Home

"取扱説明書"

Contents

1. e 000000 Facilities e Address Server 493 000000000090
2. lt e 00000000 000 000000000 R opatrtgag0000 000000000000 00 000000000000 0 LR http ww hi net manual pri vacy asp purchase fl agi 000000 0000000000000 o 70000000000 0000000000000 00000000000 gt
3. oo 0000000 DD 37 E 0000000000000000 38 TF 1 590000 DDD 3 E 00000000000000 0 0 0000000000000000 40 E 100000 o 54000 100000000000000000 4 100000 o 54000 10000000000000000 2 E 100000 o 54000 100000000000000000 43 8 1000000000000000 10000000000000000 lt s gt 000000000000000000 4 E 0000000000000000 000000000000000000 lt s gt 0000000000000000000 6 0000000000000000 0000000000000000 lt s gt 000000000000000000 46 0000000000000 400 00000000000000000 47 E 0000000000 4000 000000000000000000 48 E 1000000000 0 54000 100000000000000000 49 E 000000000 0000000 0000 0000000000000 910 0 0 000 0000 0 4o DDD 5 E 000000000 0000000 0000 0000000000000 6910 0 0 00000 0 59000 DDD 5 00000 mgggggug 0000 0000000000000 6910 0 0 00000 0 4o00 DDD 52 E 10000000 800000000 000 9900000000 00 Ms 000000000000 000000000 aD 53 10000000000000000 Scheduler Facilities 0 D 0 000000 OO DNSOOO
4. 00000 odo 000000000 000000000000 000000000000 codo 000000000000 00000000 odo 000000000 000000000000 000000000000 00000000000000000 000040040 cwpppbd0000000 0000000000 000000000000000 E 482 D 7 4 00000000 49 00000000L 94 11111111 1111 1111 111111 111 111 EIE 1
5. 0 DO D u DO pod 000000000 00000000000000000000 DODO 0 000 000000000000 00000000 L3 O q po Oooo 1400000000000000000 0100000000 co0000000000000000000000000 4 5 6 Oo q L3 Lr O 4 E 6 E EE ESL E E Oooo asya uid asya uid 210 D 7 0000000 000000 00 000 0 D 0 Oo Oo EJ tl 4 O O Lr O 1400000000000000000 000 00000100000 1300000000000 pod 000 000000000000 00000
6. 00000 gt 9 260 8 00000000000 e GetAdAI 000000 indxgett 0000000000 e Assisti 00000000 0001 D 2 0000000000000 0000000000000000 00000000 bin AppoLock dat 0 OOO 000 x00000 60 10098000000000000000000000 1 p0000000000000 00000000 te0000000 20000000000000000 0220000000000 L tr Ea E GH E GE E 3 0 0 O
7. 0000 OO0 DU 4 15 3 I 1 E D D E D E E C CE EE C DE EO LI Duunugp anugpnugnnuuapupnnuapupnpnaapunimu anudunp e000000000000000 00000 135 4 00000000 4 67 0 ERARIO BE IEE gt En AAW KEG 82727 EEO DO0D000 0000000000 Dai 0000000000 10000 B0000000 1 00000000000 B00000000000000000000 00000
8. 0000 U Schedule 00 Todo 0000 000 mn 00000000000 83 83 84 85 85 86 89 90 92 93 94 97 98 99 100 102 103 104 105 106 107 108 109 109 110 111 112 113 115 117 119 121 122 123 124 OOOO JOJO JOJO popa GOMOD 4 60 461 4 62 4 63 4 64 4 65 4 66 4 67 4 68 4 69 4 70 7 1 7 2 7 3 7 4 7 5 7 6 7 7 7 8 9 1 9 2 9 3 9 4 9 5 9 6 9 7 9 8 U 1 U 2 U 3 O O poo 00000000000 for Scheduler 00 000000000000 0000 0000 sa ojo O
9. 192 7T 0000000 7 5 CODECHG 751 01900000 000000 020000000 I 1000000000000000000000000000 O00 0000000001 OOO D00000000000 0 ddress D 00000000000 6 0 0 o lt lt 792 0180000000 usr GroupAppo bin CODECHG filename SchedulePath logname 02000 e0100 filename 0000000 1Dp0000000
10. u uU atu 1 54 SCHogimp log HL 000000000000000 00000 errno X 111 11 1 0000000000 111 1 1 1 0000000000 0000000000000000000000000 55 EDO SCHogimp 000000 SCHoegimppao0 0000000000000 O00 D errno X 11 11 110 56 EJ000 00000000000 e Scheduler Server O0 000000000000 e usr GroupAppo bin FORGGROUPck usr GroupAppo bin FORGGROUPJck 000000 lusr GroupAppolbinp 0 000000000000 57 usr GroupAppo bin FORGGROUP ck usr 00000 GroupAppo bin FORGGROFFIck 00000000 0000000000000000000000000 000 ORGGROUPtbl ORGGROFEtb1 0 0 58 EJN000 00000000000 000000 100000000000 000000 11 1111 11111010 0101 0 0 padg0 000000000000 0800000000 0000l 0000 59 EO OD0 0 0000000001 0000001 errno X 0000000000000000000000000 60 EO OO 00000000000 1
11. 1 491 pod000000000000000000000092 000000 poddo00 00 000000000000 00000000 2 3 95 4 00000000 4 6 4 00000000 4 10 DIL D D LIU LI E 2500000000000 200000000000 000 4s60000000000000000C0000000000000 DUUDDDDDDDDUDUDUDDDDDDDUDDUDDDDDUDUDUDUDDBUIIDDDDBDUD 436 o00000000000000000 LAT DEORE PS etc aali ii EL EEE BPR dn WEOiEM EDRF d 1
12. 101 4 00000000 4 11 JOU WOOO 0000000000000000 Scheduler Server 0 0000000000000 1D0000000 1 D 2 00000000 I 50000000000 8 00000 DU 440000000 4400000 TANDODERTE OKO Fey EO BARES dm BITS 20000000000000000000000 4410000000 00 000 ooo WO s0000000 co000000008000000 Mo000000000000K000000 000000000 102 4 00000000 0 44p0001D00 00000000 TANDE NV EE AND feuestB fs Fey IC 3 mmupnugunuuapnunnuagapaupnnpnumududnpibmua nmnaagpnau UUDUDUDDUDUDDIDIDDDDUDUDDDUDDDDIIIDDDUDUDUDUDUDDBDUD UUDU
13. e Groupmaz 000000000000 Scheduler Server Facilities Manager 0000000000 Scheduler Server Facilities Manager 000000 root 000000 e Groupmax Address Assist TO OOOO000000000000 Address Server 0 000000000 usrchg 000000000000 0 Scheduler Server Facilities Manager OOOO 1 gag 000 00 0000 000000 000000 00000000000 0000000000 uses 00000000000 00000000000 pad gon 0000000000 pod 0d 0000 00 0000 000000 000000 00000000000 bin sh Licensed Material of Hitachi Ltd KAll Rights Reserved Copyright C 1999 2004 Hitachi Ltd FE ke ck kc kk ck ck ke kc Yk k kk kc k k k k k k KOK k K k k KOK OR OR KOK ck ck ck ck R ck R K Please set up following variables USERNAME GRPNAME in case of need HEX USERNAME suzuki GRPNAME kaihatul USERNAME UserName is here GRPNAME GroupName is here FE k k k Yk Yk Yk Yk Yk Yk Yk Yk Yk Yk Yk Yk k Yk Yk Yk Yk k k k k k k k k k k k k k k
14. 280000000 2000000000000 00000040 E00000000000000000000000000000 00000 0 DUUDDDDDDDDUDUDDUDDDBDDUDDDUDUDDDUDBDDDDUDUDUDUDDDUBDUD DOD0 00000000000 e19g000000000000000 00000000000000 00000 DU 88 4 00000000 000000000000000000 0000000000000 431 AHA 222222 Kk X k OK K k K KOK RR LE f Gu UU RI mi sisi C Ed ER d O ME E T KA KA Pisi 2954 mimi Am a m 5 XN pra mE 944 IE zm gil i dd 51 03 5754 8188 815 inis mE pale REL Be a Sa Sak se as a ae a Se a pi id ES ops eai Iz 12
15. 0000 O30 466 00000 90000000000 20000 10000000000000000000 000000000 s 00000000000000000000000000000000000000 O 466 000000000 pee 858 2 4 D poooz LGE EX AU RFE 5F 4 00000000 4 10000000000000000000000000000 1 0 0 ck k k k 11 EE E T El Oooo Oooo O 100000000000000000000000 ea c 5 Ooo Ooo
16. 20000000000000000000050000000000000000 gt 4 000000000000000000000000 169 6 00000000 000000001 Vversion2 0p 0000000000000000 od0d0 00000500000 000000 00000000000 Dodd 00000 0 0 0000 000000 0000000000000 Dodd 00000 000000 000000000 ws 06 000 06 00 A L1 000000000000 SFdatacpQ 1 O Windows Scheduler Server 06 000 Scheduler Server 06 00 00000 gt data 0000000000 00000000000000 0 11 O 25 HO 25 HO E EI 12 5 5 Oooo oO 00000000008SFdateepod0 0000000000000 gogo Ooo 170 6 4 6 00000000 GW 1 1 5 GW po000000000000000 Ter1ego0 0000000000000 Version1 0 GroupAppomouse Version2 0 000000000000000
17. L3 Oooo O O O O O O O o 5 9 5 5 O O Pu Pu O Du 1 O Pu o Cl EJ E EJ 1 1 1 L3 L3 L3 L3 L3 L3 C3 0 0 0 0 0 0 Ooo ooo 00000000 020000000000
18. poo00000000mox0000000000000000000000000 127 4 00000000 L3 o O O O o 00000 5 El L3 OO OO OO L3 O O o O 5 0 1 000 000 000 Oooo O El 5 9 o o GA Oooo ooo Oooo ooo UUDUDDDUDDDDDUDDUDDDDBDUDDUDUDUDUDBDBDDDUDUUL poda 000000000000 O OOO Oooo ooo E E uli 46 40 44 OOOO Oooo HO Dodd 0000 00 0000 000000 0000000000000 pad 00000080 10 7200000 0000000000000 018000000000 00000000000 Groupmax World Wide Web Desktop for Scheduler Version 6 06 020 000000000000 0 50000 01005502500 OOOO OO roo Oooo G G G L3 DT ES 41 SES E HH PE E Ed et ZT Ee 00 00 UUDDUDDDDDDBDDDUUDDDBDBDDDUDUDUDUDDDBDDU
19. 500 ress Server D 00 QQ Scheduler Server B d HH 1111 HU D 0000000 Address Server Scheduler Server 4000000000 1200000 00000000 hosts O 0 O 1 0 5 O 0 2 00 ooo 0 0 0 Q ar I 0 1 Eb ooo 0 O O 0 0 0 G O O 0 660 050 00500 FFG 3 00 T 3 3 RH 5 9 O EL 3 Q o O O Oo q d 9o Es gt lt EX EJ LIE 5 O podd0 000000000000 00000000000000000000 0 00 00 0089 090 09 000900 8 e D000000000000000000000000AppoManidx 00000 0000
20. D 0 00 00 UD 0 00 DO 00 DO 11 00 a El o E ET os O z 5 9 O O E O Heg L3 L3 L3 L3 E 3 DT L3 L3 L3 OO L3 L3 L3 J L3 L3 L3 OO L3 L3 L3 go L3 L3 L3 L3 L3 L3 L3 L3 OO L3 L3 L3 L3 L3 L3 OO L3 L3 L3 EE E E E L3 L3 L3 L3 L3 L3 L3 L3 L3 E Ed SE 523 z 4 2 2 5 3 O 2 J OC ET 5 3 2 52 220 o o 5
21. log agent ScheExec 1og J 1 00 00000 AssistOOOOOOOOOOOOO usr GroupAppo bin SFagent 5 logfile name 00 D 100 flogfile name 0 00000000000 logfile name YODO 000000 0000000000000000000 podd0 0000000 000000000000000000 0000 SFagent logQ 0000000000000000 00 SFagentlogQ 00000 0 000 1 0000 e 000000000000000 Address Server D O Scheduler 0 OOO SFagentOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 0000000 log agent ScheExec loglOOUOOOOOOOOOOOOOO pod000000000000000000000 log agent SFagent log 00000 10 Assist D I I D D L Assisti 00000000000000 4ssisp00000000000000000 00000 100 2000000000000000000 00000 1 000000 Assis 00 00000000000000000000 1 po000000000000000000 16 Assistp000000000000 153 5 Groupmax Address Assist 0 00000 2 000000 Address Server 0000000 0000002 Address Server JO O0 0000000000000000 00 00 Assist D D D pog0000000000 000000000 1 usr GroupAappo bin sFagent inilQOOOOOOO
22. pH 9 OODODOODOODOOO O O A OOOO 0 0 o 00 0 0000000000 po0000000000000 30 210090 20000000000 2000pp000000000000000000000000000000 001000 2000000000 10000 2000 pogo 000000 000000000000 000 30000000 podd0 000000 000000000000000 poda 000000000000 00000000000000000 poddg0 000000 0000000000 0000000000000 pooxpoo0000000000000000000000 oa o000000000000000000000000000000 0 podd0 000000 00000000000000 4 00000000 0 4 21 000000000000 HEDRE IIIa sss 422000000000000 00000000000000
23. 0000000 Scheduler 0000000 IE E El odo00000000000 os 0000000 0 0 0000000000000000 0 indxsget0 00000000000 s0000 usr GroupAppo bin indxget 1 gt 0000000 D F 000000000 D sih 00000000000000000000000000000 7 0000000 OOOOOOOOOOOOOOOOOOOTO ApposvinilOOOOOOOOOOOOO indxget PARTIAL SORT ON AppoSVini 1110000000000 0000 0000000800000000 0o usr GroupAppo bin AppoSV ini Address Server QOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 0000 OFF00000000000000000 inmdexget 00000000000 0000 060 00 0000 00 OOOO L3 OU DU DU 000000 po00000000
24. 5 9 68880000000000000 90800 8 D 0 550 00 UD 00000000000011 TCPAPO0O 00 roomman 0 000000000000 D000000000000000000 0 5 0 6 00000000 0 hostsnOOOO 0000000000000 1000000000 001 1 TCPAPO0 0 7 9000000000000 0000000000000000000 00000000000000000000000 8 00000000000000000000000 9 0000000000000 0000000000 xxx 00000000 10 xx 0000000 11 1 ol Soloo oo oo oo oo oo oo Un p3rc r3rc3 OOO Oo D D 12 346 A 5 51 jonj noo SALLOC 00 ALLOC early 00 0 0 0000 PSALLOC early 0 000000000 00 TI 1 DD 0 3 00000 QO O aconsole QQ roomconsole 000000000 00 D 8 YOO 4 a g o B e 5 Co td
25. D LL Environment OrgEnv ON 1 OOO 00000000000 00000 81 4 00000000 1 11 0 000000000000000000000000000 00000 0 DO O Scheduler Server Version 6 06 500 0 00000000000000000 1 O20 10000000 00000000 000000000000000000000 00000000 9000000000000 00000000000000 poao000000000000000000000000000000000 O 4 24 p000000000000000000 Cage Ee HOT EDN 77 Nis hop pu MSDS FALLS OO 2 425 El o O DODO 000000000 000000000000000 sg00000000000000000000 podd0 0000000 000000000000 10000000 00000000000 O O Oooo 5 L3 L3 Oooo Oooo Oooo
