 1 8 locked Linen OOOO lineQ gg 0g00 00000000 1 10 0 1 OOOO O30 PPPOOUOU show interfaces 0 0 0000 PPPO LCPO O NcPOOOOOOOOOOOOOPPPOOOOOOO 816 0 od PPP H 1 LCPO OO up 089 LCPDHDDUDD 000 000 00 2 LCPO DO LCPOOOOOOOO 0000000000000 down O 00 Line OOOO 184 8 0000000000 PPP O 0 8 IPCPOOO up 00000000 0000000 085 8 ooo Ooo 0000000 4 IPcPoog 00000000 00000 PO O00000000000000000 down 0 ooo 000000000000000000000 show logging 0000000000000 0000 000000000000 OOo 3 00000000000000000 00000000000000000000
131. D45 RM memory ave 40 MERA FWRDO OOOO 8 0000000000000 00 00000 0 0 RM memory ave 2 CP buff ave S RM memory ave ENTRO D D 0 D lt Main Menu gt 0 D J 0 43 UDUD una RM memory ave CP buff ave s 100000000000000 30 4 000000000000 45 9 lt INFORMATION gt Ver 00000 ENTROOQOOOOOOOOOOOOOOOOOOOOOGO 00 0180000000 000000000 8 0000000000 0000000000000000000000 FWe Bpoo00000000000000000 po00000B4cxK0 00000000000 a a a 00000 0 SW BCUO BCU1 PRU0 PRU1 2D 00 O NIFO 11 51111 1411 po00000000000 ENTRgg00000000000 Mam Men gt 00000000000 odo 000000000 00000000000000000 ENTrRgo00000000000 Main Menu gt Q 000000000 O46 MODEL AX7808R 2 2 gt hb IE MODEL El FR EFA O47 00000000000 0 swg OS RE ENTR OS RE AX P6544 21 gt Ver 9 1 2 24 6 ARDER kE LE SWF LE 5 FR SwWHSZ SWii 3T U48 00000000000 0 Be
132. LE Slee 3 a EE IE Odd 0000000 show ip route 2 207 8 0000000000 Del 00000000 66500 00 0 690 0 8 5 3 DHCP O DynamicDNS 0000000 O10
133. 3 showiproute 0r 00D Bn D D a p a Oo a podd0000000000000 show ip interface 7 000000 Naugog000000000000000000000000 DU 000 OU EE eA 1 1 0 O00 D 000 DU D DU E Ea EE Lu D D D 00 OO 00 DU OOD Lr ooo OO 00 D u D 000 O 000 O 000 000 0a0 0000 podd0000000 0000000000000 1 00000000000 2 show ip policy 1080000080 00000000000000000000000000000 00000 0 009009000090 0 9 toky 0 00 POO 200145000000 D LU show ip policy interface tokyo 2 7 gt show ip policy interface tokyo lt Interface Name gt lt Filter List No gt tokyo 1 2 gt 197 8 0000000000 3 0000 00 00 0000000 Filter List N
134. 4 00000000000 keep nonevpn 00 00 00 000000000000000 110 1 0 00000000 1 dump protocols unicast all dump protocols unicast all ux OO000 G primaryMC usr var rtm OO00d0 Ort trace rt dump gz O40 MPLSQ 0000 IP VPNO 0000000 show mpls forwardingtableg 000000000000 show mpls forwarding table 0000 6100 gt show mpls forwarding table vpn Site B Total 1 VPN ID Site B FEC 192 168 113 101 32 Next Hop 192 168 7 7 Out Label 1048573 1048574 Interface Tokyo OSU MPLSOOOOOOOOOOOA MPLSO 0000 IP VPNO0000000000000000 MPESOOD 00000000000 OO ping mps 00000
135. CRC errors Layer 1 symbol errors Layer 2 symbol errors 10000000000000000 Vei 422 10008 88 80 0 0 0 00 00 0 1000000000 0000 1860 type0 0000000 0000000000000000 00 0 0 8814848000 Voli 4 2 2 1000BASE X0D 0000000000 D00000m000000000000 Voi notes interfaces 0 00000 000000000000000 1097 0 000000000000000000 0 3 show interfaces 0 0 0 0000000000000000 0000000 00000000 D D D D D Ec EJ SE E23 C3 L3 00000 Una 00000 00000 00000 00000 gt c E 8 4 4 10 28 5 10GBASE W LH D B H1 HI ED EE UE UI LI 10GBASE R 0 0 0 10GBASEWQQOOOGU0000000000000000000000000 0000 1 00000 3851000000000 LINELAN 00000000 s9000000000000000000000000000000000 2 p00800000000000000 176 ae 8 0000000000 8 11 10GBASE R O tocBASE V DD 0000 DD HD D una show interfaces 00 00 00 00 OO 00 O O O O g
136. timeout inactive 30 0 0 00 0000000000000000000000000000 62000 4 0000000000000 831 config show netflow netflow yes sample 2048 entries 0 4000 flow export version 5 timeout active 20 timeout inactive 600 e 111111 1101010001 destination 172 16 178 2 udp 1234 flow aggregation cache prefix aggregation entries 16000 timeout inactive 30 mask source minimum 24 mask destination minimum 24 destination 192 1 1 12 Oo port 1 1 2 config 265 8 0000000000 8 447 NetFlow Version 9 000000000 OP ADV 9 flow export version e 15 000000000000 832 config show netflow netflow yes sample 2048 entries 0 4000 flow export version 9 9 1 0000000000 timeout active 20 timeout inactive 600 destination 172 16 178 2 udp 1234 flow aggregation cache prefix aggregation entries 16000 mask source minimum 24 mask destination minimum 24 ipv6 mask source minimum 64 ipv6 mask destination minimum 64 destination 192 1 1 12 port 1 1 2 config 1 1P00000 UDP 16 8 33 0 config show netflow netflow y
137. 0 00000 0 a 99 El noo noo 3 3 E SE b elearipv6 dhep binding lt Q 000000000 2000000000 binding 00000000000 0000 gt show ipv6 dhcp binding detail Total 2 prefixes lt Prefix gt Lease expiration Type lt DUID gt 3ffe 1234 5678 48 03 04 01 11 29 00 Automatic 00 701 00 01 755 755 55 557200 11 22 33 44 55 3ffe aaaa 1234 48 03 04 01 11 29 00 Automatic 00 01 00 01 55 55 55 55 00 11 22 33 44 55 gt clear ipv6 dhcp binding 3ffe 1234 5678 48 gt show ipv6 dhcp binding detail lt Prefix gt Lease expiration lt Type gt DUID 3ffe aaaa 1234 48 03 04 01 11 29 00 Automatic 00 01 00 01 55 55 55 55 00 11 22 33 44 55 gt 8 0000000000 O20 0000000000000000000 000 DHePgo 000000000000 000000000000000 000000000000
138. NTPO000000000000000000000000000000000000000000000 ooo 840 NTPOOOOODO O OO O 1 200 00000000000000000000000000000000 2 O s 00000000 show calendar D 0 J0000000000000000000000000000000 3 OOOO DUDU 1000000000000 400 DUDU 1000000000000 set calendar O0 00000000000000 4 PPv400000000pmg0 0000000 123000000000000 271 DUDU Nga EIE BS DELE DEDE BEAT EET BE EE CIUS BE ET HH EEE ELLE HEU BEES EF ETLOE BU OU 91 0000000 92 00000000000 93 94 6 95 96 97 23 9 OOOO 91 DODODDO show techsupporti
139. 0 088 l RADIUS TACACS 00 a Da gamnadgnpnaand DU 000000000 2000000000 H a 5 9 a O a a a a a ooo a a a a a a a a a a 000000000000 0 0 I D root logout exit quit disable end set terminal 00 0 0000000000000 000 O 0 O 2000 OOOH 4 OBO OB 2 2 E 2 e 8 Lr Lr 000 O 52 00 0000000000000 00000000 0 00000000000 43 5 00000000 Hu gg 0000000000000 0000000000 allommand GEN 000000000
140. 6 nameserver 192 168 0 TEL C lt EEL 000000000 oo desreolvrt 0000 1Pg0000000000000000000 000000000000 00000 000 dns resolverQ 0000 1290000000000 ping DDD D D 5 O et Eu Eds ESE SERT El oO rr O O OO 00 UD 00 DU FT E ENE El El EX EEN El EJ EJ E O q EJ Cia Ea El El E El Es E a 000000000 213 8 0000000000 86 86 1 819 0000000000000 000000000 od 1 0000000000000000 Statusi O 1 00000 200000000000 000000000000 show ip static route Status 000 IFdownQ 0000000 200
141. O Vol 1 no test Vol 1 5 POS PPP Over SONET SDH 02400000000 line rdi NFo000000000000 00000080 5 POS PPP Over SONET SDHITI 0000000000 Vol 1 8 POS PPP Over SONET SDH 00000000 interfaces POS show interfaces 9 od rud r3 ON s a us H oO ETA So E L3 1 oO oo oe gt a a u A El ME 1 O j L3 El 2 r3 ER Ez c oO E j L3 on El oOo fe ES a y A E KA u 53 j L3 rs Of oOo E 2 1H oO a a Og n a aa as on H H 1 9 8 oO E gt Oo JA osuna md o E 8 LE o T Co o 53 YN So 5 3 53 53 e El DA JG ocn 1 ooo eg E E E m oe i Oo 5 a L3 a E Es Lr oOo Y E E Oa ly LIE DO oOo l mod ooo 2 2 o car ooo os 7 52 LE BOGOR m 1 lo oo
142. show logging Y 300000000 7 initialize 1 0 0000000000000 D 0 8 locked 8 4 10BASE T 100BASE TX 1000BASE T 0000000000 od 10BASE T 100BASE TX 1000BASE T 00000 1 LINELANOOOOOOOOGO 351000000000 s9000000000000000000000000000000000 2 89 10BASE T 100BASE TX 1000BASE T E ED B D B D D D D D D UI U OOOO od od show interfaces 000 0000000 0000000005000 80 400000000000 000000 ud Link down MDIQOUO0O0000000000000 Oo LII Lr LIC Yoo 1 1
143. 00 0 0 0 tokyo O00 IPOOOOO 3ffe101 105 0000 0400000000000 0000000 0000000000 1 Q000000000000 2 show ipv6 policy interface tokyo O0000 gt show ipv6 policy interface tokyo lt Interface Name gt lt Filter List No gt tokyo 40001 40002 0 OJOOOOOO Filter List No 40001 40002 4 3 00000000000000 00 t show ipv6 local policy interface tokyo 40001 400020 0 0 O DUDU gt show ipv6 policy policy interface tokyo 40001 40002 Interface Name tokyo Filter List No 40001 forward packets protocol dp ip source 3ffe 101 101 3ffe 101 1ff ip destination 3ffe 201 101 3ffe 201 1ff current policy route Policy Group Name v routel Output Interface tokyo3 Next Hop IP address 3ffe c01 2 Interface Name tokyo Filter List No 40002 forward packets protocol dp ip source 3ffe 401 201 3ffe 401 2ff ip destination atte 504201 SffecbOTc2ff current policy route Policy Group Name v6route2 Output Interface yokohama Next Hop IP address 3ffe 601 2 5 6 000 00 0 H show ipv cache policy route1 0 1 D O O 00 227 8 00000000
144. 208 932 290 94 294 941 0000000000 294 942 207 943 302 944 1 1 304 95 MCOOOOOOOOOO 305 951 0000000000 305 952 0000000000 305 96 000000000000 306 9 6 1 0000000000 86 OOO AX7800R J 306 962 1 PRUO NIFD D D D 307 97 00000000 311 971 311 972 POST D 314 111111 11 111 319 104 DD 320 102 0000000000 321 323 00A 0000 324 333 vii 0000000 0000000 00000000 11 12 p0000000000000 1 000000 1 1 11111111111 1 1 0xNgo000000000000000000000 11 0000 11 0000000000000 O 1 1 0000000 od 1 00000 0000 0000000000 2 0000 TCPO IPDHDDUD D UD D telnet 0 O D 000000000000 O 1 1 0000000 Ab AE 5 E2 U 4 5 VOAEIOMEAROAE 4 Aa Fl SR O74 VLES 13 avy FRE BE 88 gt
145. Multit 192 10 10 1 DVMRPJL 2 Multi2 192 10 20 1 DVMRP Probe amp DVMRPJL 2 192 10 10 5 03000000000 show ip dvmrp route O0 ODO 0000 00000000000000 98 6 0 00000 0 00000 000000 show ip dvmrp route 00000000 6 47 show ip dvmrp route 192 5 5 100 RPF Information for 192 5 5 100 lif multi1 192 3 3 1 Downstreaml face Forwarder Depnbrs 192 1 1 1 192 1 1 1 DepNbr 192 1 1 3 DepNbr 192 1 1 4 192 2 2 1 192 2 2 1 1 DepNbr 192 2 2 2 gt 192 2 2 2 DVMRPJL 2 192 1 1 3 DVMRP L 2 192 1 1 4 DVMRP L 2 192 3 3 192 2 2 1 EN DVMRPJL 2 192 1 1 2 1 192 5 5 100 l 4 2 RT AT IGMPO 000000 6 5 4 4 0000 00000 018000000000 show ip igmp interface JD 0000000000000000 6 Address 00000000000000000000000000000000000 podo0o0000Pmpo00000000000000000000000000000 enable DVMRPJ000000000000000000000000000000 enable 0 DVMRP enable 0000 000000000000000000000000000 podd0 000000000000 Group CountlOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 6 po0000000000000000 VersinQ 6
146. 2 5 SHUTDOWN IR SHUTDOWN FWRD BACK DOWN Yes PN 6 PYes No i ENTR i ENTR lt Main Menu SHUTDOWN now i SHUTDOWNSE T BOOT HALT 36 4 000000000000 49 1 1 po000000000000000000000000 Main Menu gt O Alarm 000000 po0000000000000000000000000000000000000000BCU0 D ALARMLEDpg000008000000000000000000000000000000 ERRoRLEDOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 0000000000 90 Es E70 Een 0180000000 9 1090 981 0000 00900 00900 9000900900 00 D gpupnnuapupnpna uapunpnpu 8 1 Man Menu gt Q 0000000 4 13 Ayt VIDRR FIFILA 7 2 KAR 6 NIF ENTR 6 NIF 01 ENTR f Msg 90002001 NIF stopped beca Main Menu 22 22 2 2 gt hb 2 2 gt hk LE TI LAIL X gt FARE EBR ISLAN gt 2 2 8 1 GET 10
147. 300 OSPFv3 0000000000 8 9 2 unm O 011000 000 0 65 3 000 0000000000 show logging BFDOOOOOOOOOOOOOOOOBFDOOOOOOOO BFDOOOOOOOOOOOO 8 9 6 3 oOSPFv3 000000000000000 DRODO PtoPQOOOOO 500 00 show ipv6 ospf interface Interface Name BackupDRU OO DR Other HH D B D 400 sp 4 Neighbor List 0 0 0801010000 DROOOOOOOOOO 600 000000000 El DROOOOOOOOOO FulOodoogd 700 5 Neighbor List 00000000000 200090000000 00 00000000 8 0000 700 237 8 0000000000 000000000 od 6 00000000000 OSPFvs OOO 00000 7 OSPFv8 PD 000000 show ipv6 route all routes 0 InActiveQ 800
148. 4 SIL F 4 VAFFORAIL RIP OSPF BGP IS IS amp E OBERE Tox RO 94 12 2 AOX B S J CEA xz BEERS U 4 y 0 4128 2 T AHH 2 4 JL 2 LL 2 DHCP O0SHE OREAR EIER LX 01000000 O O O O O PRUD NIF Line D 1 3 d show loses JU 4 192 5 8 0000000000 oooooooooooooooooooooooolna ngagagi 020 000000000000
149. 813 2 config show sflow sflow yes destination 192 1 1 1 udp 6455 2 2 7 59 gt BREENTHS CE sample 128 port 1 1 config 1 0000000 686870913 000000000000000000000 00000000000 209 260 8 0000000000 3 814 config show 81108 sflow yes destination 192 1 1 1 ARBRE C1 2 RAEE Eh Tbk sample 32 port 1 1 port sample 512 port 3 1 port sample 2048 config 0 a a 11 11 1 11101 00 0 O PRUD L E U U L 0000000 0000000000000 Co Ea jam a Oo Oo a Dopo ono 000000000 8 15 Odo Do 0000000 4 config show sflow sflow yes destination 192 1 1 1 sample 32 port 0 1 port sample 512 port 1 1 SEEEIXSPRUM 2 LI
150. BackSpace Ctrld jam a a 111 1 3 000000 0000 00 1 00009000099000 0 UUDUDDDDDDBDDDUDDDBDBDDDUDUDUDDDDDDDUDUUDDDBDDDDUDDUDUDUDDDUD Den 00000 00000 O DIDD 3 0000 srep OO00 312 show sessions 0 00000000 show sessions 1 HU show sessions 00000000 9 D B 11 OH D D show sessions OOO 314 show ip 0000000 show ip interface DL 3 15 show ip interface sottO QO 000000000000 show ip interface 000000000 sort I OOOOOOOO a a oOo ooo O O OO 3 12 show sessions 0000000 gt show sessions operator console 0 Jul 7 10 57 30 operator aux
151. ET EJ a B B E oOo oOo 6 8 8 2 000 000000 5000000000 1 1110 0 00000 0 000 00 000000000000 2 000000 DUID DHCP Unique Identifier 0000000000 3 dhcp6 server interface 00000000 4 DHCPOOOOOO 5 000000 209 8 0000000000 8 7 G ZE UA gt show logging AVY KICK 88 TERR 5 PBN ZEE Ay DIU WENGE A Ye RDE show ipv6 interfacelz amp 2 41 lt gt 2 3 50 2r AOUP DOWNO TERES 5 2124 AL HARI 04072 5 18 8 1 859 68 f auwmenco 81 PERL UP DOWN E 8 4 2 2 3 8 IC E TEER DHCP H SODA RS TERE ESTES ARO OE 121872 L FREORE CHEESY show ipv6 dhcp bindinga v 7 KICKS ARO Z 1883 576 T lt 0 8 FEEL TAL 6 L lt HEV 0105085868 30
152. gt show ip mroute Total 5 routes 3 groups 2 RPs 5 6 2 routes S sc mu A AA TENGE Dr cee Group Address Source Address Protocol Flags Uptime Expires Assert 224 100 100 10 q 92 71 1 3L SM F 02 00 02 30 01 00 in coming Multi1 192 1 1 3 upstream Direct Reg Sup 608 downstream Multi2 192 1 2 3 uptime 02 30 expires 00 40 224 100 100 20 192 1 1 1 SM F 02 00 02 30 01 00 in coming Multi1 192 1 1 3 upstream Direct downstream Localhost 127 0 0 1 Register to 192 1 5 1 224 100 100 30 192 1 4 1 SM F 02 00 02 30 01 00 in coming Multi1 192 1 1 3 upstream 192 1 1 5 downstream Multi2 192 1 2 3 uptime 02 30 expires 00 40 4G o2 routes SSSR AA UE fesse Se sees Group Address RP Address Protocol Flags Uptime Expires Assert 225 100 100 10 192 5L SM R 02 00 02 30 01 00 in coming Localhost 127 0 0 1 upstream This System downstream Multi2 192 1 2 3 uptime 02 30 expires 00 40 225 100 100 10 19 2 BAL SM R 02 00 02 30 01 00 in coming Multi1 192 1 1 3 upstream 192 1 1 2 downstream Multi3 192 1 3 3 uptime 02 30 expires 00 40 gt 6 5 3 DVMRPO I DULL OOOO DVMRPpo000000000000000000 00000 018000000000 show ip dvmrp interface JODODOODO 0000000000 6 Address 0000000000000 00000000000000000000000 DVMRP podd000000000000000000000000000 DVMRP enable 00000
153. iyvep 000 0000000000000 000000000000000000000000000 D 6 goo0o000000000000000000000 8 00000 6 Voll 13 11 40 ps 0000000 pod00000000000000000000000000U show netstat routing table numeric show ipv6 interface show ip interface JODOD0 000000 000000000000000 106 6 0 00000 0 00000 000000 668 OOOOOOOOOOOOOOG gt show ipv6 interface TokyoOsakaT TokyoOsakaT flags 80b1 lt UP POINTtoPOINT NOTRAILERS NOARP MULTICAST gt mtu 1280 inet6 3ffe 1234 5678 9abc 64 gt fec0 1234 5678 9abc 64 physical address inet 192 168 100 1 24 192 168 100 2 show netstat routing table numeric Routing tables Internet Destination Gateway Flags Refs Use Interface OOOO 192 100 24 link 3 UC DMA 0 0 TokyoNa
154. show dhcp giaddr 0 0000000000000 1P0000000000000000000 relay interface 0 00000000000 IP0000000000000000000 83 6 000000 00000 000000 6 25 DHCP BOOTP giaddr gt show dhcp giaddr interface Departmentl DHCP GIADDR lt Departmentl gt 130 3 3 1 show dhcp 80 J O0 00000000000 BooTPOOOOOOOOGO 0000000000 0 10 0 00000 00 LH 0 0 relay agent address UI 000000000000 BEB f Depar tment1 170 1 1 1 2 2417 DHCP BOOTP 170 2 2 1 F7 2 BER 170 3 3 1 2 7 PT O DHCP BOOTP In 6 26 DHCP BOOTP giaddr 0 0 gt show dhcp giaddr interface Departmentl DHCP GIADDR lt Department1 gt 170 1 1 1 00009000 80 0DO000000000000 0 8 5 2 u 6 3 10
155. 0 0 po0o0000000000000000000000000 000000 u aut a 0000000 0Ngo0000000000000000000000000 942 00000000 1000000000000000000000000000000 PRUgg Niro a 01800000000 0N2 000000000 86 00000 0 co0000000000000000000 19000000000000000000000 000000000000 840000000000 0000941 00000000000 ONgO 0001000000000 8 000000 AXT7800RTTI 0000000 000 0Ng00000000 8 0 0 0 000000000900 927 000 86 DU ttt ex 9 106000080 eH 30000 GE 60002 V D free standbya v v 7 4 Z T gt A Y ES RILA 5 66 8 set model v FET 207 9 OOOO OOO 1000000 093 1 O000000000000000 0Ng000001000000000 00 8 Ax7s00RQ 30000 Bcug000000000000000
156. 00000000000000 a Tera Term Pro Version 2 3 Tera TermPrg 00000000000 Tera Term Proof DD 0000 D BO D UU pog000000000000000000000000 Tera Term Pro Tera Term DU 1 000000 4 RS 232C RMpo00000Rrs22c 000800000000000000 000000000000 000000 0000000004Tg0000000000000000 argopo0 0000000000000 DSuws pao 00000000 000000000000 podp00 00000000000 142 po0000000000 25889 EL AR FT y 28680 EL QUA E f EvER E84 EVER E84 1 5 SG 5 GND 2 3 SD 2 RX 3 2 RD 3 TX 4 7 RS 1 DCD 5 8 65 8 CTS 6 1 CD 7 RIS 7 6 DR 4 DIR 8 4 ER 6 DSR usu 1 0 1 2 00
157. 52 pagado 0 00000 000 0000000000000 000000 000000000000 000000 0000 00 04080000 pod podd 080000 00 0000 000000 000000 000000000000 00000000 00000 70000000000000000000000000000000000000000000 010 dad D 000000001 5 3 0 og show ping show ip route 000000000 OOOO ping 1996 1 og reload Og 0 2 9 44 5 00000000 1010000000 4 1000000 054 00000000 2 Hu guru og 000000000 show ping ipv6 show system 1 0020000000 show ip ping show ipv6 route ping ipv6 1 ping 10 10 10 10 0 3 000000 055 00000000 3 E gut 00000000 show ping 10 10 10 10 000000000 reload reload UD 0
158. 9 200 DVMRP O O 000000 10 show ip 1 111110100009 S100 co0000000000000000000000000000S100 DVMRP JU D 1 0000 0 0 show ip dvmrp neighbor OOO 20000 3 ip dvmrp route 511990 000000000 20000 000000000000000 UUUDUUDUuD 20000 4000000000 20 show ip 61111110100 00 S100 GIOOOOOOOOOOOOOOO 100 DVMRP O O 000000 po00000000000000000 0 show ip dvmrp neighborQ DOO 10000 4 2 show ip dvmrp route S1 0 00000000000000 8 0000000000 400000000000000000000000000 SEI ESTE ms 2 CKE su 0 1 ECT Ee ee E OO 1 2 o 0 E t3 E 4 1 mi Ooo 10 3 Ea re Ee Es Lj a OO
159. D jer Basic LDPH 1111111100 110 4 Basic LDPOOOOOO 000 VPO000000000000 0 691 VPN 00000 50 Basic LDPQ O po0000000000000000 Basic LDPOOOOOOOOOOOOOOGO e 000 UPHDUDD Basic 000 LSPOOOOOOOOO ODO LDPOOOOOO DOWNg000000000 000 e LsRO0O000000C 00000000000 LsROOOOOOOOOO 0000 O 7H staticlSPO DO 000000000000 static LSP LSPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO U D D D show mpls static lspOOOOOOOOOOOO static LSPO 80 static LSPOOOOOOOOO O 8 static LSP static LSPQ 000 1 8 D BO DDD DD J show mpls static lsp status 0 D 0 static 246 8 0000000000 LsPp0000000000000006 91 0 VPNMPLSOOOOOOO D 7D static LSP O OOO 0000000000 staticLsPOOOOOOOOOOOOOOOOOGO e staticLSP 000 UP policy base static LSP D H B E D policy base static LSPO 0 statcLSPOOOOOOO 10000000000 2 e static LSPQ O O O Down ada dao a000 000000 O90 LP000000
160. show ip interface ipaddress J DUUDDDDDDDDUDUDDDDIP4aDDDUDDDDUDUDDUDDDDDUDUDDUDDDBDBDDDDUDUuDU 6 0 00000 0 00000 000000 0000000000 623 gt show ip interface tokyol flags 80e3 lt UP BROADCAST NOTRAILERS RUNNING NOARP MULTICAST gt mtu 1500 inet 172 16 10 1 24 broadcast 172 16 10 255 inet 172 16 20 1 24 broadcast 172 16 20 255 inet 172 16 30 1 24 broadcast 172 16 30 255 NIFO LineO UP media 100BASE TX full auto 00 12 E2 d0 97 d8 Time since last status change 00 00 30 Last down at 08 21 16 21 01 pod0000000000000pm8000000000000000000 ring n D 0000000000000 624 KEE Ay 8 0 488 LANA RB p oinsority h 6 3 9 DHCP BOOTPD D DID DL D D UO UD D D D 0000 DHCPO BOOTPOCO0O00O0O0O00OC00000000000000000000000 Jag DHcPg relaylist00 000 DHCP BOOTPQ DHCP 1P00000000000 po0000000prmg400000000000000000
161. 0000 Dad 11000 00990000 DACPpo 00000 1P0000000000000DHCP O poddg000000000000000000000pm8000000000000000000 84 6 0 00000 0 00000 000000 11011 show ip dhep server 000 81920 statistics QOOOOOOOOOOOOOOOOOOOOO dhcp subnet dhcp host D LL D U D 0 627 OOOO gt show ip dhcp server statistics DHCP Server use statistics address pools 10 automatic bindings 0 Gua O20 000000 Dal 000000 P00000000 000 0000000000000 120000000000 show ip dhcp binding 00 pogo 000000 0000000000000 IPg00000000000 6 28 000000 IP00000000 gt show ip dhcp binding lt IP address gt MAC address Lease expiration Type 192 168 200 9 00 12 E2 48 e9 2d 01 12 06 19 59 40 Automatic 192 168 200 99 00 12 E2 92 7 b9 Manual gt 6 3 11 DNSOOOUUUUUOUO 0000 00000000000000000000000000 Dad 00000000000 show dns relayQ 00 80000000000000000000 dnsresolverg 0000000000 0 629 000000 P0000000
162. 000000 00000 000000 0 St 0 St 0 0 O D u 00 O D u Lr D 6 75 show isis adjacency 0 show isis adjacency detail Level 1 adjacencies Interface Officel Interface System ID 0000 87c0 3655 Speaks IPv6 Area 49 Circuit ID 0x04 Priority 64 Interface Address SNPA Hold Timer 192 168 00000 Broa IS Type Type 9s Estab Ta ate UpOQOOOOOOOOOOOOOOOOOOOUPOOOOOOOOOOOOOOOOOOO ate Hb show isis database 1 0 O U dcast State Up 00 00 87 c0 36 55 lished Time 2003 07 01 15 30 00 677 BFDDBODDDULULULULULULULULLOoP BFDI 0000 pvs000000000000000 880000 00 0 00 0 show bfd session ipv6 e 0 O O Init D Down DU 000 DU 000 e DU 000 0 O O 0 0 O 0 0 DU 0 0 O O 00000 O OSPF 00000 00000 00000 00000 rr Lr FDO O 0
163. 1 Jul 7 10 13 01 ppp0 200 10 10 2 operator ttypl 2 Jul 7 10 49 49 192 168 3 7 operator ttyp2 admin 3 Jul 7 11 06 41 192 168 3 7 gt show sessions 00000000 grep 00000000000 3 13 gt show sessions grep admin operator ttyp2 admin 3 Jul 7 11 06 41 192 168 3 7 gt O 3 14 show ip interface 0000000 show ip interface summary tokyo UP 192 168 0 1 255 255 255 0 nagoya UP 192 168 1 1 255 255 255 0 osaka DOWN 192 168 2 1 255 255 255 0 fukuoka UP 192 168 3 1 255 255 255 0 sapporo DOWN 192 168 4 1 255 255 255 0 gt O 3 15 show ip interfaceQ 00000000 st 80000000000 gt show ip interface summary sort fukuoka UP 192 168 3 1 255 255 255 0 nagoya UP 192 168 1 1 255 255 255 0 osaka DOWN 192 168 2 1 255 255 255 0 sapporo DOWN 192 168 4 1 255 255 255 0 tokyo UP 192 168 0 1 255 255 255 0 gt 070000000 show interfaces 0000000000000000000000 3 000000 3 16 showinterfaces DL DD Uu 0 DU DD UL B D show interfaces nif 0 line 0 show interface log gt Den 00000
164. 41351104 6 83 LSPO WER 8 11 2 4 8180 8 11 2 5 BHR Hana WAS AULAS Z lt static LSP 41H LDP zc f FH LDPE y Up Basic LDPE y 0 DREAMS 8 11 2 6 BFR 3124 2 3 ERES 6 EE static LSPO 2 4 ELOJ BETER static LSPO DREAMS 8 11 2 8 5 AT Ala Up KEE ER AY L A ZALSPZ R BUL Cu AUNT 4 VIO IRE THEIRS Z 2 0 8 11 2 10 58 LDPE y Y a Down LDP y 310 Down ARES 6 8 11 2 9 3H amp RIL Up HERE 1 28 2 x lt XA Down 5 6 815 ZA O30 MPLSUD IPv40000000000000000000 069 1 J VPNMPLSOOOOOOO DSUMPLSUD IPvpo000000000000000000 000000000000000 MPLSOOO IPMAD 000000000000 000000000 00 IPv000000000000000000000 static LSPOOOOOOOGO M40000000000000000000 86 IP vwpog000000000000000000000000 O40 00000000 069 1 J VPN MPLSOO00000 04 MPLSpO0000000000000000000000 podd0000000000000 5118 1010100000000000 sPg00000000 D 60 Basic LDPU 245 8 0000000000 e Static LSPO0O 000 LSPOOOOUUOOD l 70 static LSPOOOOOOOOOOOOOOOOOOOOOOOOO O50 LSPO 1 L traceroute 000 00 00 0 0
165. D 0 O O B 0 114 00000 00000 O 0 00000 D AdminDown OOOO B po0000000000000 6 000000 00000000000 O 6 76 show bfd session ipv6 gt show bfd session ipv6 3ffe 501 811 10 260 1dff fe22 f298 Local Address 3ffe 501 811 10 260 1dff fe22 f297 Remote Address 3ffe 501 811 10 260 1dff fe22 f298 Discriminator Local 10003 Discriminator Remote 10004 PRU No 5 3 State Up Operating Mode Asynchronous Echo off TxInterval 150 RxInterval 200 Real TxInterval 160 Real RxInterval 220 Detection time 600 RM packets counter Received packets 5 Transmitted packets 32 PRU packets counter Received packets 840 Transmitted packets 780 PRU packets counter since last Up Received packets 320 Transmitted packets 150 Last session up time 12 15 17 58 37 Last session down time 12 15 13 32 02 Last session down cause Administratively Down Up count since boot 2 Session Application STATIC Next hop 3ffe 501 811 10 260 1dff fe22 f298 g
166. DU DU DU DU DU DU oO OOo O 1 p000000000 2 DNSO DD DHCP po0000000000pm80000000000000000 pod0000000000000000pm80000000000 000000000 00000 rasgo d000000000000000000000 podd0 000000000000 00000000000pm8000000000000000 000063 pg00000080000000000000000000000 3 DNSOOOO DHCPQOOOQOOOO000UU HUBO O 0 000000000000000 4 pingi 0000000000000 00000000000 000000000000000000 000000000 209 8 0000000000 pep 0000000 D 1 1 p00000000000 2 show ip route 000000 0 DNSDUUU 0000 0000 OOOO 0000 OOOO
167. OOOO 00 DU UD 00 UD 00 UD 00 DO Oooo 166 9 0 podd00000000000000000000002 2 1 L3 L3 L3 L3 Oooo L EE El Oooo Oooo Oooo Oooo Oooo Oooo po000000 0 po00000000000000000 paswwrdagg0 00000000000 clear password 0000000000000 a a mun jiji J OOOO 8 0000000000 081 password userl Changing local password for userl New password New password O20 UI L 824 RADIUS TACACS 111 111 1 1 1 1 0 0 U RADIUS TACACS D00000000000000000000000000000000 1 RADIUS TACACS Q 000000 png 0000000000 RADIUS TACACS Q OOOOUU00000000000000
168. e AX7800R 0 9 9 0000 93 ID ILU D ELO EE 1 1 D 93 1 1 1 10 0 11 1 ONIJ UU l 00000000 5 8 PRUOOOOOOOOO 0000000000000 01800000000 BCU0 D D AX7800R OO 8e0p000000000000000000 D 910 OOO BCUQ OOO 360000 Y BEL 3 561086 standbya v FR 5 gt 561066 600000230 9 NL 02 00000 Y IHIH FEB ABCUOIE 360 P free standby a v 7 FEAT FEJBA 5 Trees 000 10000 000000 8 00000000000 0 00 showsystem gt show system Enter DUUUDDUDDDDDDUDDDUDUDUBDDDDUDUDDUBCUODUDDDUIII BC010 00000000 D UB 283 9 OOOO O 9 11 show system 0000000 sh
169. lt ooo Es po e 5 e xo E Y Bud o aq DO ne Y Oop I O Os o a El A a Y ES El El a a received D LSRO O OO 0000 Basic LDP otification message received otification 1 0000000000 0000000000000000 200000000000 Basic LDPQOOOO nnn QO Basic LDPQOOOU0O0U00 0000000000000 D 0000000 BasiceLDP 000000000 DUDDUDDUDD BasiceLDP 000000000 static LSP 1 D LI D show mpls static 1sp 0 Y O O staticLsPOOOOOOOOOOOOO O 6 97 static LSP O O O gt show mpls static Isp status Total 1 Static LSP ID Status Primary Secondary Repair method FEC 1 primary Cup Local auto 10 1 1 2 32 down Td LYS amp SHEL TC PEEL 08 UL policy base static LSP VPN MPLS D D D D show filte flowgn 0000000000 125 6 000000 00000 000000 6 98 MPLSOOOOOOOOOOOOOOOOOOOOOOO gt show filter flow interface tokyol detail lt Filter List No gt 10 Using Interface tokyol in ip source any ip destination 192 16
170. show ipv6 mcache 0 1 D D netstat multicat p 0000000000000000000000000000000000000 0000000000 downstream 0 0000000000 6 8 2 18341 1 DUDU UU D 683 Mp popg000000000000000000 show ipv6 meache J 1 1Pvgog000000000000000000000 0000000000 00000000U0 netstat multicast DN O00 0000000000000000 O 00 netstat multicast 0 0 00000000000000 0000000000000000000 O 6 78 showipv6 mcache 00000000 gt show ipv6 mcache Total 1lroute Group ff15 2 upstream TokyoISP downstream Tokyo Osaka Uptime 00 O 6 79 netstat m 20 Expires 02 40 ulticast 00000000 gt netstat multicast Virtual Interface Table is empty Multicast Forwarding Cache is empty IPv6 Virtual I Mif Rate 0 0 1 0 2 0 3 0 IPv6 Multicast Origin 2001 db8 100 nterface Table PhyIF Pkts In rego 0 TokyoISP 0 Tokyo 0 Osaka 0 Forwarding Cache Group f15 2 Total no of entries in cache 1 116 Source 2001 db8 1 Pkts Out 0 0 0 0 00 Packets Waits In Mif Out Mifs 0 0 i v3 6 00000 0 00000 000000 2001 58 100 20 27 KUA Unos 32 7 en PC Pc N O O M57 2 0 IPV6 JU ARRA Fr 4 1 ZV Z27FvA 15 2 ee TER O o 7 4 6 8 2 PIM SM 1 D U HI U 0000 IP vp0000000000000000
171. 00 0 00 0 OOOOOO0 00 0000 0000000 000000 000000000000 10000 00 exe annnnnnnnnnnnnnnn 000000000000 0 0 0 6 6000000000000000000 extema 0000000000 SONET SDH F1 B Bd d B DH 000000000000 0000000000000000000000000000 1000010000 vei 424000000000000 L BIP1536 P BIP8 Vol l 49 4100010000000000 Hu WANG 0OGBASE WI 0000000000 Vei 424100000 WANGOGBASEWIID 0 0 00000000 B sw LIILILILJJLILI T o Q gt Y 2 w F AooOoO ooo oo ooo ao 4 ooo ooo ooo ooo See mad 179 8 0000000000 od od
172. 1 507 2 0 JU ZQ show trace ppp historya FAS F 1 BRE TO O show trace ppp history 8 0D00000000000000000000000000000 podd0 000000000000 00000000000000 8 0000000000 85 1 111 1111 L 85 1 111101111 01 0 8300000000 1 IPP00 000 00000000000000 2 00000000000 3 YO 0000000000000 OO 1 000 20000080000 000000000000000000000000000000 pod 0000000000000 00000000000000000 poooo0s ag0 000000000000 0000000000000000000 Pg00000000000000000000000000 podo00000 000000000000 pod 000000000 000000000000 000000 191 8 0000000000 NT LY 43815 gt X y gt 22 6 00 L 180 PRU NIF Line VR 50 07 AYER DIED 1 71 908 8 3 VR SEO 07 Acyt VB X gt 2 LY 3 AY EER 04072 gt DERIT ES GEL Ey ping lt URSA SELES 8 4 RY RI 94 Y 8 2 1 A0 MERE IAE HERA F Z YE FORA JU 2 FCR FZ 2 fal G Bul BETA show ip arpa gt RIZ show ip route v 9 297 KEBAL HALEY SUR MERIL E FIAR A Ku 27 FLARE fAFREO PAYED
173. 8 U ET config login user test allow commands show ip 3 555 gt 2 5 03 show ip 08 21 23 p 67560 show ip route amp a a FIFA shn 3 7 show ipv6 route oO IXY FIs gt v 107 KITA THR gt Z U 037 RADIUS TACACS TOO OO000000000000000000 TACACS p000000000000000000000RADIUS O 000000 RADIUS 0 0 00000 TACACS 00000 podd000000000000000000000000000 authorization 800000000 pod0000000000lekapo0000000000000000000 authorizationg D D 50 5 00000000 9 914 config radius 192 168 10 1 key RaD 001 config radius authorization config show radius radius yes radius authorization radius 192 168 10 1 key RaD 001 0000 00 0 000 1921681 00 0000000 Rad 0010 00000000000000 po000000 D 945 TACACS OD 00000
174. JU 731 2 3 2 2 2 ROI 974 gt 2 2 E 2 2 FRY ROI 9574 gt 8 ANY 2 2 2 0 9 5 O0000000000000000000 00000 000000 00000000 000000 NIF NIFO RJ49500000000000000000 000000 NIFO RJ450 000000000000000 0000 A BEE 0000000000 Voll test interfaces D 0000000000000000 O10 1p
175. fe80 13 1 Office3 80 14 1 Office4 fe80 64 fe80 20 1 Offices 0 0 Direct 51m 278 fe80 20 1 128 vil localhost 0 0 Direct 50m 30s 295 gt 110 101 10 0 0 O000 O ping ipv6 lt IPv6 Address specific route source Source Address 000000000 000000 pingipv6 0 lt Source Address gt DU IPv6 HH D D D 00008 000000000000000000000000000 000 D aD 104 000000 DACPO 0000 0 5 6 000000 00000000000 po0000000000000000000 8192 O D show ipv6 dhcp server statistics Y O D dhcp server host 000000000000000 66 gt show ipv6 dhcp server statistics DHCP Server use statistics prefix pools 100 automatic bindings 0 manual bindings 0 qna gt O20 000000 Dal 0 5 O et
176. gt gt show cal Wed Oct 29 17 21 15 2003 gt bin date Command not authorized gt 921 guest show whoami guest ttypO 2 Aug 6 14 17 03 10 10 10 20 Home directory usr home guest Authentication RADIUS Server 192 168 10 1 Class Command list Allow Deny reload close enable gt gt show cal Wed Oct 29 17 21 15 2003 gt reload Command not authorized V 922 testVOOOU0U00U gt show whoami test ttypO 2 Aug 6 14 17 03 10 10 10 30 Home directory usr home test Authentication LOCAL Class Command list Allow show ip Deny 2 gt show ip route 1 gt show ipv6 route Command not authorized V 5 00000000 527 010 00 cog00000000000000000000000000000000000 telnetO 7 poddo0 000 000000000000 0000000000000000 020000000 000000000 telnet ftp0000000000000000000000 7 O 923 telnet 11111 D D 10 10 10 10 Y E ERA telnet ftp2 24 Y gt telnet ftp x 3 0000 i DOBE OB O DO DB 0 D 00 0 000000000000 0000 0000000000000 lU 000000 H H HRHHRRHRRRREHRRREHRRHRRRRHRRHRRRHRRRHRRRHHRHHHHH Warning Warning Warning This is our system You should not lo
177. pod 4080000 00 0000 000000 000000 000000 0000000000000 Dodd 00000 00 0000 000000 00000000000 085 0000000 Hu gut oo IBI E ET 0 010 10 1010110110110 CP PRU NIF CPO PRU NIF I UU D U dump cpl dump pru dump 0 dump 1 1 OOO 101 1 0 00000 dump cp dump pru dump nif 000000 10000 0 CPO PRUD Bj B U 00000000000 primaryMC usr var evtdump cpevt lt 00000000 000 lt gt lt 1 1 1 HOUO000O 86 OOO lt 000000 lt 80000 86 000000 lt 0000 lt 800 0 0 var dump nif lt NIF gt lt 0 D 0000000 00000 00 gt 00 OO MCp 0 secondaryMC var dump ut nif lt NIFOO gt lt O000 gt 00 0 lt NIFOO ONIFOOO000 200 lt 0000 lt GOO 0 0 0000000000000 var dump pru lt PRU QO gt lt 00 000000 00000 PRUQODODO oo gt 00 00 MCpg E 0 secondaryMC var dump uuuuu 00000800000 pru lt PRU gt lt gt 0000 000000 8 1 1 0 1 1 secondaryMC var dump pru lt PRU Y lt gt 000 gt U lt PRU 0 gt
178. show ipv6 ospf neighbor 1 OP BFoO 1 1 1 1088 OD 00000 0000000000000 BD0000000 00000 6 000000000000000 BD000000000 00 Ue000000000000 DO Down 000000 0000000677 BFDO0O0000000 00000 0 9 010000 0 00 112 6 00000 0 00000 000000 6 73 show ipv6 ospf neighbor gt show ipv6 ospf neighbor Domain 1 Area 0 0 0 0 Neighbor Address State BFD Router ID Priority Interface fe80 1000 00ff fe00 2001 Full DR 41572 Ga O T 1 office02 fe80 1000 00ff fe00 2003 Full BackupDR D 172 16 10 12 1 office01 fe80 1000 00ff fe00 2005 Full DR Other Ui 1726210213 1 office01 gt 6 75 BGP4 000000000000 oP BGP 0000 IP v000000000000000 BGP4 q 00000000 D D show ipv6 bgp neighborsQOOOOO0U0U0UU00U00000000 O BGP Status Established 000000000000 00 Established 1 0000000 OO BGP4 QOQO000000000000000000000 BGP4 QO 00000000000 ping 0 BGP4 D UD U D C D U 0000080000000 00 BGP4 QO000000000000 O 6 PGP Statu
179. 000000 0 200 show ip rip gateway 300 RIPOOOOO 300 00000000000 00000000000 214 8 0000000000 00000000 DD gg po 0000 0000000000000 Dg po 0000 0000000000000 000 000000 dum 1 1 1 1 Co LI Co Co L3 Co Co Co LA Co Co EJ Co 0000000 5 6 B m er w ux 000000 primaryMC var rtm OOOO0 rt trace rt_dump gz 863 OSPF II UD U po0000000000000000sPFpg00000000000000000000000000 n 821 OSPFUDUUDDD oo do 1 200 2 OSPF D H U Ul D 0 BED D
180. 8 0 0000 6000 lt 0000 lt GOO cPooog 4 CPOHOOOUU00U0 00000000000 var dump cp00 lt Q 000 gt 00 OO 000000 0000 0 4 OO secondaryMC var dump cp00 000 gt 00 00000 U HOO secondaryMC var dump 690091 lt 0 0 D D D lt gt 800 00000000 var dump rmdump 0 OO MCI 0 secondaryMC var dump rmdump 0 0 0 a 20000000000 30 14000000 22 a 3 Oso D EXE CS E d LJ Co Co Co cam D 1000000000000 0098 140000000 D G p C3 r3 14000000 14000000 Es0000000000000000000 140000000 o x Dl XOXOXO XxX e r E p 170 8 0000000000 86 0 uuu muu uu OOOO OOOO OOOO ua gut oo guy Ha uuu uuu Hug 001 cen cPoogdg E4 CP 80000003 1132 Congestion pagada detectedon CP H1 D malti CP ooooogog
181. RORA F Z ETHET JL 2 CEA RT f RRR 9 show ipv6 neighbors show ipv6 route Y gt FIZ 2267 2 K efti iR RRR OWE ax KIRA FR Z RANK 7 FL ERARE L W PRELARE Alc th COSE RS 88 amp JI T4222nka RIPng OSPFv3 BGP4 IS Uy 8 4 F SRE 0 7 24257r A038 L TURU ERE HEA CK EEL Es ULCUS 24 2270 RABRGE ABO HERG 617 gt gt FOT HEL HEEL 0000 Ll 1 PRU NIF Line O O juu utu Oo show ipv6 interface uu O up down 51 OOOO jut JUUUU B 2 Lg EE BEI
182. gt show dns relay Primary NameServer 192 168 253 177 Secondary NameServer 192 168 253 178 Thirdary NameServer 0000 gt 85 6 000000 00000 000000 gt show interfaces OsakalSP2 2002 04 05 10 56 30 NIF2 active 4 port 10BASE T 100BASE TX retry 0 Average 0 800Mbps Peak 150Mbps at 13 53 03 Line0 active up 1008 55 TX full auto 00 12 E2 a8 c5 1c Average out 20Mbps Average in 10Mbps PPPoE OsakalSP2 connected Session ID e714 retry 0 Connected time 02 13 00 00 00 Connecting time 1234 56 30 Auto connection timer past setting 10 sec Service Name OsakalSPservicel AC Name OsakalSP01server Destination MAC address 00 12 E2 a8 fe 2c Source IP address 192 168 100 1 Destination IP address 192 168 35 2 Primary DNS server IP address 128 10 10 1 apak SAE SD Secondary DNS server IP address 128 T0 10 10 OF ELAS 6 CHAP Challenge timeout b 11 990 0000 PO00000000000000000000 DU ping I 000000000 O20 000000 181 UUUUUU show dns relayQ OOOOOOOODNSOOOOOOOOOOOOOOOOOO 8 5 4 DNsOOOOOOOOOOOOOOOOOO 1101 010 0
183. 0 6 66 DUID erase ipv6 dhcp server duid 00 gt erase ipv6 dhcp server duid gt 00000000000 000 p6 0000000 2000000000000 poo 20000000000 0000000000000000000000000000000 0000 OOO02000000000000000000000000000000000000 OOOO 0000000000000000 00 0 0 dhep6 server interface O O preference 0 0000 DUUDDUDDUDDDBDDUDUDUDDDBDBDDUDUDUDDDUBDDDDUDUUDUDUDUDDDBDUDU hcp6 server interface rapid commit JT OOOOUOOUU00000000000000000000 podo00000 000000000000 1 10 0 00000 00 0 0 SOLICITQGOOOOOOOO000000000000000000000 0 0 0 0 000000000 2 preference 0000000000 podd0 00000 000000000000 000000000000 070 0000 DHCP OO Boo 000000000 000000000000 UI L 0000 DH PN 000000000000 0000000000000000000 2000000000000000000000 0 0 ESI ESI ES 1 Oecd OO
184. 000000000000 000000 poda 000000000000 0000000000000000000000 Unknown host address lt IPO 0 00 gt 8000000000000 0200000000 000000000000 systempodgo00000000000000000000 OOO ftet D D c0000000000000000000 telnet RADIUS TACACS HH D ll Hl D D D 30 p00000000000000000000 RADIUS TACACS p0 00000000000 5 26 CLOOOOOOOOO RADIUS 000000 TAcAcS QGOQOU00000000000000000000000000 42 5 00000000 good 0000000 0000000000 0000000000000000000 poda 0000 000000000000 00000000000000000000 0 56 RADIUS TACACS Pp00000000000000000 PAY RO 9 odd 4 nZ4r gt wu ARG VEN AX 4 ana s 7 ps 1 3 LaS nZ4 DJ 71 4 TEE QYLEUAR YE ERA 7 7 FONR RADIUS TACACS FT 111 1011 1 100111 0 0 0 0 RADIUS TACACS G 00000000 podd0 000000000 000000000000 0000000000000000 podd0 000000000000 OM 00000000000 0000 root a
185. 10 1 OO 102 000000000 319 10 000000000000 10 1 OU 0 1 00 00 0 00000000 format me 0 0000000000000 PC CD ROM IPv4 IPv6z Y 2 DF Y IF hIPA ORE ftp 2 VR m7 Vy RAY FET format me aasan AYAKE ODOFA VE PY IFAI FES ppupdate a a 1 1 100009900 0 ppupdateQ 0000000000 Oooo E ssp BU ss EI SEI Oooo Oooo a a 0000 D secondary MCPOODO 000000000000 MCOOOOO MCT format 000000000000 000000 MCOo 00000000000
186. 8 9 2 I 0 0 0 LI po0d00000000000000RiPxgpo0000000000000000000000000 podo00000 000000000000 0 8 29 000000000 od 1 RiPngQ 00000000000 200 show ipv6 rip gateway 300 5 00000000000 RIPseH 000 0000000000000 000000 300 000000000000 236 8 0000000000 000000000 od 00 880 0000000 0 000000 dum si 30 r3 ct o 5 6 m c m gt O OO000 G primaryMC var rtm OO000 trace rt dump gz 893 OSPFv3 Q0 000000 000000000000 00000SPvw8000000000800000000000000000 OSPFv3 000000 8 30 oo OO 9 1 0 110 0000000000 200 4000000000 1 0 1
187. Action lt ACTION gt FREE gt PRUx x 0000 0 000 287 9 OOOO 00000000 ONOOOOOPRUOOOOOOOOO OND NeEpoo0o000 000000000000 916 PRUPA EA ER ANIFAR OEA LE lt FIR PRUABLEEEA HNIFzR FOERY SEL 2 PRUAELSEEA FNIFzR 7 5 IBS AER ANIFAR 8 4 000 0000 elesepruD a D D 0 D D U podd000000000000000 NIFD OU close pru lt PRU No gt Enter PRU 6 1 D D U DUUDDDDUDDDDUDUDDDDDDBDDUDUUDUDDDDBDUDDUDUDUDDUDDDDUDUDUDUDDUDDBDUD Main Menu gt gt Action gt lt ACTION gt gt CLOSE PRUx x 0000 PROU DD D 000 00000 8 0100000 00 NIFOOOO STATUS LEDOOOOOOOOOOOOOOO 000000 0Ng0000000000000000000000000 podd00000000000000000 000 3
188. NIF lt NIF No gt Line lt Line No gt Line No gt Line subline lt Subline No gt is under lt Subline No gt Subline line test Half a year has passed since first OOOO dumpO dump1 primaryMC usr var evtdump 1 1 dump file creation 000 00 00 000 0 0 0 0 0 0000 0 0 0 0 0 00000000000000000000000000 erase dumpfile 000 0000 000000000 Voll erase dumpfile O 0 00000000 Retrieval_mode was changed to 000000 retrieval mode mode Retrieval mode No gt 0000000000000 Qos0000000000000000000 PRUO Please reactivate PRU lt PRU 100000000000000000000000 No gt 1 close pru PRU No 2 free pru PRU No 000000000 show sysemO 0000000 8 0 000000 0 0 Retrieval mode No 0 retrieval mode PRU No PRU 20 3 000000 unam retrieval mode Hl E E EL LH 95 PRUD PRU No PRU No O show system 0000000 Retrieval mode was changed to no mode Please reactivate PRU PRU No ho C3 C3 F3 mo S eu yoo coo zoo V d RUD
189. VRRPpo00000000000000 oOo gt ine o 252 8 0000000000 D 000000000 od 6 VRRPO Advertisement 00000000 VRRP Advertisement 0 0 7 OO how tech support 0O 0 000000091 vRRPGHOHODUU 0000000 show vrrpstatus detail 00000 show vrrpstatus statistics 00000 cat var log daemon log 0 0 0 usr local bin vrrpstat Z 2 gt primaryM C usr var vrrp vrrpdump ED lusr localbin vrrpstat X 000 5 lusr local bin vrrpstat X sendcmd dump portmap 2 0 primaryM C usr var vrrp vrrpportmap 000000 usr local bin vrrpstat X sendcmd dump l2talk 2 gt primaryMC usr var vrrp l2talkdump 7 0 OO 000000000 8 123 IEEE802 3ah UDLD IEEE802 3a UDLDp0000800000000000000000000000000000000 0000000000000 6 37 IEEE802
190. gt 00000000 DD HL HL D B D L 198 0 00 000000000000000 TagvLANgoDo000000000000000000 1 p00000000000 2 show interfaces 0 0000000 Tag VLAN 0000000 Tag VLAND D 00000000 Tag VLAND 00000000 VLAN IDO 0000000000 0000000 Tag VLANQ O O LAN Swith0 000000000 YVLAND00000000 8 0000000000 VLAN 0 852 DHCPO DO i DHCP BoorPOOOOOOOOOO DHCP BooTPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO3OOOOOOOO 1 DHCP BoorPOOOOOOOOOOOOOOOOOOOOOOO 3 DHCPQ BOOTPJODODO OO 2000080000000 00000000000000000000000000000000 01 000 3 00000000000000000000000000 DHCP BOOTP
191. ooo CO ooo Co Erit Cd show interfaces 00 C20000g00 u ImeQ e20 00000 C2 EJ 1860 6 show interfaces Line detail 0000 0000 be H E 9 0020 rms Lr 56 P oo o oo o0 5 Y 25 o oo D D D 2800055 DD DD DD 0 0 UU abani eT E ae 00000 section trace message JUOUOOOGOOGOOOOOOOOOOOOOOOLG send section trace message receive D lineQ 1 uu show interfaces Line detail L3 L3 ES E 533 o0 r3 pur e ook a e Cir 86 r3 D EE ecd 00240 am oo et rr o e 3 3 r3 000 UD 0000000000 0000000000 0000000000 3 E23 0000 0000 D line 0000 HQ 00000
192. pru lt PRU No gt Enter PRU No UD PRUU O 0 Main Menu 2 Action gt lt ACTION gt gt CLOSE gt peux x 00 0 PRU DD D U 20PRU00000000 00000 STATUS PRU 000000000000 8 000 00 000000 ONO 000000000000 000000000000 000 20000000 9 000000 0Ngg000000000000000000000000 000900 pangu P 000 40 PRUQQ0000000 00000 freeprugOOOOOOOOOOOOOOOGO free pru lt PRU No gt Enter PRU 0 Main Menus gt
193. public 20 1 1 1 read write none snmp public 10 1 1 1 read ex trap level 7 8 EAT LYS SNMP 0 253 7 4 BMERLEF event moni tor snmp i 8 8 1 8 IPF FLA mRUEX config SNMPv3 SNMPUDU show snmpv3 show snmp engineid show snmp view show snmp user show snmp group 255 8 0000000000 config show snmpv3 snmpv3 nab Te enable Ro CU ccx SL C lt j S UA config show snmp engineid m m snmp enginei dCTnnp Tokyo gt Dru M config show snmp view mo view view 3 SAT LY SSNNPE 1 3 6 1 2 1 1 include 7Z2 Z L IUMIBO0IDASIE L lt EE d gt snmp view view 1 3 6 1 2 1 2 mask fe000000 exclude config show snmp user E ace ee nm BRENTON FERLET auth mas 1 94 BH 54 2 priv des aye 0799 ELI EERBUCKCHESU EOD ET up OEBERLEY user v3user gt show snmp user C zs amp fv CU Reade R LE SNMP C5 amp TERR AOS lew gt show snmp view Cz LTKESLY we
194. 020 00000000000 000000 show qos queveingQ 0 O00 000000000000000000004sp900000000000 6 108 po0000000000 gt show qos queueing nif 0 line 1 NIFO Linel outbound Rate limit 1000kbps Qmode Priority Max_Queue 8 Priority Queue 1 Qlen 1 Maximum Qlen 2 Limit Olen 127 Discard send pkt discard pkt send byte discard byte 4 6533 19 533 0k 10 0k 2 2564 1581 125 5M 20 0k 3 2256877 1235 5433 2M 10 0k 4 568788 2548 255 0k 20 0k total 2834762 5383 5559 6M 60 0k 00000 gt 132 6 0 00000 0 00000 000000 08000000000 00000000 show shaper JO0p0g0000000000000000q0spg00 0000000000000 D 61099 0000000000 gt show shaper 0 1 NIF Line 0 1 Rate limit 1000000kbps Default Aggregated Queue Omode 4WFO Peak rate 1000kbps Min rate 1000kbps Weight 1 Queue send pkt discard pkt send byte discard byte 1 0 0 0 0 2 0 0 0 0 3 0 0 0 0 4 T 0 1 0k 0 total 11 0 1 0k 0 Interface eth0 1 Aggreg
195. 102 100 usr home user2 bin tcsh 2 7T 000000 7 22 77 6 e 0000000000 sstemgoo0 000000000000 1P0000000000 podd0000000000000000000 007 31 000000000000 000000 password 2 149 7T 000000 7 3 11 731 80 008 019 0000000 000000000000 show logging grep Login 00000000 po0000000 2 gt show logging grep Login EVT 07 25 12 11 20 3 RM 00005002 1001 000000000000 Login operator from 172 16 251 69 ttyp3 EVT 07 25 11 23 56 E3 RM 00005002 1001 000000000000 Login operator from 172 16 251 106 ttyp2 EVT 07 25 11 17 10 E3 RM 00005002 1001 000000000000 Login operator from 172 16 251 67 ttyp1l 0000 gt Login incorrect 0000000000000
196. 150 Opening ASCII mode data connection for log ref txt 846 bytes 226 Transfer complete ftp bye 221 Goodby OSU BOBO go gg 0000000 000000000 poo000000000000000000000000 gt cd primaryMC var core gt Is BERRI 7 LARGEST 2 EHE 1 55 67 interfaceControl core nodelnit core gt gt ftp 192 168 0 1 h xs Rn ROT FLIRE Connect to 192 168 0 1 220 FTP server Version wn 2 4 4 Fri Jan 1 00 00 00 JST 1999 ready Name 192 168 0 1 operator test 331 Password required for test Password xxxxxx 230 User test logged in Remote system type UNIX Using binary mode to transfer files ftp prompt lt 5 Interactive mode off ftp bin 4 200 Type set to I 150200 BRAT A EAT F DHE 250 CMD command successful ftp mput core 588898 LORE local interfaceControl core remote interfaceControl core 200 PORT command successful 150 Opening BINARY mode data connection for interfaceControl core 16 363 bytes 226 Transfer complete local nodelnit core remote nodelnit core 200 PORT command successful 150 Opening BINARY mode data connection for nodelnit core 29 322 bytes 226 Transfer complete ftp bye 221 Goodby 9 OO
197. 35 Oa 1 rc GEI Im Cru E El lt 5 a A po o0 ama oO El Y 53 D Y a a OO o0 12 TA ON gA un 4 EE IE kusi mo El man poz m IM Y S iG o ooN 3 ama uo 53 1 9 O amp EL s 13 oOo mA Ci RE m 53 Boo o 53 Od fon oO ooo m CeO he oS Im od UDUD 8 0000000000 000000 000000 00 00 D 000000000 Voll 5 2 1 OC 192e STM 64 POSO 0 0000000000000000 OOOO c20000000000 00 linen ge_mode 11 111111 111 1 1 C2 section trace messa 0000000 000000 C2 000000 0000000 0000000 show interfaces 0 0 O O show interfaces 0 0 O O Line detail 1 1 D D section trace message receive P UNEQ e P PLM 188 8 0000000000 D UDUD od od JOD D 6 0000 s8so0000000 80 1110110000 0 0 0 0 line mode SS 00 DDUBDD SS 000000000
198. D D Per Hop Behavior OOOO 8 00000 00000000000000 PIM DM Protoco DVMRP OOOO ndependent Multicast Dense Model 10000 0000000808 Pvwppg0 0000000000000 00000000000 326 00A 0000 PIM SM Protocol Independent Multicast Sparse Model Pv40000000000000000000000000000 Shortest path 000000 PIM SSM Protocol Independent Multicast Source Specific Multicast PIMSMOQOOOOOO0O0O00000000000000000000000000000000000 PPP Point to Point Protocol 1 1 La PRU Packet Routing Modu Ros TU 00 00000 00000000000 0 QoS Quality of Service paga on on 1 RADIUS Remote Authentication Dial In User Service NAS Network Access Serve RFC Request For Comments 00 0000000000000000 0 RIP Routing Information Protocol IPv400
199. JO Oot EE o Cr Oat az ol 1 lt lt r 1 o o TI El o0 Oo oo OM oo Ooo oo Ooo ooo Ooo ooo amad 4 a a a a n o s c n a E o E eo c2000000 C2D c2000000 0000000 0000000000000 000000000000000 0000000000 0000 2000000000000 Voli 4 2410 0000 WAN GOGBASE W 0 000000000 00000 00000 180 Se 8 0000000000 UDUD od oo Zoo Zoo Poo o uu woo Poo moo soo El El a E oO o oec EJ a El P Oooo E3 r3 C3 Ooo 5 1 ooo noo 1 10 ooo Lr Ze gt Ou gt YN iuo a G am a G man an mos ja rasan me po ei 5 o cr D a et EI 5 Hs Lr Lr r3 wn nooo co r3 rr Nooo ooo CI ooo CI ooo Co ooo CI ooo CO ooo E ooo CI
200. VCI VLAN VP VPI VPN VRRP WAN WDM WFO WRED WS WWW XFP Source Service Access Point Terminal Adapter Terminal Access Controller Access Control System Plus Transmission Control Protocol Internet Protocol Top Level Aggregation Identifier Type Length and Value Type Of Service Tag Protocol Identifier Time To Live Unspecified Bit Rate Uni Directional Link Detection User Datagram Protocol Usage Parameter Control Usage Parameter Control Random Early Detection Variable Bit Rate Virtual Channel Virtual Call Virtual Circuit Virtual Channel Identifier Virtual LAN Virtual Path Virtual Path Identifier Virtual Private Network Virtual Router Redundancy Protocol Wide Area Network Wavelength Division Multiplexing Weighted Fair Queueing Weighted Random Early Detection Work Station World Wide Web 10 gigabit small Form factor Pluggable adLLOOOOOOOOOOOOGO 00 a EL Ea Eat TESI ESI a a a a a C3 L3 L3 L3 L3 CJ L3 L3 L3 L3 L3 L3 L3 L3 L3 puj EJ C3 L3 an Oooo a DU UUDDDD
201. ax7700rPowerSupplyF ailureTrap AX7700R 16 ax7800rLoginSuccessTr 80 000000 000000000000 ap AX7800R 000000 ax7700rLoginSuccessTr ap AX7700R 17 ax7800rLoginFailureTr 000000 00000000000 001000000 ap AX7800R 000000 00000000000 0000 100 ap AX7700R 00000000 temepo00000000000 1 access list 0 0 0 DJ 0 Password 0 0 111111 1 1 1111 1 11 OOO Console login 000000 0 Enter 153 7T 000000 oo do doo 18 ax7800rLogoutTrap 1 11 0 0 1 AX7800R 000 0000 logout exit quit OOO ax7700rLogoutTrap D AX7700R 19 ax7800rMemoryUsage III Trap AX7800R ax7700rMemoryUsage Trap AX7700R 20 axrOadpNeighborCach OADPOOOO00 elastChangeTrap guggpnggga d u 154 4200000000 75 MCII UU UU L 1100000000 00 0 showmceOOOOOOOOOOOOOOOOOOOO 0000000000000 940000000 0 815 MmCgg0000000000000000 7 7 6 gt show mc Sloto Slot1 secondary Slot primary Slot mc enabled AX F6244 66 MC256 AX7800R format 30 866
202. show ip pimbsrQ 0 0 000000 BSR Bootstrap 0 00000000000000BSR00000000000000000BSROO 0000000000 0 PIM SSM00 BSRo0o0000000000000000 show ip pim bsr 00000000 642 gt show ip pim bsr Status Not Candidate Bootstrap Router BSR Address 192 10 10 10 Priority 100 Hash Mask length 30 Uptime 03 00 Bootstrap Timeout 130 seconds gt s0 PIM SMII 111 1 1 UI show ip pim rendezvous point mapping 11 00000 IPvp00000000000000000 0 C RP Address 8 00000000000000000000000000BSRO Bootstrap 0000000000 8880000000 0000 00 PM ss Mm0000000 0C 000000000 95 6 000000 00000 000000 O 6 43 show ip pim rendezvous point mapping 00000000 gt show ip pim rendezvous point mapping Status Not Candidate Rendezvous Point Total 2 routes 2 group 1 RPs Group masklen C RP Address pri Uptime Expires 224 100 100 0 24 192 4 100 02 00 02 30 224 100 200 0 24 192 1L 1 100 02 00 02 30 gt e PmM SMOOOOOOOO show ip mroute 080 000000000000000000000000000000000000 psepgoo000000 000000 s6000000000000000000000000 6000 po00000000 in coming downstream 00000000000000000000000000 PIM SSMI II 100000000 8 0 644