26. 000 0 0000 0 0000000000 2 Scheduler Chen 0000000000000 0 000000000000000 117 4 00000000 118 T 8 DU 0000000000000 Scheduler 00000000000 00000 OOOO ooo Oooo E O O 9 El o Groupmax Mail MS Mad 00000000000 po000 p200000002000000000000000000000 022000000 000000
27. 1D00000000000 mpos4000000000000 1D0000000000 200000 00000100 0 0 4 15 0 DIRA IDO 71 4 00000000 1D00 4000000000000 prod 0000 0000000000 1000000000 ID0000 10000 0 4000000000 00 4po00 28000000000000000000000000 Wood ID g0000000000000000 10000000 PD000000 000 5 Pp00000000000000000000 16000 6 P000000000 WOO 000 mpo0000000000000000 po0000000000000 D0000 Mm oxpo000 0000000000000 00000000000 DUIDJUDDDDDDUDDDDUDUDDUDDIDIDDDDDDUDUDIDIDDDDDUD DU Oooo ooo oO ooo O 0 0000 4 16 0 SAND Siw E 7o 004 AND evesta Fey BIO ID
28. pod0000000000000000 log agent D rg t 21 0000000000000000 etc m te21 00000000 mp01p000000000 0 0000000000000 000000 300000000000000000000 100 D 1 000 O aa lt oOo D D D 0 00000000 D tz p000000 D D D D ooo Oooo Ooo Ooo Dl MVresult tb Assist 70 0 0 SFdatacp 0010000000000 00000000 D 2 6 b 1000000000000 D UUDDDDUDDDBDUDUDUDUDDDBDBDDUDDUDDDUDDDDDUDUUDUDUDDBDBDUD 9 0 D D UUDUDDDDDDBDDUDUDUDDDBDBDUDDUDUDDDDDDDDD 1es asent 000 Ip Mvresuit tb 00000000
29. 0030 2 147 483 64707 00000000000 OOOOOOOO gentExclusive_RetryInterval 300 0 0000000000 30000 38009 2 147 483 6470 00000000000000000000 D Oo 155 5 Groupmax Address Assist OO 000 00000000 SFdatacpl L oA O L3 L3 L3 L3 L3 L3 L3 EJ E E ESI E T san E23 E EJ L3 LJ E PO OOO 900400 0 0 4 1 SHO a Scheduler Server Version 6 Facilities Manager Version 6 nager Version 60 0O 00000000 00000000000 SVO RMSV Opa god 0000000000000 000000000000 AppoManl RoomMan 000 RoomMan 0000000000 OO AppoMan 0 F im 1 0 E ES rrr 55 gt e E
30. 0o O O O Scheduler Server Facilities Manager 0 0 0 000 Server 00000 e Groupmax Scheduler Server 1 0000000000000000 log Locsv log e Groupmax Facilities Manager OO H1 D LH 0000000000000000 los LOGRMSV 1og 0009000 9 0 usr ikipD 00 000000 446000000 450 00 00 0000000 0000000 120000000 0000 00 YYYY MM DD 1 DU D D QD 100000 D HH MM sSp 00080000 ID 00000000 Imp 100000 ID P00000000100000 0000 0 81110 K2000000 317 OO kK DD K 1 Scheduler Server Facilities Manager HO 0000 1 r 000 re a
31. 0 O O O Groupmax Scheduler Client Version 6 06 80 PP00080 00000 0000000000000 Dodd 00000 0 00000 0 00000 000000000000 0000 Groupmax Scheduler Client Version 6 06 500 000000000000 GOD 00 000000000000 pod0d 080000 00 0000 000000 000000 000000000 000000 000 pod0d 080000 00 0000 000000 000000 000000000 pod0d 00000 000000 0 00000 0000000000000 Groupmax Scheduler Client Version 6 06 500 0900000000000 DODO 000000000000 Groupmax Scheduler Client Version 6 06 500 000000000000 AHOO0000000 Dodd 00000 0 0 0000 0 00000 0000000000000 Groupmax Scheduler Client Version 6 06 500 900000000000 1 00000 E L3 L3 Oooo Oooo Oooo El Ed EJE Oooo Oooo EIE ESI E Oooo Oooo Oooo Oooo Oooo
32. DON 00000 ID OO 00000 00 00 45102 I The cache memory function is disabled 000000000000 45103 W A setting for the pnugaggagagaaggagagagduadaull cache memory functionis 1 00 00000000000000 0 UD invalid The 000000 cache memory function AppoSVini 00000000 will now be enabled nnnnnnmnn 45104 W An error occurred during memory initialization anonn The cache memory 0nnnnnnnnnnnnnnn 0000 function will be disabled Aaaa until initialization 2 nnnmnmnmnnn succeeds XXXX 9nnnnnnnnnnnnnnn 1111111111 111 111111 1 1 IDINDX idx KENNIN log 000000 2000000000000 3 usr GroupAppo bin 0 O00 0000000 AppoSV ini RetryInterval 000000 DAda pag gd gon gd 0000000000 Dada np ag gd gon gd 0000000000 11 4510711111 1 1 1 OO 1 48105 W An error occurred during 0000000000000000 updating 01 memory The 1000
33. e 08300 MO00000000000 000000000000 e0400 0 0 OO AB0g0 800000000 000000000000 0000000000 e 0500 logname 000000000000 00 0 000000 0 00 O logname 000000000000000 logname Er ET i 40 2 0 200 7 0000000 O30 0000000 000000 e 100000 04000 am E 606000050 ie mm Ki oes Iu EJ EJ a EJ EJ EJ p C 4 Oooo n files descripto
34. 0 O poo uda 0 aconsolel OO 0 0 11 O0 HOSTCHG ta SA pm ERE 12 Po 000020 Y Ono OO O Oooo ES ES 6 16 E E EIE UUSVU 00 00000000 roomconsole OO RMSVO 0 O 060 2000000000 Scheduler Server 0 00000000000000 100000000000000 DU 1 p008000000000000000000000000U0 Scheduler Client 358 O P Scheduler Server 1 Scheduler Client 00090 3 0 00 00 00 0000000000000 1 0000000006 aconsolef OO ud svp 0000000 AppoMan OO roomconsolef OO O RMSVI 0 D 0000000 RoomMan D Windows 11 gt G LEGE O EX E EJ LT Ene E DO Groupmax Scheduler Server Groupmax Scheduler Server Tool Groupmax Facilities Manager Groupmax Facilities Manager Tool a3
35. paa 000000 0000000000000 1 00 00000 3 00000000000 4 HL D D D B 0000000 5 00000000000 e HD OLD B 000000000 7 0 11 400 00000000000 12 000000000000 13 Assist 0 0 00 10 0 0 5 0 OHOOO0000 11 papa gg o 000 0000000000000 345 QO O aconsole reomconsole H E D 00 DD 12 O xxx 13 11 1111 1 0 1 50 1 14 0000 PSALLOC OOOO PSALLOC eavdyt 000000000 3000000 000000 0000 PSALLOC early 0 0000 00 0 2 d 1 gt gt DD 0000 r YOU HO HO L3 11 1
36. 6000000 0 000000000000 oe ae 0 O 0 T EEG CE D D D D 0 El 401044 E Oooo Lr 10 1 D00000000000 13 JUDDLEU ULL 1 331 0000000000100000000 01 1 38 n FY DAT 5547 Scheduler Client 1 000000000 000000 11900000000 0 O O O Facilities Manager 0 O Scheduler Server 1 2 0 AFL 6 8 Fin 5171 ATI 5347 9347 g 20OOOOOOOOOOOOOOGWOOOOOOO Scheduler ClientOOOO O Scheduler Server D 0 0000 Facilities Manager 000000000000 1 3 2 Scheduler Facilities Manager DJ 000000000 1901001000 1 DO00000000000 U 1 3 A HERE 1888 Facilities Manager X6 LAN Groupmax OT TUF Scheduler Client Integrated Desktop Facilities Manager Client E 4 BEL F 1 7 23 0x1 00000000000031 000000000 7 1 D GetAdAum 0 D D O00 7 2 ndxget U 0 D d D B D 0 D U ED 2 Address Server Groupmax 0000000000000 0000000000 Address Server 000000000 41 D D
37. 9 UUDI 32 000000000 2 a3 32 3 0000000000 OOO0M32 go0000000000000000000000000 31 5 sb ANO CT TH 01000 poda 000000000000 0000000000 podd00000000000000000 Scheduler Server 0000000000000000 oeg TraceSVlx log Facilities Manager 0000000000000000 Aog TraceRMSVIx log 1 OO0000000000000000000000 TraceSV1 log TraceSV4 log OO 400000000 TraceRMSV1 log TraceRMSVA log 0000000 0 O Groupmax Version 707 300 000090000000000000000000 000000000000000000000000000000 0200000 0090000900900000000000 poda 000000000 00000000000000000000 podd00000000000 0000000000000000000 0000 usr GroupAppo bin AppoSV ini rod DU DU DU DU 000000 Trace Trace 000 e Size 00D 10000000000000000000000000 KB 000100 1 048 5760 0
38. 45 D TES ESTIMA ME ESS WTS E Fey PIC 1010101010 podd0 000000000000 112 4 00000000 040 1 1 1 1 Scheduler Server 0 00000000000000000000000000000 pogo 000000000000 000000000000 Scheduler Server 0 00000000000000000000000000000 9 4142 HL BO D D D 000000000000000000000000000000000 10000 9 00000000000 D1D000000000 00000000 podd0000 000000 000000000000 00000000000000 00000 2008000000000 00000000000000 O 452 000000000000000 OKO 2 O 11 31 SRSA ARO 1011 ltt A IEEE 1018352 8881000 1001 JKD ATQ 77702 52007 EE 113 4 00000000 020200000000 Dai 0000 100008080000 000000000000000000000000000 400 Oooo 20000000000000000 200000000000000000000000000000 3 0 OK00000000000000000000000000000000
39. 0000000000000000000000000 O40 2000 20000000000 2 200000000000000 Oooo oO Oo O LI OKQ 0000 0 0 O 000 0 DU 000 2000000000000000000000000000000 poda 000000000000 0000000000000000000 2 ES 4160 84 Oooo oo
40. 00v 000000 W 00000000000000000000000000 00x 00000000 00000000000000000000000000000000 Am 000000 Groupmax Address Mail Version 707 000000000 00000 8000 3 A80 Groupmax Address Mail Version 70 000000000 0000000 3000 3 A81 Groupmax Address Assist Version 60000000000 8090 8 850 Groupmax World Wide Web Desktop Version 6 000000000 8020 3 B60 Groupmax Scheduler Facilities Manager Version 700000000000 3020 3 D150 Groupmax Scheduler Version 7 0 0 00000 0 9020 3 DO 7 Groupmax Facilities Manager Version 6 7 0 00 0 0 3020 3 B35 0000 090908080808908908900000080080000008080 0000 An 0 TO BIB 7 25 F7 vyZ705IR 45 EBT A DER 5 Groupmax Address Assist 0038175 ik 65 BALO EFA 75 FOR ABD YP WE BCE UTHER 0000000000000 00 DD 200000000 00000000000 0000000000 0000 um oo on O oO U 0 00000 OO OO C S Client Server CSV Comma Separated Value DLL Dynamic Link Library DNS Domain Name System GUI Graphical User I
41. 019000000 podd0000 000000 000000000000 000000000000 podo000000000000000 491 p000000000000000 e 00000000 200 9 000000000 091 7 9264 2 F SIMEAUAREAOBS mm ES O 491 00000 Oooo 5 9 O O oO podo00000 000000000000 000000000 413000000000 000000 O 5
42. 99 0000 2000000 100000000000000000 3 pog0 0000800000000 0 0000000000000000000 podd0 000000000 00000000000000 E E Dep 0000000 DN 0000 a OOo 53 00000 111 4 00000000 a3 po00000000000000 moxp00 0000000000000 Df 2 00 3 pog080000000000000000000000 00000000000 00 pop 0000000000 1 pag 00000000000000000000000000000 2 pago 000000000000 00000000000 0000000000 podd00 00000000000 o 0000000 1 pa000 000000000 00000000000 000000000000 4510000000000000000000000000000000000 0 2 1200000000000000 200000 D 3 poxpg000008000000000000000000000 L3 L3
43. D OOOOOOOOOOOOOGO Address Server UNIXG U 0000 HOSTCHG O 0000 00000 0000 0000 000000000000 M aconsole D 353 DO P Scheduler Server OOO 0000000000 AppoMan OO 2 0 00000000000 roomconsolel OO 00000RMSV O 0000000000 RoomMan O D Scheduler Server 000000000000000000000000000000 DU Scheduler Client 0000000000000000 00 1 Scheduler Client 000090 200000 0000000000000 3 DO 20800000 000000 0000000000 2 0H00000000000000000000000000000000000 1 000000000000 mM aconsolel OO AppoMan OO 2 000000000000 M roomconsole O J D 0000000000 n RoomManl D D 00000 WindowsOO00000000000000000000000000 DO Groupmax Scheduler Server Groupmax Scheduler Server Tool Groupmax Facilities Manager Groupmax Facilities Manager Tool a3
44. 1 00000 000000 12 7 E a Scheduler Server Facilities Manager I 0000000000000000 00 Da pag do doo 00000 00000000000 1 DO eduler Server Facilities Manager Hl B HH HH B H D HH D 1D D H 0 0000000000000000000 WwW000000000000 So pogo 000000 000000000000000000000 poda 000000 000000000000000000000 podd0 000000 000000000000 000000000 0000 Oooo L3 ED F podd0000000 0000000000 OOO Oooo S 5 8 RIPE waza EE Ee EAE gir 0 0 0 O D Y cheduler o Facilities Manager 0000000000000 00000000 Scheduler Server Facilities Manager 0000000 0000 8 bin etc log room BIND ETc LOGO ROOMY 00000 IDD 00090 00000000 IDO Scheduler Server Facilities Manager 1DP00 0800000000000 0000000000000 ugpniendggdggag pod o 0000002000000 00 000 0000000020000 000000 00000000000 2922800808 0000 00 0000 0 00000 000000000000 ID Facilities Manager 0000000000000 1D00000
45. 1000000 DO 8 0000 0000 0000 C3 P00000000000000000000 4 30 FBT 7 DALE 2 po0p000000000000000000000 poodd0000000 0000000000000 Oo oann gn 53 1 4 O oann gro 63 q O gt 4 00000000 poddo0 0000000000000
46. po OO Dar 1 cD RoMOOOOOOOOOO HP UX O 0 mount dev dsk clt2d0 cdrom AIXQ 00 mount r v cdrfs dev cd0 cdrom co0000000000000000000 2 PP00000000000 3 0000000000 HP UX I 0 cdrom HPUX SETUP cdrom AIX 00 cdrom aix setup cdrom O 0000000000 cpe roMpgoo00000000000000000 D CD ROM000000000000000000000000000000000 OO PPOO U ete hitachi setup O