203. 0 291 9 OOOO 920 BCcUD OU DDUUD 8 86 FICMS MCE GEE TIC EN C 7 5 512 6 SI MS256 EBCUR FD EURO v FIZIBA UL TC BCUMER U fr UE 000 400000 ON 000000 0Ng000000 000000 po0000000000000000000000 ONg00000 000 000 44000000 8 8 show system 00000000000 8 0 00 0 Standby OOOO00000000 gt show system Enter show system 00 000000000000000 9 21 show system I L 0 1 DD show system System AX7808R AX P6544 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location 8000 Q Xi FHXSBCUOO E AK REA TACTIVE CHSTE RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON 0 times restart 8001 TEHESRSBCUO E BARRERAS l standby THATE RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 43 Power ON O times restart 1000 00000 0000 set eg 00000 mode 0000000000 10 MCOOOOOOOOOOOOOOOOOOOBCUOOOOO
204. 000000 200 PORT command successful 150 Opening ASCII mode data connection for etc ftpshowtech 226 Transfer complete ftp 142533 bytes received in 2 56Seconds 55 61Kbytes sec ftp quit 221 Goodbye client host gt 00000000000 000000000 client host gt ftp 78002 O te00000000 857800 ftp Connected to ax7800r FTP server Version wu 2 4 1 Tue Apr 1 15 33 09 JST 2003 ready 220 User ax7800r none staffl Password required for staffl 331 Password User staffl logged in 230 ftp get show tech detail show tech detail txt show tech detai1 000000 PORT command successful 200 Opening ASCIT mode data connection for etc ftpshowtech 150 Transfer complete 226 ftp 273603 bytes received in 29 56Seconds 9 26Kbytes sec ftp qui Goodbye 221 client host gt 0000000000 show tech detail txt0 00000000000 ftp 0 1s000000000et000000000000000000000000000000 ngagagi 0000004x7s80Rpp0000000000000000000000000000 e fpOOOOOOOOOO show runningconfig O 0000000000000000 800000000 e show 00 000000000000000000 ftpuserQQ 0000 a a a a
205. DowaOOOOGO 000000 1 2 ExStart Down I D 00000 3 Full ExStart 0000000000000000 4 Full 2wayOOOOOOOOOOOOOOOOO 5 Full 0 100000000000 D 7 axrOspfNbrStateChang 08 0 UU 6 0 ospfVirtNbrStateChange DO 00000000000 11000 0 58 Down O 00000000 8 axrOspfVirtlfStateCha OOOO 10 20000000000000000000 nge OOO i 100000 190 00000000000 0 2 000000 Down 1 0000 1 000 7T 000000 tu 1 Du DD B u 9 axrOspflfStateChange OSPF 00000 10 80000000000000000000 000
206. G lt gt RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 43 Power ON 0 times restart 000000000 02000 00 286 0000 000000 1000 MCQggood MCopo 000000080000 000000 00000 00 Mmepoo00000000000000000000000000 BcUOOOO set mode 0000000000 10 MCp000000000000000000000 BCU 0000000000 10 MCp0000000000000000 Bug 00000000000 podd00000000000000000 setmoepo00 0000000000000 set mode standby slot1 reload Enter 000 reload 0000000000 B5e40000000000000000000000000000 gt reload dump image f standby Enter 000 Bcunnaggung 80 000000 8 8 0 000000 uggag Be0g000 000000000000 show system 0000000000000 show system JJI 000000 914 show system gt show system Enter 0 1 8 1 0 0 0 LU 1 9 0000 0 915 8 1 110110 0 PRUzR FORARE 5 ENE PRUzR 8 U SL 5 FE PRUzR FOR iti FEJBS PRUzR FOARS 5 FEA 000 10PRUQQ0000000 OOOO PRUDHODDUUDUDDUUDU closeprugOOOOOOOOOOOOOOOOOOO 0000000 PRUQOO NFpo00000000000000 close
207. List No gt 41000 Using Interface tokyol in ip source any ip destination any protocol ip drop packets 327032706 gt 665 000000000 0 000000000000000000000000 0 0 0 0 0a0 000000000000000 show ipv6 local policy O0 0000000000000000 000000000000000000 0000000000000 flowfittr9000000000000000000000000 102 6 00000 0 00000 000000 Dess po000000000000000 gt show ipv6 local policy interface tokyo Interface Name tokyo Filter List No 40001 forward packets protocol z Ap ip_source 3ffe 10 2 3ffe 10 30 ip destination nc 3O f e 2097 2 3ffe 20 50 current policy route Policy Group Name routel Output Interface tokyol Next Hop IP address 3ffe 31 10 lt Interface Name gt tokyo lt Filter List No gt 40002 forward packets protocol ip ip source s 3120 101 21 3ffe lOl tff ip destination 3ffe 201 1 3ffe 201 5f current policy route Policy Group Name route2 Output Interface yokohama Next Hop IP address 3ffe 200 10 0000 gt 020000000 Dad show ipv6 cache policy 00000 Dese gt show ipv6 cache policy routel lt Policy Group Name gt routel priority Interface Name status Nexthop gt 1
208. System name config quit System name quit System name gt 3 13 0100000 D U35 config li Tab line link aggregation config lin prap ooo 000000 000000000000000000000 config line line0 Tab 10gigabit ethernet ethernet gigabit ethernet config line lineO Tab O20 00000 0360700000000 gt show ip arp Display the information of ARP cache Display the conditions of policy route group information entry Display a detail information of a particular route interface Display the information of interface local Display summarized policy routing information policy Display Policy Routing Information rip Display RIP information route Display all route static Display the information of STATIC cog00dg0000000 000000 0000000 00000000000000000000 D 200000000000 0000000000000 3 000000 031 00000000000
209. UDUD D CoCo CoCo OI line clock 00000 D N oo external independent 0000000 show interfaces 0 0 O 00000 00 00 P RDI RDI P AIS P LOP L REI P REI ooo i E aa Lr JO Au Lr JO oo O jr i JO Oo O jr JO oo Cir oo O jr JO oo oO BEI Olt Er JO oo oo Ol Tal or HH Lr E Lr E uu oo maji or E Ono oo oOo 200 p Y oOo L3 Oo Oat asa w C L3 3 Oca a og ji L3 L3 Gu Zt L3 rg Oat Oo lt Taji zs Oat E Oe O 1 0 1 Oat O a O a JO E EL 5 Su rt gt Olt gt Lr Oat NO O Q c5
210. o R Y o Z Y 2 H L3 r3 L3 r3 L3 L3 r3 L3 r3 L3 r3 CI es 110111 1 2 we gt G is IJI IL IC ESPE Coy Coy EJ EE LIT LIT LITT Lr LL ETE LL Co Lr ERCI Lr Cl EFE Er 53 5 5 o HO 3 gt 6 n El lt QK Te ikan oo ooso o 5 2 5 186 OOOO 0000 un 000 187 D D RDI Vol 1 000 D D B 8 0000000000 0000000000 00000000000 SONET SDH 00000 od 11 000 000 D O PPP Over SONET SDH O Voll 5 POS PPP Over SONET SDH T 0000000000000 00000000 00000000 clock O O 186 00000 00000000000 external independent external 0000 Vol 1 5 POS od 00000 D 0000000 00 00 OOOO show interfaces RDI P AIS P LOP L REI P RDI P REI
211. oO r3 r3 a oO a oO r3 gt z isl gt a 0000000000000000000000 0000000000 0000000000000000000000000000 0000000000000 000000000000000 000000000000 0000000000000 000000000000 000000000000 00000000000 0000000000 000000000000000000000000000 Voli 4 3 8 100 D 00 i 9 0000 Voll 42 WAN 10GBASE W0 0 0 0 D wy oOo a a L3 a e aga 178 8 0000000000 UDUD od od Se 10000000000000000000000000 0 1000000000000000000000000000 1000000000000000000000000000 0 0 0000 no test interfaces 0 000000000000 10000000000000000000000000 80 100000000000000 7 0000000000 8 4 5 10GBASE W SONET SDH I 1 0000 SONET SBAP Op 00000000 00000000000000000000000000 000000000000 351000 000000 3900000000000000 podp00 0000000000000 812 SONET SDHO0000000000000000000 0000 1 show interfaeesOO 000 0000000 00000000000000 linen 000000
212. show snmp notify BERS dv CU SSNPXIERDT SR SNMP FERLET RLEJ show snmp user C LY snmp not LapNotifyl SIMP 65 8 C amp 88 use 3 notify filter General Trp 4 8882 4 JU amp ERLE GROSSER target Tokyol show notify fi Iter G m fcuvssNPa 3 CHS 0 2 FULA mRUSES IPP 0 SNMP SNMP D SNMP 0000 SNMP 1620 UDP D D 8 0000000000 8 14 8 14 1 DODODDO 8 11111 sFlow D 0100000000000000 podd0 000000 000000000000 00000000 6 000000000000 00 rn p000000000000000000000000 0000 slowpog00900000000000000 0812 po000000000000 1 config show sflow sflow yes AVesl8 2006 destination 192 1 1 1 sample 128 port 1 1 conf ig 1 11 UDPO O
213. 0 shutdown n s SHUTDOWN SRO Xm END EX 800 415506 5 EGA 26 4 000000000000 4 2 Line LI Lmnep00000000000 tmego000000000000000000 lt INFORMATION gt Line 00000 ENTROOOOGOOOOONIFOOOOOOOOOOOOOO O10 NIFT I 0000 Lineg NIFOOOOOOOOOO FWr bgg0000000000000 0000000NF00000000000000 NFEDO0D0000000000000BACKODO 0 FWRDO000000 NEgog00000000000000 NFO000000 ENTRO OD DD OOOO Lnepgg000000000000 NFO0o000000 42 Which NIF NIF No lt o op O 20 Line D Line po00000000B4cxpg00000000000000 NFOOOOOOOOOOOPFWRD BACKU DU NIFOOOOO 00000 ENTRQOOOO000 D lt MainMenu gt 00000 0 4 3 Linel U JU 0 1 active up 1000BASE SX full b LEO NIFEE Lines E 8 TE 110489 7 8 41 og og og Line 0 0 active up 08000 0000000 active down initialize test fault closed 1 1 1 unused mismatch locked pad0 0000000 looped by remote remote loopback O 27 4 000000000000 00 od od auto locked Line 0 10BASE T 100BASE TX 1000BASE T 10
214. 00000000000 00000000 DHCP ooo 00 00000000000000 xkyoo000000000000000000 00000000000 0000000000 Voll dhcp key DHCP DNS I 0000 M000000000000 3 DNSQ0000000000000000 DACPO O 0 000000 00000000000000 poda 0000000000 0000000000000 0000000 Voll dhcp zone 0 DHCPDNSP 0000 mn 0000000000 000000000000 0000000000 4 DNSpo 000000000000 00000000 00000000000000000000 Vol 1 dhcp ddns update enable DHCP DNSO OOO 0000000000000 000000 DNSSpoo00000000000DNsp 000000 00000000000000000 0000000000000000 0 pcooo0o0o0oDHePr o go ooo 0000000000000 0000000000000 pod 000000000 00000000 0000000000000 Vol 1 dhcp option pDbHePoo00000 000000000000 00000 Vol 2 show ip dhcp import O00 D UB un 0 00000 sopq00000000000000000 DNSpog0 000000000000 UTCODO 5 000000000000 show calendar 000 0000000000000000000000 Vol 2 1 NTrPgo0000000000000000000 L3 00000000000 DNS c000000000000000000000 show ip interface 000000000 0 00000 9 a OD EE EJ 50060 y Ea Z
215. 00000000000 Windows 0 0 Telpet 0000000000000 C Windows gt telnet 2 Windows Tenet 0O00 0000000000000000 unset CRLFO0O000000 Microsoft Telnet gt unset CRLF 1 2 3 MC 6 MCO000000000 Meoig 10000 20000000000000000000000 Meco 00000 000Mc0 2000000000000000000 U 1 3 200 OOOO 00 000 MCOOMCOOO 1 0000000000 2000 200000000000000000000000000000 000000 il 000 MCO0 200000000000 0000000000 MCODO OD OD 00000 1 000000 UDUD 000000000000 200 0000 DD 200000008000 000000 00000000000000 000000 1 pmMego0 000000000000 000000000 000000 0 DODOg 00d 000000000 000 000000000000 0000MCO 0000000000000 0000 DUDU 0 21 00000000000 22 23 0000000
216. 00000000000000000000000000 1 00000000000 2 show iparpQO 000000000000 00000000004RPo00000000000000 00000 3 DQO OD 00000000 D0000ARPgg 0000000000 00e0 000000000 4 IP pep 0000000 1 QOO0000000000 2 show ip route 00000000000000000000000000000 3 IPvwpo0000000000000000000000 86 0 0 O O U U SHO000000000000000 DHCP BOOTPO 0 1 gd DHCPQ lt e 00000000 1 1 1 0 0 000 Df 000000 000000 000000 a
217. 1 Waiting Partner Synchronization 1 1 1 1 111 nmatch Partner System ID 0000 Partner ae e H et B YN ooo lt ct O 3 2 BODE EI ET lt m et o 3 Oppo 2 Ei O O show link aggregation statistics lacp J OOOO onov q L3 oQ H ELA ORO gt gt gt e nooo O 182 000000000 Partner Key Unmatch ooo d ooo d ooo s gt madati d Ooo ooo ooo onoo s noo e E lt e gt tu noo ooo 8 cet ooo 000 ooo lt cosa j san Ji
218. 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location Node Info Cuplex Mode gt Ft Duplex CEE BCUO Active RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON 0 times restart BCUT 8 6 8 RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 43 Power ON 0 times restart 000000000 0000 000001000 MCQ0000 MCODOD 00 DD DO Beu gg 0000000 00000 00 meo 0000000 000000000000000000 8 1 1 1110 00000000800 0000 98 000 09000000900 000000000 MCO000000000 set mode standby 810861 reload Enter 000 0000000000 BeUOOOOOOOOOOOOOOOOOOOOOOOOOOOO gt reload dump image standby Enter 303 9 OOOO 000 BCUGOOOOOOOOOOOOOOO show system 00000 0000000000 0000000000000000000 BCUOOOOOGO Standby 0000000000000000 00 show system 000000000000 933 show system gt show system Enter 0000000000000 O20 0000000000000 NIF L L
219. 128MB PRU1 Active AX F6544 R2B2 PRU B2 Lamp LED green Memory Size 131 072kB 128MB PRU2 Unused PRU3 Unused 307 9 21 0 al D 5 O et 308 uu NF 000000 000 00000 OOOO NIFOO 20 Line a 9 show nifQOOOOOOOOOO gt show nif 2 Enter D0000000000000 9 36 10BASET 100BASE TX 1000BASE T NIF show nif gd 0000 0000000000000 00000 NIFZ DUDU Line active up 00000 0 e Line 1 00 000000000000 00 00 00 100BASE TX full auto 0 gd 0000000 00000000000 10BASE T 100BASE TX 1000BASE T a 00000000000 e 000000000000000 5008 80 410000100000009019 0 800 9009080 0 09800080 0980080 9 0080 9 00080 90000090 0 0000 0 0 800 9009080 98080 8980080 9 0080 9 0
220. 13 6 15 29 12 Initialization 2 15 29 11 1 15 29 11 ive 1 15 29 11 1 15 29 11 Address 1 15 29 11 1 15 29 11 Address Withdraw 0 00 00 00 0 00 00 00 Label Mapping 11 15 29 25 10 15 29 11 Label Request 0 00 00 00 0 00 00 00 Label Withdraw 1 15 29 21 0 00 00 00 Label Release 0 00 00 00 0 00 00 00 Label Abort Request 0 00 00 00 0 00 00 00 Others 0 00 00 00 0 00 00 00 Hello tE 6 0 00000 0 00000 000000 0 62 Basic DP 1111110000 Uu 0o 1 show mpls ldp detail 000000 Last Basic 1 0000 UPOO Down U down reason B B U U 11111 1111 1 1 1 1 1 300 Basic LDPQ 200 2 HeloQ 0000000 Hello 00000 00 100000000000000000000000000 Basic LDP 00000 JO 5 a a 3 show mpls 105 detail 0 O Last down reason DU D 000000000 unsupported hardware ooo oppo ooo Q 5 d aq R g o B E p es Hello o0 m o o DE 9 a EI E c YN c g
221. 2 00000 config quit show dhcp giaddr interface Departmentl DHCP GIADDR lt Department1 170 1 1 1 D0000 200000 POOO relay interface 000000000000000 P000000000000000000000 DO00O0O0OOO0O0O0O0O0O0000C0000C0C000000O0 3 1 O a 000000000000 relay interface 0 00000000000000 1P000000 a config delete relay interface Departmentl Are you sure y n y config line Departmentl ethernet 0 0 line Department1 config delete ip Are you sure y n y line Department1 config exit config show line Departmentl ethernet 0 0 relay_list 170 10 10 10 relay_group BlueGroup 1 config 3 2 120000 1200000 120000000 00 config line Departmentl ethernet 0 0 line Department1 config ip 170 2 2 1 24 8 0000000000 line Department1 config ip address 170 3 3 1 24 line Department1 config exit config show line Department1 ethernet 0 0 ip 170 2 2 1 24 ip address 170 3 3 1 24 relay list 1 170 10 10 10 relay group BlueGroup 1 config 6 1 0000000890080000 8008 config line Departmentl ethernet 0 0 line Department1 config ip address 170 1 1 1 24 line Department1 config exit config show line Departmentl e
222. 2 AX 10 009 58 ka gt YIR 2 8 EAHA F AX 10 005 A 0000000000 ABR AC ACK ADSL ALG ANSI ARP AS ATM Available Bit Rate Alternating Current ACKnowledge gay Vol 1 10 010 gt 8 8 Vol 2 AX 10 011 ER 0 AX 10 012 MIBZE R MIBUFJF7 ELA AX 10 013 Asymmetric Digital Subscriber Line Application Level Gateway American National Standards Institute Address Resolution Protocol Autonomous System Asynchronous Transfer Mode 0000 AUX BCU BFD BGP BGP4 BGP4 bit s DCE DHCP Diff serv DIS DLCI DNS DR DSAP DSCP DTE DVMRP E Mail EFM ES FCS FDB FR FTTH GBIC GFR HDLC HMAC IANA ICMP ICMPv6 ID IEC IEEE IETF IGMP IIH IPCP IPv4 IPv6 IPV6CP IPX IS IS ISDN ISO ISP LAN LCP LED LLC LLDP LLO 3WFQ Auxiliary Basic management Control module Bidirectional Forwarding Detection Border Gateway Protocol Border Gateway Protocol version 4 Multiprotocol Extensions for Border Gateway Protocol version 4 bits per second bpsq 000000000000 Bridge Protocol Data Unit Basic Rate Interface Constant Bit Rate Cisco Discovery Protocol Classless Inter Domain Routing Committed Information Rate Conn
223. 3ah UDLD 00000000000 000000000 od 621716 1 show efmoam 1 0 00000 Link status 1308800909 V0 000000000000000000 IEEES02 3ah UDLD 00000 00000 OO 0rz0g00800000000000000000000000000 D 200 Link status 02 38 1 IEEE802 3ah OAM OO 2 3 1 Info Unstable show efmoam statistics 5 TEEE802 3a4 UDLD Y 0 D0 000000 000000000000 10000000000000000 Info TLV Unstable GOOOOOG00000000000 400 4 11111111111 D0000000000000000000000000000000 500 du B B0 D BHO D HH D QU E D U 010 0028 show efmoam 8
224. 4 Serial No AA RM8MS000A2R010831F001 Error Factor 3181 80000008 primaryMC var evtdump File Name cpevt001 000 Date 2005 08 03 15 52 12 Version AX P6544 11 9 4 Serial No AA RM8MS000AR010831F001 Error Factor 3181 80000008 2 0O0000000000000000 show logging 0000980000000000000000000000000000000000 3000000000000 00000000000000000000 083 gt show logging Gua EVT 08 19 16 04 04 E3 RM 00003004 1000 000000000111 RM restarted due to user operation EVT 08 19 16 03 57 E3 RM 01910202 1001 000000000000 System restarted by user operation 10 0 3 show tech support 4000000000000 000000000 169 8 0000000000 OOOOO000000000 40000000000 ON OD erase dump file 1 0 0
225. 8 113 247 8 11 4 EoMPLS L2 VPN O 000000000 249 812 DOOOOOOOOOO 251 8121 IPY40 000000 YRRPOO00000000 251 8122 000000 YRRPOO00000000 252 8 12 3 IEEE802 3ah UDLDO 0000000000000 253 843 8 0 0 0 255 8131 8 0 0 0 800 000000 255 8132 0000000000000000 206 8 14 209 8141 000 00 sFowQO 0000000 slow 259 8142 0000000000000 000 sFlow D 261 8143 0000000000000 0000 sFewn 262 8144 0000000 NetFowQ 00000000 NetFlown D 263 8145 000000000000000000000 NetFlowg 264 8146 000000000000000000000 NetFlowg 265 8147 000000000 NetFlow Version 9 0000000000 266 8148 8 000000000000000 266 815 269 8151 LLOPOO00000000000000000 269 00 8 152 0 0000000000000000 269 816 NTPOOOOO 271 8161 00000000000 271 OOOO 273 91 0000000 274 911 000000 0000000000000000 274 92 11 1 01 00 0 0 0 276 921 000000000000000 276 922 2 699 00000000000000 279 9 23 show tech supportl 0 00000000000000000 280 924 000000 281 93 283 931 0000000000000000
226. 9 O56 00000000 4 000000 DD 00000000 show show system show ping ping ipv6 1 UD 5 exit quit disable end set terminal O O O show whoami O57 QOO00000 5 888 00 000000000 logout exit quit disable end set UD 0000000000 terminal show whoami logout exit quit disable end set og terminal show whoami D 6 11 1111111 101 0 1 9 45 5 00000000 O58 00000000 6 DD OOOOOOO root OOO u 000000000 7 1
227. EEN 8 5 CU SSNMPY x0 config IPF FUAZERLESF SNMPv3Q 000000 po00000000000 00000000000 show snmpv3 show snmp engineid show snmp view show snmp user show snmp group D show snmp notify filter D show snmp notify 207 8 0000000000 256 snmpv3Cenab le 6 85 9 56 TC PEEL 98 LYSSNMPI LLL IDEmUE3 8 1 9 gt LE 536 5 76 8 0102 L lt snmp view view2 1 3 6 1 2 1 2 mask fe000000 exclude config show snmp user fimp user v3user 58 5 0 25 FERLET auth mds abo 1234 IHR HE FO A IV ODER priv des xyz 67892 TELWOEGHBLTC ESL EN j REN TIN 5SNIPZJL 7 ul e EP nb kk NPI SERLE D group T o use show snmp user CU BAEC ERL ET SNMP PT 58 show snmp view TLS 0 LUCK FEL how snmp noti fy fi Iter spmp noti fy fi lter General Trap BRONCO SMM 1 gt 3 6 1 5 LEN KG 20 Ry FRRATEL lt 3 6 1 CLASS CE 0 config
228. FR 2 7 26 F 2 2 F 2 GEI 252r ABGBITEAJARUXvyt L20m amp l gt RL E GX2 ROX RH 212133 7 NIF Stopped because its hardware failure O20 0000000000000 lt Main Men gt f 000000000000 I1D000000 ENTRI DU 200000000000000000 ENTRIJI I 10000000 1 1 110 00 000 0 000000001000000000 0 0 00 000000 e lt Main Menv gt Y 00000000000 000000000000 e Main Menv gt Alarm 0000000 0000000000 000000000000 000000 9 040000000000 pod 000000 000000000000 00000 00000000000000000 37 4 000000000000 FWRD0 0000 Bexpo000000000000000000000000000000000 P0000000000000000 000000 po000000000 414 E6 NIF 01 Msg 90002001 38 0 0 0 000 0 0000940 00 000000 0 0000 9 00 00 0 008
229. HOA OOOO 0 ul ARP Address Resolution Protocol IPv4 AS Autonomous 000 AS D D DU OSPF BGP4 Borde IPv4 BGP4 Mu IPv6 BGP4 BGP44 BGP I BGP T BPDU cPOOOO BCU lJ D D 1 DHCP BOOTP 0 Iti D OO OU System 0000000 r Gateway Protocol version 41 OO Co protocol Extensions for Borde D Co OSPF 000000000 0000000000000 0000000000 11 1 r Gateway Protocol version 41 00000 000000 FOOD 0000000000 00 Bridge Protoco Uu 000 0 000 000 000 VLAN DD 0000 EJ OO El Host Configuration Protocol 0 O 00000 0000000000 DHCP BOOTP 0 DHCP BOOTP 8000800000000 000 00000000000 0000000 Dana DHCP D D II D IPyv4 DHCP ODO 0000000 1Pg000000000000000000000000000000000 D
230. L1 1 330 1 1 0 00 00000 0 0 330 000000 MIB 00000 330 00 00000000000 0 10 261 0 0000000 NetFlow 265 0 0 0 0 000000000000 00 NetFlow 264 DUDUUDUUDUUDUDUH 138 259 000000000 NetFlow Version 900000 00000 266 0 20 6 0000 000000000 26 0000900000 000000000 30 OOOU00 304 ooo 4 331 UD 19 5 00000000 42 pod000000000000000 165 182 72 podo0000000000 269 337 00 143 331 pod00000000000000000 331 331 po00000000000000 331 po00000000000000 77 po00000000 8 331 14 Uu 4 11111 L3 41 150 000 166 149 0000 ma ma ma So L3 L3 C3 L3 L3 L3
231. OOOO Voll 4 2 WAN 10GBASE W 2050 a a ooo 4 Vol men Co Opodo 177 8 0000000000 MAMAMA od od ss jes Onn OO Onn 2 Co CI Onn Cd Onn CI A Co Cd CI Cd Cd Co 100 0 Vol 1 BASE W J lt OO s Z EN L3 i oO vn L3 L3 poo o HO gt n L3 aB T 1 4 oO 3 Ic E4 4 10000 Vol1 4 2 ROD NGOGBASE W 53 EE Gad en Q gt no Odo S noo Onn Onn L3 TI Onn C3 oong AG Poo Foo CICIT CO 000 r3 a oO a
232. OSPFOOOOOUO0O0U000000000 OOO InactiveG OOOOOO0O000000 800 show ip route all routes OOO Active 000000 00000 dump protocols unicast all 8 100000000000000000000000000000 9 000000 dump protocols unicast all u OG primaryMC var rtm t trace rt dump gz 000000 864 BGP40 0 000000 op sepg 8 22 BGPA D OU DD UD po0000000000000000B86P0000000000 podo00000 000000000000 podd0000000000000 oo 1 BGP4 j 00000000000 OOOO 0000000 200 show ip bgp neighbor 00000 Established 00000 30 D 2 000000000000000000000000000000 3 0000000 00000000 pao 0000000000 400 ooo show ip bgp received routes dump protocols unicast all 4 500
233. QoSJJUDDUDUU 0 80000908000 0000009090 8 8 68 0100 0 a a 201 8 090 DHCP BOOTPD 000000 hD 202 000000000 DHCP BooTPOOOOOOOOO P000 1 relay list DHCP BOOTPQ OOO IPO 1Ppg000000000 interface bootp hops 11 B D u O 0 o relay agent address OO 00000000 rPo000000000000000DHCP DHCP BOOTP 0000000 POOD 90 0000000 800 00000 DHCP 0000000 00000000000000 relayinterface 00 0000000000000000 DHCP BOOTPU
234. abcd Tokyo 00 05 01 40 fe80 200 87ff feb0 1234 Tokyo 00 05 01 40 0000 gt Tokyo PIML A 2328 RHEL CU 6 O30 00000000 show ipv6 rpPfQOOOOOOU0000U000000000000000g 118 6 00000 0 00000 000000 B 1 D show ipv6 682 gt show ipv6 rpf RPF Information for 2001 db8 100 If multil NextHop fe80 1 0000 gt O 40 PIM SM BSR show ipv6 pim bsr 0 0 000BSRpgg0000000000000000000000 000 BSR Bootstrap 0 0080000000000008s R00000000000000000 8811100000 0 8 PIMSSMQQ 8881010000000000000000 D 6 83 show ipv6 pim bsr c D gt show ipv6 pim bsr Status Not Candidate Bootstrap Router BSR Address 2001 db8 1 Priority 100 Hash Mask length 30 Uptime 03 00 Bootstrap Timeout 130 seconds gt O50 PmM SMOOOOOOOOOOO show ipv6 pim rendezvous point mapping 00000000 IPv0000000000000000 OOO CRP 1 0 0000000 0 Bootstrap 00000000000 BSROO 00000000000 PM SSMOOOOOOOOOOOOOOGO 0000000000000 O 6 84 show ipv6 pim rendezvous point mapping O 00000000 gt show ipv pim rendezvous point mapping brief Status Not Candidate Rendezvous Point Total 2 routes 2 group 1 RPs Group masklen C R
235. bgp neighbors D gt show ip bgp neighbors 192 168 50 2 BGP Peer 192 168 50 2 Remote AS 1810 Remote Router ID 192 168 22 200 Policy Group 1 BGP Status Established HoldTime 90 Established Transitions 1 Established Time 16 25 34 BGP Version 4 Type External Local Address 192 168 50 1 Local AS 2735 Local Router ID 192 168 22 100 Next Connect Retry Connect Retry Timer Last Keep Alive Sent 18 42 20 Last Keep Alive Receive 18 42 20 Graceful Restart Both Restart Status Receiving 2004 07 08 17 01 23 Receive Status Finished 2004 07 07 10 11 12 Stale Routes Retain Time 30 NLRI of End of RIB Marker Advertised and Received BGP Messages UpdateIn UpdateOut TotallIn TotalOut 12 14 36 42 BGP Capability negotiation IPv4 Uni GracefulRestart gt Send IPv4 Uni GracefulRestart RestartTime 120s Receive IPv4 Uni GracefulRestart RestartTime 300s IPv4 uni Authentication TCP MD5 No fast fallover configured gt 646 1541501000 000 00 op tsisp 90 0000 Pv4go0000000000000 ISTSD D UU D D D D DD D show isis adjacency 0 e AdjacencysQOOOOUO0000000000000000000000000000000000 e State UplOOOOOOOOOOOOOOOOOOOUPOOOOOOOOOOOOOOOOOOO e St
236. gt 170 2 2 1 gt 0 0900000080 8 DHCPO 8 0 9 0 PHCPO BOOTP 0000000000000 00 rPpg000000000000000000DHCcPpO Bo0rPp 00 0000000000000 podd00 00000000000 pIrgod0000 000000000 1 p0000000 Po000000000000000000 IP000000000000001P0 000 12g000000000000000000 relayinterface 00000000000 config show line Departmentl ethernet 0 0 ip 170 2 2 1 24 ip address 170 1 1 1 24 ip address 170 3 3 1 24 relay list 1 170 10 10 10 relay group BlueGroup 1 relay interface Departmentl relay group BlueGroup config line Departmentl ethernet 0 0 line Department1 config delete ip address 170 1 1 1 24 Are you sure y n y line Department1 config show ip ip 170 2 2 1 24 ip address 170 3 3 1 24 config 203 8 0000000000 204 2 OO rrgo000000000000000000000000000 line Department1 config show ip ip 170 2 2 1 24 ip address 170 3 3 1 24 line Department1 config ip address 170 1 1 1 24 line Department1 config show ip ip 170 2 2 1 24 ip address 170 3 3 1 24 ip address 170 1 1 1 24 line Department1 config 00000000000000 eutp 0 UD O show dhep giadar0 00000000000000