47. 11 4 00000000 4 16 1 1 11 9 po00000000000 1 po000000000000000000000000000000000000 DO 20000000000000004000000000000000 0000 indxget D 0 1 Q indxgt0 0000000600000 7 2 ET Ee 1 3 T 1 EE I oO E E EE EEE oO EJ L3 E 4 OO E oO oO T oO E 51 1 5 ETE Ooo usr bin Appoman J 000000000 0 RMSVI UU 000000 1 E n H Ei 5 i z e OOOO noo EEE L3
48. 44 readDiffRecO failed xxxxx Address Server 45 ReadFile xxxxx failed 46 comConvCSVtuSTRUCTO failed 47 orgConvCSVtuSTRUCTO Oo failed 48 userConvCSVtuSTRUCT Oo failed 49 SetFilePointer failed xxxxx 50 MoveFile failed xxxxx 000000000000000000000000000 000000000000 000000000000000 D0O000000000000000 51 00000000000000 0000 00 0 0 00 0000 0 0000 00 000000000 100 52 00000000000000 Address 0 0 0 00000 0 0 00 0 53 Address Server O000000000000000000 54 00000000000000 000000000000000000000000000 000000000 0000 0 0 0 0000 0 55 000000 60 0 56 000000 amp xxx 0000 330 M GetAdAII O indxget DL D uL DD HL DD 0000 0 ud O 87 00000000000000 xxxxx 58 000 DGxx3000000 D DD D 59 000 ID xxxx D 00000 60 00 ID xxxx7 00000 D UU U 61 000 ID xxxx 100000 D D U U 62 63
49. 7 Scheduler Server Facilities Manage 00000000000000090 usr bin AppoMan ini usr bin AppoMan ini bak In s usr iki log AppoMan ini usr bin AppoMan ini ln s usr iki log AppoSV ini usr GroupAppo bin AppoSV ini 8 Scheduler DOOOOOOO00000000000000000 cd umount gmaxpkgd vgchange a n dev vg03 D AIX D O podp00 0000000000000 0000000 Scheduler Server Facilities Manager Version 6 06 02 00000 pod00 00000000000 Version 606 000 000000000 Version 6 062040090008 00 0000 000000 000000 000000000000 Dodd 000000 0 00000 00000000000 393 394 0000 Server un oo 00 0000 DO Oo tO OOO OO 00 FOO FO FOO O O 000000000 1000000000000 20000 Scheduler Facilities Manager 0800000000000000000000000 0000 100000000000 00000 1 Var optihg D D 0 U D 000000 DU 3 O O O 0 ooo ET 00 DO 00 00 s EME AE EI 000000000000 Q p H HACM 0 ct 5 9 O El O O 5 O H
50. 49 0000 99 4 00 100 U 4399 DO O WON EDRR Wu iR 2238 lo ll 1 00000 UUDDDDDUDDDUDUDDDDDDDDDUDUDDDDUDBDUDDDDBDUDUDUDUDDUuNU 000900009 008 00000008000000000000 2 00000 00000 3 0000 ooo Wo ooo oo 000000000000 000010000000 0 0 270000000000 4 00000 o 4 00000000 00000 gt
51. pog000000000 00000000000000000000000 4 0000 Ub 1 2 Oo Oo Oo 1 1 TT Oo Oo 0 Oooo L3 L3 L3 r3 Oooo 00000000 1 2 nooo EX 10 3 p 450 P0000000000000 8 2 7 ri Sik T6287 ns OF Ud 0000000 2 lt 0000 Fey RIC 4 00000000 podo00000000000
52. aa Na llaahu aa aa aa p00000000000000DNspo00 00000000000 1 Address Server 0000000 Address Server D 000000 Address Server 1 11 DB D B HB D Scheduler Server Facilities Manager 0000000000 4 1 Address Sever 0 0000000000000000 0 00000000 pae000 0000000000043 0000000000000 00000 0 00000000 Bo000000000000 44 D U a DNSH 00 000000000000 45 DNSpo00 00000000000 000 0000000 pedo 0000000000046 0000000000000 00000 0 po0000000 DODO DODO 0000000000047 DODODO0 000000000000 D LL 48 49 D LL 1 2 0D00000000 10 DOU 9 1D000000000000000 11 DO 12 OOOOO0UM4180000000000000000000 UD 000000000000 00000000 M41400
53. 020 000000000 1 1111111111 030 0000000000 040 00000000 1 111111111 O 5 Groupmax Address Assist O 00 Groupmax Address Assist B HH B HH B H D O60 gado 000000000 0000000000000 O70 0000000 Address Server 8000000000000 0000000000000000000000 080 00000000000 O90 000000000 DO A E 0000 008 000000 0000000000000 00000 00 6 Windows JJ D B D D U Windows 0000 UNXpo0000000000000000000 gado do 0000000 0000000000000 00e go00000000000000 OOF p00000000000 poe gado do 0000000000000 00000000000000 00 H Assist D D SFdatacp
54. usr GroupAppo bin SFimport 3 Dasya csv usr iki 209 7 0000000 0 SFexport 7 10 SFexport Scheduler Server Facilities Manager 00000000000 9 00000000000 7 10 1 SFexport 00000000 000000000000 74000000 0 75 SFexport 0000000000 00000000 ST N efo 7 10 2 SFexport I LJ 00000008 Fexper 400000000000 e SFexport SFimport 0 O SFexport 1 D D SFexport OOOO SFimport D U D SFimport 0 OOOO SFexport 00000000000000 OO0000000000000 7 10 3 SFexport L U 0180000000 usr GroupAppo bin SFexport sfgu a OutputFileName SchePath 1ogname 02000 S
55. O o E Oooo Oooo oOo 0Ox000000000000000000000000000000000000 OO00 000000900000000000 an o0000000000000000 00 Oooo 1D000000000000000 137 138 O30 0000000000 1 9 000010000 B0000000000 1 000000000000 B000 Pg000 000000000000000 0000 469GO000000000000000000 2000 000000 8000 Doo000000000 B0000000 000 0000000 190000 B0000000000000 3apgo000000000000000000000000000000000000 00000 a g 469000000000 E aah 050 0000000000 B0000 0000000000000000 00 1 000000000000 B000 Ppg00000000000000 0000 Dp gBupnugapupnpnauammugpnuanugapnuanaudgpnadnmIpaunp UUDDDDDDDBDUDDUDUDDDDDDUDIDDD eel 00000 DD DUN 2 p0000000000000000x0000
56. 00000000 amp xxxg errno YYYY 101 GSSGetComInfo failed rc Address Server 00000000000000 d result od Address Server 0 0000000000000000000 O O Address Server 000000000000 102 GSSGetOrgInfo failed rc Address Server 00000000000000 Aa TESE TAA Address Server 0 00 0000000000000000 0 0O O Address Server 000000000000 108 GSSGetUserListO QQ ID Address Server Scheduler Server 00000000 es Address Server Scheduler Server Facilities Manager 000000000000000 104 GSSGetUserListO 0 000 Address Server Scheduler Server 040000000 0000 Cs Address Server Scheduler Server Facilities Manager 0 000000000000000 334 M GetAdAII T O indxgetd O 000000000000 D 0000 UD D GSSGetComListX faild re XXXX Address Server 0000000000 YYYY XXXX result YYYY 00000000000 Address Server 00000000 00000000 Address Server 000000000000 0 D D Address Server 000000000000 GSSGetOrgListX0 faild rc XXXX Add
57. 000segg0 00010 72000 00000000000 50000 000 000000000 1000 gt e 000000 e 100000000 000000000000 1000 00000000 000000000000 1000000000000 e 100000000 0000000001000 gt e 000000 e 100000000 0000000 SFpackage 0 0000000000000000 00 u 1 SFpakage Invalid parameters 0000 Usage SFpakage s r e SV RMSV AppoMan RoomMan 2 4000400000 Scheduler 0 Facilities Manager D UU uut 3 000000000000000 Scheduler 000000000 Facilities Manager 0000000000 4 SFpakage SV down Scheduler 00000000000000 5 SFpakage RMSV down Facilities Manager 0000000000 1111 0000 6 SFpakage AppoMan down Scheduler 0000000000000 pao 00000000 7 SFpakage RoomMan down Facilities Manager 000000000 407 00 10 JUDUDDUDUDUUNU 408 1 HP UX 00 060000000000 Scheduler Server Facilities Manager 000000 uai Dad 0000000000 k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k k KKKK Ho HIGH AVAILABILITY CLUSTER CONFIGURATION FILE KKK KK KKK kk RR For complete
58. indxget 0000 Address Server Address Server qaad Address Server Address Server Address Server D pod 00000 00 0000 0 0000000000000 0000 0000000000 O T 4 1 7 OOOOOOOO DUUGUDUDUOU D 0 Scheduler Server 000000 0 00000 000000000000 2000000000000 E ES E E Er EE EI E BEE E ES ET El r3 r3 3 E D D 00 D 185 7 0000000 186 00000 000000 000 Ooo 00 0 O 0 O 1 cz ee ETE E217 Eg Oooo a E O O 5 9 O O O 5 o 000 Oo Y Oo Oo Oo Y Oo Oo E Ed Oo Oo Y E 5 Oo Y Oo Oo Ooo Oo oOo Oo Ey El O O O 5 o 5 O L3 L3 L3 o 5
59. 221 0000000 uu Du 000 usr iki e0400 logname 0 00000000000 8 0 0000000000 00000000000 1280000000000000 0 0 SFexport log O 0 D pnapnagnnnnpaupunnnupnagagpnpnauupnapnaan O30 0000000 e 000000 1000000 O40 0000 DUUDDDDDDDBDUDUDUDDDDBDDDUDBDUDDDBDBDUDUUDUDDUDUDDDUDUDUL 000 SFexpot 0000000000 SFexport log 0d 00000000000000 0000000 SFexport log 00000000000000 0 SFexport 00000 000000000 RS SFexpt00000000000000000 7 104 SFexport OOO 222 SFexport 11000000000080 72000000000000000 00000000000 SFexpotOOOOOOOOOOOOOOOOOOOOOOOO D fu kip0000000000000000000000 tmp data csv 0 D D 0 0 0000 7 0000000 7 2 0 SRO NORE Scheduler Server SiR ORS Facilities Server gt am Hb Hb HP ak O UJ BH36 288 m TE PS ERES LL NE 28 usr GroupAppo bin SFexport a tmp d
60. Server Facilities Manager 0080000000000000 usr GroupAppo bin AppoSVini OOOoOoOSVORMSVOOOOOOOOOOOO Environment KBN ENHANCE OFF OOO uadit e Scheduler Server 4044900000000 100000000 oo0o0o0000000000000000000000001000000000 OHOO000000000000000 000000000 Scheduler Server 000000000 Version 70 00000 DO00000000000 000 482 0000000000000 podd000000000000000000000000000 4 77 4 00000000 78 0 4200000000000000000 VELIE ER KO OEE THE RIDER BADE MUR MERE 22 12 5 2000000000000000000000000000000000000000 421000000000000000000000 DO e 0000000000000 00000000000000000000000 DO aa aa
61. 42200000000000000 0 8 EPR EI HUYU N NH BN EN NH Nu NH NH E 0 N 8H I 8H III HIIIZIAI II II ert AlDDDDUDDDDUDDDDBDDDUUDDDBDDDDUDUDUDUDUDDDDUDUUDUUDUDUDUDUD 239000000000000000000000000000 UDDDDDDDDDDDDDUDDDBDDDDUDUDUUDUDUDDDUDDU pad do 0000000000000 00000000000 100000000 pod00000000000 4 00000000 0 423 00000000000000000 BADE HU RD ERE i m 9 m m m Y T TII u 483 0482 DO 0 Duunuuanugnnugapnunnuapnupnpn uapBapnpDa 0100000 p00000000000000000000 usr croupappo bin Apposv ini
62. O 0000 0000000000 3126 GetAdAlNT indxget 0 D H 8 D 7 1 GetAdATD D J 000000000000000 7 2 D UID Den 1 Address Server 0000000 2 000 3 000 ID 0 O 47 4 00000000 Oba o00000000 podd0000000 0000000000000 1 0000 2 000 ID 1 000 ID OOOOOOOOOO O O 000000000900 Scheduler Server Facilities Manager 000000 1 0000 000000 0000000000 pod090000 00000000 1es eee 00000000000 oo Scheduler 000000000 Integrated Desktop D Groupmax WWW JI 0 Groupmax DODO 0000000000 000000000000 000000000000 L3 L3 uud Scheduler Integrated Desktop Groupmax WWW mo 000 1D00 sig 2 ooo NOSORT OOO000 POSITION
63. m TO Assist U DO 000000000000 000 a ew o0000000000000000 K po0d000000000000 L 1 0 0 0090 0 0 GetAdAII indxgett D JJ 1111 1 D D M N O aconsole O roomconsole P Scheduler Server 0 Q 0000000000000 TI ET tak h EST SE aj EH SERE EP EE GA Tm TT 421 R J SFimport QQ 000000000000 ET at am Lax Tip nani em em i zx JO o T SER ESSE ET HH SESS ead Ed ps p000000000000000000000 285 DT 0000 P000000000000 000000 OW 00000000000000 O DX 286 HL A H B 000 0808 0182000000000 Scheduler Server Facilities Manage 111 00000000 0 0 1 Scheduler Server 1 11 111 0 0 0 1101 10 0 groupmax SystemManager GMSCHDT IN System Agent TCP IP 1 LJ B ppinfo F 0000 asr GroupAppo bin GMSCHCF System Agent TCP IP
64. 0 Scheduler_FacilitiesQ 08000000 0 0 OSU 000000000000 SFimport 00 0000000000000000 9 1 0000 9 00000000 000 00000 12 345 D D D 12 345 UUDUDDDDDDDDUDUDUDDDBDBDDDUDUDDDUDD 100000000 200 DDD 00000 AB e D 0 0 0 0 AB e D 0000000 type ash 00000000000 7 9 3 SFimport 0 O SFimport 00 00000000000000000000000000000000 0000000 SFimport 00000000000 00000000000000 SFimpot Q 00 000000000000 000000 00000000000 000 O O O Scheduler Server Facilities Manager 1 p00000000 212 7 0000000 2 00000000000000 3 00000000 4 SFimport 9 5 0000000 6 7 00000 0182000000000 SFimprtp 0000000000000 0000000000 000000 Scheduler Server Facilities Manage popa 0d gd 0 og 00000 000000000000 0000000000007 9 2 SFimport J O
65. 000000 O O O 2 00000000000046 DU 4180 04A0000000000 419000000 D 418 ADDODDUU ATID CRE GB 35 Aff ny m mM BJ 4 4 D Ez EBL CIE BIRD 38 sss IEE ES 74 4 00000000 D 419 Pien Ah FER kikakuhost Ba 32 88 kaihahost 95172 95172 AFH 35 73 108 180 Aqg00008000 000000 000000000000000000 000000000000 0 0 LI BOAO w 00000000000000 0 WWW forSchedulr 0 D uu D D D U 000 200000000000 0 000900009000900000000000000000 00 48 0 podd0000 000000000000 02000000