237. login cleartext He service grlogin class allcommand user guest login cleartext He service grlogin deny commands reload close enable user test login cleartext service grlogin allow commands show ip ny commands 5 00000000 Value 00000 000000000000 10 0000 000 00800000 0000000000000 000000000000 000000 enable reload close po 510 po0000000000000000000000000 Tacacs 0000000000 login RELET 1888 2 gt F LES reload close telxenable 5 AVY 8188 L al low commandsAEE SANT UV U YI eb DIX 5 5 EY EFAOERNERERL ET show ipl DEBIENDO show ip route a 7 FIFE NETAH show ipv6 route 0 IXY FIs SHEA 107 18 gt U EF 3 3 L ET OOOO e 00000 classQOUO0U000U000000000000100000000000 2000 0000000000000000 L0 0 elss nomanage noenable O H nomanage deny commands allow commands 0 0 000000000000000000 0 00000 10241 00000000 025000000000000000000 podd00 00000000 0000000000000000000000000000lo
238. normal end gt O 2 O 3 4 5 6 DU 0000 OOOO OOOO L3 L3 L3 C3 L3 C3 mun jaan L3 L3 L3 L3 OOOO OOOO OOOO ODO 924 DODODO 000000000 0 0 H 018 00000000000 0000000000000 094 ftpp00000000000000 ftpserver example com 9 0000 X1 x 2 3 x 5 x 6 get DDD D 0000 1 dump Idump0 dump1O 000000 GO 2 dumpO p 000000 OO 3 dump1 dump1 00000 OO 281 9 OOOO 282 U99 client host gt ftp ax7800r O fco OOO0000 ax78oor tp O Connected to ax7800r 220 FTP server Version wu 2 4 1 Tue Apr 1 15 33 09 JST 2003 ready User ax7800r none 1 331 Password required for staffl Password 230 User staffl logged in Remote system type Is UNIX ftp gt binary Kl 200 Type set to I ftp get dump dump tgz 200 PORT command successful 150 Opening BINARY mode data connection for etc ftpdump 226 Transfer complete ftp 4478793 bytes received in 15 66Seconds 286 08Kbytes sec ftp quit 221 Goodbye client host gt 0000000000 dump tsz 000000000000 Dx 1
239. show qos queueing nif 0 line 10000000 2 7 show qos queueing nif 0 line 1 NIFO Linel outbound Rate limit 1000kbps Qmode Priority Max Queue 8 Priority Queue 4 Qlen 1 Maximum Olen 2 Limit Olen 127 Discard send pkt discard pkt send byte discard byte 6533 49 533 0k 10 0k 2 2564 1581 125 5M 20 0k 3 2256877 1235 5433 211 10 0k 4 568788 2548 255 0k 20 0k total 2834762 5383 5559 6M 60 0k 3 Priority 4000000000000 discard pkt 1000000000000000 8 ss ppo00000000000000000000000 D O80 00000 196 8 0000000000 Null 29 DIA G V KAREN TLS AD show ip interface ipv4 unicasta Kink amp Null4 VS 2 1 XAOIRR V TERR 8602 2 29 4 1 7 57 28 ODER show ip 0 162 v TERR ER show ip interface 6 y FANE S DER 1 show ip interface ipv4 unicast 00000 11111 00000 2 9
240. tokyol Up 3ffe 31 10 2 tokyol Up 3ffe 32 10 3 tokyo2 Down 3ffe 33 10 4 tokyo3 Down 3ffe 30 10 default 66 6 Nul D D D 0 0200000000 show ipv6 route 0000000000000000000000 setiegod0000000000 podo000 00000000 000000000000 D 657 gt show ipv6 route static Total 1 routes Destination Next Hop Interface Metric Protocol Age 3ffe 501 811 ffcc 64 null 0 0 Static 16s gt 103 6 000000 00000 000000 020000000 Dad 0000000000 show ipv6 interface 8 DODO 000 NaIgg 00000800 000000000000000000 6 58 gt show ipv6 interface delete packets null interface Interface Name null Discard Packets IPv6 gt 92 pkts 667 1110 0110000000980000000 Dal D 5 6 6 6 showipe6route U 659 000000000000 gt show ipv6 route Total 4 routes Destination Next Hop Interface Metric Protocol Age 1 128 1 localhost 0 0 Direct 51m 45s 3ffe 64 fe80 11 1 Officel 0 0 Static 50m 30s fe80 12 1 Office2
241. ttl 31 time 1 225 ms 192 168 0 1 ping statistics 1 packets transmitted 1 packets received 0 packet loss round trip min avg max 1 225 1 225 1 225 ms 2 1 gt 6 LINU 8 61616 2 3900853 2 63 20410581 1 OHS ping 192 168 0 1 numeric count 1 Xm amp voc IPP 24 8 275 17042 3 gt ping 192 168 0 2 numeric count 1 192 168 0 2 54 Cpinga v FEET PING 192 168 0 2 192 168 0 2 56 data bytes 192 168 0 2 ping statistics 1 packets transmitted 0 packets received 100 packet loss 1 1 OU OU 1 1101010 091 00 0 L og UG UO 11 1 UO 32 Q00000000000000000000000 1 2 000000 o000000000000000 3 En Apo 000 0000000000000 4 str 000 sr 0000000000000000000000000000 5 strl str2 strig sr20 0000000000 1 showhistryOdD000000000000000
242. una L3 C3 E EE 1 ESI LE ESI ESTE Ee ESI ES L3 L3 L3 L3 L3 C3 L3 L3 L3 L3 mw C3 C3 23 Oooo a E a a a 146 338
243. 0 000000000 0 OOOO 00000000000 0 0 0000900 0 00 00 0 b OD synchronizeQ 00 U userfle 0000000 OOOO00000000000000 3 000000 3 2 CLI I I D 321 322 9 9 killoergog000000800000000000000000000000000 321 pog000000000000000000000000000000000000 configure po0090000000000000 0000
244. 0 000000000000 0851 000000000000 podd00 00000000000 79 6 000000 00000 000000 6 34 MO HOTO 0000000000000000000000000000000000000 0180000000 0800000000 show filter flow U 67 po000000000000000000 gt show filter flow interface tokyol detail lt Filter IP List No gt 1 Using Interface tokyol in ip source 170 10 11 21 170 10 11 30 ip destination any protocol ip forward packets 461 lt Filter IP List No gt 2 Using Interface tokyol in ip source any ip destination any protocol ip drop packets 50121 lt Filter IP List No gt 1 Using Interface tokyol out source ip 170 10 12 1 170 10 12 254 ip destination any protocol ip forward packets 3 000 635 DO DO DO Ul 0000000000000000000000000000000000000000 OM 0000000 000000000 Dad o000000000000000 show ip local policy Q 4080000000 000000000000000000000000000 000000000000 fowfitteg000000000000000000000000 80 6 000000 00000000000 U 618 po000000000000000 gt show ip local policy interface tokyo Interface Name tokyo Filter List No 1 forward packets protocol dp ip source 200 1 4 0 200 1 4 255 ip
245. 0 6413 gt show vrrpstatus Department1 VRID 1 MASTER virtual ip fe80 1234 priority 150 gt 6 11 3 IEEE802 3ah UDLD H D B 1 UI 0000 show efmoam 01 01000 1010100100 1010 111110 1 11 1 efmoam 0 0000 IEEE802 3ah 1 11 11000000000000 00008089000 000009900009090 po0000000000000000000000001EEE802 3a4 04M0p00000000000 0 6 114 IEEE802 3ah OAM 0000000 gt show efmoam Date 2007 01 10 23 59 59 Status Enabled udld detection count Port Link status PEA EL UC E UDLD status Dest MAC i 00 12 e2 98 dc 20 unknown active FITE L PA 213 ACRE BCE 135 6 000000 00000 000000 O20 000000 136 p0000000000000000000 show efmoam detail 0000000000000000 e Link status Up0 00000000000 DestMAacOOOOOOOO lt UDLD status active detection 000000000 Dese MAC U D U U D 6 115 IEEE802 3ah OAM 0 0 D D 2 show efmoam detail Date 2007 01 10 23 59 59 Status Enabled udld detection count 30 Port Link status UDLD status Dest MAC 0 1 Up detection 09 00 12 6e2 98 dc 20 0 2 Down active unknown 0 3 Up passive
246. 0 00000000 IPVeCPD OSINLCP D00000000000000000 75 6 000000 00000 000000 66 QPPPOOOOOO gt show interfaces 3 4 line 0 2004 04 02 12 00 00 NIF4 active 1 port OC 192c STM 64 POS retry 2 Average 1000Mbps 20Gbps Peak 2000Mbps at 08 10 30 Line0 active up OC 192c STM 64 POS G 652 single mode 40km Clock independent CRC 32bit Scramble on Mode sonet RDI lbit SD BER 6 B2SD link down off SF BER 3 Time since last status change 10 30 30 Protocol PPP MRU 1500 Octets MTU 1500 Octets LCP up IPCP up IPV6CP down OSINLCP down MPLSCP down 000 O30 0000000 76 show port statistics 0 ODO 000000000000000000000000000000000 69 gt show port statistics 2003 02 23 12 00 00 Port Counts 12 Port Name Status T R Unicast Multicast Broadcast Discard 0 0 0 up Tx 0 0 0 0 Rx 0 0 0 0 1 0 down Tx 0 0 0 0 Rx 0 0 0 0 0 2 0 2 down Tx 0 0 0 0 Rx 0 0 0 0 qa uud gt po00000000000000 lt Discard gt Q 000 000000000000000000000 0 0000009 000000009 000 Voli showinterfaes POS9 00000000000 6 0 000000 00000 000000 62 HOU 3111111111 L 6 2 1 t HD up down O O rvwpop00000000000000000000000 P vw0000000000000 show ip interface 00000001P00000000 updowap 0 0 UP 00000000000 0000 D 6 10
247. 0 OSU VCOOOOOOO TumellsSP 00000000 show mpls l2transport 70000000 In VC Labell Out VC Label Tunnel Label 1 65 6106 185610 gt show mpls l2transport Total 6 Transport L2transport VC In Out Tunnel Peer Address VC ID Interface Name Status VC Label VC Label Label 4 officel UP 23 26 1048576 10 1 2 2 S 16 offices UP 20000 20000 TG 101 office2 DOWN 24 100 3 3 2 106 DOWN 5 66 88 11 10 3 2 S 10000 office6 UP 20001 25000 10000 4294967295 office99 DOWN 1048575 1048570 200 10 10 2 65 Label 1 D D U U Label OOO Hug 1 In VC Label 0 00 O00 show interface Q 0000000000000 l2transport activeup 00000 L2transport Interface Targeted peer 0000000000 2 Out VC Label 0 00 000 DO0000 i2transport OOO UPC DO o d D 0 CIDO L2transport Interface Targeted peer 0 000000000 3 Inf Out O0 VC Label DUDU OOO 11 1 VCID Targeted peer 0 0000000000000000 4 Tunnel Label OO OOO 06 9 1 VP
248. 0 0000000000000 5 00 00000000 6 088 6 98000 ooo 0000000 6 IPV6CPODO 00000000 0000 0 0 0 0 0000000 0 down 000 000000000000000000000 show logging 0 0 0 000 000000 1 600000 000000000 00000 300000000000000 00000000000000000000 0 0000000000000000 7 OSINLCPOO 00000000000 OSINLCP ON 85 4 0000000000 000 900 0000000 088 6 0000000 8 OSINLCPOO 00000000000 000000000000000000000 dw mpog 00000 1 e 5500000000000000000 0 000000000000000000 0 0 0 0 0 0 show logging 0 0 0 0 00000000 Line0 0000000 000000000000 30000000 000000000000000000000 000000000000000000000 9 MPLSCPODO 0000000000 0 MPLSCPODO 0811 MPLSO 00000 OP MPLS OD 9800 000000 00000000 10 MPLSCPgOOD 00000000000 6 mesdo0 0000 00000000000 down 0 0000 0000000000000000000 show logging 0000000000000 Line d00000000000000000 3 00000000000000000 000000000000000000000 000000000 8 48 POS 00 000000000000000000000000000000000 1 00000 352000000000 LINEWANQO 0000000 ssp 00000 000000000000000000000000000 p0800000000000000 2
249. 0 10 1 downstream Multi 192 20 10 1 Multi4 192 20 40 1 2 27 KUA 225 10 10 1 NHI 192 10 10 1 AJF 2 F JL 2 7 1 172 10 10 1 AS 225 10 10 1 IPZIULFE RA F Mul til 192 20 10 1 Multi4 192 20 40 1 172 10 10 1 KUA 225 10 10 1 6 5 2 PIM DM PIM SM U 0000 IPv490000000000000000PIM DMp0000 PM SMOOOOOOOOOO show ip pim interface O Address PIM DM 000 PIiMSMpp00000000000000000000000000000 PIMC enable podp00 000 0000000000000 000000000000000000000000 DU 92 6 0 00000 0 00000 000000 111 0 D Nbr Count 0000000000000 00000 O 6 39 show ip pim interface D 1 0 DD LH PIM DM 000001 show ip pim interface Address Interface Component Vif Nbr Query JP C RP DR Count Intvl Intvl 192 10 10 1 Multil PIM DM 1 2 30 5 192 1 Multi2 PIM DM 2 0 30 x u gt 14 8 1 000001 gt show ip pim interface Address Interface Component Vif Nbr Hello DR Count Intvl Address 192 10 70 4 Multil PIM SM 2 30 1 921301 1 0 5 192 1 Multi2 PIM SM 2 0 30 192
250. 0 VLAN 0 gt 24 0 41 gt 8 2 2 CHEAT 86 lt AH KPU JIDAN BUT Ya 277 1 29 2 20 show ip interface show ipv6 interface FG RYZJI gt p 2 0 ping ping pv6 v TRA EEE show ip route show ipv6 route F CHEER AER 228 8 0000000000 1 poa000000000000000000000000000000 e 00000000000000 tunne 00000000000000000000 Voll tunne 111110 0000000000000 000000000000000000000 pod00000000000000000 pad oo odo 000000 000000000000 000 00000000000 9 2 show ipv6 interface J e 00000 physical address 8400000000000000000000000
251. 0 config copy erase startup config synchronize OOOOOOOOOOOO O 00000000000000000 00000000000 adduser rmuser clear password password killuser 00000000000000 noenable 0000000000 enable OOOOOOOOOOOO O 1 ooo 000000000000 roti CG 00000 000000000000 00000000000 Dodd 0000 00 0000 0000000000000 Dad pa 1 C 0000000000000000000000000 1 1 podd 080000 00 0000 000000 000000 000000 00000000000 080000 00 0000 000000 00000000000 0000000000000 00 11 000000
252. 0 poda ooo doo 000000000000 00000000000 000000000000 152 un 07 4 oo oo uguu 1 ax7800rSystemMsgTra 1 00 00 pO AX7800R O O ax7700rSystemMsgTra pO AX7700R 2 ax7800rStandbySystem BCUJOO 8 BCUTQ UpTrap AX7800R OO 1 AX7702RQ 10110101001000000 0 0 3 ax7800rStandbySystem BCUDOO Cold Start 0 0 0 BCUNDO DownTrap AX7800R AX7702RQ 0 0 0 OOOOOOOOOO 4 ax7800rTemperatureTr QQ QOO000 BCUDUOUOOU00000000000000000000 ap AX7800R ax7700rTemperatureTr ap AX7700R 5 axrIsisAdjacencyChang 16 181000 D D e ISISPOO DO DDD 00000000 e uu e ISISOOOOOO000000000 e ISISOOOOOOU000000D 6 axrOspfVirtNbrStateC 10 5 1 0 hange OOOO
253. 0 48000 00000000000 aute 000000000 1200 2400 0 0 V 90 K56flex x2 0 gogo 00000000 00000000000000000000000 0000000000 00000000000 3 0000000000000 0000 0000000000000 20000000000 0 2 4 822 8 0000000000 0 8 4 1 od 1 i PCO ping 1 2 D DNs 500 000 2 0000000000 0000000000000 1 0000000000000 system 00000 IP000 1Pv60 0 0 1 0000000000000 0000 system 0
254. 00 8 host target 1 OHOOO00000g0 0000 config show dhcp6 server interface dhcp6 server yes oP ha a 231 8 0000000000 dhcp6 server interface TokyoOsaka preference 100 host target Osaka host target Tokyo config OA 0000000000000 D el D 232 1 5 Fa E UE binding 0 OOOO show ipv6 dhcp binding detal 1 0000000 DUIDQOOUUOU00U00U000000OO podd0000000 0000000000000 0000 gt show ipv6 dhcp binding detail Total 2 prefixes lt Prefix gt Lease expiration Type lt DUID gt 3ffe 1234 5678 48 03 04 01 11 29 00 Automatic 00 01 00 01 55 55 55 55 00 11 22 33 44 55 3ffe aaaa 1234 48 03 04 01 11 29 00 Automatic 00 01 00 01 55 55 55 55 00 11 22 33 44 55 a o E 7 S L3 LJ CO 2 e E po a inding detalQ
255. 00 gt show ipv6 cache policy routel lt Policy Group Name gt routel priority Interface Name status Nexthop 1 tokyol Down 3ffe a01 2 2 tokyol Down 3ffe all 2 3 tokyo2 Down 3ffe b01 2 gt 4 tokyo3 Down 3ffe c01 2 default 0 4 000000000000 0000000 gt O O O show ipv6 cache policy 0 DD HELD B D DT 0 000000000000000 TagvLANgoDo000000000000000000 1 OO00000000000 2 show interfaces OO 000000 Tag VLANQOOOOO0 VLANQGOOOOOd0d000 VLAN mpo0000000000 3 Tag VLANDODODOODO VLAN ID 0 0 0 0 show interfaces 0 0000000 Tag VLAN0 0 UU 0000 0000000 Tags VLAND0000000000000000000000000 Tag VLAN Y OO 000000000000000 00 LAN Swith0 000000000 VLAND0000000
256. 00 09 00000 000000000000 NIFDO 10 Lineh D 008000000000 NIFOO 10 Line 0 0000 test interfaces no test interfaces Er 1 U gt close nif 1 line O Enter 0001 test interfaces nif 1 line 0 network line Enter 00001 test interfaces nif 1 line 0 connector Enter 0100000 00010000 no test interfaces nif 1 line 0 Enter V mV Vv O D free nif 1 line O Enter D 8 00000 9 7 2 POS QU 314 9 0000 940 ARE ERE ES a JL M8 2 9 2 2 2 2 JU Z3 2 2 24 0 2 2 2 2 24 JU 731 2 3 JU 22 45 2 2 2
257. 00 00000000 335 00 po000000000000 9 po00000000 329 1 0 1000000 0 0 0 329 2 8 00000 po000000CL00000 20 PRUNIFU 307 BCUOOOOO 306 110100 134 251 OOOOOCLHOOOOO 17 14 NetFlowOOOOOOOOO low 263 000 sFowQ 0 0 sFlow 0 259 Oo 3 uggaggggaagaggunmuug 164 DoOo00000000000000 329 64 L3 r3 D 0 O 0 O 0 Net L3 L3 L3 a 00 u D u 00 DU Oooo 9 a 99 o c3 S EI c3 El a a a a 21 1111 1 0 3 0 329 329 00000 162 283 OFFU Mm 2 2 oO CJ Ed c C c n OO E Ed ao EJOEdSES Ej CJ EJ CJ CJ c C a a C C 5 em EJ EY Eu C3 C3 C3 CJ C C pb a a a a a ngagagi a a 000 ONDDDDD a a E a 274 151
258. 00 12 e2 98 74 78 ERSINTLUI LS 6 00000 0 00000 000000 612 SNMP I DI D D UO DO D D D D 6121 SNMPODODODO 0000 S8NMPgo0000000000000000000000 MBOOOOOOOO 6 SNMPOOOOOO 6 1000 420000000 ping 0000 SNMPOOOOOO 1 000000000 861 poo 2 MIBpo Do 0000000 000000000000000 000000813 SNMPpo000000000000000 137 6 000000 00000 00 0000 615 1 1 11 LLL 6 13 1 sFlow BHL DO D 1 1 UU 0000 000000 0 O10 ping I 0000 sFlowOOOOO 1Pg00000000000000000 86
259. 00 P000 IPven 0 0 D 00000000 00000525 2 0000000000000 0000000000000000 4 DO pg 000 0D 0000000 0000000000000 1 0 0D 0000000 000000000000 00 TCP 000000000 1 Bog Do 000000 00000000000000 10 3 00000000000000 556 3 000000000000 0000000000000 1 XONQ XOFF JO 000000000000 0000000000000 pp4000000000000000000000Cr0 0000000 2000000 2 DODO DO 0000 0000000000000 00 3 0 osgg ogg 008000000000 00000000000 4 000000000000 000000000000 000000000000 00000000000 000000000000 2000000000 killuerd 9000000000000000000000 000000000 configured 0 DO0 DO 0000 00000000000 quit eit DO ODO ODO 000000 00000000000 8 2 3 0000000000000 018 1 L3 L3 L3 r3 L3 L3 OOOO L3 L3 OOOO L3 L3 OOOO L3 L3
260. 000 config tacacs 192 168 10 1 key TaCH001 config tacacs authorization config show tacacs tacacs yes tacacs authorization tacacs 192 168 10 1 key TaC 001 0000000000000 0000000 00 19216851 000 P0O000 0000 9 16 config login authorization config show login login authorization login user guest deny commands reload close enable x login user staff class allcommand login user test allow commands show ip O 00 510 pgog000000000000000000000000000000000000 0000 RADIUSO TACACS QO D 517 RADIUSU config system login authentication radius local D 518 5 11111001 config system login authentication tacacs local 9 19 config system login authentication local 51 5 00000000 04000000000 52 000000000 RADIUS TACACS p80000080000000000000000000000 0000000000000 showwhbamapgogo000000000000000000000000 podd0 000000 000000000000000 0 5 20 staff 000000000 gt show whoami staff ttypO 2 Aug 6 14 17 03 10 10 10 10 Home directory usr home staff Authentication TACACS Server 192 168 10 1 Class allcommand Allow all Deny Command list
261. 000 4 ud 2000000000000 configuration discord 000 00 00 copy duplex 0000 startupcontig O00000000000000000000000000000000 1010000100 copy 00 80000000000800000000 162 8 0000000000 oo 0000 5 000000 00 2000000000000 software version discord 0 00000000000 duplex 0 00 00 reload stop standby 0 O00 0000000000000000000000000 1110190889 8008 0 0000000000000 MCO 1111010009 000000000000000000000 600000000000000 ngagagi copy 8 0 0000000000 00 0 0 00000 0 0 0000 0 000000000 6 000000 00 2000000000000 license key discord 0000000000000 duplex 0 0000 reload stop standby 0 0 0000000000000000000000000000 1111999089 8 08000800000000000 0000000000000 Mcnnn 000000000 0000000000000000000 0000000000 00 copy 000000 mel 0000000000 0 0 00 000 00000 0 0 0000 0 0000000 7 0000 0000000000000000000000000000000000000000 0000000000000000 3 000000000000000000000 000000000000 00000000000000 8 14
262. 000 0000000 0000 Voll 5 2 1 OC 192c STM 64 0 OU D D 0000000 00000 000000 849 PPPO0000000U0 0100000 PP PPp0000000000000000000000 PPPJ I show logging 000000 3 3 1 OOOO00 PPPOO0O00000000000000 00100000 000 00000000000 O20 0000 818 0 D 0000 og od D 1 showinterfaces 0000 00000000 linen CRCO000000 0o00 CRC Errors 2 showinterfaeesD 0000 OOOO show trace pppO 0000 OOOO PPPOOOOOOOOO
263. 000 CPO 000000000 e OSPF OSPFv30 15151 0000000 Hellentevat 0000000 190 d d d d d d O D RouterDeadInterval HelloInterval 1 3H B B HH 90 3210 00000 U UUDDDDDDDDUDUDUDUDDDBDBDDUDUD 1000000000000000 3000000 pod 000000000 000000000000 000000 e BGP4 BGP4 Q 000000000000 HodTime0 0000000000000000 x 100 gt HoldTime pp 0000000000000000000000000 10000000 podd0 100000 00000000000 000000000 58 5 00000000 9 4 NFODODODOD 5 4 1 NE1G 48T 1 11 O10 0000 000 NIFOOO O000000000000000000 00000000000000000 poooo001epgod000000000000000000000000000000000000 0000000000000000000000000000000 00 0000000000 0000 NIFOOO NE1G 48T D 929 OOOO 8k4 2542r At F amp 22724Z7v vzavI BE ENE d LCUST42582r AHWm ESXLCUST 425 9076688606 TI ANY Zr ABUSSIT6ELN VRMR CHS 473971 A MESITA IAN 182 3 BHE FIR 4 E NFRA ORAFI 3EJBAO IBS CT X EEL ooo ssQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 00000000 311NkiG 48TOOOOOOOOOOOOOOOO 000 20000000000 817600000 s176000000000
264. 000 OOO 1 0000 000000 OSPFOOOOOOOO Up 2 0000000000 0 0 0 0 0 58 Backup DR Other dtu 3 1 1 0000000000 0 Down 10 axrOspfVirtIfConfigErr 00000 0000 10 300000 1111111111 or 1 0 10000 Ou 2 0000000000 0000000000 Du 3 HeloQOOOOOOO O00 HelloInterval RouterDeadInterval 00000000 11 axrOspfIfConfigError OSPFOO0000 0000 10 300000 1 20000 2 OSPFOOOOOOO O 3 80000000 O O O HelloInterval RouterDeadInterval 111 1111 1 1 O 12 axrOspfVirtIfAuthFailu osPFOOOOOOOOO 6 8 axrOspfIfAuthFailure 111111 11 1 14 ax7800rAirFanStopTra uggggga Oo pf AX7800R ax7700rAirFanStopTra pO AX7700R 15 ax7800rPowerSupplyF 0 ailureTrap AX7800R
265. 0000 9 0000 physical addressQ 0O0000000000000000000000000UP000 0 851 pgod0000000000000000000881 0000000000000 E EST 0 6 E 3 D pingi pingipv6 000 000000000000000 oooooooooooooooooooooooocooloooms31 0000 go000000000000000000000 881 a a a O a UUDUDDDDDDBDDDUUDUDDDBDBDDDUDUDUDUDDDDDUDUDUDUDDUBUBDDDDUUL o oooooooooooocooooooooooooooooooooooooona o oooooooooooocoooooooooooooooooooooooooona Vol 1 1311490000000000000000000000000 LL show netstat routing table 6 Voli 13114g9g00000000000000000000000 00000 a a a a a a a m po
266. 0000 00000000 0 0 8 OFF0000000 14600000 18 0 0 0000000000000000 00000000 O OO reload stop 0 OOD po00000000000000 O0FF0000000 2 0000 24 s p10000000000000000 D22 08 18 11 17 30 Starting 1st loader ROM 03 02 Rev6 Wed Mar 6 13 05 59 2002 JST BIOS Rev R1 02 E4 990129 08 18 11 17 33 Loading from MC slot 0 08 18 11 17 33 Starting 2nd loader 08 18 11 17 33 Loading boot done 08 18 11 17 34 Starting 3rd loader 08 18 11 17 35 Loading bsd 0000 gz done 08 18 11 17 37 Loading rdimage gz done 08 18 11 17 42 08 18 11 17 42 Loading rdimage2 gz done 08 18 11
267. 0000 9 0000000 ATrOOOOOOOOOOOOOOOO 00 000008 00 008000000000900 OOOO UDUD 0000 Hayesi D ATO 000000 CDDDUD AT amp C1 0000 DTROOOO 0 0 AT amp D3 ATEO DTEQ AT amp K3 e RTS CTSOOOOOOO XONXOFF 0000000 DrEgo0 000000 ATQ1 ngagagi ATS0 2 AT amp Y0 AT amp WO 00000
268. 0000 8 54 3 5 111 11 1 1 1 1 L 210 0 00000800000000000000909000000 3000 00000 0000000 2 3 8 0000000000 lt m G Z LY show 0881 82 X SMBS X OIRRETERE Vr BS ABRES JS lt MERA BERE JS lt U4 Av RIERA LO U4 lt gt RARD S E 3 lt gt AY EER 2121 65 FrAyve VO MG EKU 1 show ip interface v FIZk 4 YATIA Qup downO TERR MNCS xu 510 68 ISHED TC HEELS up down show dns relaya Y 1 2 2 D N 8 LOIRE 8 4 Ry ROI 94 14 2 5 TERR 65 2 gt gt ESL AGRE OE 121872 L ARIE ODER yE LC Fl Y 2 6 4 VERE OT RL NOD RETO TIREN LESU Lmepg00000000000000 00000000000000 p0000000000000000000000 go0g00000000000000000 5 0200000 Dal show dns relayQ OOOO DNSpgo0000000000000000000000000 show dnsrelay 0 0080000000000 0000000000000000 dns resolver 0 0 0000
269. 0000 40 show ip mcache J 00000000000 8100 61000000000000000 300 PIM DM 0 00000 1110111011000008000900008000900000000 3 7 EST EA E E o0 gg LJ yO 10 show ip 61111110100 009 S130 GIOOOOOOOOOOOOOOO 19 41 1 D 000 0 D U D D show ip pim neighbor 0 0 00 20000 30 3 show ip mcache 0000000 S100 61000000000000000 E E 00000 00000 00000 00000 00000 po0000000000000000 00 PIM DM J enable god g000000000000000000000000000 O DODoDOoODO EIE ue E 3 2 2 53 3 oo UU show ip pim neighbor OOO 10000 40 30 showiprpf SO 00000000000000 80000000000000000 oo ET O O 0 O 0 O D 0 0 O O 0 0 O O 219 8 0000000000 872
270. 0000 00000000000000 320000003100 ath trace message send 0800000000005 000000000000 path trace message receive 0000000000 SSD Un ner ssOOO000 SS line 89 1 1101 OOO OOo rr JE in A 1 D D 00000000000 D D D 0x DODO0D Dg 0 DD 00D 0 DD 00D 0D DDD DDD DDD 00D 0 o ooo ooo 000000000 000000000000 181 8 0000000000 846 ME HATO poo od 000000000 8 13 Sea EJ 1 show link aggregation 0000 ma active 0 Ooo 2 n lt o ooo ooo noo ooo O noo ooo gt n 5 gt gt a OO e 1 I a El
271. 0000 S00000000000000000000 13 0 0 0 0 MLDv2 D D show ipv6 mld 000000000000 61000000000 0000 Ss00000000000000000000 14 000 40 show ipv6 mroute O0 000000000 8100 6100 0000000081610 000800000000000000000000000030 200 00000000040000 0000000000 ssMpo00 0000000000000 000000000000000 20 IPv6 PIM SMOOOOOOOOOOO enable 000000 15 0 0 0 20 show ipv6 mrouteQ O0 000000000 8100 6100 00000000081 61000080000000000000000000000003f000 1 4000000000000 SSMOOOOOOOOOOOOOO po000000000000000 000000 00 PM SMOOOOOOOOOOO enable 00000000000000 16 1 00 10 show ipv6 mrouteQ O0 000000000 8100 6100 1910 8 0 100 00 0000000000 41010000000000000000 0 243 8 0000000000 8 11 MPLSH 0 0 D OP MPLS 1 0 8 11 1 LI H ED H D U LI D 0190000000 po000000800000000000000000000000 Voll 17 MPLS OP MPLS O D cog0000000000 000000 00000000000000000000 20 MPLSO podd0 000000 000000000000 O20 0000 0 0 0
272. 00000 9 8 0 309 064 7 BFDO0000000000 00000000000 OP BFD D 6 31 show ip static route 00000000 gt show ip static route Status Codes valid gt active Destination Next Hop Status Flag gt 0 0 0 0 0 10 T 1 50 Active 172 10 1 24 158 10 1 104 Active gt 192 1 10 24 190 10 1 120 Active Up BFD 192 10 10 24 190 10 1 108 InActive Down BFD gt 192 168 7 24 190 16 71 100 Active Reachable Poll 192 168 51 24 190 16 50 101 UnReachable Poll gt 87 6 000000 00000 000000 643 RPOOUOOOUOOOOOOOOO 0000 Pv40 00000000000000 RP000000000 U D show ip rip gateway O D podd0000000000000 O Gateway Address 0 00 0000000 000000000000000000000000000 O e Ager 300 00000000000000000000800000000000000000000 0000 rRPpgog0 000000000000 000000 000000000000000000 O Flags Format AuthFailg HO D D 00 D 0 Format AuthFail D e Flags Rejet 0 000000000000000000reeegod00000000000000 0 rRPpog0000000000000000