66. 000000000000000 00000 e usr GroupAppo bin AppoSV ini 1 1 1 1 e usr GroupAppo bin SFagent ini 00 Windwwpp00000000000000000000000000 E O O Yetc Ylog Yroom Facilities Manager 000000000 Ybin AppoSV ini 1 0 0 YbinYSFagent inilDDO00O0DO O O O O O O O O 51 5 1 a Ea 0 D L3 L3 L3 L3 EE E 2521 CEST 9E DC EST LESE podd0000000 0000000000000 us2 ixi000 0000 pod 00000000000 00000000000 0001 00 podo0 000000000 00000000 Windows 000000000000 000000000000000000 O1000000000000000000000000 000000000000000000 Scheduler Server Facilities Manager 0000 Address Server 0200000090 11 0 0 0 OOO0000000000000000 OHO0000000000000000 usr GroupAppo bin AppoSV ini usr GroupAppo bin SFagent ini 0000 0000 o O 0 O 00 UD 00 PT E 8 0 Oo Oo EE 0 0 O o O EJ O O
67. 200000000000 AppoSV ini OrgGroupomitMarkQOOOOOOOOOOOOOOOOOOOOOO lt 0x0D gt lt 0x0A gt Y Windows 00000000000 Windowst 00000000 ENxpo0 0000000000000 000000000000000000 020000 ORGGROUPt 0000000000000 0 0 ET EE 1 a 229 7 0000000 7 8 ORGGROUPEtbI J u 1 egyou2ka asya 4 0x0D7 0x0A asyaQ DODDO0000000000Dasya0 00000 1 dO esos gt 0000000000 280000000 eyou3ka asya lt Ox0D gt lt 0x0A gt asyad 2 00000000000000 400000000000 eyoutka asya lt 0x0D gt lt 0x0A gt asyad 0000 3838000000000 00000000 3 sekkeilka bsya lt 0x0D gt lt 0x0A gt bsya 00 0000000000000000000000 4 bsyaQ 000 OutOrgGroupSecurity J sekkeizka bsya 2 lt 0x0D gt lt 0x0 bsya 00 00 2000000000000 2000000 5 A gt 4000244000000 000000000000 878 OO O O OutOrgGroupSecurity 000000 kanri csya 4 lt 0x0D gt lt 0x0A gt csyalOOOOOOOOOOOOOOOOOOOOOO 40 6 kanri 000000000 POD0 0000000000 Dado 000000 00000000 lt 0x0D
68. 20 1 000000000000 440000 AssistO 00 0000000000000 0000000000000 0000000000000 DNSpo0000000000 Assist ODO DO Do 0000000000 44 SA EEK Assist 815160653 BAST AR LY 19 BOE S TEAL do GARRAL TC DISTA HY AT LOGAN X do LF 1 BI 8 OCTAL do 5 47 kaihahost kikakuhost ENE 888077 0o0000DNsgo 000000 000000000000 DpNSDDU add 000000000 000000000000 000000 0000 pco000000000000000000000 moxpo000000000000000000000000DNS Ooo Ooo 1 2 1 e E OOO 1 Oooo 56 0000 000000 4 00000000 57 4 00000000 46 ID D DU UL LU 461 58 Pg0000000000000000000000000000 s00000000010000000 9 00000 po00000000000000
69. O45800000000M00000000000 Den 0000 1 00000000 UUDDDDUDDDDUDUDDBDDDBDBDUDUDUDDDBDBDDDDUDUUDUDUDDBDBDUD 2 0000000 1g000000000000000000000000000000000000 gop00 000000 00000000000000 000000000000 000000000000 00000000 Wave OOO 060 2000000000000 odo 0000000000000000000000000000000000 000000 Oa 4590 123 4 000 00000 459 0000000000000 0 000000000000 5 1 2 000000 uwaga aaa uu O7O 000000 000000000000 Da 46000000 0000000000000 124 4 00000000 04600 000000M00000000000 ISE AAA 52 e777 iih EOE 73 35 ITA TADO RT 72 Y C vdd sor ccEDMeTdCETRS M YN Send M 21 97 33 5 554822 M ody URLS wa Ibh DO Nah 43003 4I MER lam Ej t P 2 122 22 8
70. Windows O1000000000000000000000000 357 DO P Scheduler Server OOO 4 Address Sever p0000000000000000000000000000 Address Server IO I Address Server var opt GroupMail Groupmax GroupApp item def 0 r rrr Lr po000000000000000000000000000 Address Server 0 0000000006 aconsolel DO AppoMan OO roomconsolef 000000 RoomMan OO 9 Windows 11 D D Windows Y 00000000000000 0 00000 0000000 0000000 01000000 0 0 10 UNIX Windows 000000000
71. 0000 200000000000000000 lt gt 000000 000 oen O 0 0 00000 010 0000000000030 eL TI D 10110 10 0 D D U U CD STOOOU00000000000 DO ID D0000000 100000000 podd0 000000000 00000000000000000000 gogo 00000000 800000000900000000 codo OO 00 000000000000 00000000000090 19 IDO 00 abe12345 Abe12345 000000000000 000 000040 00000000000 pog00000000000 000000 O 0 0 0 0 OOoOoOoOoOooO o oo 0 0 0 0 0 O 0 3 Fa Oooo 207 7 000000 Ei 12 00000 2350000000000000000 EMaiQOOOOOOOOOOOOP O 1000000000 0000 ilia aaa aaa aa aa aa aaa aa 0000 00 Ri 00000000000000000000 DU DE LL 3 ood 13 O Ez ESO ESI ERE El 14 Fimport I 000000000000000000000000000000 000
72. 0000000000000000 0000 0 e usr GroupAppo bin AppoSV ini 1 1 1 U e usr GroupAppo bin SFagent inil 1 1 1 1 11111 1 Windows 0 OOOO0000 e 00000000000000 00000000000000 Ylog e 00000000000000 room Facilities Manager 000000000 e 00000000000000 binyapposv inif 0000000 00000000000000 YbinYsFagent imip 0000000 poo 0x vs ixi0 000000 upnpnuugapaggggsgamnaggnunppudgunpauru 1 4 Q0000000000000000000 Scheduler Server Facilities Manager 5 359 DO P Scheduler Server OOO 360 6 Address 59 00000000000000000000000000000 Address Server 1111101000000000008 090000 9 I 000000000000 Address Server
73. OOO000 20000000000000 O 0010000 1 SchedulerQ HO DODO DO DO DO DO DDD 000000 mkdir gmaxpkgd 2 Scheduler 00 090000000000 000000000 387 vgchange a e dev vg03 000000 8 09 090909090 8 SchedulerQOQOOOUOO00000000000000000 mount dev vg03 lvoll gmaxpkgd 4 RN gmaxpkgd iki 5 DODO DO DO OD ODO 0000 000000000000 ln s gmaxpkgd iki usr iki 6 Scheduler Server 000000009090 etc hitachi setup i dev rmt 0m 0 0 0 0 0 00 0 000 7 Facilities Manager B B 1 Facilities Manager etc hitachi setup i dev rmt 0m 8 Scheduler Server Facilities Manager l 00000000000000090 cp usr bin AppoMan ini usr iki log AppoMan ini mv usr bin AppoMan ini usr bin AppoMan ini bak ln s usr iki log AppoMan ini usr bin AppoMan ini 9 Scheduler Server Facilities Manager O0 000000000000 vi usr iki log AppoSV ini goa000 0000000000000 00000000 00000000000 0000000 Data HAHostName gmaxhost WriteTh
74. 1 Address Server 000000000000 2 1 Address Server DO 0000000000 0000000000 00000000000000000 Groupmax Address Mail Version 7 1 000 3 Address Server 1101000 0 0 0 Address Servr0 000000000000000 1008800000 000000 000000 0000000000 45 4 00000000 indxget OOO OW 7 2 0 0 Da B D D B D poo0o0000001 g00000000000000000000000 000000000000 000000 DODO 0000 0000000000 uasr bin AppoMan usr in RoomMan 0000000000000 D LL hedulerpg0008000000000000000000000000000 O PN ENEE EE yoo E oO oO c3 oO o oO El ma oO c3 oO El oO c3 oO c3 ma oO c3 e O O o o oO O Oooo ur Oo Y Oo
75. ooo 2 0000000000 0130000000000000 ID 6304 0000000000000 E a L3 E EET ET Fe 58 0 O 0 0000 000000 po0000000000000 paraminil 00000000 param ini O UUUDUDDDDUDDDDDD etc param ini 0 O 0 0 0 0 0 usr GroupAppo bin param0 ini 0000000000000 000000000 usr GroupAppo bin param1 ini usr GroupAppo bin param2 ini 9 247 8 00000000000 0 1400000000000 00000000 00000000000 DODO OO OO 000000000 00000000000 ua aa aaa aa Hl O01 0001 0000 0 DO 2 pod
76. 0 0180000000 usr GroupAppo bin indxget g 8 83 si n o 020 00 e 00000 901 01 0 GMAXSYSI D gU Address Server GMAXSYST 0000 Scheduler Server Facilities Manager DD D 0 GetAdAli 00000 g 80000000 00000000000 gd 004000000000 0 e 000000 1 D D U U U OO s00000000000000 Address ServerQ 000000000000 0 Address Server O0 00000000000000 415 00000000000 sido Address Server 4440000000000 Address Server O00 000000000000000 415 D OO Si000000000000000000 Address Server Address Server p D 1 U 000000000415 OOOOOOOOOOOOOOOOOOOOO e 00000000 Address 00000000000000 DODO 000000000000 000000000000 e 00000000
77. 128p00000000000000000 1280000000000000000 0 0 86 0 5 1 110001000000900000090 O30 000000 usr GroupAppo bin SCHogimp exe 040000000 e 000000 1000000000000 00000 227 7 0000000 e 2000000000000 e 30000000 20000000000000000000000000000g SCHogimp log OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO D 8 000000 001 2000013 200000001 00000001 0000000000000 1008000000000 9000000000000000 10 00000 pod 000000000 000000000000 00000000000000 0 p 10000 000000000000 SChHogimp log 400000000000 00000000 SCHogimp log gt SCHogimp bk1 gt SCHogimp bk2 gt SCHogimp bkX xpood000000000000000000000000000000000 SCHogimp bkOQ 0 000000X000000000000 usr GroupAppof bin J 00000 SCHogimp ii 000000000000 00000000000000 SCHogimp mi 08 FileCnt 6 OOO log O O FileCnt 10 000000000000000000000000 6000
78. O O O O 106 4 00000000 aaa 2000000000000000000 445000 podd0000000000000 000 Ox0000000000000 00 OKD UD DO D L3 L3 L3 r3 L3 LJ L3 L3 r3 L3 L3 L3 r3 L3 L3 L3 r3 Oooo D D D 00 O L3 L3 L3 Oooo L3 L3 Oooo r3 L3 L3 Oooo 0 0 0 0 0000 L3 L3 L3 0 0 0
79. 00000 ID 60301 00 0000000 Error in the socket function DON 60302 Scheduler Server Tool Facilities Manager Tool has been started to process N3 1 1 aconsole roomconsole 00000 ID 33705 OO I 0000000 The modified information notification process has been started 33706 Because servers are currently performing other processes The modified information could not be notified Se ey noo See noo EEE noo EE mm EJ EL 0 1 33707 Fail to perform the modified information notification process 33708 The modified information notification process has succeeded 33709 Failto perform the modified information notification process 33710 Failto perform the modified information notification process 44701 Control data retrieval process has been started 44702 Control data have been successfully retrieved UIIDDDUDUDUDDUDUDDUUDUDDUUDDUUDU 44703 Because servers are currently performing
80. OOW DUDDU ID 00000 00 XXXX00000000YYYYoo000 000 KSFg00008 E 8 1001000000 1 222 1111110101 0200000000 func YYYY 000 errno ZZZZ AppoMan ni 000000000000 XXXXQ AppoSVinif 0000000 KSFg01000 W AppoSVini 9 Ut 000000000 AppoSV ini 00000 KSFg01001 W AppoSVini XXXX XXXX AppoSViniD 0000000 10 YYYYO xxxxOOOOOOOOOOOO YYYY 00 ood 000000 AppoSV ini 0 XXXX 1 0000000 1 1 1 1 1111 423 OO x DDUDDUDD UO X 01000 pogo 000000000 0000000000000 lt 000000000000000 00 gt log sFTLog_xxx log D xxx D 0 O DliLogPileNua9000000000000000000000000 000000000000 400000000 SFTLoeg 001 log SFTLog 004 log 000000 0200000 podd000000000000000000000 00000 lt pp00000000000000 gt bin sr32sys ini e 000000 log e DliLogLevel Y 000080 00 1680 0000000000 000000 0000000000 pd 000000000000 000000 0000000000 D LogLev
81. 000000 Security OrgGroupSecurity 0 ONgHo 000000 000000000000000 1 00100 0 00000900000900900000 OutOrgGroupSecurity 0 O opp 40000000000 epa 80000 000000 000000000000 00000000 202808900008 000000 000000 000000000000 0000 ooo 34080800008 0800000 000000000000 00000000 490090000 000000 000000 0 0000000000000 DODO 0000 0000000000 400000000 GroupOmitMark 000 HOO 10 020 0 0 0000M 000000 e0 0 0 0 0 00000 00000000000 0 3 000 AppoSVini 000000 0000000000000000000000000 O O O O 08 r 3 E E Security 0 0 0 0 OrgGroupSecurity 0N 0 O OutOrgGroupSecurity 2 0 0 O OrgGroupOmitMark 000 279 9 OOO000000 0000000000000000000000000 20 ORGGROUP tbI OOO ORGGROUP bII 0000000SCHomp 0000000000000 SCHogimp 000000000000 7 11 0 SCHogimp 00000000000 0000 030 ORGGROFF tbI O ORGGROFF b10000000000SCHoimp 0000000000000 SCHogimp 0000000000000 7 11 0000
82. poddg0 0000000000 00000 podd00000000000000000 o O O L3 O 1 OO L3 3 OO OO L3 3 L3 OO OO OO Oo EJ 1 L3 ad E 5 o o O L3 93 4 00000000 O43500000000000000000 BASES kaihatuid 71 4 C SARE ALA FET Fee DUUDUDDDDUDDDBDDUDUDUDDDDBDDUDUDUDDDUDBDDDDUDUDUDUDDDBDUD D BD t DUUDDDUDDDDUDUDUDBDDDDBDDUDUDUDDDDBDDDDUDUDUDUDDBDBDUD 000000000 odo 000000000 000000000 000000000000 pod 000000000 000000000000 000000000000 4 po00000000000 pog0000000000000000mM0xp0000000000000000 O30 0000 1 0101000900 pad UUDUDDDU
83. 344 44910 Fail to perform the user information creation process QO O aconsole roomconsole H E UU D O O aconsole O roomconsole 1 1 1 aconsole roomconsole YODO DO 1 OD O 00000 00000000000 00000 Jp00000000000 U o1 00000 DU 00 1 lt lt 00000000 gt gt 0000 2 00000 7 Y or ND 0000 5 6 000000000000 services 0 O I xxx 0 O O 8000000000011 TCPHPI 000 roomman 0 O xxx Bm o n et E EJ 7 hhh p D BL D T xxl 0 0000 0 000 2 Q E d 8 9