273. 00000 00000 000000 O20 000000 Da show ip interface 8 6 21 gt show ip interface delete packets null interface Interface Name null Discard Packets IPv4 92 pkts gt 637 00 011010 o120000000000000000 Dal D 5 show ip route OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO De 00000000000 gt show ip route Total 4 routes Destination Next Hop Interface Metric Protocol Age 172 16 10 24 172 16 10 1 LANO1 0 0 Direct 29s 172 16 10 1 32 1T72 16 70 1 LANO1 0 0 Direct lh 12m 172 16 20 2 24 192 168 10 1 LAN10 0 0 Static lh 10m 192 168 20 1 LAN20 192 168 30 1 LAN30 192 168 40 1 LAN4 0 172 16 4 172 16 10 2 LANO1 2 0 RIP 29s gt 10101 O 0 00 O ping IPv4 Address specific route source Source Address D HH E 1111 1 DU OOOO lt Source Address gt 0 Y 1 4 0 0000000 0 638 OOOOOOOOOOOOO 011 00000800980000000 D aD 82
274. 00000 0000000 AX7700R 0 0 000 Voll 3 2 2 AX7700R 00000 AX7700RD 00000 Voll 8 2 2 11 9 NetFlow D O0 0000000000000000 8 0000000000 8 13 1 1 8 15 1 LbPpo000000000000000000000000000000000000000000 8 38 od D 200 EnabledQ 8 070 1 Disabled 000 LLDoPOOOOOOOOOOOOOOOOOOOA showlidp 0 000000000000 0 0000 0 00000 00 0 300 25 00000000000 LDPJ00000000 0000000000000 0 0000000000000 showldpOOOOOOO0O000000 0 0 400 3 200000000000 Dwppg0008000000000000000000008 4 000000000000 000000 20000000000 4 show lldp 0 0 000000000500 opp0000000000 10000 4000 200000000000 0000000000 00000000000 0000000 5 show lldp 00 0000000000 eni 1 Chassis ID Chassis ID 6 show lldp f 000000000000
275. 000000 DU free pru PRU No Enter PRU No B D Main Menu gt gt Action gt lt ACTION gt gt FREE PRUx x 00 00 00 932 1 OFFOOOOO pog00000000000000 0 80 8009 0 0 99 0000900 0 O10 000 OFF BCUOOOOOGO 290 00 100008 Be0go0000000000000000000000 8 1 AX7800R 0 0 9 18 DDD 000 EB EJROFF Hg U 5 FIE 00000 000 0000 EE RON BCUQ EE FAA RE TERE 100000 OFF 00000 0 34 FIRS 9 0000 UU 00 1 000 80 1 DD U 919 8 1 ODO 20 BCU 0 DU OU 0 OFF 80 FIDE V C AMOR U HL 8000238 9 L 000 3000 BCUOOOOO
276. 000000 enable 0 O show ip pim neighbor O0 000000000 20000 4000000 000 show ip mroute 00000000 100 61000000000000000 0700 04 50000000000 OO D u 00 D D 221 8 0000000000 81 1 PIMSMp 0000000000 ODOOOO0O0U0000000000000 12 0 00 1 show ip pim neighbor 0 0 0000000000 10000 00000000000 873 222 KEEN 05844 KUA gt 5503 0584420 FDA 100000 610000000000 81108 IPveDvmrPp 0000 1 00000000 show pru resources OOOOOOOOPRUOOOOOOOOOOOOO IPv4D O O 40 show ip igmp interface 00 0000000000 0000000000 IGMP UUDUDDDDDDD 0008800800980000090000 4 show ip igmp 00000 0000000000 40 show ip 61111110100 00 S100
277. 0000000 129 6 000000 00000 000000 6 105 LDP gt show mols Idp 10 1 1 1 detail Total 1 Interface Name localhost targeted Local 10 3 3 3 Remote 10 1 1 1 Time since last LDP status change 1 Last down reason d Hold time 45sec Hello intervat Message Send count Last sent Receive count Last received Status DOWN ge 0 egal message received 0x80000003 Sr L SEE Notification 0 00 00 00 0 00 00 00 Hello 5 11 15 19 5 11 15 19 Initialization 1 22 55 29 1 11 15 19 ive 5 12 23 30 5 11 15 19 Address 0 00 00 00 0 00 00 00 Address Withdraw 0 00 00 00 0 00 00 00 Label Mapping 0 00 00 00 0 00 00 00 Label Request 0 00 00 00 0 00 00 00 Label Withdraw 0 00 00 00 0 00 00 00 Label Release 0 00 00 00 0 00 00 00 Label Abort Request 0 00 00 00 0 00 00 00 Others 0 00 00 00 0 00 00 00 6110 t 20 Mt AR Targeted LDPOOOOOOOOOOOOO 6 4 oo 0 og 1 UPOO Down 10 DU D show mplsldp 0000000 Last OOO Targeted 1 8 000000000 down reason Targeted LDPOOOO
278. 0000000 O55 config system login user 5 config 0 51 O0000000000000 od 000000000 telnet rloging 4 1 10 000000 LL O d 0 gt DO Go vxpg00000000000000000000000000000000000 O 0 O O 0 000 000 Du 000 000 000 DU DU Lr rcu HO Lr El PN Bs 525 DUOOOOOOOOOOOOAOOOOOGO 018000000000 IP000000000 pod 000000000000 00000000000000000000 00000 IPv4n 00 Pvepooo00000000000000000 12800000000
279. 00000000 O Flags Format 8 00000000000000000Fomepo00000000000000 000000 RiPngOOOOOOOOOOOOOOOOOOOOOOOOOOOO e Flags Reject 000000000000000000Reetgo000000000000000 OO RiPasogog0000000000000000000000000000 ripangi 000 interface 0000000000000 mpmQO0000000000000 O Flags ImportkestritJ0080000000000000000 ImportRestrictQ 00000000 6 000 0 O 0 6 71 show ipv6 rip gateway D B DDD gt show ipv6 rip gateway Gateway Address Age Flags fe80 2a0 c9ff fe6b 8elbs0ffice01 58 lt Accept gt fe80 200 87 fed0 e261 0ffice02 8s Accept fe80 260 8ff fe8e 3090 0ffice03 12s lt Accept gt gt 111 6 000000 00000 000000 674 0000 D 000000 show ipv6 ospf interface Interface Name show ipv6 ospf interface detail 1 HH 1 1111 10101 HE D DU e Neighbor Liti
280. 00000000 pinggOOOOOOOOOOOOOOOO pinglOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO pingOOOOOOOOOOOOOOOOOOOOOOOOOOO pingOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO ARPOOOOOOO 000000 pingOOOOOOOOOOOOOOOOOOOOOOOOOOOOOARPOOOOOOOOOOOOO oooooooooooooooooooooooooooooooooooooolag 1 2 9 show ip arp OD DO00000000000000000000004rRPg0000000000000 000000 po000000000000000004rRPpgo000 0000000000 6000000000 podp00 0000000000000 193 8 0000000000 11 1 0 0 0100000000090 i IPvwggo0000000000000000000000 86
281. 0000000000 220 PIM SSMO 0 0 D 0 0 327 LineQ DDD 000000000 27 LLDPE 00000 326 LLDPOOOOOOOOOOOO 145 M POSOO 80000 314 5 183 MCOOOOOOOOO 163 75 PoSOOOOOOOOOOOO 185 305 PPPO 00000 327 305 189 305 MCUDDDDDDUDDBD 3 PRUD OOOO 327 MCOOOOOOO 155 6 MIBO 0 0 0 0 326 MLDO OO D 0 D 326 Q U 327 0 1 90681 1580 0 000 122 MPLSUDDDD 244 9681 11 132 N R 326 00000 NATO 6 00000 16 48 0 59 pe e sl NetFlow 0 000000000000 139 RADIUSO 327 NetFlow 0000000 326 RECO 327 NetFlowQ 00000000 139 RIPO 00000 327 334 RIPng 0000 327 RIP ngp 000000 236 RIPg 0000000000000 111 RP0000000 214 88 RMDDUDDUU 327 RMON 0 0 0 U 7 RS 232C 4 RTTO 00000 327 S 138 000000000000 sFlow O d 327 11110 1 136 show tech support 0000000000000 280 SNMPOOOOOO 327 SNMPOOOOOOOOOOO 137 SNMPOOOOOOOOOOO 2 SNMPOOGOOO 255
282. 000000000000 167 8 0000000000 2 00000000 RADIUS TACACS O p000000000000000000000000000000000 00000 RADIUS0000000000000 0 0 0 TAcacs 0 00 0 Service 0 000000 RADIUS TAacacs 0 00000000000 3 26 CLIDDUDDUDUDU po00000000000 3 RADIUS racacs OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO show ip shwipg000000000 000000000 OU show ip interface 0 000 00 0000 D D D show ipv6 interface 0 0000 826 D UDD O00000 HDH U 168 000 1 show whoami J 0000 show whoamilOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 2 5 6
283. 000000000000 IPH 200 10 10 2 0 000 000 000 000 000 DU 532 config line aux line aux config ip 200 10 10 1 24 destination_ip address 200 10 10 2 line aux config 8 O20 00000000000 Dad 000000 1Po00000000000000000 0 9 18 OOOO OOOO 1 0000000 PPP 2 000000000000 TCP J IP TCP IP 3 IPOOOO 4 5 0000 0000000000 6 0000 00000000 00000000000 0000000000 0000000 0000000000000000000000000000 12000000000 paswwrdeg400000000000000000000000000 0000000000000 66 5 00000000 0 al D 5 O et 000 000000000000000 00000000082 Q00000000000000000 D 0000 IP00000000000000pme8000000000000000 O O OOOO 1Pgo0000000000000000000 show sessionsQ 000000000 0
284. 000000000000 rip0 0 D D D interface po000000000000 ripagg0 000000000000 O Flags ImportRestrict 0 0000000000000000 0 ImportRestrictQ 00000000 00000 00000 0 O elin 000 00 5 0 O 0 O 0 O 0 Er EE Lr show ip rip gateway 1 00000000 6 32 gt show ip rip gateway Gateway Address Age Flags 192 168 50 185 1s Accept 192 168 60 30 14s Accept 192 168 70 30 9s Accept gt 644 11 1 66 0000 411 0 00000000 00000000 00 show ip ospf interface IP Address O show ip ospf interface detail 1 B L BH e Neighbor Lit po00000 Helen gnu unudgnuaunuudapnuanugpnuanugapnauanadnpu O Network Type PtoPQ Neighbor 1111111111 Full Dn 1 980 6
285. 00000000000000 podd0000000000000000000 6 111 po000000000 gt show vrrpstatus Department1 VRID 1 MASTER virtual ip 170 10 10 2 priority 150 gt 6 11 2 IPv60000000 VRRP D D DU 0000 Dal 0000000 show vrrpstatus detail 11 11 111 E wrtualrouter 0 VRRPU 134 6 000000 00000000000 VRRP LH U DD 6 112 gt show vrrpstatus detail Department1 VRID 1 Virtual Router IP Address fe80 1234 Virtual MAC Address 00 00 5e 00 01 01 Current State MASTER Admin State enable Priority 100 IP Address Count 1 Master Router s IP Address fe80 abcd Primary IP Address fe80 abcd Authentication Type SIMPLE TEXT PASSWORD Authentication Key ABCDEFG Advertisement Interval 1 Preempt Mode ON Virtual Router Up Time Tue Feb 22 13 05 53 2000 Critical Interface Department2 Critical Interface Status IF UP gt O20 000000 MASTER Y O BACKUP pop 0000000000000 0000000000 00000000000000 podd000000000000000000000 show vrrestatus 00000000000
286. 000000000000000 L3 L3 L3 L3 C3 O 0 O O 0 323 DUDU 111111 1 I AX7800R 000000000 0000000000080008000000000 standboy 0 00000000000 eo0000000000000000000 2 fstandbyOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOGO 3 324 i SBY D u po0000000000000000000 login userl Password Copyright c 2005 ALAXALA Networks Corporation All rights reserved Welcome to the System SBY gt 3 2 5 telnet 0000000 tenetpg000000000000000000000000 temep00000000000000 00 000 000 000 a a a a O teme podo000000000000000000000000000000000 podd0000000000000000000000 a a O a a a a 326 HB B 11111 HPH TBI H p 0000000000000 Voli 15 00000000000000000000000000000 23 3 000000 O primaryMC var dump T secondaryMC var dump 0 0 0 327 CLIOOOOOOOOOOOOOOO Ctp OO COO Ctrl O H ZOD
287. 000000000000000 gt ping 192 168 0 1 PING 192 168 0 1 192 168 0 1 56 data bytes 64 bytes from 192 168 1 51 icmp seq 0 ttl 255 time 0 286 ms 64 bytes from 192 168 1 51 icmp seq 1 ttl 255 time 0 271 ms 64 bytes from 192 168 1 51 icmp seq 2 ttl 255 time 0 266 ms le 192 168 0 1 ping statistics 3 packets transmitted 3 packets received 0 packet loss round trip min avg max 0 266 0 274 0 286 ms gt O 615 gt ping 192 168 0 1 PING 192 168 0 1 192 168 0 1 56 data bytes ping sendto J ping wrote 192 168 0 1 64 chars ret 1 ping sendto 00000 ping wrote 192 168 0 1 64 chars ret 1 ping sendto J 2 168 0 1 64 chars ret 1 ping wrote 19 20 192 168 0 1 ping statistics 3 packets transmitted 0 packets received 100 packet loss gt 6 3 2 traceroute 0 00000000 1Pvwpgo0000000000000000000000000000 D 616 traceroute HB d B traceroute 192 168 0 1 numeric traceroute to 192 168 0 1 192 168 0 1 30 hops max 40 byte packets 1 192 168 2 101 0 612 ms 0 541 ms 0 532 ms 2 192 168 1 51 0 905 ms 0 816 ms 0 807 ms 3 192 168 0 1 1 325 ms 1 236 ms 1 227 ms gt 6 3 3 O00000 8 11 1 L rvwpop00000000000000000000000 P vw0000000000000 show ipar 000000000 00000000 0000000000000D0ARPO000000000
288. 000000000000000 10 BSRODO0000D0000000rRPg0000000000 2000000000 20 show ipv6 pim bsr 000 DU D 11 O O O O D O O O O PI O M o 3 0 E E LH Ed o 5 2 O O 0 O O O show ipv6 pim rendezvous point mapping 0 DU DU 20 858 OO 1 11 8 0 0910 0000 0000000 20 8880111000 10 BSRgg00 000000 0000000000000 2 show ipv6 mroutef 00000000000 S100 6100 6100 000081610000 6 300 000000 9 enable 0000000000 show ipv6 pim neighbor O 000000000000000000000000000 0 0 0 13 1Pveg 00000000000000000000000000000 30 show ipv6 pim bsr Y O show ipv6 pim rendezvous point mapping 0 O HH E RP D Q000000000000000 20 PM SSMOOOOOO 242 01 0000 IPv6 PIM S85Mpp0 00000000000 sud 610000000000 10000 pogo 000000 000000000000 1 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 0000 DO 81 EIE E ed ed ea ea FJ EST EST OOO show pru resources IJJ
289. 0000000000000000 OO0000 IP 206 8 0000000000 00000 fixed addressQ 000000000000 000000000000000000000 000000 192 168 10 192 168 10 100 0 192 168 10 110 000000000 192 168 10 110 O 192 168 10 1100 9000000000 dhcp subnet 192 168 10 0 24 range 192 168 10 100 1 0 dhcp host manager hardware 00 11 11 ef ff 11 fixed address 192 168 10 110 gd00 0000000000000 00 000000000000 0000000000000 0000000000000 00000000000000 dhcp option routers D D D gdg00 0000000000000 00 000000000000 0000000000000 Vai 13 DHcPOOOOOOOOOOOOO 0 10 DACP O 00000000000 000000000000 00000000000 00000000 00000000000 Voll dhep
290. 0000000000000000 108 67 8 60000000000000000 110 671 000000000000000 110 672 110 673 869 0 0 0000000000 111 674 08830 00000000000000 112 675 BGP4 0 0000000000000 oP BcPr 113 676 1514500000 0 0 op isisg 113 677 8 0 00000 0 8 0 114 678 00000000000000000000000 115 00 6 8 11000 0 OP MLTO 116 681 0000000000000000000 116 6 8 2 PIM SM I EH DB DU D 117 6 8 3 120 69 MPLSO 0 0 OP MPLST 122 6 9 1 VPNMPLS I D U E H 122 6 9 2 IP VPN I H B DDD D 126 6 9 3 EoMPLS L2 VPN 0 0 1 00 128 610 00500000 132 6 10 1 QoSHOO0000000 132 6 11 134 6 11 1 IP4 000000 134 6 11 2 IPV6Q 000000 BL B 134 6 11 3 IEEE802 3ah UDLD 00000000000 135 6 12 SNMPODODODODODO 137 6121 8 000000000000 137 613 138 6 13 1 sFlow 000000000000 136 6 13 2 sFlow 00000000 136 6 13 3 NetFlow 000000000000 139 6 13 4 NetFlow 00000000 139 614 1 11 1 0 143 6 14 1 10111 1 1 01 0 143 6 14 2 040000000000 144 O00000 147 71 0 148 72
291. 000000000000000000 O 2 OOO OOO un 00000 03 921 000000000000000000000000 te0 0000000000 276 9 0000 019 00000000000 0000000000 9 2 Ll Ll Ll JUUYUH gt cd var dump gt ftp 192 168 0 1 HXAMXAO7 Connect to 192 168 0 1 220 FTP server Version wn 2 4 4 Fri Jan 1 00 00 00 JST 1999 ready Name 192 168 0 1 operator test 331 Password required for test Password xxxxxx 230 User test logged in Remote system type UNIX Using binary mode to transfer files ftp prompt HEE Fez Interactive mode off ftoobin lt 200 Type set to ftp od EXT L4 BERT A F 250 CMD command successful ftp mut 6 y7774NOEE local rmdump remote rmdump 200 PORT command successful 150 Opening BINARY mode data connection for rmdump 2 312 345 bytes 226 Transfer complete local rp00 000 remote rp00 000 200 PORT command successful 150 Opening BINARY mode data connection for rp00 000 512 322 bytes 226 T
292. 000000000000000000000 RIPng Routing Information Protocol next generation 00000000000 RM Routing Manager PRUQDOOOOOO RMON Remote Network Monitoring RTT Round Trip Time sFlow sFiow0 00000 0000000000000000000000000000000000000000000 SNMP Simple Network Management Protocol TACACS Terminal Access Controller Access Control System Plus NAS Network Access Serve 00 0OOOOOO0000000000000 Tag VLAN TEEEQ QOO00 VWAAND 000000000000 8 VLANGOO VLANDOD 327 00A 0000 UDLD Uni Directional Link Detection UDP User Datagram Protocol
293. 0000000000000000000000000 D flJ O Software Version Discord O License key Discord O DUUDDUDDDUDDDBDDUDUDUDDDBDBDDUUUDDDBDDDDUDUUDUDUDUDDBDBDUD UUUDUDUDDUDDDBDUDUUDDUDU Oo Lr a Ooo a a a O00 0000 0000 OOOO o oooooooooooocooooooooooooooooooooooooona 0000 0000 0000 0000 a Lr a FT E D D D D D D 96 2 DODODOO PRUO NFEDDDDD po000000000000 PRUD O10 PRUD OO 00000 PRUDD 0000 0000000000 show 0000000000 gt show system Enter 1 935 PRU showsystemp000000000000000000 e 0000 PRU active D Hl 000 D DD e PRUQOOOOUOOO C PRU1 active PRUQ 00000 00000 O ono o C3 oo NA U 8 35 PRU 000000000000 gt show system O O O PRUO Active AX F6544 R2B2 PRU B2 Lamp LED green Memory Size 131 072kB
294. 0000000000000000000000000 uut 10000000000000000000000000000000000000000000000000000 Hu uut 10000000000000000000000000000000000000000000000000000 1000000000000000000000000000000000000 0 10000000000000000000000000000000000000000000000000000 10000000000000000000000000000000000000 00000000000000000000000000000 0 OD DDD 8 329 00A 0000 000 ESYOBgO Dg 0D Dg 0 DD 0 DD 00D 00D 0000000000000 0 Co L1 mad Lu 1 0000 0008000000000 000000000 000000 0000000000000000000000000 ODO 0d 00000000 000000000000 000 000000000000 00000000000000000000000000 0000 SNMPQO 0D 000000000000 00000000 Lu E EN NEN L 1111 pscPpupnud 0 MB 10 0 DD
295. 00000000000000000000000000000 0 0100000000 D D D D DD set exectimeout 0 O 0 D 000 31 4 1 1 1 1 1 U L 110 00000000 0098 CHAO dog 0000000000000 0000000000000 OO0000 eugnpng 21 3 000000 22 0 34 000000000 Cllogdd een tl OO mam 1 D O D U U U U 2 Damm 8 Damm 10008080808080800080800080800000800
296. 000000MO00 100000000 0000 000 SD NIFI I D NFpggo00000000000000000000M000000000 000000 59 5 00000000 oxNngog000000000000000000000000 000900 pani N 000 NIFLDODD OOOO NFgoD0 000000000 NIiFgo0000000000 000000 freaf00000000000000000 free nif lt NIF No gt Enter NIF No UDUNIFU 0 1 0 0 000900000000 free pru lt PRU No gt Enter PRU No 0 U si76000000000000000000000000000 16k 0000 O30 8 AX7800R BcUOOOOOOOOOOOOOOOOOOOOO s8760000000000000000000 1expo00000000000sp0000000000000000000000 0 60 5 00000000 55 1 1 00000000000 8
297. 0008000000000000000000000000000 6 1 1000BASE X0 000000000 gt show interfaces nif 0 line O 2003 02 23 12 00 00 NIFO active 12 port 1000BASE X SFP retry 2 Average 700Mbps 20Gbps Peak 750Mbps at 08 10 30 Line0 active up 1000BASE SX full 00 12 E2 40 0a 01 0000 gt podd000000000000000084 po00000000000000000000000 DU O20 0000000 show port statistics JOD0000000000000000000000000000000000 O6200000000000000 gt show port statistics 2003 02 23 12 00 00 Port Counts 12 Port Name Status T R Unicast Multicast Broadcast Discard 0 0 GEO O up Tx 0 0 0 0 Rx 0 0 0 0 0 1 GE0 1 down Tx 0 0 0 0 Rx 0 0 0 0 0 2 0 2 down Tx 0 0 0 0 Rx 0 0 0 0 DUDU gt po00000000000000 lt Discard gt Q 000 000000000000000000000 0 000000 0000000000 00 Voli showinterfaes Qg nn 0 00000000 podd0000000000000 612 1 show link aggregation 000000000000 lt LA Status gt 0 000 Up 000000000 pod odo ago 0000000000000 00000000000 000000000000 72 6 000000 00000000000 000000000 pesgog000000000000000000 gt show link aggregation Date 2003 01 15 14 15 00 link aggregation Counts 1 LA ID 1 Mode LACP LA Status Up Elapsed Time 10 10 39 Multi Speed
298. 0081 770081 000000000 88 80 89 0000090090000900 OP ADVI TI 0000000000 2 OP BFD TJ AX7800RQ 0000000000 OP BFDOOOOOOOOOO 868 0 u OP F64K u OP ISIS T OP ISISU HE EI HH OE O CO DI DE D BSE U a a a a a a 0 oP BGPOOOOOOOOOGO aH 000000000 000000 OP a a a a a a a U oPMBsSEQOOOOOOOOGO 000000000 PLS OO OP M U OP MLTIT M U a a a O a a O OP MPLSOOOOO0000d0 1111111111 11 11 1 p0000000000000000000 mul AX7800R OO AX770R0p000000000000000000000000000000000000 0000 00000 11111 n nan DOU p10g000000000000000 O10 000000 dgg0000 000000000 000000000000 a a a O a a a a AB wo a a og og El a a jaan al a og Ep
299. 00BASE SX 1000BASE LX 1000BASE LH 1000BASE LHB 10GBASE SR 10GBASE LR 10GBASE ER 10GBASE ZR 10GBASE LW 10GBASE EW OC 192c STM 64 POS G 652 single mode 2km OC 192c STM 64 POS G 652 single mode 40km OC 48c STM 16 POS single mode 2km OC 48c STM 16 POS single mode 40km full Du half un full auto 000 0000 half auto 000 0000 28 4 000000000000 4 3 RM000000 00 00 lt INFORMATION gt CPU 110100 ENTROQGOOOUU00 CP 00000000000 DO 1 CPUD DI E 44 0 RM cpu ave s 30 FWRDQ OOOO 8 810 0000 000 00000000 0 RM cpu ave S 2 CP epu ave S RM cpu ave s ENTRQOOOO000 D lt Main Menu gt Q 00000 U 42 OOOO OOOO RM cpu ave s RMQ 100000000000000 CP cpu ave s cPQ CPUDOOO 100000000000000 29 4 000000000000 44 1111111111 11111 eMpo0 0000000000 008009900009090 INFORMATION Memory DU 000000 100000000000000000
300. 011100000000000000000 00 0 000 000 00 0 0 0 000090009000 00 00 swpbeugg 0000000000 a 0 O a m a ugaguggagaudgaggagagaggaggggaaugaggaggggagagmauauagaru 0000000 save copy startup config 0000 ugagugugagaugggugaadaggaggggggmaumuu u U79 enable configure AU LI RMSUI 2v 7727247v 7ar config OME amp BARB El O a a a a a a a O O a a a O p D D D D D D D D OOo d 0 O 0 EEE EA 3124 YU Ya 8 config save NC f amp fh config quit copy startup config standby primary gt 23 747vL 7a 2y74MWe fxirab6 Standby system is restarted at command execution Are you sure y n y 4 MMBAT SL LE S NOR quit gt 157 7T 000000 7 7 0 0 0 0 0 AX7800RD 774 191111 00000000000 BcUOOOOOOOOOOOOOOOOO OG swap buQOOOOOOOOOOOOOOOOOOOOOOOBCUOOOOOOOOOOOOOOOO 000000 BCU ALTERNATE 0000000000000000000000 3800000000 pod 000 000000000000 000
301. 080 090000009 0 0000 1000BASE X OQ D 0 E3 EI El L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 5 11 ES dE El DI L3 L3 C3 oo Ee 3 El E E EE EE O L3 L3 L3 L3 I E47 san a san CESSIT L3 a podd000000000000000000000 3 C sani ET El OOO OOOO L3 L3 L3 L3 L3 L3 O 0 0 L3 L3 L3 L3 DO L3 L3 L3 L3 L3 GJ E EE EST EST L3 L3 L3 C3 DO e000 0 10GBASE R 10GBASE WQ O 000000000000 e a 9 36 9 0000 10BASE T 100BASE TX 1000BASE T NIF show 000000000000 2 show 11 2 2003 02 23 12 30 00 NIF2 activo 12 port 10BASE T 100BASE TX 1000BASE T retry 0 Average 0 20Gbps Peak OMbps at 00 33 25 Cactive up gt lt TOOBASE TX auto full
302. 0PmMsMpoo0000000000000000 0 0 show ipv6 pim interface 6 80 show ipv6 pim interface 1 D show ipv6 pim interface Interface Component Vif Nbr Hello DR This Count Intvl Address System Tokyo PIM SM i 2 30 fe80 200 87ff fe10 a9 5a Y 0000 eiuinunununununununununununununununununupnupnapnanpnan 00000000 IPv6 PIMU Nbr Count 0411001000000000000000000000000080 6 000000000000 00000 117 6 0 00000 0 00000000000 Tokyo PIML 2 2 28 BE L 005760 Nbr Count BiEJL 2 3 8 32 A PIM Hel 5 okyo TSP PIMJL A BEE LEO Nbr Count Bi EJL 2 3 amp 0 0200000 show ipv6 pim neighbor 0000 0000000000000000000000000000000 6 81 show ipv6 pim neighbor 00000000 gt show ipv6 pim neighbor NeighborAddress Interface Uptime Expires fe80 200 87ff fea0
303. 1 1 1 1 1 1 1 1 PIM SM 0 D 220 AREAS IT I A gt KEKUBSR 0000 IPv4 PIM SM0 0000000000 IPv4 PIMSMQQOOO00000 8100 61000 1 O show pru resources 1 000000PRU00000000000 ssMOOOOOOOOOOOO GIO 8834 000000000000 00000 Ooo A 0 0 30 3 D 3 0 n O show ip igmp groups NUN 10000 0000 OO U 0se p 000 GIOQOU000000000000000000 G0000 E EX CES tc E LE DO enable g0 000000 000000000000000000000000 57 5 1 E T es CE T SET ETE ESTE Tp T T EET ip pim bsr show ip pim rendezvous point mapping 00 BSR ORPOOOOO 000000000000000 2 2000000000 8 Uu IPv4 00000 how ip igmp interface 1101111100 10000000000 enable O O show ip mroute 1111100001 8100 Pm sMOOOOOOOOOO 00 000
304. 1 swapbeu JJ 0000000 000000000 0000 2 BCU ALTERNATED OOOO BCUT BCUALTERNATE H D B D 0 D U D U BCU 0 0000000000000 0 00 BCU 1110100001000 010 00 0 8 1 00 0 773 0000000000000000000000 0000 0772 D 172 QOUUU 0 auto dupe 8 00000 Vol 2 10 000000000000000000000000000000 111 00000 00000 111 00000 OO MC 00000 111 00000 00000 00000 OO 05000 ooo O a 0 9 Mc
305. 10 11 10 0 0 000 show filter flow interface tokyol detail 2 7 gt show filter flow interface tokyol detail lt Filter IP List No gt 1 Using Interface tokyol in ip source 170 10 11 21 170 10 11 30 ip destination any protocol 6 tcp port source 80 ack check off syn check off 194 8 0000000000 forward packets 461 lt Filter IP List No gt 2 Using Interface tokyol in ip source any ip destination any protocol ip drop packets 50121 111 0 tokyol Filter IP List No 1 JU D D OO lt Filter IP List No gt 1 2 000000 3 00000000000000000800000000000000000 lt Filter IP List No gt 170 10 11 10 0 O Filter IP List No 2 000000 lt Filter IP List No gt 2Q OOOO0U00000000000000000000000000000 l 2 00 1 0 1 10900 00 show qos ip flow0 JO 000000000000000000000 GosOOOOOOOOOOO 000 0 0 0 0 0 tokyolf 000 IP00000 170 10 11 210 D 004spo00000080000000000000000000000
306. 1020 1 gt rp Multi1 192 10 10 DIZPIML 4 2 28 BEL CU S E te Nbr Count 81 2 2 132 192 10 10 3 111 192 10 10 1 Mu Tera PIN Hel lot Multi2 192 10 20 1 AE LL Nbr Count B e 8 0 O20 0000 show ip pim neighbor 1 000000000000 NeighborAddress Y 0 IPO000000000 93 94 6 000000 00000 000000 6 40 show ip pim neighbor 00000000 show ip pim neighbor Address Interface Nei ghbor Address Uptime Expires 192 10 10 1 Multi 192 10 10 3 00 05 01 40 192 10 10 5 00 10 01 35 gt FER Multi1 192 10 10 1 IXPIMJL 5 232 192 10 10 3 192 10 10 5 WBL CU 192 10 10 3 t 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 li 7 7 ji 7 7 7 Multi 192 10 10 1 Multi2 192 10 20 1 PIN Hel lok 192 10 10 5 O30 00000000 show iprpfQOOUOOOUO000000000000000000000 6 00000 0 00000 000000 641 11111 gt show ip rpf 192 5 5 100 RPF Information for 192 5 5 100 If multil NextHop 192 10 10 1 proto 103 gt 192 10 10 1 Ft 192 5 5 100 multil PIMJL RITA 1 3 4 PIM SM 888 0 l
307. 17 43 login 220 Ag E 0 B D D D D operator 100 00 0 11 111 111119 1 19 0801191198 L 34 Cb p a 3 2 CLI UU LU 3 000000 3 1 CLI I I D 3 11 O000000000 0100000 Login incorrect D O D31 000000 stan KAT ERE EN TUNG 85335 5 Password xk V FOARFAAR RENEA Copyright c 2005 ALAXALA Networks Corporation All rights reserved Welcome to the System gt MS 20 00000 cago0000000000000000000 logoutOOOOOOO exitd OOO00000000 podd00 00000000000 032 00000 gt logout login 312 11 1 3 000000 033 enable disable KETHEK configure OLA z D31 00000000 00000000 una configure adduser