84. 12000000 0 opa g000 00000000 g 0000 0 00000 0 0000000000000 4 5 PABa DO da ag 0000 000000000000 0000000000000 podd0 0000000 383 4 Scheduler Server Facilities Manager Address Server Address Server 8000000000 000000000000 Address Server H HH D H B B D 0 Groupmax Address Mail Version 70 000000000 BOBO 0 DO DD 00 00000000000 00000000 Scheduler Server Facilities Manager UID 0000000000000 000 00000 00 00008000000000000000 00 00 0 0 Os
85. 9 9 9 000000000 20000000000000000000000 1 DU D D 1 01010090008000800800090 0800000 9000000900 pogo 00000000000 00000000000000000000 3000000 U93 O00000 lt ayug49 b Eo TRE 50015 PHT A fal EEF 000000 94000000 273 D 0000000 U94 U24512 iC TRE 2452 PHT S S 9 22 JUD U 9 00000 Scheduler Server Version 60 000000000000 9 2 3 I I LI 274 UUDDDDDDDDUDUDU
86. OOOO 0000000000000000000 Scheduler Server Facilities ManagerOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 0180000000 1 00000000000000080000000000000000000 aw ddress Server JU Address 0 L D D U 0 0 ull 1 D 00000000000 Address Server D D 0 000000000045 oo 0 0 O O D u 0 5 6W0 0000000000000 00000462 00000 m0000 0 0 O 0 00 D D u I 0000 ETEILCILCITiT 3 0 0 0 7 O HOSTCH 0 0000000000000 0200000000000 HOSTCHGOOOOOOO0O00000000000000000000000000 WWW for Scheduler 00000000 Scheduler Client Y 00000 000000 2 00000 0000000 0000 00 000000 BosrcsGOOOOOOOOOOOOOOOO
87. OF o OF m D D 00 Eir esa E OF 2 000000000000000000000000 0 1 DUUUunuunuuiliaconsolel OO AppoMan OO UL roomconsole DO 0000000 RoomManl OO O P Scheduler Server 6 0000000000 Version7 800000000000 7 Versin7TOOOOOOOOOOOOOOOOO 8 poeg008000000000000000000000000000000000 gt Address 0000000000000000 9 var opt GroupMail Groupmax GroupApp item def 10 Address Server 0 O0 LO 000000000000000000000000000 1 Address Server LO OOOOOOOUU0000000000000000000 200000000000000000000 30000000000 000000000000000 var opt GroupMail Groupmax GroupApp item def 0000 po000000000000000000000000000 Address Server O El El 12 0 E aconsoled OO 0000
88. 119 4 00000000 120 6 200000 000 7T 100000000000000000000000T000 0000000 8 O30 6901 1 D D L 9 00 Dal Todo T e94p00000000000000 456000 Todo 0 4 00000000 O 4 56 11 1001000000 Aisle wm wm J k ben 0000 1 0000000 Tedwpggd00000000000000000000000000000000 poddo0 0000000000000 00000000000 MD00000
89. 9 E101 nga O Zu a a a e e e e e Soo L3 L3 Ooo LEILJ Ooo LIE Ooo L3 r3 Ooo LE Ooo L3 L3 Ooo L3 L3 Ooo EIL 3 4 aim CU O E 5 E102 Ooo 9 000000000000 HD Pe se 4 E103 nga 00000 9000 800000000000 5 8104 10 1000000000000000000000 1000 000 18900000000000 6 E105 00 0000000000000000000000 000000000 0000000000 7 E106 10 000 0000000000000000 e O 9 E gt oO t Ll L fe Ej pi o gt A e X E Ll E Co 8 E1070 E109 0 D gt gun Holo Solo E E E E ES Co LJ e 2 c a x E a E Co Ojo 5 9 E110 10 10 E200 O 11 E255 UD nwo oO oolooolpooolos solos 0 2 E mm WA y 2 5 OO 1 HH HHO OHO E 00000000000000 792 SFimport 000 00000000000 DU checkid 0000000077 DO DO 000000 checkid 0000000000000 DO R 2 SFimport SFimport 0000000 3000000 365 OO 8 D S
90. OOOOOOOOOOOOOOOO 4 U 10 Address 1 O O 000000000000 000000000 87 552 KFCG5552 1 Address Server 000000000000 2 Address Server 8 0000000000000 000000000000 OD Address Server pod000000 3 000000000000 0 10 Address 1 O O OOOGOOOOOOOMOOO 111111 01 10 58 553 KFCG5553 Address Server 39 2000 B gd on gd go 000000000000 Dodo go 000000000000 i pagada a god 000000000000 pad 0000 0000000000000 DOd og Dgo on og 0 000000000 2 DOBO DO DO DD 000000000 Address Server 1 uut OQ Scheduler O0 0000000000000 256 8 00000000000 UD Scheduler Client WWW 000000000 0000 for Scheduler 00000 40 2001 KFCG5701 Bag gg 00 000000 0000000090 0000000000 0000000000 0090 1 PCO Hosts OOO Services 0000000000000 pn000000000000 0 Scheduler Server 000000000000 Hosts 00000 2 OOOO Scheduler 00000000000 000000 Scheduler Server
91. sooo 10000000 odo 000000000000 00000000000 000000000 poda 2000000000 000000000000000 2 0000000000 B000 1Ppg00000000000000 00000 0 3 00000000000000000 00 00 0000 415200000 podo000000000000 3000000 4poxp 0000000000000 000000000000000000000 B0000000000000000 Ub 0000000000000 0000000000 10000 80000000 100000000000 00000000 60000000000 000000 0000 2 00 ID 8000000 00000000000 M0000000 10000 B000 0000000 B00000000 136 O 468 000000000 4 00000000 HERO m0002 r TRR AIBR TER ARNAR WRZ Emz ase C Bry ARAL THE TC BEES REIR ee C AEE AIEEXY A map 2 AUER OKO amena Fey RIC 3 0D00000000000000000000000 00 4152000 0 D po0000000000000 3000000 BOO 0 DU 0 B00000 Bp00000 D UB man 000000 C O20 000000000000
92. 00000000 6 Address Server JODOD000000000000000000000000 poddo0 000000000 000000000000 0000000000 pog00000000000000000 418 000000000000 50 Address Server J 0 0 O Scheduler Server OOO Address Server O0 00000000000000 D 0 D 808000000800 4819 QO000000000 0 00000008000 4619 0000000000000 0 O 0 0 0 0 L3 L3 L3 L3 C3 L3 CJ L3 L3 L3 rj 4 4 a O ESI E ES E L3 L3 L3 CJ L3 C3 C3 4 00000000 42 JUG Windows 0000000000000000000000000000000000 UUDUDDDDDDBDUDUDUDUDDDDDUDUDUDDDBDBDUDDUDUDUDUDUDDIUI 1 1 018200000000 Windows 00000080000000000000000000000000000 0000 D poego00000 0000000000000 TePr1P 000000000000 0000000011 0000000000000 1 Groupm
93. D DU DU 232 1 5 6 7 0000000 ORGGROUP tbl ORGGROFF tb 00000 WindowsQ 000000000000000 ORGGROUPtbIg D D U d U 00000 ORGGROFFtbIg OOO0000000000000 Scheduler Server 1 0 SCHogimp 0 0 0 0 ORGGROUP tbl ORGGROFF tb I D D D SCHogimpQ 0000 o00000000000000000 ORGGROUP tbI ORGGROFF tbI OO OO 0000 0 SCHogimp 00000 000000000 SCHogimp 00000 4000000000000000000 Dodo 00 0000000 000000000000 000 Groupmax Scheduler Server Tool Groupmax Facilities Manager Tool 00000 DUUDDUDDDUDDDBDDUDUDUDDDBDBDDUUDUDDDBDDDDUDUDUDUDUDDDBDUDU OSU 1 10 00000 DUUDUDDDUDDDBDDUDUDUDDDBDBDDUUDUDDDBDDDDDUUDUDUDUDUDDBDUDU 1 ORGGROUP bI ORGGROFFtb10 00000 Windows 000000000000000 ORGGROUPt 00000000 ORGGROFFtbIg 8000000000000000 Scheduler Server pog0000000000000fe000000000000000000
94. RoomMan 0000000000 D ti 8 0 BITECHGO 00 000000000000 uNIxp pd UNIX OO 000000 9 10 000 podd0 000000000000 00000000000000000000 pogo 0000000000 0000 000000000000 0000 OooogooooooooooooooooooooooooooooUNXO 0 0 305 OOF g00000000000 306 1000000000000 000000000000000000000000 po000000 12 00 000000000000 000000 HOSTCHGH 000000000000 00 020 20000000000 HOSTCHGOOOOOOO0O0000000000000000000000000 WWW for Scheduler 00000000 1 Scheduler Client 000090 200000 0000000000000 6 O30 HOSTCHGH 808 0010100000 0 grpchs 0 DU Address Server 000000 grpch 0 0000000000000 00990000 HOSTCHGODODDODO OOO 0 0090900000000 gpchs0000000000 indxget 0000000000 72 000000000000000
95. 1esD 00000000000000000 000 000000 backupfilelog 0 000 0000000000000000000000 00000 user 000000000019 801as0 00000000000 backupfile log 111 B 1 1 B B DU user 199801 nsd bk 000000 199801 nsdf 0000000000 8 0 0000000 00000000 WOO 9101001000 00 9 8 000000000 youfile dat O 00000000 backupfileloeg gd 000000000000000 user_env_youfile dat bk O0 0000000000000 000000000000 1000000000 0000000000000000vsrgo 0000000 00000000 0 youfile det 0 0000 DUUDUDDDDDBDUDUDUDUDDDBDBDUDDUUDDDUDDDDUDUDUDUDUDDDUDD og 00000000 0000000000000000000 1000000000000 0000 L 0 O 0 0 0 DUUDDUDDUDDDBDDUDDUDDDBDBDDDUDUDUDDUDDDBDUDUUDUDUuDU O O usr GroupAppo bin Apposv ini 0 000000000000000 Sockets ReplTimeOut2 Q 000000000000000 Sockets ReplTimeOut2 60 245 246 00000000000 D ReplTimeO
96. 85 E 0000 86 E 9500000000 000000000000000000 87 E 000080000 penO 0 D 96s lerrno 96d 88 E 00000 malloc0 errno 6d 89 E 00000000 GeadDDD s errno d 20 E UDDUDDUD write 0 D pad dd 000000000000 s lerrno d 91 E 000000 remove 96s lerrno 96d 92 E 080000 reatO O pad dd 0000000000000 s lerrno d 370 OO 8 D SFimport 586 960 11101010000 a D u 0o 93 E 0000000 0 vs to po 0000000 0000000 s errno d po 0000000 0000000 94 E U D seek seekO s errno d 95 E 000000 renamed O O s to
97. AddressG 000000000 4 OO O O 0 I 7 1 GetAdAll 0000 7 2 0000000000000 0 00 00 00 DO fp EXC GEH OE 0 0 41 7 Scheduler Server Facilities Manager Address Server 0000000090 Address Server 0000000000000 Address 0 0000000000000 Server g1 Address Server JO 0000000000000000 00000000000 OOOOOOOOOOO 49 00000000 2 Address Server JO 01900008000000000000000000000 podd00001000000000000000000000000 3 Address Server JODO00000000000000000000000000 4 0000000000000 00 000000000000 Address Server 5 Addreespg0 000000000000 000000000000 Scheduler Scheduer0 0000000000000000 0 Scheduler 000000000 0000000000 po00000000000000000000
98. D O 00 l 000000 000000000000 000000000000 00 41300 4 14 4 15 4160000 00000000000000 417 416 ADUDDU 4 19 000000000000000 420 421 00000000000 422 0000000000000 423 0000000000000000 424 p000000000000000000 20 24 25 27 28 30 52 54 55 56 59 59 60 61 64 66 67 68 71 71 72 73 74 75 78 79 80 81 82 vii DD OO AS OOO D3 TEJ E3 ET JOO C3 1 O 4 25 4 26 4 27 4 28 4 29 4 30 4 31 4 32 4 33 4 34 4 35 4 36 4 37 4 38 4 39 4 40 4 41 4 42 4 43 4 44 4 45 4 46 4 47 4 48 4 49 4 50 4 51 4 52 4 53 4 54 4 55 4 56 4 57 4 58 4 59 D B D 0 4 00000 1101 4 000000000000000000
99. DO b D an 00 0000 0000 0000 Scheduler_FacilitiesQ 00000000 0 0 gt 000000000 0000 SFimpert 00000000 podo010000000 00000000000000 00000830000000 0008000000000000380000000000 PUDDDUD 00000 000001400000000 0000000000 Oooo 100000 Pp0000000000 d 0000 D000 MANida 0000000000 211 7 0000000 Deo 98 0 0000 IDOOO MAINrmx OOOOOOOOOGO 9
100. Oooo Ooo E El El EST EE Oooo ooo EE E VJ L1 OO O20 200000000000 Da podd00 00000000 000000000000 000000000000 odo 0000 0000000000000 0000000000000000 odo 000000000 000000000000 000000000000 455000 000000000000000 Schedule 0000000000 4 00000000 Q 4 55 Schedule JJ ML uL DD UH D Dn 0000 1 0000000000000 DUUDDUDDDUDDDBDDUDUDUDDDDBDDUUDUDDDBDDDDUDUDUDUDUDDDBDD 0000000000000 2 3 00000 00000010 160 sp00000000000000 300000 4 DO0D0 pod 000000000 000000000000000000000000 2000000000000000 80 000 200 cspoao000000000000000000000000000000010 pod 0000 00000000000 000000000000000000 pod 000000000 000000000000 000000000000 pod 000 000000000000 0000 10000000000000 podpo0000 000000000000 0000000 1000000000 podd00 00000000000 s
101. mp0000 100000 000000 6 uid ID000000000 rid 6 000000 podd0000000 000000000000 3 oO O 1D0000000 0000000 00000 000000 6 uid 00000 000000 6 rid J J yO n Oo O OO Ooo Oo O Ooo Ooo e dd FET EIE 5 3 5 G A O AEA OO Ooo P ES OOo 4 L OO E
102. e 000000000 1000 0 0 D Address Server 0 0 O Address Server O O Address Server 0 0 DL D D 0 D H DUUDUDDDDDDUDDDUDDDDBDDDUDUDDDBDDDDUDUDDUDUDDBDBDDDUDUUL 0000 O 20 Address Server 0 000000000000 Address Server TO OOOO00000000000000000000000000 podd000000000000000000 pod 0o 200 000000000000 000000000000 000000 pod 0000000000000 00000000000000000 pogo 020000000000 0000000000000000000000 0000 Versions 000 Version 6 e Version 50 Version 50 000 000000000000000000000000000000 DUUDUDDDDDDUDUDUDUDDDDBDUDUDBDUDDDDBDUDUDUDUDUDUDDDUDUUL DU 277 9 OO
103. 0808 2500000 000000000000 4 5 DNS SFdatacp Assist 0OD000000000000000000000000000000 4 52 Assist 0 100000000000000 00 00 0 Assist 0000 00000 0000000000000 log agent Schehost tbl 000000 00000000 ooo EJ ES EJ EJ a a ogo O O Windows 000 0 00000000 0 0 000450DNp90000000000900000000 000 DU DU DU DU DU DU DU Oooo oo O O E E EST E W20000000000000 O 5 O Tr OOO da 4 OO q a E 065 0 E 160 LZ 100 12