308. 185008 00 UU Targeted LDP 00 IPOOO0 000 VPN 8 8000000000 69 1 D VPNMPLSQ OOOO OO O40 MPLSQOOO0O0000000000000 LSRO0000000000 VPN MPLS O O 20 EoMPLS L2 VPN VC D 0000000000000 show mpls l2transport 0 OOOOOOOOVCOOOOOOOOOOOO 000 5 00000 128 6 00000 0 00000 00 0000 O 6 103 show mpls l2transport OO 0000000 gt show mpls I2transport vc 5 Transport Interface Name VC IN Out Tunnel VC ID State VC Label VC Label 8061 5 officel 23 26 1048576 CO WL TC RELY O 3 Targeted LDPOOOOOOOOOOOGO EoMPLS L2 VPNO 00000000000 LSRO Targeted LDPO00000 00000 Targeted LDPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 6104 gt show mols Idp total 3 Interface Name Local Remote Status Sent Received T localhost 10 3 3 3 10 1 1 1 toR2 172 16 1 1 172 16 1 2 toR3 16 2 1 172 16 2 2 KUH Targeted LIPE y Ys StatusAUPT d 6 L lt EEL 4 Targeted LDP 1 D 1111 p D LU 00000000 TargetedLDPPpg000000000000000000000000000000 86 Pvwpgodg0000000000000000000000000000000 show mpls idp UU 000 detalQOOOOOOOOOLDPOOOOOOOOOOOOOOOOOOOO OOOLDPOGOOOOOOGOOOOOOOOOOOOOOOO 64 Targeted 0000
309. 2 1 IPv40 000000 VRRPELBL BL BL B 7L BE 7E UE DT 8 35 VRRPDUDUUDUDU od 00 1 00000000000 000000 000000000000 00000000000 00000000 0000000000000 00000000 00000000000000000000 OG GLI GEE L3 r3 Ep OE EFLI GIESE Fp 3 E 3 Ela EC GALI LLLI L3 EE E Ez EE JE Ez E E E 5 1 1 3 200 1 300 500 5 ping DN 0000000000000 OOO Pv4g 00000000000 11 1111111111111 uu OOO v4O00000000 400 4 show vrrpstatus detail 000
310. 22 59 86 0 0 AXHIEEAN 6 133 NetFlow 000000000000 0000 NetFlowgog800000000000000000000000 1 Netrlow 000000000 ping 000000000 NetFlow0 0000000 1P000000000000000000000 0000000851 g0000000000000000000000000000 20 NetFrlow 0000000 NetFlow 00000 Netflow9gg00000000000000000000x Xetflow 0000 po0000000000000 Netfoweg0000000000000000000 PBODo00 000000000 000000000 8 6 134 NetFlow 1 0000 NetFlowOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 1 NetFlowr 0000000000 show netflow 1 1 0 0 D NetFlowQ J 00 dB D 0 010 000 0 netflow O 0 9 139 6 000000 00000 000000 O 6 118 show netflow D D show netflow Progress time from NetFlow statistics cleared 10 00 06 PRUO Active Received Flows 123456 Dropped Flows 3412 L CU x t 4 0 Overflow Entries 0 Used Entries 1998 Un used Entries 2 Flow export Version 5 Service status enable Active Timeout 30 minutes Inactive Timeout 15 seconds Collector 10 1 1 2 udp 6534 Source 10 1 1 10 Send Flows 468 Discard Flows 0 Send UDP Pack
311. 3 L3 L3 L3 L3 L3 L3 OO L3 L3 L3 L3 OO E EF ET ET L3 L3 L3 L3 60 zs EE 1521 Ea ESI L3 L3 L3 L3 a 2show dns relay Primary NameServer 192 168 0 1 Secondary NameServer 192 2 Thirdary NameServer Error Statistics 0 3 7 L TUT Lack of memory 125 C OLA EY ARA L CUE Communication error 374 0 882 r RELE Communication status lt source IP address gt destination IP address gt status 192 168 253 9 192 168 0 1 inquiry 192 168 253 9 192 168 0 1 inguiry 192 168 253 9 192 168 0 1 inguiry 192 168 253 9 192 168 0 2 retry inquiry 1 192 168 253 9 192 168 0 2 retry inquiry 1 FLAINSOXST 7 ERAI NERUCC EEL 0000000000000 D aD 212 pod0000000000000 5 1111101101 0 0 00000000000000 show dns resolver DNSQO00Do000 0000000000000 000 8 0000000000 show dns resolver dns resolver yes hostname router mydomain com nameserver 192 168 0 1 nameserver 192 168 0 2 yes ME 80065 gt show 006 7680 dns resolver yes ostname rou mydomain com nameserver 192 168 0 1 2 4
312. 30 expires 00 41 6 8 3 LI D D 0000 0000 00080 120 show ipv6 mld interface 0 eineracei nipBD unnuuugdnanuuuaganpuugnpnpauauapnagugdgagudd u Mppopg000000000000000000000000000 pim6 00 man IDD D 0 D Group Coat 000000 00000000000000000000000 6 MLD Report pao 000000000 0000000000 O Version e Notice A 0000000000000 MDpo0000000000000000000000000 6 0 00000 0 00000 000000 O 6 86 show ipv6 mid interface LI show ipv6 mld interface Total 10 Interfaces Interface Querier Expires Version Group Count Notice Tokyo fe80 100 87ff fe10 2959 02 30 1 4 L Osaka fe80 100 87ff fe10 2959 01 30 2 2 Nagoya fe80 100 87ff fe10 2959 2 5 OR Officel fe80 1234 01 00 1 3 Q Office2 fe80 2592 02 30 m 6 Gua gt O20 000000 show ipv6 mld group 0 0 O Group Address
313. 32 statistics Current Statistics Status Collecting Total 1 FEC 192 168 113 101 32 Next Hop 192 168 7 7 Out Label 4503 Interface Fukuoka Packets 78901 Octets 25874630 Discard Packets 190 static LSP 10000 00 0 D O O show mpls forwarding tableQ 80000000000 BasiclDP O 00000000000 show mpls 105 0000 Basic LDPOOOOOOOOO OO VPN Basic LDP BasiclDPQO0DO0000000 6 95 gt show mpls Idp total 2 Interface Name Local Remote Status Sent Received THT REL jer BasicLDP II I 00 000000000000 124 Basic LOPO 00000000000000 show mpls Idp detail DO Basic LOP O O D D 6 96 BasiclDP 0000000000000 show mpls Idp detail total 1 Interface Name toR2 Local 10 2 4 4 Remote Status DOWN Time since last LDP status change 00 00 04 Last down reason dello expired 0x80000009 Hold time 15sec Hello interval 5sec Message Send count Last sent Receive count Last received Notification 2 15 29 30 1 15 29 06 6110 3 15 20
314. 325 ICMPv60 D 0 0 325 IEEE802 3ah UDLDJ 0000000000000 253 IEEE802 3ah UDLD 0 00000000000 135 IGMPH 0 D D D 325 99 1Pv40 00000 325 IPvpo000000000 79 VRRPQO0D00000 134 000000 IPv4p 0000000000 191 IPv4Q 000000000000 325 IPvpo00000000000000000 92 IPv4O0000000000000000d 219 IPv4QOO00000000000000 87 IPv4Q0O000000000000000 214 IPv f 325 IPv DHCPOOOOOOOOOOO 325 IPv DHCPOOOOOOOOOOOOOOO 229 333 00 68000009000000000000000 NIFDODDUD 32 UD 115 00000000 59 0 00000009000000 325 00 0000000000 271 0 000000000000000 32 NTPOOOOO 271 0 0000000900 101 000000 099090 134 6 0000000000 3 a 2 00 00 9000 0 ses SABO SOLD Rr ae 8000000009000000000 16 e e Oe 3 680000090090000000000 24 GERD cravat doe 600000900000000000 10 DUBIO TU es 6800000900000000000 236 600000000000000000 5 IS IS 0000 6 08 7 0 000000 215 e GIRO owm DDnnnonnnse 5 68809000000 8 600000000000 Es osPF 0 00000000 00000 326 s 1S00000000000 400000000 p 0000000000 eo s IS00000000000mv600000000 880 00000 326 0009000000 113 PIM DMI PIM SMOOOOOOO 92 PIM DM 0000 0 326 L PIMDMO 0 98 0009000000 219 PIM SMU D D 0 0 327 PiM sMAGOOOOO 117 PIM SM00O00
315. 5261 250MHz Memory 262 144kB 256MB MCO Primary Slot MC Enabled AX F6244 66 MC256 AX7800R Format 00070000 29 563kB used User Area 29 563kB Dump Area OKkB 200 181kB free User Area 176 181kB Dump Area 24 000kB 229 744kB total User Area 205 744kB Dump Area 24 000kB MC1 Secondary Slot MC Disconnect BCU1 Standby RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 43 Power ON 0 times restart Lamp ACTIVE LED light off READY LED green EMA SUPPRESS LED light off ALARM LED light off ERROR LED light off SYSTEM OPERATION PANEL No error Board CPU Intel Pentium 3 850MHz Temperature Normal 28degree CP CPU Active Boot 2003 01 11 19 27 43 Power ON 0 times restart Board CPU RM5261 250MHz Memory 262 144kB 256MB Memory 262 144kB 256MB Memory 262 144kB 256MB 62 BCU PRU 0 HB 0 D 2200 AX7800R 5 31 MCO Primary Slot MC Enabled AX F6244 66 MC256 AX7800R Format 29 563kB used User Area 29 563kB 200 181kB free User Area 176 181kB 229 744kB total User Area 205 744kB MC1 Secondary Slot MC Disconnect PRUO Active AX F6544 R2B2 PRU B2 Lamp LED green Memory size 131 072kB 128MB FDB current number 0 max number 0 PRU1 Active AX F6544 R2B2 PRU B2 Lamp LED green Memory size 131 072kB 128MB FDB current number 0 max number 0 PRU2 Disconnect PRU3 Disconnect gt O20 NIFOOO NFOD00000000 shownif
316. 8 113 101 policy mpls routing lt Ingress LSP ID 10000 hit packets 1234567890 DIVIMBATWSCE 08 00 6 9 2 IP VPN I UJU O10 00 58 VPNMPLSO OOOO MPLSO 1 8 000 000000 000 IPDD UD D OO 0 691 D VPNMPLSOOOOOOO 0 40 MPLS 000000000000000 LSRO000000 000000 VPN MPLSOO0O0000000000 00000 20 IP vPNO 00000000 0000 Pv40 00000000000000 VPNO 0000000000 show ip route vpn DUDU OO VPNOOOOOOOO 699 gt show ip route vpn Site B In VPN Site B routing table 192 168 220 24 Total 22 routes Destination Next Hop Interface Metric Protocol Age 10 1 2 24 10 1 2100 LANI 0 0 Direct 12d 11h 127 8 127 0 0 1 0 0 Static 12d 11h 127 0 0 1 32 127 0 0 1 5 0 0 Direct 12d 11h 172 30 180 24 10 2 LAN1 2 0 BGP 8d 2h 172 30 191 24 10 1 2 92 LANI 2 0 BGP 8d 2h 172 31 16 192 168 214 21 remote gateway 0 0 Static 10d 21h 172 32 16 192 168 214 21 remote gateway 0 0 Static 10d 21h 192 168 1 24 10 1 2 88 LAN2 2 1 OSPF ASE 3m 21s 192 168 3 24 10 1 2 88 LAN2 2 1 OSPF ASE 3m 18s 192 168 11 24 10 1 3 92 Site A 3 0 BGP LOCAL 19h 32m 192 168 13 24 10 1 3 92 Site A 3 0 BGP LOCAL 19h 32m 192 168 51 24 10 1 4 32 Site C 2 2 BGP LOCAL 18 2h 192 168 53 24 10 1 4 32 Site C 2 2 BGP LO
317. 8 000000 80 000000000 dump protocols unicast all 238 8 0000000000 ux G primaryMC var rtm rt trace rt dump gz 8 9 5 15450 0 0 0 OP SIS co0000000000000001Sis900000000000000000000000000 0 832 5 5111 0101 0 0o OO 1 ISISQOOOU0000000 1111 01 200 show isis adjacency D0000 09000000 400 2 11 1 3800 2000000000000 00000000000 00000000 3 11010000000000000 Active show isis interface El OO 400 D Passive OOO 1515800000000 4 ISISOOOOOO00000000000 InAc ve H0 0 0 0 B d D HO D 500 ooo show ipv6 route all routes OOO Active 0000000000000000 O dump protocols unicast all 5
318. 8TO000000000000000 NE1G 48T 293 9 OOOO 94 1 1 94 1 111 1 1 Beug PRUQ PRUOOOOOOOOO 00000000 01800000000 BCUL 000000 AX7800RT 8e0p000000000000000000 8 22 000 8 00000 6000029 Y BEL CHARA 5close standbya v 7 FET 2 EE 75 4 2 TALERE RJV D c losef 2 5060000308 UHL EE ERE FORE pice FE GERABCUAN D set modea v FET podd0000000000000 000 10000 093 1 0000000000000000 0N0000001000000000 ONg00000 OO 8 O00 10000 00020000 BCUIIDDDDU 093 1 0000000000000000 0N0000001000000000 ON000000 OO 8 20000 BcUp000000000000000 000000 oxngog00 0000000000 000000000000 000 000 setmadepgag0 0000000000 set mode simplex Enter show system D
319. AXT800R AX7700R UE U 00000 Ver 10 10 O Rev 1 AX 10 005 KO AlaxalA mill 7800 0 AX7700R0 000000000000000 0 0 AXx7800R0 000000000 6 0000000 AX 70OR000000 osROOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 111 1 1 00000000000 00000000000 000000 000000000000 mill Cisco O O Cisco Systems nc 111110000000000000000 Ethernet Microsoft O O Microsoft Corporation NetFlow 0000000000000000 Cisco Systems Ine 4000000 Octpower 0000000000000000 OpenView Hewlett Packard Company 000000 sFlow 1111 11 1 0 0 0 0 0 0 0 InMon Corp DO 000000 Solaris D Oracle Corporation O0 000000000000 800000000000 00000000000 UNIX O The Open Group 0000000 Windows 0 O Microsoft CorporationQ 111110000100010001000000000000
320. BASE T 100BASE TX 1000BASE T 0 1 ether01 lldp test2 Tag 10 Untagged IPv4 Address Untagged 192 168 248 250 IPv6 Address Untagged 3ffe 501 811 ff01 200 8798 5cc0 e7f5 1 TTL 110 Chassis ID Type MAC Info 00 12 E2 68 25 05 System Description ALAXALA AX7800R AX 6544 R80EM AX7804R AC Routing sof tware AX P6544 11 Ver 9 1 OS R Port ID Type MAC Info 00 12 E2 98 dc 20 Port Description 10BASE T 100BASE TX 1000BASE T 2 0 Tag 10 Untagged Tagged 1 10 20 4095 IPv4 Address Tagged 10 192 168 248 220 6 14 2 OADPU 00000000000 JU OADP J OO 0 Uu 1 U TET 111141 014 11 11111111111111111 show oadp oadp OADP ut UUD i OADP JU 144 6 000000 00000000000 6 124 OADP T
321. CAL 1d 2h 192 168 200 26 1 92 168 21611 remote gateway 1 3 BGP 14m 218 192 168 200 128 26 192 168 216 3 remote gateway 1 3 BGP 14m 218 17723322155 1 remote gateway 0 2 BGP 1h 42m O 30 mP B6PO00 00000000000 IP VPNO0000000000 LSROO BGP OU D U 0 D 0 0 BGP Capability 00000000 000000 0000000 0 00 645 D OP BGPITI O O O show ip bgp neighbors 0 0 0 0 0 BGP Capability negotiation 4 popa g000 00000000 126 6 0 00000 0 00000 000000 VPNp0000000000000000 VPNJD DD DD 00000000000 DOOOVPNOD 000000 0 0 CelearipbgpQOOO0000000 VPN 0000000000000 63 0 oo oo 1 BGP Capability negotiation 0 0 O 200 000000000000 0000 show ip bgp neighbors xx xx xx xx Q xx xx xxxx 000000000 Irv4 vVPNOOOOOOOOOOOOOOOOOOOOOOOOOGO 2 vPNOOOOOOOOOOOOOOO 300 venmap D D U 0000 1000000000000000000000000000000 5 400
322. DDDBDDUDUDUDDDBDBDDUDUDDDDDDDDUDUDUDUDDDBDDUDUDUDUDUuD 10240000 1kKB Q OO 00 10 1MB JI 16 1 024 1 024 1 024 000000 VI 11 2 42 3 121 00000 3 122 00000000 3 123 000000 MC 5 1 7 24 D 00000 8 2 2 9 23 000 10 2 4 11 241 0000000000 4 ID I Bu 13 31 Cun 14 311 0000000000 14 312 000000000 ib 313 11 16 314 61100 0000000 2 32 CLIDUDDD 23 321 00000000000 23 322 23 323 OOOO 600000 00 0 0 0 0 780080 23 324 0000000000000000AX7800R 23 3 25 0000000 23 326 0000000000000000000 23 327 1000000000000000 24 11 1 1 11 1 111 25 4 1 26 42 Linen 0D D 27 43 0 00000 29 44 30 45 0 51 46 32 4 7 33 00
323. DLD U D Ver 10 2 000 t OOO IGMPOOOOOOGO e JGMPvsOOOOOOOOOOOOOOOOOOOOOO e JGMPvsOOOOOOOOOOOOOOOOOOOOOOOOO OO Ver 10 1 000 DO CLIDO U u 9 00000000 000000 MPLS MPLSCP 1 0 0 B U B 2 I EH 1 1 1 ut e show interface 0000 MPLS 0 0 0 0 0 0000 000000 PoSOOOOOOOOOO UG OO 0000 MPESO D Ver 10 0 000 og Ver 940000 U 00060 DD 20000000000 0000 Ver 930000 SNMPv8QOOOO0O0U000000000000 0 0000 e PODO
324. E R 0 0 10GBASEWpoo00000000 176 84 5 10GBASE W SONET SDHD 0000000000 179 8 46 0000000000000000000 182 8 4 7 POSOp00000000 183 8 48 08000000000000 185 8 49 189 IPV4 Q0000000000 191 851 0 00000000000000000 191 852 DHCPO OO 000000000000 199 8 5 3 DHCP DynamicoNsOOOOOOOO 206 854 800000000000000000 210 PA4Q0000000000000000 214 861 0000000000000 214 6 62 RP000000 214 8 63 OSPF0000000 215 864 BGPA BH D U D B 0 OP BGPQ 216 8 6 5 15 50 0 0 0 0 488 217 866 8 0 0 0 0 000 0 0 0 OP BFOO 217 871 000000000000 219 872 8 0 00 0000000000 220 873 8 0000000000000 222 88 0000000000 223 881 0 00000000000000000 223 882 6 0 6 0 0000000000000 229 883 00000000000000000000 234 89 00000000000000000 236 891 000000000000 256 892 000 236 893 OSPFV30 000000 237 894 BGP4 0 0 op Berg 238 895 15 50 0 0 0 D OP ISIST 239 896 8 0 0 0 0 000 0 0 0 239 810 0 OP MLTQ 241 8101 PIM SMO0000000000000 241 8 11 MPLS 0 0 0 0 OP MPLS 244 811 1 MPLSUHDDDDDDD 244 8 112 VPNMPLSO D D D D 244
325. E T retry 2 Average 700Mbps 20Gbps Peak 750Mbps at 08 10 30 Line0 active up 1000BASE T full auto 00 12 E2 40 0a 01 Protocol up VLAN 1 Interface name TokyoOfficel description Networkl Protocol up IP address 158 214 179 10 Broadcast IP address 158 214 179 255 VLAN 2 Interface name TokyoOffice2 description Network2 Protocol up IP address 158 214 180 12 Broadcast IP address 158 214 180 255 VLAN untagged Interface name TokyoOffice3 description Network3 Protocol up IP address 158 214 185 13 Broadcast IP address 158 214 185 255 gt 0200000000 78 show vlans Tag VLAN D 00000000 show vlan 100 DO 0 00 0 D Tag VLANDO00000000000000000000000000 00 6 13 VLANOOOOOOOOGO gt show vlans 2000 04 02 12 00 00 NIF1 LINEO VLAN 1 active up Interface name TokyoOfficel description Networkl Protocol up IP address 158 214 179 10 Broadcast IP address 158 214 179 255 lt Out packets counter gt lt In packets counter gt Out packets 120 In packets 130 Out Discard packets 0 In Discard packets 0 0000 gt 6 0 000000 00000 000000 6 3 HD 1 L ipo 5 31 BHD E I rPvwpodo000000000000000000000000000000000000000000 po0000000pm8000000000000000000 D 6 14 ping 0
326. EP rJ d WIB san 3 EE 4 01 sen 3 Lil A Ll A OO OO 1 q E OO EY oL of 000 0000000 OO 3 3 gp 5 1 1 1 DL EJ ik 0 O 4 2 0 O 2 1 0 D ID show pru resources OOOOOOOOPRUOOOOOOOOOOOOO IPv4D 00000000000000 GIO SssMpgo0 0000000000 O show ip igmp interface 0000000000 0000000000 enable D pod 000000000 0000000000000 Q show ipigmp groups i 00000000 6100000000 10000000000 D UDD 0 smjoampg0000000000061509000000000000000000 O showiprpf 000000008000000000000000000000000 0 000000000 O show ip mroute 1111100000 8100 OS1 GIQOU0000000000000000000000000nf000 000 H OO00000000000 0000000000 00 PM SsM00000000000 O show ip pim neighbor O0 000000000 40000 200000000000 0000 O show ip mrouteQ 8100 000000000 OS1GIQOU0000000000000000000000000nf000 1000 OO0of000 4000000000000 410100 000000000 0 0 000000000 000000 100 PIMSM00000
327. ETRE JE KYT KAD mp BGP EF vy 71548 6083 5 8 11 30 BRR P VPN E TE DS LY IP VPNEB ASH SAN 8156 E GLY 8 FO ERR EEE 6 8 11 3 8 BHR O20 MPLST 069 2 IP VPNO000000 O40 MPLSP Oo Do 0000000 0000000000000 O30 069 2 IP VPNO000000 O50 MPLSOOOOOOOOOOOOOOOOOOMPLSOOOOGO 040000000000 Deggo 00000 000000000000000000000 069 2 050 00 58 VPNMPLSOOOOOOO IP VPNO000000 LSRO00000000 GPUDU 1Pg000 000 VPN 0000000000000 6 9 2 IP VPNOOOOOOO 01000 LSROOO VPN MPLS O J 0000000000 sp00000000000000000000000 VPNMPLSQ 0000 D VPN MPLSOO00000000 Dep IP VPNO 00000000000000 0000 D VPNMPES 0000000 248 8 0000000000 8112 VPNMPLSOOOOOOOOOOOMPLSOOOOOOOOOOOOOOO IP VPNOOQOOUOGUdO 069 2 IP VPNOOOOOOO 020 IP VPNOOOOOOOOOOOOOO IPVPNDODDUDD UUUDUDDDUDDDDDUDUDUDDDDBDDUDUUDUDDU m B6Pg000000000000000000000 078 000000000 meB6PO 00000000000 0 6 9 2 IP VPNO000000 O30 mpPBGPOOD000000000000000 mp PGP O D
328. Gateway Dhcp gt 3ffe aaaa 1234 48 1 osaka 0 0 Static 23m Active Gateway Dhcp gt 233 8 0000000000 OOO 0 030000 8 Hal primaryMC usr var dhcp6 dhcp6s_duid O00 DUID OHOrmOOO0000000000000000000 b DUID U DUID D D Hl D D restart ipv6 dhep serverQ 0000 0000000000000000 00000000000 00000 DUIDO UO show ipv6 dhcp server statistics L1 BB HH BH HL BH D 6 6 8 IPv6 DHCP I OOO 00000 40 DUID DHCP Unique Identifiey 00000000000000 883 000000000000000000000000000000000000000000 0100000 show interface
329. J o o a 5 lt o0000 5 o gt lt Co o 60 164 CONSOLE RS232C 000 0000000000000000000 3000 0000000 0000000000 000000000 8 0000000000 0000 0000 165 system CONSOLE RS2320 0000 19200bps 0000000000 9600bps D Microsoft Windows 3 1 B0 Bj CB H BH HL B H HE E D D DD D B 7 U U U D DO DL 7 I U U Microsoft Windows Ctrlg O D 00000 E Et UDUD OOOO Microsoft Windows Microsoft Windows 3 1 Tera Term Pro 00000000000 peo 0000000000 od 0 8 3 1 10 u 1 K56flex x2 O 0
330. JST 2004 ready Name 10 10 10 10 staff 331 Password required for staff Password 230 User staff logged in Remote system type is UNIX Using binary mode to transfer files ftp oooooooooo 00000 72000 000000000 9000 D uu suuuuuununununununuunuunuuunuuunuuunuunuunuunuunuunuunuunuunununununununuun 00000000 show system login message before login after login before login ftp after login ftp plain text po00000000000000 57 5 00000000 53 1 11 U 5 3 1 OQ H 1111111111111 111111 OO OOOO OOO 1 config system 9 1 timezone OOOO 00000 Voll system 2 NTPD O 00000 Vol 2 NTP O T 8 rdate O00 Voli poo rdate 9 3 2 1 1 RM
331. L 0000000000 0000000000000 Now configuration file is locked please try again Code XXXX XXXX 5 00000000 poda 000000000000 00000 0 save 000000000 save 000000000000000 copy running config copy startup config copy backup config copy merge config erase startup config 65 5 00000000 37 0 571 1P00000000000 00 546 O0000000000000000000000 OO od OOOO 1 00800000000 tened 0000000000 0 O O O
332. Line0 Linel Line2 Line3 Line4 Line5 Line6 Line7 Line8 Line9 Line10 Line11 active toco scc Average out OMbps Average in OMbps 00 12 E2 d0 67 68 unused 00 12 E2 d0 67 69 Average out OMbps Average in OMbps unused 00 12 E2 d0 67 6a gt 5 6 15 Average out OMbps Average in OMbps unused 00 12 E2 d0 67 6b Average out OMbps Average in OMbps unused 00 12 E2 d0 67 66 Average out OMbps Average in OMbps unused 00 12 E2 d0 67 6d Average out OMbps Average in OMbps unused 00 12 E2 d0 67 6e Average out OMbps Average in OMbps unused 00 12 E2 d0 67 6f Average out OMbps Average in OMbps unused 00 12 E2 d0 67 70 Average out OMbps Average in OMbps unused 00 12 2 40 67 71 Average out OMbps Average in OMbps unused 00 12 E2 d0 67 72 Average out OMbps Average in OMbps unused 00 12 E2 d0 67 73 Average out OMbps Average in OMbps O 30 NIF POS O O 00000 0000 20 16691 O 00 OC 192c STM 64 POSOOO000000000000000 000000000000000 shownti 0000000000 D al O gt show nif 2 Enter e 0000 NIF J po00000000000 podd0 000 0000000000000 podo00000 000000000000 po0000000000
333. Line0 DOWN media 00 12 E2 98 dc 50 Time since last status change 00 00 54 Last down at gt vr 20000000000000000000 poo po0 00000000 0000000000000000000000000000000 3 000000 os p00000 DODBoO DO DO 000000 000000000000 00000000000 11 1 1 DODoO DO DO 000000000000 0000000000000 11 100 1 0 0 3 14 pp0000000000000000000 gt ping 192 168 0 numeric count 1 192 168 0 112x3LTping v FEI PING 192 168 0 1 192 168 0 1 56 data bytes 64 bytes from 192 168 0 1 icmp_seq 0 ttl 31 time 1 329 ms 192 168 0 1 ping statistics 1 packets transmitted 1 packets received 0 packet loss round trip min avg max 1 329 1 329 1 329 ms gt 1 AILI 3 Y 3 3 2041058 1 1 193 ping 192 168 0 1 numeric count 1 ARRENSOC JAYANE TACI Y C AVG gt ping 192 168 0 1 numeric count 1 lt 192 168 0 1IZxfL Cpingd v Yy F PING 192 168 0 1 192 168 0 1 56 data bytes 64 bytes from 192 168 0 1 icmp_seq 0
334. MAC Info 00 12 E2 68 20 21 Interval Time 30 Hold Count TL 120 Po ounts 2 Link Up Neighbor Counts 1 Link Up Neighbor Counts 1 O20 000000 po0d0000000000000000000U0 show lldp deta Q Chassis ID lt Info gt Q 0 PortIDQ Info 00000000 6 ChassisID lt Info gt Q 0 Port IDO lt Info gt 00000000 6 pad 0000000000 00000000000000000 143 6 000000 00000 000000 6 123 1 108 0 000 gt show lldp detail Date 2004 04 18 12 26 4 Status Enabled Chassis ID Type MAC Interval Time 30 Hold Count System Name LLDP1 System Description ALAXALA AX7800R AX 6544 R80EM AX7804R AX P6544 11 Ver 9 1 OS R Total Neighbor Counts 2 Port Counts 2 Port 0 0 Tag 10 Untagged IPv4 Address UnTagged 192 168 248 240 IPv6 Address Untagged e 501 8 1 TIL Port Descr IBETOR Tag 10 Untagged Tagged 1 4095 Infoz00 12 E2 68 2c 21 AC Routing software 55 608 Port Description TOB 1 0 T 0 0 ether00 00 166 REESE S 6 IPv4 Address Untagged 192 168 248 200 IPv6 Address Untagged 3ffe 501 811 ff01 200 8798 7478 e7f4 Port 0 1 Link UP Neighbor Counts 1 Port ID Type MAC Info 00 12 E2 98 5c 61 Port Description 10
335. N 000000 6 Basic LDP 1 5 OD line type local remote 131 6 000000 00000 000000 6 10 QoS I D D 6 10 1 D DLE LU U U U 0000 9 00000000000000000000000000000 show qos ip flow 1 00000000000 Q4sp000000004sg0000000000000 0 0 89 00 08 00 08 00 0 0 0 0 09 00900 U 6 107 OOO 66500 00 UU gt show qos ip flow interface tokyol detail QoS IP List No af Using Interface tokyol in ip source 170 10 11 21 170 10 11 30 ip destination any protocol ip packets of 1000000kbps and under priority3 discard4 7021 packets of 1000000kbps over drop 729 lt QoS IP List No gt 2 Using Interface tokyol out ip source any ip destination any protocol 6 tcp port destination 20 21 ack check off syn check off hit packets priority8 discard4 0000 gt 11568793
336. O Retrieval_option was changed Please reactivate PRU lt PRU No gt retrieval option 00000000 9 PRUD PRU No PRU No O show system 0000000 gt ae Zoo 5 goo F g yoo Ano yoo coo RUDO Retrieval_entry_partition was changed Please reactivate PRU lt PRU No gt retrieval entry partition B 1 1 1 B D 0 111 1 PRUD PRU No PRU No O show system 0 0000000 PRUG UB OU D D C LO UO U adad Pe 5 5 so OO du c PRU lt PRU Ano DODOD0D Dg 0 DD 00D 0 DD 00D 00D 00D 000 0000000000000 setcalendarQ O O Voll set calendar 08 ODO ODO 0D 000000 00000000000 0000000000000 00000000000 1000000000 podda 000 0000000000000 0000000000000 0000000000 200000000000
337. O Bee0po00 000000000000 10 00000 292 9 0000 pod0000000000000 setmodepod0 000000000000 set mode active 81081 reload Enter OO set mode standby 81651 reload Enter Lac 00000 BcUOOOOTOOOOOOOOOOO 8 uu OO gt reload dump image f active Enter OO gt reload dump image f standby Enter Lac ooo 8 100000000000 Ul show system 00000000 Bug ACTWVEMOOO BCUQ Standby O 000 po0000000000000000showsystemgg00000000000 9 21 show system gt show system Enter O20 00 OFFI O30 00 OFFI O40 00 OFFOO DUDUH 000000000 0000 16ek00000000000000000 9 0000000541 NE1G 4
338. O gt show ipv6 route s Total l0routes Destination Next Hop Interface Metric Protocol Age 3ffe 1234 5678 48 er tokyo 0 0 Static 45m lt Active Gateway Dhcp gt 3ffe aaaa 1234 48 1 osaka 0 0 Static 23m lt Active Gateway Dhcp gt gt UUDDUDDDUDDDBDDUDDUDDDBDBDDDUDUDDDDUDDDUDUDUDUDDDBDBDUDUDBDUDUDUUUDUD dhcp server static route setting 00 0000000 000090000000000000000 Vol 1 14 IPv6 DHCPOOOOOO00 0000000 DHCPOOCO00000000000000 po000000000000 1 clear ipv6 dhcp binding 0 0000000000000000 MOOOOO0000000000000000000000000000 9000000000000 dhep6 server static route setting 0 0 0 0 D 4000808880000000000000000000 030 00000000000 00000 OO pHePpo 000000000000 00000000000000000000000 DHCP 000000 Reconfigure JOQO0000000000000000000000000000 9 9 4 DUID DHCP Unique Identifier O O Ooo ET SL TT L ESE RE 000
339. O0O0 00000000000000 Negodo0 000 000000000000 0000000000000 O N 0000 80000000000 000000000 NE1G 48T 000000 00 D 0 000 20N O O 0000000000000 podo00000 000000000000 0 freeenf00000000000000000 000 free nif lt NIF No gt Enter NIF No H 0 Main Menu 2 Action gt lt ACTION gt gt FREE NIFxx xx 0 0 00 00 PRUOOOOOOOOOOGOOOOOTO 00000000000 301 9 OOOO free pru lt PRU No gt Enter PRU No D PRUU O 1 Main Menus gt Action gt lt ACTION gt gt FREE gt PRUx x 0000 0 80 000 supnunuunpanpaand
340. OOO 12000000 relay list relay grupp 00000000000000 00000000 DHCP BOOTPQ 00000 DHCP BOOTP REQUESTODOD O giadaz IPQ0000000 D 0000000DHcP O BOOTP po 00000000000000000000000000000 120000 000000000 0000000000000 DHCP BOOTP REQUEST OOOO giader 00000000 DHCP BoorPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO O 7 0000000000 1P000000000 show dhcp giaddr 0 0 000000000000 IPHO nU BU BoOOTPOOOOOOOOO 000000000 IP000000000000000000000 8 0000000000 Department 170 1 1 1 F27 2 AEA 2 7 gt EER 170 2 2 1 AY F7 2 BEE 170 3 3 1 Ay F7 2 CRE DHCP BOOTP 22 DHCP BOOTP 0 8001 2 24 FY 2 FLA 170 1 1 1 0 92 4 2 amp LHLIP7 FLASH 170 1 1 10 170 1 1 20 000000000 show dhcp 400 00000000000000000000000000 000000000 DHCP 800 gg 000000000000 1P00000000000000 gt show dhcp giaddr interface Department1 DHCP GIADDR lt Departmentl
341. OOO OO a E oOo O 8 0000000000 88 6 D E D L 88 1 1111111101 1 0300000000 6 00000000000 2 3 OO 1 000 2000000000000000000000000000000000000000 IPvern np podd0 000000 00000000000000 L3 EE E oo E 1059 651 er 0 O a 223 8 0000000000 GBA CERE show logging v Y X SMBH PRU NIF Line FEEDER 7 6 5 BS 550 MEM AYER 0 3 X I PAY OFLIPL show ipv6 interface v 7 FIz amp LAG 41257r A0up downtkf d TERR BEUT ALY EES RAJA 29 2 20 614 2 gt RIA EP 888 7 CORAL rz AQOQup downdk RE amp T ERE up down 8 4 RY F7 24 25 ping ipv63 v gt k IS SBIRIOD Z2r AOiB SISE I HE Bieta RIMA J
342. Off Max Active Port 16 Max Detach Port 15 Description 6 ports are aggregated MAC address 00 12 E2 12 ff 02 VLAN ID Router Interface Switchl IP Address 172 16 1 249 24 LACP Activity Active Periodic Timer Short Actor information MAC System Priority 1 Key 101 System Priority 10000 MAC Key 100 0 1 3 10 12 13 0 1 2 0 3 10 12 13 Partner information Port 6 Up Port 2 Down Port 4 020 00 12 E2 12 ff 02 00 12 E2 f0 69 be show link aggregation detail HOHOOOOOQOQ00000000000000000000000000 gt gt 000000 000000000000 1 lnkaggregation aggregated port lt Status gt Q 000 Up od 0000000000000000 0 00 Dow OOOOOOOOOOOOOOOOOO lt Reason gt 0 000000000 73 6 000000 00000 000000 O64H0000000000000000000000000 gt show link aggregation detail Date 2003 01 15 14 17 00 link aggregation Counts 4 LA ID 1 Mode LACP LA Status Up Elapsed Time 10 10 39 Multi Speed Off Max Active Port 16 Max Detach Port 15 Description All 100M Full Duplex MAC address 00 12 E2 12 ff 02 VLAN ID Router Interface Switchl IP Address 172 16 1 249 24 LACP Activity A
343. Ono Hun Soo nooo bd oF 2 gt Hj d ooo H 3 l Oo LL Oo EE 0000000000 oO et 200004 Co Co EJ Co COCO CO 7 Y 3 00000000000 El T Co LE L3 5 El a EL EE ea pl L3 ERE LL 1 1 Cy Co Er EJ Aa x E WP TES ILI IIT IJI IJ ETT LIII Co Co e Q o yo n a system CONS 19200bps D D D U U U 103 Oooo a jes bo 20 30000 9 rar oo N lt mad mE 56 o 200 o ooo Ooo Ooo Co s ct o r3 E 200bps OO 00000 a LILILILI 3 1 1 L3 L3 rr L3 L3 rr Cy ooog H OO D 1 D D D D D 1 r3 BD ODO 0000000000000 EJ N E3 EJ E
344. P Address ff15 100 32 2001 db8 1 ff15 200 32 2001 db8 1 gt e PIM SMII show ipv6 mroute Jp80 000000000000 0000000000000000000000 o00sp00000000000000 se0000000000000000000000 00 60 119 6 000000 00000 000000 po0000000000 in coming downstram lQOOOOOOOOOOOOOOOOOOOOOO 0 0 0 6 85 PIM SMU 1111110100 UU gt show ipv6 mroute Total 4 routes 3 groups 2 RPs S G 2 FEQUESS 3 sae Group Address Source Address ffl5 100 50 2001 db8 100 Uptime 02 00 Expires 02 30 Assert 01 00 Flags F Protocol SM in coming TokyoISP upstream Direct Reg Sup 608 downstream Osaka uptime 02 30 expires 00 40 ff15 200 1 2001 db8 200 Uptime 02 00 Expires 02 30 Assert 01 00 Flags F Protocol SM in coming Tokyo upstream Direct Reg sup 60s downstream localhost uptime 02 30 expires 4G 2 1 3111 0909 ee aS AAA Group Address RP Address 15 100 50 2001 db8 1 Uptime 02 00 Expires 02 30 Assert 01 00 Flags R Protocol SM in coming Tokyo upstream This System downstream Osaka uptime 02 30 expires 00 40 15 200 1 2001 db8 2 Uptime 02 00 Expires 02 30 Assert 01 00 Flags R Protocol SM in coming Tokyo upstream fe80 1200 87ff fe10 1234 downstream Osaka uptime 02 30 expires 00 40 downstream Nagoya uptime 02
345. PPPOOOOU00000 00000000 down 00000 Status unmatch 0 000000000000000 PPP J Oo 000000 S In invalid PPP pkts 189 8 0000000000 H gu oo Echo Reply 000000000 0000000000000 Echo Request LH Configure Request 1111 1 000000000 0OBpO0 0000000 000 0 0000000000000 00000000000 190 UD 1 0 LLL LO show trace ppp historyp O0 00000000000 0000000000 000000 000000000 od 0000 00000000000 show trace ppp history 1 1110011010 00000000 00000 Vol 1 show trace ppp history B D 086 pgodo0000000000000000000000000 ULZSHIKT 1 2705 3 E ERED 5 RRA L TLS AD Y ILE OPERAN EY aaa e 4 Fal UR AAA aR show logginga FISK U 2 2 3
346. Q 7 5 00000000 24 000kB 24 000kB 0 0 PRUOOOOO 5 15 ooo NIF O E PRU D AX7804R on 1 20 3 AX7808R on 1 20 8 A 5 60 7 AX7816R on 1 2 8 A 5 60 7 80 9 100 11 120 13 140 15 AX7702R on 1 63 5 00000000 56 11 1111 11 UL 5 6 1 UU 000 562 1 H AX7800R 64
347. R gt em Maza ESI Ea 225 8 0000000000 pep goo00000 1100 0 9 0 00000000 851 poggo000000 000000000 07000000000 4080000 0000000000000 O70 RADOBDBBUU 0 0 0 0 0000080000 080009900009000 8 00000 9 678 e 00000000 98 D 6110100000089 O80 UUDUDDUDDDBDDUDUDUDDDBDBDDDUDUD
348. VPNMPES 000000000 M30 VCD 0000000000000 D VPNMPESO 0000000 08 112 V NMPLSP0000000000MPLESpo0 000000000000 030 Vco UD 6 9 8 EoMPLSL2 VPN U 000000 O 20 86 UPIJD D M70 00 00 0 Tunnel LSPQOOOOOUU00000000dg vPOOOOO Targeted LDPO 000 VCOOOOOOOOGO I 40 Targeted LDPOOOOOOOOOOOOOOOOOOOOOO e static ve DN 000 VCOOOOOOOOGO L 60 statieve 0000000000000000 ULU 40 Targeted LDP D O 6 8 8 EoMPLS L2VPN 0000000 8 Targeted LDPP9g08000000000000000 Targeted LDP 1 1 0000 Up Down 000000000000000 Powa 000000 50 Targeted LDP 0 000 000000 SL Targeted LDP O0 000 Down 1 H D B D LI D 69 3 6 4 gt 8 0 040 Targeted LDPU DownQDOOOO00000 OOOO Targeted LDP 0000 Dwagggggaggaaggmuuu 6 static vc 1 H1 1111011011 1 D staticvcOOQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO show mpls I2transport po00000000000 O70 vco 000000 Tunnel 06 9 3 EoMPLS L2 VPN OOOOOO00 O50 VCQO00000 Tunnel LSPQOQOO0000000 OOOO 1 512 200 8 0000000000 8 12 8 1
349. Y 0400000000 gt 0000000 config DK UUDDUDDDDDDDDUDUDDDDBDDDUDUDDDDDDDDqutDUDDDD 000 1 1 100000 00 0 showiparpHOO00000000 config show ip arp poe 0000 1 D system name 00 OO0 0 000000 v000000000000001P vepg00000000000000 MePLsSOOOOOOO OJ ay po 0080 00000000000000000000000 po0000000000 000000 1 0 300000000000000 Ooo Ooo ooo EE r TE EI GUER ESI Ooo ENEE E O L3 EJ E E EH a El a a a a O a a a a a 3 000000 0 3 4 00000000 gt enable configure config system name System name System name config save System name config static 192 168 201 0 masklen 24 gateway 172 16 178 2 System name config apply System name config save
350. ain Menus gt Action gt lt ACTION gt gt CLOSE NIFxx xx 0 0 0 0 8 00 D 000 20NF00000000 00000 NIFQODO STATUS LEDO 00 0000000000000000NIFQ00000 9 000000 0Ngg000000000000000000000000 289 9 OOOO 000 3SNFo00000000 000 00 0000000000000000000080 0000000000000 000000000000000 5 41 NE1G 48T0000000000000000 Nroo000000 0000000000 D NIFQOO e NE1G 48T 000000 ep uuuugapauunpaapaagpnagugddgoud podd00000000000000000 000 40NF00000000 O freemfQ 0000000000000000 free nif lt NIF No gt Enter NIF No B UU 9 Main Menu 2 Action gt lt ACTION gt gt FREE NIFxx xx 0 0 0 8 00 0 0 NIFOOOOO Free pru Nr po0000
351. ate UplOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO show isis database D 6 36 show isis adjacency UU B D D gt show isis adjacency detail Level 1 adjacencies Interface Officel Interface Type Broadcast System ID 0000 87c0 3655 Type IS State Up Speaks IP Area 49 Circuit ID 0x04 SNPA 00 12 E2 c0 36 55 Priority 64 Hold Timer 9s Established Time 2003 07 01 15 30 00 Interface Address 192 168 7 2 6 0 00000 0 00000 000000 6 4 7 8 0 1 1 lI UH 1 OP BFDU 0000 Pv4QOO000000000000 8 9 8 D D 000 show bfd session ip IP Address gt show bfd session 1 000 e pocgo0000000000000000000008 P000000000000000000 00000000 mt000 AdminDowaQlOOOOOOOOOOOOOOOOOOOOOOOOO podp00 0000000000000 1111 1 0 Dewapo0 000000000 B po0000000000000000000 Br po0000000080000000000000000000000000000000000 00000 1 000000000000
352. ated Queue 100 Omode LLO 3WFQ Peak rate 300000kbps Min rate 300000kbps Weight 1 Queue send pkt discard pkt send byte discard byte 1 0 0 0 0 2 6831 4782607 10 4M 7 3G 3 0 0 0 0 4 14530338 33261538 22 1G 50 6G total 14537169 38044145 22 1G 57 90 133 6 000000 00000 00 0000 6 11 6 11 1 IPva 000000 0000 Den 0000000 show vrrpstatus detail BH HH HH BH BB H virtual router O 1 HU U vRRPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO VRRPOOOOOO 6 110 gt show vrrpstatus detail Departmentl VRID 1 Virtual Router IP Address 170 10 10 2 Virtual MAC Address 00 00 5e 00 01 01 Current State MASTER Admin State enable Priority 100 IP Address Count 1 Master Router s IP Address 170 10 10 2 Primary IP Address 170 10 10 1 Authentication Type SIMPLE TEXT PASSWORD Authentication Key ABCDEFG Advertisement Interval 1 Preempt Mode ON Virtual Router Up Time Tue Feb 22 13 05 53 2000 Critical Interface Department2 Critical Interface Status IF UP gt 020000000 Dad 0000000000 poeg0000000 000000 000000000000000000000000 MASTER Y O BACKUP ooo 0000000000000 0000000000
353. before login after login before login ftp plain text J 000000000000000000000000000000000 a after login ftp po0000000000 1000000 00008008 000 08008 0000000 00000000000000 pg0090000000000000000rogepgo 0800000000000 00000 0000000000000 00000000000 528 0000000000000000 010 00 pog0000000000 000000 0000000000000000000 telnetO 7 020000000 000000000 telnet O ftp0000000000000000000000 7 526 telnet DD D D 10 10 10 10 Y E ERA telnet ftp7 24 7 gt telnet ftp x 3 i u 2 00000000000000 fpoO00000000000000g podBd0 000000000000 00000000000000000 55 5 00000000 5 27 system login message after login config system login message after login plain text Press CTRL D or only on last line CTRL D config config system login message after login ftp disabl
354. change between systems Intermediate system to Intermediate system Intra Domain routeing information exchange protocol for use in conjunction with the Protocol for providing the Connectionless mode Network Service ISO 8473 Integrated Services Digital Network International Organization for Standardization Internet Service Provider Local Area Network Link Control Protocol Light Emitting Diode Logical Link Control Link Layer Discovery Protocol Low Latency Queueing 3 Weighted Fair Queueing LSP LSP LSR MAC MC MD5 MDI MDI X MIB MPLS MRU MTU NAK NAS NAT NCP NDP NET NIF NLA ID NPDU NSAP NSSA NTP OADP OAM OSI OSINLCP OSPF PPPOE PSNP PVC QoS RADIUS RDI REJ RFC RIP RIPng RMON RPF RQ SA SDH SDU SEL SFD SFP SMTP SNAP SNMP SNP SNPA SOH SONET SOP SPF 0000 Label Switched Path Link State PDU Label Switched Router Media Access Control Memory Card Message Digest 5 Medium Dependent Interface Medium Dependent Interface crossover Management Information Base Multi Protocol Label Switching Maximum Receive Unit Maximum Transfer Unit Not AcKnowledge Network Access Server Network Address Translation Network Control Protocol Neighbor Discovery Protocol Network Entity Title Network Interface board Next Level Aggregation Identifier Network Protocol Data Unit Network Service Access Point Not So Stubby Area Network Time Protocol Octpower Auto Di
355. ctive Periodic Timer Short Actor information System Priority 1 MAC 00 12 E2 12 ff 02 Key 101 Partner information System Priority 10000 MAC 00 12 E2 f0 69 be Key 100 Port Counts 6 Up Port Counts 2 Port 0 1 Status Up Reason Speed 100M Duplex Full Actor Priority 128 Partner Priority 100 Port 0 2 Status Up Reason Speed 100M Duplex Full Actor Priority 128 Partner Priority 100 Port 0 10 Status Down Reason Duplex Half Speed 100M Duplex Half Actor Priority 128 Partner Priority 100 0000 gt 00000000000 00000000 show link aggregation statistics 00 BODO 0000000000 00000000000000 lt Tota gt 0 0000000 gt NIFO lt 91 0000 O6SOO0000000000000000000 gt show link aggregation statistics Date 2003 01 15 14 18 00 link aggregation Counts 1 LA ID 1 Up Total Octets TX 12760301 Rx 9046110 Frames TX 71483 Rx 64377 Discards Tx 96 Rx 9 Port 0 1 Octets Tx 12745991 Rx 9033008 Frames Tx 71432 Rx 64332 Discards Tx 95 Rx 5 Port 0 2 Octets Tx 14310 Rx 13102 Frames Tx 51 Rx 45 Discards Tx 1 Rx 4 Port 0 3 Octets Tx 0 Rx 0 Frames Tx 0 Rx 0 Discards Tx 0 Rx 0 dau ud gt 0400000000000 show link aggregation statistics lacp 0 UDO00000000000000000000000000 0
356. destination 200 1 7 0 200 1 8 255 current policy route Policy Group Name routel Output Interface tokyo3 Next Hop IP address 200 1 10 1 Interface Name tokyo Filter List No 2 forward packets protocol 35 ip_source 200 20 200 125 255 ip destination 200 1 19 0 200 1 20 255 current policy route Policy Group Name route2 Output Interface yokohama Next Hop IP address 200 1 50 2 0000 gt 020000000 Dad show ip cache policy U Pg00 00000000 0000 U 6 19 gt show ip cache policy routel lt Policy Group Name gt routel priority Interface Name status Nexthop gt 1 tokyol Up 200 1 1 2 2 tokyol Up 200 1 2 2 3 tokyo2 Down 200 1 8 3 4 tokyo3 Down 200 Ls X0 3 default 6 3 6 Null DO D L 0200000000 show ip route 0 g0000000000000000000 steategod000000000000 6 20 0 gt show ip route static Total 3 routes Destination Next Hop Interface Metric Protocol Age 172 16 250 24 192 168 11 101 rmEthernet 0 0 Static lh 8m 172 16 251 89 32 null 0 0 Static im 9s 0000 gt 81 6 0
357. ds Collector 10 1 1 3 udp 6534 Source 10 1 1 10 Send Flows 2 428 Discard Flows 0 Send UDP Packets 118 Discard UDP Packets 0 CAF S RR 20000000000000000 Overflow OOOOOOOOOOOOOOOOOGO config show netflow netflow yes sample 2048 entries 0 2000 0000000000000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 0 2 port 2 0 1 config netflow entries 0 4000 config show netflow netflow yes sample 2048 entries 0 4000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 0 2 port 2 0 1 3 NetFllwQ 0000000000 show netflow 0 0000000 NetFlowQ 00000000 NetfMw0000000000000 00000000000 NetFlow0 00000000000000 00 0 6 13 3 NetFlow 1 O00 podo00000 000000000000 141 6 000000 00000 000000 6 120 show netflow 1 gt show 611 low Progress time from NetFlow statistics cleared 10 00 06 PRUO Active Received Flows 123456 Dropped Flows 0 Overflow Entries 0 Used Entries 1998 Un used Entries 2 Flow export Version 5 Service status enable Active Timeout 30 minutes Inactive Timeout 15 seconds Collector 10 1 1 2 udp 6534 Source 10 1 1 10 Send Flows 468 Discard Flows 0 Send UDP Packets 108 Discard UDP Packets 0 Flow Aggregation cache protocol port Service status enable Overflow Entries 0 Used Entries 0 Un used Entries 2000 IL THEA Active Timeout 30 mi
358. e config show system login message OFI Yk ye 0229 2 4 ARLES RABID IES E 2 thOfs 7 0 1 0 FAD LET ftp 7 E XBF 8 42 YE VERTE SAS ELEY system login message after login encode LSOtLSOtLSOtLSOtLSOtLQp ZWxsbyBteSBmcml IbmQuC i OtLSOtLSOtLSOt LSOtLSOK system login message after login ftp disable config config show system login message after login plain text config O40 0000000000000000000 56 AANA BgMicrYa Fk ENTREENET showDEI plain text 22 5 BE GSE RERT Heb G telnet ftp D telnet ftp 5 1 00060 5 00000000 9 28 etelnet 000000 gt telnet 10 10 10 10 Trying 10 10 10 10 Connected to 10 10 10 10 Escape character is login staff Password Copyright c 2005 ALAXALA Networks Corporation All rights reserved Welcome to the System gt eftpr r uut ftp 10 10 10 10 Connected to 10 10 10 10 221 FTP server Version wu 2 4 1 Fri Aug 27 15 15 05
359. e lt 10ms TTL 128 1 bytes 32 time lt 10ms TTL 128 HAHA HAHA Ping statistics for 192 1 1 1 Packet Sent 4 Received 4 Lost 0 0 loss Approximate round trip times in milli seconds Minimum Oms Maximum Oms Average Oms gt 8 145 1 1 1 11 1111 11111 1 NetFlow 0000000000000000 1 1P00000 UDP 24 8 0000000000 829 12 config show netflow netflow yes sample 2048 entries 0 4000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 1 2 config 8146 NetFlow D 0000000000000000 1 000000000000 0000000000000000 1200000 000 poda 000000 0000000000000 13 830 config show netflow netflow yes sample 2048 entries 0 4000 flow aggregation cache prefix aggregation entries 16000 mask source minimum 24 mask destination minimum 24 destination 192 1 1 12 lt 1 11 11 11111 11 111111 11 111 11 1 port 1 1 2 config 1 110000000000000 0 0 0 timeoutiinactiv 0 0000000000
360. ectionLess Network Protocol ConnectionLess Network System Connection Oriented Network System multi layer Control Processor Cyclic Redundancy Check Carrier Sense Multiple Access with Collision Detection Complete Sequence Numbers PDU Destination Address Direct Current Data Circuit terminating Equipment Dynamic Host Configuration Protocol Differentiated Services Draft International Standard Designated Intermediate System Data Link Connection Identifier Domain Name System Designated Router Destination Service Access Point Differentiated Services Code Point Data Terminal Equipment Distance Vector Multicast Routing Protocol Electronic Mail Ethernet in the First Mile End System Frame Check Sequence Filtering DataBase Frame Relay Fiber To The Home GigaBit Interface Converter Guaranteed Frame Rate High level Data Link Control Keyed Hashing for Message Authentication Internet Assigned Numbers Authority Internet Control Message Protocol Internet Control Message Protocol version 6 Identifier International Electrotechnical Commission Institute of Electrical and Electronics Engineers Inc the Internet Engineering Task Force Internet Group Management Protocol IS IS Hello Internet Protocol IP Control Protocol Internet Protocol version 4 Internet Protocol version 6 IP Version 6 Control Protocol Internetwork Packet Exchange Intermediate System Information technology Telecommunications and Information x
361. end NG Receive OK 60 Recei ve NG 0 Data compare error 0 Out underrun 0 Out buffer hunt error 0 Out line error 0 In CRC error 0 In frame alignment 0 In overrun 0 In monitor time out 0 In line error 0 H W error none gt O20 0000000000000000000000 312 0 0 cdoseOOOOOOOOOOGOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOODO free podd0000000 0000000000 000000 tmegoodg0000000000000000000000000 00000000 10 90 OOo 0 O 9 0000 uuu test interfaces no test interfaces 0 0 D gt close nif 1 line O Enter test
362. es sample 2048 entries 4000 flow export version 9 timeout inactive 600 destination 172 16 178 2 udp 1234 flow aggregation cache bgp nexthop tos 52 x 4 TCU Au aggregation entries 16000 timeout inactive 30 destination 192 1 1 12 port 1 1 2 config 8 148 PRUDDDDUOUUDUUUUDDULULU 0000000000000000 266 8 0000000000 8 34 OOOOOOOOOOOOO 17 config show netflow netflow yes sample 2048 entries 0 1000 NetFlow 00000 PRU 1 1 1111 1 1 flow export version 5 destination 172 16 178 2 1234 port 1 1 2 1 config O 8 35 shownetlowQ QO 0000000 gt show netflow Progress time from NetFlow statistics cleared 0 02 56 PRUO Active Received Flows 0 Dropped Flows 0 Overflow Entries I 0 Used Entries 0 Un used Entries 1000 PRU1 Active No Entry xo Entry 0000000000 2 Received Flows 0 Dropped Flows 0 Overflow Entries 0 Used Entries E 0 Un used Entries 0 Flow export Version 5 Service status enable Active Timeout 30 minutes Inactive Timeout 15 seconds Collector 172 16 178 2 udp 1234 Source 10 1 1 10 Send Flows 0 Discard Flows 0 Send UDP Packets 0 Discard UDP Packets 0 u uuu 1 1 1110000090 0 O 8 36 show pru information 11 0 1 1 0 gt show pru information 2005 02 01 13 58 56 PRU 0 disconnected
363. ets 108 Discard UDP Packets 0 CAF GBB po00000000000000000U0 Dropped Fowpg00000000000000000 config show netflow netflow yes sample 2048 0000000000000 entries 0 0 flow export version 5 destination 172 16 178 2 udp 1234 port 1 0 2 port 2 0 config netflow sample 8192 config show netflow netflow yes sample 8192 entries 0 2000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 0 2 port 2 0 0200000000000 140 show netflow 0 1 000000 NetfMowd00000000000000000000000000 0000000000 Used Entries Un used Entries 6 00000 0 00000 000000 6 119 show netflow 0000000 gt show 611 low Progress time from NetFlow statistics cleared 10 00 06 PRUO Active Received Flows 123456 Dropped Flows 3412 Overflow Entries 5 430 Used Entries 1998 Un used Entries 2 Flow export Version 5 Service status enable Active Timeout 30 minutes Inactive Timeout 15 seconds Collector 10 1 1 2 udp 6534 Source 10 1 1 10 j ign gt ETAN Send Flows i 4468 Discard Flows 0 Send UDP Packets 1608 Discard UDP Packets 0 Flow Aggregation cache protocol port Service status enable Overflow Entries 0 Used Entries 340 Un used Entries 1660 Active Timeout 30 minutes Inactive Timeout 15 secon
364. from 49 168 7 from 192 168 6 from 192 168 5 8 0 JN time 100 001ms mtu 1500 Label 22 code 8 0 7 time 97 102ms mtu 1500 Label 21 code 8 0 7 time 123 304ms mtu 1500 Cimplicit null code 8 0 7 A time 110 075ms code 3 0 3838 L PEL UC gt L C lt EEL 6010088 S CUYAS B L C lt ESL O0 6 92 LSP traceroute DOOOU000000 OOO 1 gt traceroute mpls 192 168 113 101 32 Trace to 192 168 113 101 32 is via LDP FEC from 192 168 7 7 time 100 001ms mtu 1500 Label 22 code 8 0 from 192 168 6 7 time 97 102ms mtu 1500 Label 21 ode 4 0 00060375 LBW CRT LEF 0 6 93 LSP traceroute 0000000000 OOO 2 gt traceroute mpls 192 168 113 101 32 Trace to 192 168 113 101 32 is via LDP FEC timeout timeout timeout 50 O30 MPLS O 00000000000 UL LDPOO OO 000000000 6 41 god00000000000000000000000 static LSP 0 0 O40 VPN MPLS 0000000 show mpls forwardingtable 0 00000000000 MPsp o00000000000000000000000 00 show mpls forwarding table 1 0 0 0 D statistics 00 g00000000000000000000000 123 6 000000 00000 000000 6 94 IPpog000800000000000000000000 gt show mpls forwarding table 192 168 113 101
365. g CPuHnnu 5000 goog 1 10 118 000 E4 CP 80000004 1134 CP recovered from congestion 833 Odo 1110010000 00000000000000 primaryMCvar core OOOOOOOOOOOOOOOOOOOOO 1 p0000000000000 817 p0090000000000000000000000000 084 gt ls 1 primaryMC var core rwxrwxrwx 1 root wheel 1153219 Jun 21 16 35 rtm core gt 2 000000000000000000 show logging 0 00080980000000000000000000000000000000000 3000000000000 00000000000000000000 0 85 0 0 00 0 000000 gt show logging EVT 06 21 16 36 27 R7 RM 05001001 1001 000000000000 rtm restarted 0000 5 0 show tech supportd OOOOO00000000 ugpnagaggaadguue 4 0000000000 00d08B 800000000000 000000 000000000000 000000000000 ea 0 000000000092 101 5 0110000000 Oo 171 8 0000000000 84 1 1 841 1111 1 1111 1 1
366. gimO 0 0 49 5 00000000 0 543 1 unam class and noconfig nomanage noenable B allow commands D 110110 DD o OOOO OoO w Q o B v 5 confi a Co 200000000000 000000000000000000000 0008000000000 000000000000 000000000000 in user staff allow commands show ping telnet deny commands D al QOO00000 oO Sores ES 153 53 533 TES TTE 2 S um anmi 20000 g 03 L3 E3 E3 2 3 3 3 3 o gin user staff deny commands enable reload close 00 510 JDDDDDDDDUDUDDDDDDBDUDDUDUDDDBDBDUDDUDUDUDDUDDDDUDUDUDUDUuDU podd0000000000000 0 5 13 0000000000000 config login user staff class allcommand config login user guest deny commands reload close enable X allcommand 188 lt gt F LES reload 61086 3 75 36000 65 5 AVY al low commands ABE Jv T LYELL ED HHO
367. gin Please close connection IHHHHHHHHHBHHBHHBHHBHHHBHHHHHHHRHHHHHRHHHRHHE 000 0 L 9 53 5 00000000 5 24 system login message before login config system login message before login plain text Press CTRL D or only on last line n4 E gt TIHBHBHRRHBRHBHRRHRHBHBHRRHBHHHRRHBHHRRRHRRE 0292 Warning Warning Warning AALET This is our system You should not login Please close connection 5 AJ053845 27 5 HHH E U EH Of 0 1 0 FAA LET conf ig config show system login message before login system login message before login encode lyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjcl dhombpbmch ISEgV2FybmluZyEh SBXYXJuaWon SEhC RoaXMgaXMgb3Vy HNSc3R IbS4gWW9 1 HNob3VsZCBub30gbG9naW4u CIBsZWFzZSB jbG9zZSB jb25uZWNOaW9uLgo j lyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMjlyMj lyMj LyMj T config ARENA YL VIA F 9 1 config show system login message before login plain text SHNCHESHET Warning Warning Warning This is our system You should not login Please close connection 5 28 1 9 31 16 1 A
368. goyaT DUDU gt show ip interface TokyoNagoyaT TokyoOsakaT flags 80b1 lt UP POINTtoPOINT NOTRAILERS NOARP MULTICAST gt mtu 1280 inet 192 168 100 1 gt 192 168 100 2 physical address inet6 fe80 1 64 gt fe80 2 109 6 0 00000 0 00000 000000 6 1 11 1 1 11111 00000000 show ipv6 route Total 10 routes Destination 96 fe80 10 Tfe 501 811 ff01 64 0000 IPvepgod000800000000000000000 show ipv6 routeQ 000000000 9 6 7 3 RIPsgD 0 0 678 iP vepg0000000000000000000000000 000000000 O 6 69 show ipv6 route 00000000 Next Hop Interface Metric Protocol Age sd 0 0 Direct 300 edd 0 0 Direct 300 680 2a0 c9ff fe6b 8elb PAIRI 3 0 RIPng 100 ABET F AA lt REL 672 0000000000000000 OOOO show ipv6 static route e Flag 8 09 1 1101 StatusQ 000000000000 6 Flag PolQOOOGOOOOOOOOIMPOOOOOOOOOOOOOOOOOOOOOOOOOO 110