104. 8 00000000000 000000 000000000 uuu 268 1 1 L WWW for Scheduler uuu KFCG5009 KFCG5010 KFCG5011 KFCG5012 Scheduler Client 10 11 12 10 DD 251 KFCG5013 KFCG5017 KFCG5018 13 170 18 11 12 8 00000000000 00 KFCG5016 13 Scheduler Client 16 22 26 29 67 74 83 00000 19 24 27 32 68 79 87 21 25 28 33 69 82 89 WWW for Scheduler 00000 KFCG5019 KFCG5021 KFCG5022 KFCG5024 KFCG5025 KFCG5026 KFCG5027 KFCG5028 KFCG5029 KFCG5032 KFCG5033 KFCG5867 KFCG5868 KFCG5869 n n m e LLL n e BE x poo Ooo gogongo nan goo Un Un lt 5 oO t FEL TE 00 T mor 41 E 3 EE og unn Co Co 0 O O Assist dna H Co LE E Co E E Co N wo gt 7 2 Y e L3 L3 oao 14 252 36 KFCG5036 EJ E
105. Groupmax Address Assist O00 143 5 1 Groupmax Address Assist Groupmax OOO 144 52 000000000000 SFdatacph OOOO 156 pqo0000000 163 61 164 62 0000000000000 167 63 00000000000000 169 64 GWOOOOOOOO 171 6 5 Facilities Manager 0000000 174 66 00000000 175 179 7 1 GetAdAIl OOOO 180 7 2 indxget 0000 184 7 3 HOSTCHG I 00090 189 731 189 732 189 7 4 BITECHGO 0 O00 192 7 5 0 CODECHGJ 0 0090 193 751 193 752 193 76 000000000090 chkorder O O sortdate O O O 195 7 6 1 chkorder 195 7 6 2 sortdate 196 77 DODBODOD OD DO DO 0 D D D 198 78 0000000000000 0 grpchg0 0 DU D 200 7 9 SFimport OOO 203 7 9 1 SFimport 203 792 SFimport 1 1 D 1 D D 205 7 9 3 SFimport 0000 212 7 9 4 SFimport 1 000000 214 7 9 5 SFimport 0000 214 DD 7 9 6 SFimport 000 216 7 10 SFexport OOOO 220 7 10 1 SFexpot0 00000000 220 7 10 2 SFexpotO 000000 220 7 10 3 SFexpot0 0000 220 7 10 4 SFexport 000 222 7105 SFexport 00000000 224 7 10 6 SFexport OOO SFimport B B 1 E U 224 7 11 866980 0 0 0 0 225 7 11 1 SCHogimp 0 00000000 225 7 11 2 SCHogimp 000000 225 7 11 3 SCHogimp 227 71
106. OOO Gxxxx 64 00000000000000 6 6 67 0000000000 68 0000000000000 69 70 00000000000000 uu in 0000000000000000000 00000000000000 ogete bk ete 0000000000 eg GetAdLck dat 71 GSSGetPosList failed rc Address Server xxx result Address Server Address Server O0 0000000000 72 GSSGetComList0 failed rc A xxx result A 1 O O Address Server 73 GSSGetDomNameTableO failed rc xxx result xxx 74 GSSGetOrgList failed rc xxx result xxx 75 GSSGetUserList failed re xxx result xxx 331 M 0 GetAdAll O indxget OOOOOOOOOOOOO 0 u U 76 GSSGetUserInfoByUIDO failed rc xxx result xxx uid xxxxx 77 GSSGetAPInfo failed rc xxx uid xxxxx 78 GSSGetAPInfo 000000 O O UID xxxxx 79 GSSGetServerInfo20 failed og rx xxx result xxx uid xxxxx 80 GSSGetServerInfo30 failed Dn rx xxx result xxx uid xxxxx 81 GSSGetAddP
107. 00 20000000000000 10000000000000 10000000000000000M000 0000 2000000000 20000000000000000000000000 00 2 1 L3 L3 L3 L3 L3 LES Address Server 0 0000000000000000000000000000 podp0000000000000 00418 00000000000000000 000000 462 0 00010010101001 01 cog00000000006Wg 000000 M000000 WJ0000 00006 W0 0 00 Scheduler Server 0000000000000000000 po00000000000 0 GWO D Scheduler Server 000 0000000000000 prog 000000000000 000 10000000000 podd0 0000000000 00000000000000000 1D000000000000 O 0 Oooo e EJ 3 EI 0 65 4 00000000 66 DUUDUDDDDUDDDUD
108. 000xx0000000000 00000000000 ol ol ol A tal Cd 004000 0000 201 7 0000000 00000 00 6 80000000 0 No 000000000000 7 8 0000 xxx0000000000 9 0000000000000000000000 10 0000000000000000000 1000 DDUD 00000000000000000000000 12 000000 00 00000000000000 00 000000000000000000000 14 0000000000000000000000 10000000 15 OOO 00000000000 00000000000000 5600800000 16 2 g Xia 000000 IDINDXidx 000000 00000000 00000000000 18
109. 0462 ooo EISE E e o ka am Oo OO O N FI O O 1 o H o H o H pH E H P Q EJ lt Eel ss El HO HO Oo gt 5 Cl E 9 mn vn LI g L3 L3 O 0 Em EE H 0 G Q 00 e 8 o 5 8 O gt aA or 43 4 000 9 10 11 12 13 14 44 0000 000000000 Scheduler Facilities Scheduler Server Facilities Manager 0 0 O O Address Server O Address Server 1 111 101 0 0 0 0 0 SchedulerQG 00000000 Address 00 0000 Address Server DOOOUHOOO000000000000000000000000 0000 000000 IDO Scheduler ServrQOOOOOOOOOOOOO O Scheduler Server Facilities Manager 0 000000000090 IDADI Dodd 0000 00 0000 000000 00000000000 00 000 00 A 400000 00
110. 9 8 1 0 0 924 DODODDODDO podd0 0000 0000000000000 000 0000000000000 podd0 000000000000 000000000000 410000000000 46 0000000000462 0000000000 pco06eWwp o000000 00000000000 280000000000 00000000 1 D 2 O O L3 O L3 O O O O O O O ES ea 0 40 40 81 es L3 L3 L3 L3 ET EST 2 ESTE Ea EZ E L3 L3 L3 L3 L3 L3 L3 L3 EPEKE EEE D L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 r3 0
111. E 14 E 15 E D0000 0 000 000 0000800000000 000 16 po00000800000000000 E D0000 17 E 18 0 00 0000000000 E 000 00 ww 19 E 20 21 E 22 0 1 aJU 1 10 E 23 374 00 DD OO 8 D SFimport OOOOOOU00000 000 Co 000 24 4900000000 s00000 oooonnooooooonooon 00000 1000000000000000 25 E 400000000 s00000 0000000000000 0 0 00000000000 26 0000 27 E 68 0 10000000000000000
112. 5 Address Server 1 0 00000 0 0 0 000000000000 Groupmax Address Mail Version 000000 ress Server 1 0 00 O Scheduler Server 00000000000009090 Q D U U D U Address 00000000000 10 Address 0 LU D U GroupMail Groupmax GroupApp item def 000000 0 00000 000000000 roupAppo GroupApp item def QO Address Server 0000000000 OO Scheduler Server 0000000000000000 opa g000 ado 0000 0000002000000 AddressGOOOO000000 poda 0 g000 00000 roupMail Groupmax GroupApp item def O O Address Server 000000009090 ress Server 00000000600 Groupmax Address Server podd08 0000 000000 0000000000000 Scheduler_Facilities 1 1 1 11 11111 1 1 1 000 4 1 3 Address Server 000000000000000 Address Server 1 E D D D
113. 9 9 OO Version2 0 Version 3 Version 5 Version 6 Version 7 1 x x 2 11111 1 x x 3 Iul x AS 4 11111 1 O x 5 x x 6 O ps 7 x O 8 O O 9 O O 10 Address 0 1 0 0 0 11 Address 0 000 O x 12 O O 13 14 15 Address 00000000 16 Assist 2 298 Dub uu opdo00g000000000000000000000000000000000 0000000000000 xpogg008008000 000000 0000000000 0000000 Version2 0 000000000 ADOBD OD OD OD OD 00000000 IPOD000 00000000000 uu D x 1 Version2 0 c 1 DDD 1 000 Version 3 Version 5 Version 6 DO Version 7 H U Hl l l BH MBO
114. L3 L3 L3 L3 L3 L3 L3 L3 C3 EJ i o X 9 ZJ oo a E EE E E E L3 L3 L3 6 EST ESTE E san EE 00 448 E TS El L3 L3 L3 L3 L3 L3 L3 CJ Oooo oo Oooo E AEST E EET 275 9 OOO000000 020 1 2 po000000000000000000000000000000000000 a3 pop000000800000000000000000000000000000 9 0 4 925 1 1 Address
115. WWW for Scheduler 0 0 0 000 2 9 0000 COM1 COM2 COM3 COM4 COM5 COM6 COM7 COM8 COM9 LPT1 LPT2 LPT3 LPT4 LPT5 LPT6 LPT7 LPT8 LPT9 PRN CON NUL AUX 3 000000 Windows NT Server 000000000 00000000000 Pp0000000000000000 D0000000000000000 00 0 Oo 0 0 I1D00000 0 Ooo Ooo e aaa 0800000000 op TEES usa EEE ESTE y EE A FH 3 4 4 El E
116. 40000000000000000 800000 0 L3 L3 DUUDUDDDUDDBDDUDUDDUDDDDDUDUUDDDBDBDDUIDDBDDU 000000000000 A DU O L3 L3 L3 L3 AO OOO 4 u 1 a O H 5 9 O O podp0 000000000 00000000000000000000 podo00 000000 00000000000000000000000 Oo LEES 1 4 E sas Ea 11 O O O O O O O CI O O El O O 5 9 o 79 4 00000000 80 7 a 8 Pomp e Scheduler Server GWOOOOOOOOOOOOOOOOOOOOOOOOO
117. 0 0 0 Dn gn 0000 0000000000 Modo 0000000000000 0 0000 Scheduler Server Facilities Manager 000000000000000000090 00000 0 0D 00000000 690000000000000 00000000046400 UUDDUDDDUDDDBDDUDUDUDDUHIIDDDDDBDUDDBDUDDDBDBDDDUDULDULU 15 4 1 EI 261 8 00000000000 02300 0000800000000 0000 000000000000 00 0 0000000000000 5 podo00 000000000 00000000000000000000 000 Scheduler Server Facilities Manager Y 000000000000000 000000 00000 0 000000000 640000000000000 00009 990 0 0 0200000000000 00000000 000000000000 peda 0000000000000 2000900000000 OOOO 0 D Oooo OU podd0 000000000 00000000000000000000 O SF325YS i910000000000000000000 0
118. 000000000050 cd umount HACMPdata varyoffvg HACMPvg 395 Scheduler Server Facilities Manager 30 20000000000000000 100000 1 110 0 00 0 0 bostsQ OOO000 2 services ikisaki appoman appoarea roomman 000 100000 2000000U aconsole roomconsole 1 D B 1 00 1 3 0090000000000000000000 000000 00 0000008000 08000000000000000 000000000000 varopt xpop0000000000000 pod 000000000000 00000000000000000 sOOOOOO 00000 Address Server 0 0 D D D D Address I H0 0 0 D D 0 0 ilia aaa aaa aa aaa 0 0 ddre uu uu Assist Assist Uo Er EX 5E E E E HO u e 1 Address Server Mail Server MC ServiceGuard Y DO 00000000000000 0000000000
119. O 307 000000000 131 135 138 po0000000 2 po0000000000 305 198 195 0000000 1 88 91 429 DD JOO 65 88 89 91 ou Oh oo o 294 DO 146 10 146 000000 4 HUH 9 1 53 OO 384 0 O O 0 1 5 4 E E 3 Y 3 311 LL LE Dp 1 EI c c L3 L3 L3 CJ Er EST EH FE L3 L3 L3 CJ ID 5 273 8 81 92 2 49 L3 L3 L3 123 315 171 103 65 00000 7 82 86 000000 4 211 205 4 0 OOOOOOOOOOO 8 205 1 33 430 48 4 297 1100 4 362 396 11 249 000000 82 00000000000 77
120. o 0 0 0 0 o 200000 o 00000 O 445 0000000 HERO BAMA BRL BZ kaigirid HEDER GARLET7 WOR FORERO C AEHRUI 7 7 WE FOS her evtl 107 4 00000000 414 11 1 1 1 1 0 9090080 00880080809008000000 44600000 podd0000000000000 00000000000000000 446 0 80 4 14 1 D D D D Du ugnugapnunnugapunnuagapupnpn uagapBapnpDa poo 1000 10000000000000000000000000 Oo 5010010000 5000 0 0 LL c O 0 0 EL E E Oooo Ooo r3 L3 L3 L3 r3 r3 r3 LL 0 0 0 447000000000000000000000000 0000 10
121. oOo Og Exp oO 2222 o oO a a Oe 3 oO oo lu oO oo Og Olean E a BO BO Opn L3 r3 P8O0300 042 O O BO Oo L3 12 r3 gt 00 Ln El Oo Em E tE E Es oo Og 22 2 gt n E OA Z oOo L3 12 O zr oe Coe o oa 2 Ela og gS 2 Er 2 x om oo saa r Oo OOOO S liolo xX290 x20 00 ES ES ES 53 L3 El xO 3 I ala xn xcu rur Bo aojac ao 2oooo 2ou 31 gt 2 le ia Ia oa 10 e oo o bm e oD Au 10 o w e N N N N N N N N ja N co oD 235 00 00000
122. 20000000000 usr bin RMSV U U DU 3 000000000 RoomMang 0000000 40000000000 usr bin RoomMan 1 1 11 1 EI O O O o e 0000000000 e Address Server 0000000000000000 D Address Server pod0d 00000 000000 000000 0000000000000 GetAdAll indxget JO DO DO DO 00d 000 000000000000 0000 00 0000 00000000000 e Scheduler Server Facilities Manager 00 000000000000000 ooo Dodd gg 00 00 0000 000000 000000 000000000 1 0000 00 0000 000000 000000 000000000 pod 0 0000 00 000000000000 umask DU tub d umask 022 umask opa 0000000000 2000000000 Schedule Server Facilities Manager 000000000 1 0 Dodd 080000 000000 00000 00000000000 e PEAD Bag 0000 000000000000 0000000000000 podd0 000000000000 0000000000 poepo0 0000000000000 000000000000 000000 popo0000 000000000000 0000000000 poda 0000000000 000000000000 00000 322 00 00000 0
123. 4 8 Scheduler Server G W 0 0 0 O O Version 6 O Scheduler Server O O Dodd 00000 0 00000 000000000000 e 10000000000 0 00000 00000000000 000000000 pod 00000 00 0000 000000 000000000000 0000 O0OU00000000000000000000000000000000000 oO 00 00 0 00 0000 0 0 Scheduler Server Facilities Manager 172 6 00000000 1 usr GroupAppo bin AppoSV ini 0p 000000000000000 AppoS Vii papa pg gH cH 0000000000 00000 Environment KBN_ENHANCE OFF 2 0000000000 1 0 0 000 D D aconsole OO 0 SVD n D 5 0 000000000 roomconsolel 1 OO RMSVU O00 OO RMSV O00 0 0 0 O O O e EI LIE dm ate 0 Scheduler Server oo ata 8 EIE EY 4 47 E
124. 71 048 576 00 0 U 2 Version 59 000000000 D 3 Version 6 06 50 ADO DO DD OO DO DD 000 000000000000 00000 O30 00000000 1 PE ng a a DODO 000000000000 000000000000 1p00000000000000000000 Scheduler Server Facilities 2 Manager 0000000000 4 00000000000 2 Groupmax Scheduler Server Version2 0 00000000000000000 Scheduler Server Version2 0 Dodd 080000 000000 000000 000000 000000000 0o Scheduler Server Version 3 Version 5 Version 6 Version 7 00000000000 0000000000 00 00 LOGSV bak 0 0 00 0 LOGSVlogp 000000000 00000000 O Xx gd 0000000006 0000000000 0000000000 1140000000 3 Groupmax Scheduler Server Version2 00 0000000000000 00090 uU au e Scheduler Server Version2 0 0000000 299 OOD e Scheduler Server Version 30 Version 5 Version 6 Version D L 4 GroupAppomouse Server 01 00 0000000 Yete 000000 oldserverist 00000000000
125. 9 po000000 pp0000000000000000000000000000000 405 LockLoop J 38000000000 LockLoop 000000000000 LockSleep 00080000000 120000000000 LockSleep 10 Do 000000000000000000000000 SFpackage Scheduler Server Facilities Manager DO U B D B D EB 0 O 10 SFpackage Scheduler Server Facilities Manage OOO usr GroupAppo bin 00000000 D an 00 SFpakage 8 r e SV AppoMan RMSV RoomMan t sec ct sec D 100 200 SV Scheduler e AppoMan Scheduler 1 D e RMSV Facilities Manager e RoomMan Facilities Manager 000000 u 300 sec 000000 1000 rO0000 seed dut 10 7200000000000000 600000 406 D 400 ctse 0000000000 0000000000000 1000 DO
126. O L3 5 9 303 00e sg HOSTCHG HOSTCHGH grpchs 0 DU e Address Server 000000 D Facilities Manager O00 000000 e Scheduler ServerQ 0000000000000000000000 Scheduler Server 0000000000000 grpch 0 0000000000000 009090000 HOSTCHGODODDODO OOO 0 0 0090800000000 00000000 0 e Scheduler Client Oooo 0 0 0 0 el HOSTCHCO0 0000000000 7 3 BOSTCHGOOOOOOOOOOOOO 000 1 111000 00 00 4 1 3 Address Server ej 71 OO 000000000078 OOOOOOOOOOOO po000000 O O grpchgel OO 304 OOF DOF
127. cc ga LE E L3 ae LL EVE L3 LLLI L3 8 00000000000 DO Scheduler Client WWW 000090 for Scheduler 00000 15 38 KFCG5038 i 000000000000000000000 1000000000000000000000 1000000000000000000000 9 0 000000 000 DD 0000000000000000 P0000 1000000000000000000000 11000000000000000000000 000000 660000000000 00 3 0000000000000000000 Sc Co Co L Co Co LJ Co Co Co Co Co 1521 Co Co oo Yoko c l CI oO CI oO Co l CO E F oO Co 1 Cd CO EA oO E 0 E cuon OIC 1 000000 AppoSVini 0000900000 00000000000 000 0 0 0 Scheduler 1000000000000000000000 Data HAHostName 000000000 WriteThroughSV ON 29
128. Address Server 000000000000 0 0 000000000000 9052000 000000000 0 00 0 0 0 12 O 13 ae D 4 HO poda 000000 000000000000 OOOWO0 gt 0000000000000 OOOOO00000000000W 0 0 O 0 yo m Er ES 1241 E Oo L3 5 9 ADO 5 9 L3 C OOOO p O O O 53 C O Oooo 14 D 000000000 00000000000000000000 0000 OOOO OO OOO D ee D Ed EX CEN 4 000 L3 C3 L3 1 C3 L3 C3 r3 r3 C3 L3 C3 r3 r3 C3 L3 C3 L3 r3 r3 L3 C3 L3 r3 r3 ES ES ES q EI SES L3 L3 m Ez EJ Ed Ed EJ ese ee 9E GE EE L3 C3 L3 L3 C3 C3 EX EJ E J 11 EFJ dg Cag ct ED LE nan E EE e 2 Oo 0000000 0 Address Server 000
129. co000000000000000000000000000 Scheduler Client 06 500 0000000000000000000000000000000 o n Y D 2 4 00000000 0000 4 1 3 Address Server 000000000 000000 Address Server H B B 1 B B DDD Scheduler Server Facilities Manager 0000000 1 Address Server OOOOOO0000000000000000000000 D Groupmax Address Mail Version 70000000000 00000000000 200000000000000 Address Server 0000000000 Version2 0 Version 91 1 11 0 11 0 0000 00000000 DODO OO 0000 000000 000000000000 0000 GetAdAN 7 1 t D 0000000000000 poda 000000000000 0000000000000000000 Address Server 00000000000000 4 pog8000000000000000000 5 Dg 1 Address Server JODODO0000000000ete000000000000 podd0 000000000000 00000000000000000000 D 2 4 1 4 Address Server 0000000000 4 1 3 Address Server 0000000000000 Address Server 000000000000 Address OOOOO0O00000000000000
130. 19 20 z g 4 DH D D OO 21 2000000 xxxxxQ 000000000 22 0000 0000000 28 00000 Usage 0 OOO 202 7T 0000000 7 9 SFimport NOOO SFimport Scheduler Server Facilities Manager 00000000000 1111000 0 CSVO Comma Separated Valued 000000000 0000000 7 9 1 SFimport SFimport 9 0009000000000 71000000000000000 72000 000 71 SFimpor 00 00 0 UD 00000000 1 000000000 2 00000000000000 3 000000000 4 000000 5 000000000000 6 00000000000000000 7 10 00 08 81 000 000 8 10 00 08 81000 0000 9 10 00 08 8691000 000 10 0 0 u 12 13 0000000 144 goood 1 DO000000000 18 00000000000000 17 goood 203 7 0000000 Q 7 2 SFimpot DD 200000000000 000 000000000 D 191 OO OOOO 0000 0 2 000 190 0 190 00 CODECHG O DD 1 CODECHG 1 oO 1 ol 1 o 1 o o o 1 o 3 1 oo H
131. B00000000000000000 1 00900 0 O DODO 0000000 00000000000 0 Ve L3 Version6 000000000000 ersion 6 400000000000 0000000000000000000 0000000000000 Address Server 0000000000000 OO 100000080000 0000000000000000000000 Bpoog 0000000000000 0008000000000000 BUD Address Server 00000000000000000 10 podBd0 000000000000 aa 000000000000000B00 Address Server 0000000 podd0 000000000000 000000000000000008B0 Address Server 0 3 34 4 E a a c 1 0 A 0 0 67 4 00000000 68 000B00 Address ServerQ 0000000000000000000000 po0000000000000000B00 Address Server 00000000 O041200000000000000000000
132. 0800000000000 000000 SCHogimp 0 0 0 ORGGROUP tb ORGGROFFty10 00000000 SCHosimp 0000 ORGGROUP tbl ORGGROFF tboh 0000000000800 000000000 cheduler Server I 0000000000000000000 00000000 SCHogmp 00 0000000000000 0000 44000000000 00000000 233 7 0000000 7117 00000 DD 00000 DD 1 0000000000000 0000000000000000000000000 0000001 A Ed 2 020000000000000000000000 DDD 00 3 0000000 0 10000000009000000000000000 00000000000008 00 10000000000000000000000 128 5 020000000000000 ORGGROUPsb 0000001 1 0 ORGGROFF10 00000000000000 00000000000 30000000000000 000000000000 SCHogimp log 000 1000000000000000000000005 0000000000000000000000000 e 05300000000000000000
133. DD brc Appoarea OOOOOO DO roomconsole Facilities Manager 3 0 uu 1 groupmax bin SCHpreBK 0 00 08 0 08 OO SCHstpBK OO SCHstrBK usr GroupAppo GroupApp Address 00000000000 usr GroupAppo GroupApp item def Address 0000000000 usr GroupAppo bin AppolnfoGet System Agent TCP IP 1 000 0 OOO OO BITECHG O L CODECHG OOO m0000 CreateManagersR QQOOOOOOOOOOOOO mx oo GetAdAll Address 0000000000 OO HOSTCHG 11 1 L ModifyAppoManI O L ModifyAppoManI ni SCHpreMV Assist 0 0 000000 00 288 1101 D 1T SCHstpMV Assist 0000000 1 00 SCHstrMV Assist 0 0 000000 1 00 SFagent Assist 0 0 0 00000 1 SFenvget Assist FL ET EL FL FL FT FI 1 00 agtcout Assist 0 000000 ki 00 rindxget Assis DO 000000 ki 1 SFdatacp grpchg 000000000000 1
134. USERNAME 00000000 usr GroupAppo bin usrchg 000000000 00000000000 etc iocairc0 o 000000000000000 0003 2120000000000032 202000000000000090 OQ suzxukigOOOOOOOOOOOOOOGO Scheduler Server 0000 Oooo OF 0 O 0 HP UX9 AX 000 etc iocairc0 000000000000000 EEE PET ESI EST EZ if test x usr bin brc appo then Ibin su suzuki c usr bin brc appo fi Facilities Manager 0 00D if test x usr bin brc Appoarea then Ibin su suzuki c fusr bin bre Appoarea 6 OOOO 000000000 dog go 000000 000000000000 0000000000000 uaa O Scheduler Server O 1 aconsole 000000 OOOO usr bin aconsole 321 Dot usr bin svOOOOOOOGO 00000 000000000 AppoMang 0000000 D UU D 0 usr bin AppoMan 0000000 Facilities Manager O O 1 roomconsole 000000 0000 0 usr bin roomconsole 2 0
135. UUDDDDDDDDUDUDUDDDDDBDDUDBDUDDDBDBDUDUDUDUDUDUDUDDDBDUUHL poda 0000 000000000000 000 0000000000000 ooool 0 000000000000 0000 HO0000 000000000000 Scheduler Server Facilities Manager 0 1 0000 00 0000 000000 0000000000000 e Assist CL 0000 000000000000000000Mm0 5170090000 e Groupmax Scheduler Client 11 1100101000000000000000 000000 000000 Groupmax Clients Scheduler setup 00000000000 oNDDU 0180000000 1009000000000 0000000000000000000 2 Scheduler Server Facilities Manager 000000000 AppoMan 0 0000000000008000000000000000000 aw Address Server Scheduler Server Facilities Manager 000000000 AppoMan RoomMan p000000000000000000 Address Server IO ODOD000000000000000000000M00 pogo 000000000000 00000000000000000 mdxget po000000000000000000000000 0000000 00000000 Address Server 0000000000000000000000
136. etc bk O 1 B r3 OCI Co Co LF LH ST Qi se A ESTE rr upagapnpnauagpnan o a Es o H E r3 xxx 70000000 OO Gxxxx lt 5 a 5 un un mo o lt o El a a Eis oO a r3 lt 4 5 OO OOOO cet e E On Ong L3 r 000000 Gxxto tal lt O COCO CI oO ae Coy Co El LE Co l EJ Co 10 000 Address Server Scheduler Server 00000000 Address Server Scheduler Server Facilities Manager 111 1110110000 000 0 l 11 CopyFile0 failed xxxxx 00 00 12 DeleteFileO failed xxxxx ec 00000000 13 328 FindNextFile f
137. 080000 000000 000000 000000 00000000000 pod0d 080000 000000 000000 000000 00000000000 20000000 2289000000000 0000000 0000000000000 pdodd 080000 000000 000000 000000 00000000000 Dodd 080000 00 0000 0 00000 0000000000000 O0OU00000000000000000 21000000 20000000000000000000000000000000 1 0 ooo 177 11 11 11 1 Address Server 0000000000 00 0000 0 00 0 8 7 1 GetAdAI O O 7 2 indxget OOOO HOSTCHG 7 3 7 4 BITECHGG 0 0 7 5 CODECHG Jj O O 76 0000000000 U chkorderg sortdate 00 77 0000000000000000 Q0 checkidd OOOO 78 DOOOOOOOOOOOOO grpchad OOOO 7 9 J SFimport 0 0 0 O 7 10 SFexport OOOO 7 11 J SCHogimp OOOO 179 7 0000000 7 1 GetAdAIl O O 000000000000000 1 0180000000 usr GroupAppo bin GetAdAll gl s sjl o 020 1
138. O DU 0 O 000000 84 4 00000000 D 428 1111101109 0 1 1 00000 TA 2 25 25 25652 5 E TAB JEDI EEG BERD 482 40000000000000000000000000000 D 429 p00000000000x0 00000 Pepo zl we go Hd MM MM NH Hd MM 61 NHN af P ao fl sf HH HH HH NN ae wf mf ef ef 85 4 00000000 86 000000 podd0 0000000000 00000000000 000000 aiana na aaa aaa aa aa aa aaa UDH 0000 U3DUUDUUDUDUUUDUUDUDUUUDU
139. O pod 000 0000000000000 podd0 000000 0000000000 podpo0 000 0000000000000 4 53 3 ETA EAU 4 1 mai Ea AAG 1 E O TPE OOO 1 O O 0 0 0 0 O 0 0 0 0 0 BO HH OH IO OO 6 E E E Ed Ee Ee oH 0 0 0 O Lr O O O 10 Address 000000 00000000000 010000000000 000000000000 po00000000000 800000000 0 00000000000 MMQOO UU 00 1200000000 1220000000000000000 p1g0000000000000000000000 1998 1 po00000000000 0000415 0000 po00000000000 Address Server JODOD000000000000000000000000 Address Server JODOD0 000000 00000000000000 Groupmax 0 000000000000 10000000000000000 Address Server 000000000 41 Address Server 000000000 c00000000000000000000 Address Server 0000000000 0000 11 Address 1111 IPHODU OD 3 0000000000 0000000 0000 00 0 0 Address Server 000000000 IP
140. e 000000 28 3 0000000000 0000000 Uu uu 8800000000000 000000 000000000000 aconsole 000000000 roomconsoleg 040 0000000000000000000 lt lt Groupmax Facilities Manager 0 0 gt gt uu 000000 D Un Un OOO 0o00 OOOO 000000 000000 000000 0 00000000000000001000400000100000100480400 50000000000000000000000g0g 0000000000 60 100 120 168000000000000 podd0 000000000000 000000000e0000000000 ersion2 0 Version 30 Version 50 0 O Version 6 BO uuu 49ppg080 0000 000000000000 0000000000000 oO oo er E CO E CSS lt 29 3 D 000 Un D 36 8000000000000 roomconsolel Groupmax Facilities Manager RAT Xa WRAT LO F U 2 80 VES et BY 8 38 tr RA RBIF ELA 4 EHT IA 5 38 tr RADHA 8 0227 AI BAXEE lt FEA gt gt T TEAT Va BS BAT 8 PS BAT Va JVBIUERERRE 8 75887 Va LAURA zac roomconsole 1 16 usr iki RS H 38 03830027 HALL 11MB SUO SHEDS 125 AE 4A lt lt GroupmaxAddressServe
141. 2 00 O 1 NOU 1000000000000000000 0001a90fcaf86430 2 NOU 280000 0000000000000 0001a90fcaf86430 3 HACMPvg 4 HACMPdata 5 HACMPly 6 IHACMPloglv 7 Scheduler Server Facilities Manager 00000000 HACMPdata iki 385 Dus HEXATRA F hacmphost EAIPZFLA 172 1 1 3 fa 0661 fa F 0062 IPZ FLA 172 1 1 1 IPF FLZ 172 1 1 2 HACMPvg Y 02 kT4Uv2kU HACMPdata Tki log AppoMan Tm IJ gt 2 274 JL iki log AppoSV ini 274 usr iki usr iki usr bin AppoMan ini usr bin AppoMan ini usr GroupAppo bi n usr GroupAppo bin 0001a90fcaf86430 AppoSV ini AppoSV ini Groupmax FH 5747 00000 020 OOO00 OOOO 12Pg0000000000000 51 bostsQOOO00000000000000000000 os ad HP UX O O HP UX0 0000000000000