369. iff serv 0000000000 IPO0000 pHCP BOOTPHHDUDDU 0 Differentiated services Po000000000000000000 000000000000 0000000000000 DNS J OO DNS Domain Name System OOO OOOOC0O0000000000000000000000000000000 324 00A 0000 DSCP Differentiated Services Code Point IPOOOO IPOOOO DS Field OO 6000000 DSO U Diffserv i 000000000000000 DVMRP Distance Vector Multicast Routing Protocol 411000 0 000000000000000000000000000 EFM Ethernet in the First Mile IEEE802 3ahQ 0 00 0 0 D 0000 0000 FDB Filtering Data Basel ICMP Internet Control Message Protocol IPv4 00000000 Do0000000000000FDBO0 00000 00000 El EJ Co Co CJ Co Co E Co Co L El Co El Co Co ICMPv6 Internet Control Message Protocol version 6 IPv6 IGMP Internet Group Management Protocol IPv4 IPv4 Internet Protocol version 4 320000 IPv4 IPv4 1 IPv6 Internet Protocol version 6 128 IPv6 DHCP oo 8
370. ing grep KEY KEY 08 01 10 35 05 userl gt show logging grep KEY Gua KEY 08 01 10 34 38 user2 passwd 0000 gt 732 DOdOD0 00000000000 show logging grep EVT show logging grep ERR 000000000000000 O76 pg00000000 gt show logging grep EVT Gua EVT 08 03 08 34 51 4 LINELAN NIF 2 LINE 0 90111001 1350 02 00000038 Error detected on the line EVT 08 03 08 34 37 E4 LINELAN NIF 2 LINE 0 90110001 1350 03030000003b Line status is up Gua ugpnagagaggagaggggaaggggaagggmnagggng 11101000000 0 0 0 show 0008 000000000000 000000000 1 110 320000 0000000000000 8 gogo 000000000000 00000000000000 151 7T 000000 7 4 SNMP ITI D 0000 00000 SNMP go 0000000 00000000000000000000000000000
371. interfaces nif 1 line 0 connector Enter 0100000 no test interfaces nif 1 line O Enter pod 000 000000000000 00000 gt free nif 1 line O Enter V a V a 0 O0 1000BASE LH 1000BASE LHB 10GBASE ER 10GBASE EW 10GBASE ZR OOO OOOO 8 6 No UDUD 0000 del 1 1000BASE LH 5 22 2 1000BASE LHB 170 36 3 10GBASE ER 50 11 4 10GBASE EW 5 11 5 10GBASE ZR 150 24 8 po00000000000000freepodoo0000000000000000000000000 10GBASE
372. ite view SNIPE 2 CB 5 C 0 2 500000000000 00 0000000000000000 000sNMP000000000000000 0000 SNMPQ 0 3 0000000000 go 0 00000000000000000000000000SNMP 0000000000 UDPpo00 0000000000000 1610 0000000000 8 13 2 25 DIT 000000000000 0000000000000000 1 pa0000000 000000 000000000000000000 SNMPv1 000 SNMPv2c D D D D D D 00000000000000 skowsmppg000000000000000000 SNMP podd0000 000000 000000000000 00000000000000 po0000000000000 000000000000 sampi 00000 SNMP JIJU D H 206 config show snmp 8 0000000000 snmp public 20 1 1 1 read write none snmp public 10 1 1 1 read ex trap level 7 8 4 9 snmp Cevent monitor ISI TAHU trapE lZex trapO rh NTUACEFEERLOX
373. kB used user Area 30 866kB 200 514kB free user Area 175 046kB 231 380kB total user Area 205 912kB mc enabled AX F6244 66 MC256 AX7800R format 30 866kB used user Area 30 866kB 200 514kB free user Area 175 046kB 231 380kB total user Area 205 912kB 7T 000000 00070000 dump Area 0kB dump Area 25 468kB dump Area 25 468kB 00070000 dump Area 0kB dump Area 25 468kB dump Area 25 468kB 155 7T 000000 7 6 D 1 U OO 0000000000764 6 7 61 NIFpo0 00000000000 poda 000000000000 ve 320000000000000 PRUD NEpogo 00000000 00000094 Do0dg000000000000000 762 OOOOOOOOOOOOOOOO 20000000000000000000000000 DU 763 0 0
374. laxala Allow Commands 101 string Alaxala ATTRIBUTE Alaxala Deny Commands 102 string Alaxala OO 510 pg0000000000000000000000000 D D B D 5 9 staff Password eorex 2 A al command Ci gt F Class al command THI LES Password k zd s Re N Alaxala Deny Commands close reload enable close TE SAVY F reloads XU enable ZR LL EF al low commands AEE amp L LME UNE ADIY ETS LASOE E 0 5 Z 555 3 Password eek show ip 70046 21 59 67 60 Alaxala Allow Commands show ip show ip route amp pa v Y Kida S L ETA show ipv6 route O av Fit BO SHEA HhO FS 5 3 12 L ET 47 5 00000000 0000 e 00000 Cas 00000000000001000 Class 200000 Class O D 510 pp Class Class noenable AE G 4 B 05 672 ANEGUEI Class allcommand e 00000 0 0 0 0 000000 2000 1 1 00 0 0 0 OO class nomanage noenable 0 0 0 0 0 O nomanage e Alaxala Deny Commands Alaxala Allow Commands
375. ms code 3 0 from 192 168 0 7 seq 4 time 110 075ms code 3 0 from 192 168 0 7 seq 5 time 105 870ms code 3 0 Isp ping statistics 5 packets transmitted 5 packets received 0 packet loss STADT 00050 O 689 5 91 O00 1 gt ping mpls 192 168 113 101 32 Route to 192 168 113 101 32 is via LDP FEC from 192 168 5 7 seq 1 time 100 001ms code 11 0 from 192 168 5 7 seq 2 time 97 102ms code 11 0 from 192 168 5 7 seq 3 time 123 304ms code 11 0 from 192 168 5 7 seq 4 time 110 075ms code 11 0 from 192 168 5 7 seq 5 time 105 870ms code 11 0 sp ping statistics 5 packets transmitted 5 packets received 100 packet loss SERTENEEA O 690 LSPpingQ DUDU 000 2 gt ping mpls 192 168 113 101 32 Corresponding FEC dose not found 0200000000000 LDP O 00 routingbase LSPO O VPNMPESP 000000 00000000000000000 000000 traceroute 0080 00000000000000000000000000 pod0g000090000000M0 691 LSPtracerouten 0000000000 000 310 0 122 6 0 00000 0 00000 000000 10 0 00000000000 00 692 LSP 86 1100000000 000 0 traceroute 8 111111100000000000000 0 0D 693 LSP traceroute 0 OOO 000000 000 20000000 D 6 91 LSP traceroute 0000000000 OOO gt traceroute mpls 192 168 113 101 32 Trace to 192 168 113 101 32 is via LDP FEC
376. nutes Inactive Timeout 15 seconds Collector 10 1 1 3 udp 6534 Source 10 1 1 10 Send Flows 128 Discard Flows 0 Send UDP Packets 18 Discard UDP Packets 0 O40 CPU T H1 E U U show cp cpu U CP CPU CPU II 10 NetFlow 0 0 20 0 Od U oO 6 121 show cp cpu show cp cpu minutes xxx minute date time cpu peak cpu average buffer peak buffer average Apr 0277 9 0 0 0 0 Apr 0277 9 30 3 0 0 Apr 02 18 21 00 18 21 59 90 Ce 0 0 Apr 0277 9 86 0 0 Apr 02 18 23 00 18 23 59 36 8 0 0 AL 69 112 6 0 000000 00000 000000 614 6 14 1 LLDPHOUOUUOUOUUUUUO 0000 LLDP90000000000000000000000000 OM 00000000000 00000 show 1ldp pg980000008000000000000000 lldpopo000 pod ooo ooo ooo ooo 00000000000 000000000000 000000 6 122 0 LLDPO 00000000 gt show lldp Date 2004 04 18 10 12 26 Status Chassis ID Type
377. o 9 120 000000 4 3 0000000000000000 rl show ip local policy interface tokyo 1 20 0000000 gt show ip local policy interface tokyo 1 2 lt Interface Name gt tokyo lt Filter List No gt 1 forward packets protocol ip ip_source 200 1 4 0 200 1 4 255 ip destination 200 1 7 0 200 1 8 255 current policy route Policy Group Name routel Output Interface tokyo3 Next Hop IP address 200 1 10 1 Interface Name tokyo Filter List No 2 forward packets protocol dp ip source 200 1 5 0 200 1 5 255 ip destination L3200 1 194 0 20071205255 current policy route Policy Group Name route2 Output Interface yokohama Next Hop IP address 200 1 50 2 s 000 e 00000000000000 0 0 nb M show ip cache policy routel 0000000 gt show ip cache policy routel lt Policy Group Name gt routel priority Interface Name status Nexthop 1 tokyol Down 200 1 1 2 2 tokyol Down 200 1 2 2 3 tokyo2 Down 2004 1 8 3 gt 4 tokyo3 Down 200 POS d default Dpuunuugnuunuupnuanuuanu unugapnuanaudimes4 000000000000 O show ip cache policy 0
378. o00000 8 1 show ipv6 mrouteQQOOOUU00000 8109 6100 000008 G0000 6100 IPvpo0000000000000000 61000 co000000000000000000000000 1000 200 IPv6 PIM SM 000000 enable 4s00000000000000000000000000 3 BEG ogg EET za Fa a 00000000 sspoo00000000610 ssMpog0 000000000000 00 1 1 110000000000 0 0 8 0 0100 000000090 S500000000 O 10 show ipv6 6100 8100 00000000000 pog00000000000000000000000000000008S100 IPv6 PIM SM 000000000 enable EJ Es EE kh ETT sur EI EE EI A a 0 O 0 O O O O O G O O 0 O 3 E u 9 show ipv6 pim neighbor 0 20000 0000000000000 OG show ipv6 pim bsr O O show ipv6 pim rendezvous point mapping 241 8 0000000000 00000 BSRO000000000000RP00000
379. odem put nodelnit core 00 gt 9 2 8 showtech support 280 10 1 1 00000000000 show tech support 0000000000 019 00000000000 0000 0000000000000 098 pgadbo000 00000000 0000000000000000 gt show tech support ftp Specify Host Name of FTP Server Specify User ID for FTP connections userl Specify Password for FTP connections XXXXXX Specify Path Name on FTP Server usr home userl Specify File Name of log and Dump files support Transfer Text file file name support txt Executing 000000000000 Operation normal end Dump files Information 1HHHHHHHHHE 1 dumpO KAKAK total 1368 rwxr xr x 1 root wheel 1316167 Apr 23 21 14 rmdump rwxr xr x 1 root wheel 52077 Apr 23 21 14 dpdump ls l standby dumpO total 1368 rwxr xr x 1 root wheel 1316167 Apr 23 21 14 rmdump rwxr xr x 1 root wheel 52077 Apr 23 21 14 dpdump End of Dump files Information THHHHHHEHHHE Core files Information 4HHHHHHHHHE 1 primaryMC usr var core 1 standby primaryMC usr var core No Core Files HHHHHHHHHH End of Core files Information Transfer binary file file name support tgz Executing DODODODODODODO Operation
380. ow system System AX7808R AX P6544 11 Ver 9 1 OS R Node Name System Name Contact Contact Address Locate Location BCUO Active RM CPU Active AX F6544 R5M8MS BCU RM8MS 0000 Boot 2003 01 11 19 27 42 Power ON 0 times restart 8001 F ABCUO E FH TR RR 0000 000 8 1 0 Fault 00000000000 00000 BCU00000000 close 8000000000000 gt close standby Enter Main Menu gt gt Action lt ACTION gt gt CLOSE standby I I 0 200000000 Be0000 00000000 0000 800 000000000000 0000000 se 00000000000000000 BCU0 0000 86651 00 0 0 0000000000000000 00020000 000 B8e000000000000000000 D 9 12 DUDU 8886 FICE LY SMCO AR U L L GEE MCP 7RAHICNCE RY NT E MCA 6 RTRETEA S 0 G MOPZ ERGY 0 5 gt L TK ESL 8 86 FORY HL 000000 oxNng0000000000000000000000000 podd000000000000000000 284 9 0000 00030000 856 000 0 000000000 BcUOOOO 000
381. ply from 192 reply from 192 reply from 192 reply from 192 bytes 32 time lt 10ms TTL 128 bytes 32 time lt 10ms TTL 128 bytes 32 time lt 10ms TTL 128 bytes 32 time lt 10ms TTL 128 PARA PARA PPP Ping statistics for 192 1 1 1 Packet Sent 4 Received 4 Lost 0 0 loss Approximate round trip times in milli seconds Minimum Oms Maximum Oms Average Oms gt 8142 DOBO dan gon 00000000 sFew D 0000000000000000 e pcgo0d00000000000 000000000000 000000000000000000 0000000 6868870913 0 00000000000000000000 080000000000 261 8 0000000000 U 820 6 config show 51108 sflow yes destination 192 1 1 1 sample 32 port 1 1 port sample 512 port 3 1 ARI CEBU YL TU ARE SACHS CE port sample 2048 config PRvOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOPRUOO 1 config show 81108 sflow yes destination 192 1 1 1 sample 32 port 0 1 port sample 512 port 1 1 port sample 2048 TIL T 3 lt 8 port 2
382. port sample 2048 524288 C SE L ES port 1 2 port sample 524288 config OOOOOOOOOODI 616 lt show sflow detail sFlow service status enable p Configured sFlow port 0 1 1 1 1 2 Sampling port rates Port 0 1 Configured rate 512 Actual rate 524288 Actual 4160 18 KD Port 1 1 Configured rate 2048 Actual rate 524288 Port 1 2 Configured rate 524288 Actual rate 524288 11 1110900000 0 0 0 0 forward offC 00000000000000 1 8 0000000000 5 8 17 0 config show 81108 sflow yes destination 192 1 1 1 sample 128 port 1 1 lt CCIzforward off REN amp dv CU VEU E config 000000000000 sFow0 0000000000000000 8 0 0 0 show interface 00000000000000 0000000000 up down OO actveupOOOOOOOOOOOOOOOOOOOOOO 818 gt show interface nif 0 line 0 2003 04 02 12 00 00 NIFO active l port 1000BASE SX retry 2 Average 700 2000Mbps Peak 750Mbps at 10 10 12 Line0 active up 1000BASE SX full 00 12 E2 45 0a 01 Protocol up IP address 10 0 0 2 Broadcast IP address 10 0 0 255 0000 00000000 000851 pg00000000000000000000000 00000 0000000000000 sMowpg0000000000000000000000000000000000 pnms8000000 podd00 00000000000 819 gt ping 192 1 1 1 pinging 192 1 1 1 with 32 bytes of data re
383. port sample 524288 config U 8 22 2 gt show sflow detail sFlow service status enable p Configured sFlow port 0 1 1 1 1 2 Sampling port rates Port 0 1 Configured rate 512 Actual rate 524288 Actual rate AX EI TEDTWEHAA Port 1 1 Configured rate 2048 Actual rate 524288 Port 1 2 Configured rate 524288 Actual rate 524288 8 143 DOHOUUUUUUUUUUUUOUY sFlow 0 1000000 eut OU 262 8 0000000000 pogo 000000000000 0000 U 8 23 0o000000000000 8 config show sflow sflow yes destination 192 1 1 1 polling interval 60 2 0289 42076 6 sample 8 port 1 1 config 8 144 DDDDUDU NetFlowQ 00000000 NetFlow 018 0000000000000 pod 000000 0000000000000 000000 6 NetFlow 00000000000000 no 9000000000000 0000000000 000000 Netflowe400000000000000000 824 0000000000009 config show netflow netflow yes lt 000 ves 000000060 sample 2048 entries 0 4000 flow export version 5 destination 172 16 178 2 udp 1234 port 1 1 2 config 1 0
384. rak ERE DE TEA config 04d 0000000 0000000000000 54 0000000000 00000000000 OOO 1110 1 1110090100 1 O 5 25 pog0000000000000000 etelnet gt telnet 10 10 10 10 Trying 10 10 10 10 Connected to 10 10 10 10 Escape character is HEHEHEHE HE HEHE HE HE HE HE HE HE HEHE HE HE HEHE HEHE HE HEHE HE H H H HH HH HHHH HEHHEHE Warning Warning Warning This is our system You should not login Please close connection HEHEHEHE HE HEHE HE HE HE HE HE HE HE HE HE H HEHE HHE HE H H H HH HHH HH HHHH HEHEHEH login eftpr gt ftp 10 10 10 10 Connected to 10 10 10 10 Z20 HHEHHHHHHHHHHHEHHHHHHEHHEHHHEHHEHEHEHHE HEHEHE 220 Warning Warning Warning 220 This is our system You should not login 220 Please close connection 220 HEHHHHHHHHHHHEHHHHHHEHHEHHHEHHEHEHEHHE EHH 220 FTP server Version wu 2 4 1 Fri Aug 27 15 15 05 JST 2004 ready Name 10 10 10 10 staff 5 00000000 5 00060 s 0 0 0000000000 00000 72000 000000000 90000 a a a a EJ a 1 0000000 show system login message
385. ransfer complete ftp bye 221 Goodby 277 9 OOOO 020 0000000 00000000000 278 9 3 1 gt show logging gt log txt gt show logging reference gt log_ref txt gt ftp 192 168 0 1 4 EEXRXOT7 FLA EE Connect to 192 168 0 1 220 FTP server Version wn 2 4 4 Fri Jan 1 00 00 00 JST 1999 ready Name 192 168 0 1 operator test 331 Password required for test Password Xxxxxx 230 User test logged in Remote system type UNIX Using binary mode to transfer files ftp ascii PARE 200 Type set to 110206 RAT A RU RAT ILO LORE 250 CMD command successful ftp put log txt 0 748 OSE local log txt remote log txt 200 PORT command successful 150 Opening ASCII mode data connection for log txt 1 345 bytes 226 Transfer complete ftp gt put log ref txt local log ref txt remote log ref txt 200 PORT command successful
386. ro Q 50050 oo E Pp WE o DEn Ta OOO isabled 2 0 10 0 0 0 0 0800000000000 000 0 O show link aggregation detail 0000 Down OOO 1 Reason 5 5 gt Y Disabled 0 0000 DOWN 84 d o OOy o0 Lr ilo LCD Lr E ou Port Speed Unmatch plex Half QO Half Duplex ood c L3 g tJ El 3 Co Co a Ic a Co MU a EJ tf Co LI a Co I E oo a a E E a a a a HO a a a a ac o et Selecting
387. s EstablishedQ 0 000000 BGP4 QOO000000000000000000 0000000 86 0 0000000000000 4 D B D show ipv6 bgp 11111 D D CDI 6 74 show ipv6 bgp neighbors 00000000 gt show ipv6 bgp neighbors 3ffe 501 ffff 5 2 BGP4 Peer 3ffe 501 ffff 5 2 Remote AS 300 Remote Router ID 192 168 22 10 Policy Group 1 Description Tokyo Center IPv6 BGP4 Status Established HoldTime 90 Established Transitions 1 Established Date 2001 08 21 19 41 01 BGP4 Version 4 Type External Local Address 3ffe 501 ffff 5 1 Local AS 500 Next Connect Retry Connect Retry Timer Last Keep Alive Sent 10 39 30 Last Keep Alive Received 10 40 01 Graceful Restart Both Restart Status Receiving 2004 07 08 17 01 23 Receive Status Finished 2004 07 07 10 11 12 Stale Routes Retain Time 300 NLRI of End of RIB Marker Advertised and Received BGP4 Message UpdateIn UpdateOut TotalIn TotalOut 1 7 61 68 BGP4 Capability negotiation lt GracefulRestart gt Send lt IPv6 uni GracefulRestart RestartTime 120s gt Receive lt GracefulRestart RestartTime 300s IPv6 uni gt Authentication TCP MD5 No fast fallover configured gt 6 7 6 15 180000 000 00 OPASISI 0000 IP eOOOOOOOOOOOOOOO ISTSU DU 00000 show isis adjacency O AdiacencysOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 113 6
388. s JO 400 00000000000000000000000000000000000 podo00000000000 00000000000000 827 OO Line og OO OOO active up 1 1111 6o4 Q0000000000000000 active down 1111111111 1 2 O E show logging 0000000000000 6to40 0 0 1 1111111 0 0 000000000 0 OOO 3 0000000000000000000000 po0008000000000000000000000000 locked OOOO 1 1111111 1 110100 00 3 1 0200000000 show interfaces JO 000 00000000000000000000000000000000000 234 8 0000000000 p0000000000000000 881 235 8 0000000000 89 1 1 1 1 11 1 1 1 1 11 1 1 89 1 D DDDUOUUOLULUULLL 828 0000000000000 000000000 od 1 0000000000000000 Statusi O00 00000 200000000000 000000000000 show ipv6 static route Status 000 IFdownQ 0000000 200
389. scovery Protocol Operations Administration and Maintenance Open Systems Interconnection OSI Network Layer Control Protocol Open Shortest Path First Organizationally Unique Identifier PADding Personal Computer Protocol Control Information Protocol Data Unit Protocol Implementation Conformance Statement Protocol IDentifier Protocol Independent Multicast Protocol Independent Multicast Dense Mode Protocol Independent Multicast Sparse Mode Path Over Head PPP over SONET SDH Point to Point Protocol PPP over Ethernet Primary Rate Interface Packet Routing Module Partial Sequence Numbers PDU Permanent Virtual Channel Connection Permanent Virtual Circuit Quality of Service Router Advertisement Remote Authentication Dial In User Service Remote Defect Indication REJect Request For Comments Routing Information Protocol Routing Information Protocol next generation Routing Manager Remote Network Monitoring MIB Reverse Path Forwarding ReQuest Source Address Synchronous Digital Hierarchy Service Data Unit NSAP SELector Start Frame Delimiter Small Form factor Pluggable Simple Mail Transfer Protocol Sub Network Access Protocol Simple Network Management Protocol Sequence Numbers PDU Subnetwork Point of Attachment Section Over Head Synchronous Optical Network System Operational Panel Shortest Path First 0000 SSAP TA TACACS TCP IP TLA ID TLV TOS TPID TTL UBR UDLD UDP UPC UPC RED VBR vc
390. serverQ 00000 DHCPo000000000000 podd00000000000000000000n00 000 yego000000000000 80000 config show dhcp6 server dhcp6 server yes config 2 0000000 dhep6 server interface 000000 00000000000000 show dhep6 server interface 0 DHCPOOOOU0000 uua 0000 config show dhcp6 server interface dhcp6 server yes dhcp6 server interface TokyoOsaka preference 100 config 3 000 dhep6 server host 000000 0009900000000 show dhep6 server host DHRCPHLuBDBaO UU 01 0 00 0 0 0 00000 0 prefix 00000000000000 did 000000000 dud 0000000000 DUID 1 C1 7 UE U UE U UU C U U LU UU config show dhcp6 server host Tokyol dhcp6 server yes dhcp6 server host Tokyol duid any range 3ffe ffff 1111 48 3ffe ffff 1112 48 config 4 00000000 dhcp server host target 0 000 880 8 000 0000 0000 00 00 dhep6 server interface host target 0 0 0 1 host target 0 O0 Dag gg on ogg 0d gg 000000000 000000 000000000
391. system telnet disable 5 1110100000 000 000000 00 O O system rlogin disable 3 tp 000000000000 00000 0 l system ftp disable 4 00000000000 0 O system time port disable 66 5 00000000 98 DODODODOO O AX7800kR 58 1 1 111 1 L 000000 917 00000000 od od 00000000000 00800000 BC00 0000000000000 00000000000 dado 000000 00000000000 000000000 11 1 11 0D 0000000000 0000000000 11 1 1111 1 DO D 0D 0D 0000000 0000000000000 dado pg og 000000000 0000000000000 1 00 MC 0000000 MC lU MO DUN MEATO 00000000000 67 5 00000000 59 1 111 018000000 Den 000000 OOOO Vol2 21190800000000000000000000000000 00000000 00000 O a DO D bn 000 D 0 00 DU E GB CEH 00 200 10 10 10 0
392. t 678 00000000 010000800 000000 0000000000000 show ipv6 routers interface 0000000000000 0000 e pcgo0000000 000000 0000000000000000 00000000000 000000000000000000000rRA000000000 po0000000000000 000000 0000000000 00000rR4a000000000 00 O 6 77 show ipv6 routers interface 1 1 L1 show ipv6 routers interface Office01 Index 2 Name Office01 Statistics RSin wait 0 0 RAout 0 RAin invalid 4 0 Intervals Advertise 200 600s next 219s later Lifetime 1800s ReachableTime RetransTimer ManagedFlag off OtherFlag off Hoplimit 64 AdvLinkOpt on AdvLinkMTU Prefix origin ValidLife s PrefLife s OnLink Autonomous 3ffe 2 64 RAconf 2592000 604800 on on 3ffe 1111 2222 3333 64 IFconf 2592000 604800 on on gt 020 000 00000000000 000000000 pingipv6 pg 000 000000000000000000000000000 115 6 00000000000 0000000000 6 8 6 Hl OP MLT 6 8 1 1 110 0 1111 111 10 U OOOO
393. t ACTION gt FREE O20 000000000 33 4 000000000000 30 close 4 10 close ACTION 2 5 CLOSE FER CLOSE board CLOSE board bStandby PRUO bPRUO PRU1 CLOSE board PPRU4 NEFT gt CLOSE Standby CLOSE board CLOSE board Yes PNo Standby gt gt x Standby lt Main Menu lt ACTION gt CLOSE Standby No CLOSE Standby close CLOSE Standby Completed lt Main Menu gt 34 4 000000000000 free OO 4 11 free ACTION 2 5 FREEZ IR FREE board FREE board bStandby PPRUO PRU1 FREE board PPRU4 NIF1 gt FREE Standby FREE board Yes 6 Standby gt FREE board gt x Standby lt Main Menu lt ACTION gt FREE Standby No FREE Standby FREE Standby Completed lt Main Menu gt 35 4 000000000000 48 TUDUH O0FF0 000 O0Ng000000 lt ACTION gt SHUTDOWN 00000 ENTrRogogg00000000000000000000 D 018000000000 pod 000000000 00000000000000000000 02000900000 g 412 SHUTDOWNJ 0000 ACTION
394. thernet 0 0 ip 170 2 2 1 24 ip address 170 3 3 1 24 ip address 170 1 1 1 24 relay list 1 170 10 10 10 relay group BlueGroup 1 config 6400000000 relay interface 000000000000 config relay interface Department1 relay_group BlueGroup config show line Department1 ethernet 0 0 ip 170 2 2 1 24 ip address 170 3 3 1 24 ip address 170 1 1 1 24 relay list 1 170 10 10 10 relay group BlueGroup 1 relay interface Departmentl relay group BlueGroup config 3 5 show dhcp giaddr 1100100000 5 5 00008 PO0O0000000000000000 00000 config quit show dhcp giaddr interface Departmentl DHCP GIADDR gt Departmentl gt 170 1 1 1 Dig VRRPOOOOOOOOOOOOOOOOOOOOOOO DHCP 800 1 VRRPOOOOOOOOOOOOOOOOOOOOO DHCP 800 DO 000000DHcP o BOOTPOOOOOOOOOOOOOOOOOOOOOOOOOOO VRRPI O 205 8 0000000000 UUDDUDDDUDDDBDUDUDUDDDDBDBDUDUDUUDDDBDBDDDUUDUDUDUDDDDUDUDUDUDUDDDBDUDU BoorPOOOOOOOOOOOOOOO DACPO go 000000000000000 020 pAePppo 00000000 0000000000 000000 00000000000000000 1 1 800000000 00000000000 2 DHCPOOOOOO 3
395. ug 0 BCU RL8MS ENIR sn 0A1HBNO3AOOO AX F6544 R5L8Ms CX RO10021F001 Syt 724 vk 2 6 2 LE R FRS AR FREE ER YU PILE UN TR RAF VU UA RE 31 4 000000000000 46 IU DI UO D D LI E lt INFORMATION gt Temp 00000 ENTROOOOOOOOOOOOOOOOOOOOOOO 0100000 rwe bgo0000000000000000000000000000B4cKg0 00000000 DO D BCUO BCU10 BCUO ENTRODO000000 lt Main Menu gt 000000 49 00000000 Temp BCUO Normal 27 2 2 gt bh LH Temp BE zR 8 1 TE mE C 4 4 0 00000000 Una Normal OO 2 43 C OO 0 290148 q 58 C OO 58 q 65 C Caution Critical 32 4 000000000000 4 D 000 000 BCUQ O AX7800RM D NIFO D OO oNgodo0000 0000000000 000000000000 1 0000000000 cosegod 00000000000 2 19 0000000000000 3 00000000000 4 00000000000 feepo00000000000000 pod 000000000000 000000000000000 p18 00000000 00000 lt ACTION gt CLOSE 00000 l
396. un ignal detect LOS of sync HI BER LF DD DD DD DD DD S show interfaces L3 C3 E3 E3 EEE EEE L3 E3 L3 E3 E3 E3 CRC errors Symbol errors od 0000000 0000000 000 od 0000 Voli 4 2310000000000000 000000 Voli 42 4100 00000000000 WANG G0OGBASE WI 01 00000000 Voll 423100000 QoGBASE RGOOOO000 Voll 4 2 4 0000000 0000000 WANGOGBASE Wp I U 0 EI Ce CTA gq Co Co Co El apo 0000000 1 GoGBASE P 000000 423100000 1 4 2 Vol 1 BASE W DL er lt EE o test interfac B LE OOO for lla EA Fis Ooo 22 SOOO Nooo a a a a a a a a 23100000
397. very ooo oooooooooo rPvsgooolooooooooooooooooao NAT Network Address Translation Co I Co Co NDP Neighbor Discovery Protocol 6 NetFlow NetFlewrn D NetFlow D 0 l NIF Network Interface board 1 OADP Octpower Auto Discovery Protocol OADP PDU Protocol Data Unit DOOUOOOO00000000000000000000000000000 000 OAM Operations Administration and Maintenance OSPF Open Shortest Path First Co OSPFv3 6 Co 00000 OSPFO OOO 100000000000000 OSPFOO0000000000 0000 0000000008 0 8 008 800000000000000
398. wan A o o mang ooo N r cet oos B DoS ooo ac et lt 2 1 1 lt 5 nspecified ce o ELA r3 0 0000 k 5 E 5 5 B e OOo OO gt lt 847 8 0000000000 od oog oo oo 000 f Detach Port Limit 10 0 098111 Key OOOO Hj ool oOo gt Do oo a oo oo oo Partner Key Key 00000000 NIFO Linel PPPOOOOOOOOOOOOO O10 NFOOOUO show interfaces U 00000 NIFOOOOOOOOOOOONFOOOOOOOOOOOOOOOO D 814 NFOOOOOOOOOGO NIF O O 1 active OO OO 815 Lmeg0g0000000000 0 gt 2 mismatch 0800000 NIFO Line I 000 000000 Ltiegg0900000000000000 0 8 unused OO 000000080 NFp0000000frep0000000 4 610860 OO

Download Pdf Manuals

Related Search

Related Contents

WooKong Multi-Rotor User Manual  MaxFlash PD16GM6-R USB flash drive  5 Linien mit intgrierten digitalen TWG  IDA 200 Insulation Diagnostics System  1-Ton Gantry Crane  Télécharger le manuel  Make you own Glass jewellery, anyone can do it !  Ergotech Group 100-D28-B33 flat panel desk mount  User manual  Slim Dimmer Plus Manual  

Copyright © All rights reserved. Failed to retrieve file