142. AppeMan RoomManf 1 00 0 0000000 3 26 000000000000000 O RMSV 0000000000 5 EXE O ES EE en a c o o E E J E J El Er oo 313 OO 000 0000 CODECHGO 0000000000 75 CODECHE DU 314 DuJ 1 00 3 1 1 1 1 1 1 1 1 1 1 0000000 W 00 0000000000000 kiss 000000000 000000000000000 Scheduler Server pogo0000000000 000000 00000000000 6 W000000 B00000000 201300000 400000000 BO 400000 00000000000000 400001 0000400000 1 000000000000000 000000000000 2 0000000 0DNspo00000000000000000 3 DNSp00000000000000 B0000000000 40000000000 0000 O00 HOSTB 40000 pooo00B8g000000000000000000 B0000000000 BO
143. TEEN FESTER EMS mm WKO AD 777707 ES SU El 02000000000 Dan 0000 100000000 000000000000000000000000000 400 0000 22080000000 0000000 2000000000000000000000000000000000 60000 0 83000000000000000000000000000000000000 OO 800000000000 80000000 0000000000000000000000000000 Ub 000000000 00000 10000000000000 podo00000 000000000000 200000000000 OOOO0000UWO podo000000000000000 38000000000000000 400000000000000000000000 El 5 5 9 00000 O O O O O O El O E O I 0 D D 000000 oO o oO O O o 5 9 5 115 4 00000000 pea 0000000000000 1000080000000 00000000000000000000000000 podo00000 000000000000 20000000000 000000000000000000000000000 3 paga 00000000 ma o0000000000 0000000000000 Odd 2000000000000000000000000000000000000
144. s Top WOO 90 4 00000000 oooooooooooooocoooooooooooooooooololag 0000 podo00000000000 poego00 000000000 0000000 mM o0x00000000000000 030 Er Ed 4 Ea Ea Eg 0 0 0 0 D 0 0 0 4330000000000 00000000000000000000000000 0000 UUFIDDDDDDDUDU FO z200000000000000000000000 OBO Epo00000000000000000000000000000000 Aapoo00000000000000000B0 200000000 A0000 po0009000000000000000000000000000000CsvoO podd0 00000000000 0 mwaa 91 4 00000000 433 DONDOO po ng 0D 000000000 000000000000 PARED AHA RO ORO RO EO ROGO GE GEO KE 4 ORO RO RO EX EASES GR GIG OR RO EO REOR 8 8 8 GR GR OR xo o o 492 11101010100 00 000 0 0000000000000000000000000000000000000 0000900000000000000000000000000000000 0000900000000000000000000000000000000 poddo0 000000000 000000000000 0000000000 0000100409410 LI t m mg gp drug F F F F m
145. O 20 Address Server 1 0 0 ABCH abend a D D D 000000000000 Address Server 8 0000000000000000 OW UIDIDDDUDDUUDDDBDU 0000000 Address Server 00 00000000000000000 00 3 bin etc log room BIND ETC LOGO ROOMIJI 120000000 0 0000 Address Server QO 00 000000000000000000 4 Scheduler Server 1 PD0000000 000000000000000 Address Server OOOO P0000000 1000000000000000 E EE 5 Address Server O0 00000000000000 2000000000000 0200000000 2000000000 Scheduler Server D Facilities Manager opd0000204 0000000000000 19000000 0000000 ooo 6 Address Server Dodd 00000 0 00000 000000 000000000 00 ID 000 e 0000 e 0000 42 4 00000000 000 e 000000 7 0000000000000000 000 WWW for Scheduler 000000000 O30 190008 0000000000000 10 00000000000000 poda da 000 00 0000000 00000000000 000000000 1 0000 00 0000 000000 00000 0000000000000 pad 0000000000 2 Address Server 0000000000000 0000000000000 Address Server 00000000 3 Address Server ONO D 0000000000000 0000000000 4 Address Server
146. 0 00000 HOSTCHGO 0000000000 7 3 HosTtcHGg 000000000000 DU BITECHCO 000000000 0 74 BITECHG LH 00000000000 D e0 grpchs0 000000000078 00000000000000 erpchgO U O Assist 00000000000000000000000000000000000 Y 3 OOO OOO O OOO OOO J oOo OOOO gO ooo 12 usr GroupAppo bin agtcout DD OU 0 J 000 1 0000 e agtout i 0000000000000 000000C0000000000000 0000000 log agent SchezExec 1og 0 000000000000000 log agent SFagent log 152 5 Groupmax Address Assist 0 0 00000 AppoMan RoomMan 000000000000000 9T J I D D D L Assist 0000000 Address Viewer 0000000000 Seheduler D D 1 0
147. 132 4 00000000 Ub 000000000 10000000000000 10000000000 es 0000000000000000 0000 2 000 100000000 9 80000000 DO000000000M000 10000000000 ID0000 O 465000000000 2 39 EB aD faooo2 IFE TER RAEE C 22 8 8 BI FART DE FERA IU FC BEA 18 C AEE 31867 AD Xue AUER OKO amena FeV ELC 3 00 00 00000000000000000 3900000 2o0xp00000000000000000000000000000000000 podd0 000000 0000000000000000000 00000000000000 100000000000000000000000 00000000 200008000 000000 0000 000000000000 00000 2 000000 3 00000000000000 000000000000000000000000 UUDUDDDUDDDBDDUDUDUDDDBDBDDUDUUDDDBDDDDUDUDUDUDUDDBDBDUDU 133 4 00000000 134 020 aaa
148. 62 4 00000000 pooo000 WM oxp000000000000000 p6 200000000 1 pao 0000000000 00000000 0000 0000000000 200000000000000000000000000000000000000 000000 0000 071000000 1 pao 00000 00000000000 0000 00 00000000000 DODO 000 000000000000 00000 24000000000 000000000000000000000000 0000 a 000000 ps8 000000000 1 0 9 0 009800 1 0900 00900 90090090 0 DU Oa 200000000000000000000000 1 00 2000000000000 0000 000000000000000000 2 0080000000 00000000000 49000000000000000 0000000 63 4 00000000 000000000000 Ls Die iN ELE VO FORE Aah prr rl C BARLESBST tong 3apgo0000000000000000000 m0 0x00000000000000 podd0 000000 0000000000 0000000000000000 podd0 000000000000 0000000000000 0000000 poda 000000000000 000000000 000000000000 DU 2000000000000000000000000
149. 88888 DDDDD 1 DUUDDUDDUDDDDUDUDUDUDDDBDBDDUUDUDDDUBDDDDUDUDUDUDUDDBDBDUD 194 7T 0000000 76 1 UU chkorder sortdate DOUG chkorderQQOOUUOQ0U00000000000000000000000000 0000000000000000000 7 6 1 chkorder 0180000000 usr GroupAppo bin chkorder rsd smn msd ssd nsd v r f logfile name directory name 02000 directory name J 000000000000000 vsr ixig 00000000 0000000 rsd smn msd ssd nsdQ 0000 00000000000000 rsd 11 11010 0 smn 1 1110101 00 0 ms 000000000000 96 000000000 nsd 1 pod 0000000000000 0000000000 0000000000 pod 00000 000000000000 000 0000000000000 pogo 000000000000 000000 O30 00 e0100 169 smn msd ssd 0000000000000 e rsdd 00000000000 sand 00000000000 smapo00 00000000000 e msd 00000000000 mse god0 0000000000 e sa 00000000000 e sdi 00000000000 89 smn msd ssd 991 00 10 chkorder rsd ssd usr iki 000000 usx ixi0 0 rsd ssd0 00000000000000
150. Scheduler Server 000000 U EXE E EEE Oooo Oooo 121 1 6 D u D 00 L3 L3 L3 0 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 El S E El dg Address Assist o 00 60 po000 00000 00000 00000 00000 Assist 0200000000 Address Assist 0 0 D D 000 Seheduler OOOO OOOO OO000000000000000 Address Assist 000000000 Groupmax Address Assist Version 6 000000000000 OOO0000 Dep 00000000 p0000000000000000000 4ssisp0000000000000000 1 0000000000000 0000000 5 Groupmax Address Assist 0 usr GroupAppo bin SFagent ini 000000000000 00000000 e Assist DODODO DO DO DO DO DD ODO AgentAPI TimeOut 7200 000 podo00000000000000000000000 3 6000 0 2 147 483 647 J 0000000000000 AgentAPL Timeou 00000000000 SFagentimippg0000000000000000 AgentAPI TimeOut 3600 0 pod 000000 000000000 000000000000 Version 51 00 000000000000 000000000000 AgentControl 000000000000000 Versien 5 1 D B B B B U 0 AgentControl 09 0 0 00 0000000000
151. 0 00 roomman 0 0 0000000000 000000000000000000 D I xxx 6 0000000000 0 hostsOOO000 0000 000000000 1100000000 000 1 1 TOPHPUDDD 7 00000000008 oooooooooooooooool 8 9 0 00 000000000 0 xxx 00000000 10 0000000000 00000000000000000000000 u 12 PSALLOCG early 0000 OOOO PSALLOC eary 0 000000000 000000000 FAA PSALLOC early D O00 00000000000 UU 1 pos 0000000000000000 00 000 DD 00 000000000 200000000 00000000 2 348 0000000000000 usage aconsole stop s tstop t update u delete d indxget I O P Scheduler Server OOO O O P Scheduler Server JOO 0 0099008000 1 1 000090000 DU D UNIX podd00000000UNxpgp000000000000000000 Windows 000000000000 Windows 0000000000 Windows 00000 110 000 0 090 OM 200000000 0000000000000 Version2 0 Version 3
152. 167 6 00000000 e Scheduler Server GWOOOOOOOOOOOOOOOOOOOOOOOOGO aaa podd0 000000000000 00000000000000000000 168 6 00000000 63 ID ILU D ELO 111 D U DI 1 UUDDDDDDDDUDUDDDUDDDDDUDBDUDDDDBDUDDUUDUDUDU 00 Scheduler Server Facilities Manager 0 0 O QO Scheduler Server Facilities Manager poda 0 000000000 roupmax Scheduler Server Version2 0 0000000000 OOO 0232090000008 0000 00000000000 upmax Scheduler Server Version 707000000000 GroupAppomouse 00000000 6 01 200000000000000000000000 Groupmax Scheduler Server Version 0000000090
153. Oooo 0 0 0 0 etc hitachi setup i cdrom 5 H A 0 0000 OO uuu umount cdrom 0 0000000000 D Ub 1 PPp00000000000000000000 tar xvf dev rmt Omn 0 1 101000100 0001 001000000080 e etc hitachi_setup Y PP 1 1 1 1 D letc hitachi start 00000000000000 e ete hitachi bin SHOWPP J PPQODODODO Uu 10100 0 0 etc hitachi setup i dev rmt 0mn 15 3 1 0 0000 0 0 0000 O30 PPOOOUUOUOUO svp RMsv0 D D U D 000 AppoMan RoomMan 0000000 UUDDDDDBDDDUDUDDDDDDDDUDBD
154. 0 HACMPdata aryonvg HACMPvg ount HACMPdata ln s HACMPdata iki usr iki 5 Scheduler Server 0000000000 mount r v cdrfs dev cd0 cdrom H cdrom aix setup cdrom Facilities Manager 0000000000 6 Facilities Manager O00 0 1 0 0000000000000 mount r v cdrfs dev cd0 cdrom H cdrom aix setup cdrom 7 ju ud d adult cd umount HACMPdata 0 varyoffvg HACMPvg E CI L3 5 FO dut L3 Ll 3 DH lt 11 3 rg 0200000000000 co0000000000000000 0800000000 ad HP UX J O O HP UX0 0000000000000 000000000000000000 O O O Scheduler Server Facilities Manager Version 5 05 00 0000 DUUDUDUUDUUDUDUDUDD Versions 00000000000 Version 500 0 O 000000000 00000000000000000000
155. 0000000 s errno d 1 96 E 00000000 G ReadDBO 0 s lerrno d 97 E 0000 430000000 8 E 0000 430000000 OOOOOOOOOOOOOOO O OOOOOOOOOOOOOO 99 E 1 1 1 1 po 0000000 0000000 100 E 0000 430000000 1 Scheduler_Facilities 00000000 checkia 0 00000 101 E 9 000000000000000000 102 E 1 OOOOOOOOOOOOOO s 000000000 Scheduler Facilities 00000000 checkid p 00000 103 E 000000000000000000 104 E 000000 000000000000000000 105 E 000000 ee 1 0000000900 Scheduler_Facilities 00000000 checkid p 00000 371 QO 8 D SFimport 0 O SFexpor 8 ODO 00000000 Og Od 11 1 0 100 0000000000000000 o000000000000
156. 7 E E 7 ETE ETE gl iei mi al J T mi Bi uu 82 519 2 FTT PEA MADE 9 E E F F Ei a Bi F F F F iya iyisi kika pi B zl sa 8 I Fl 15 E F m m Ti Fl 7 In E l ua asd 0 L L3 E3 L3 E O L3 L3 L3 L3 0100000 11 0000000 Groupmax Scheduler Server Groupmax Facilities Manager Version 6 06 02 000000000000 O20 0000000000000 92 4 00000000 434000 4340000000000000000 ERE Bb Ba 8 Ol iFsizE Tere N El E Sia c Sia El a poddg0000000000000 00000
157. ugpnaggaggaaggggaagggmnagggnnagggunpnagagunpau OOOOOOO PN 191 7 0000000 7 4 BITECHGII LH 00000000 Windows NTOOOOOO UNNxpog0000000000000 0180000000 usr GroupAppo bin BITECHG SchedulePath logname 02000 D 1l SchedulePathJ 00000000000000 0000000 3 000000 e0200 logname 000000000000 lognamep 8 000000800000000000000000000000000 0000 bitechg log 0000000000000000 biteehg log L 0 00 O30 e 000000 e 100000 O40 00 e BITECHGCO0 0000000000 10000 10000 6553800000000 bitechglogQ 0
158. 0 8 1 0 00 0 0 0 0 00 0000000 00000000 e DTOBO DO DD BO DO DDD 00000000000 000000000000 0d08g00 000000000 000000000000 0000000000 usr GroupAppo bin GetadA11 gt 0000000 e GetAdAIQ 00000000000 0000000000000000 pod 0d 0000 00 0000 000000 000000000 F opa 0000 000000000 e Address Server Address Server 11 1 1 90 GetAdAID 00000000 hostsQOOO0O000000000 00000 000 000 000 l al umm Deenn pnunnuupnunnuapnauannudnpudand Dp gpupnnugpupnpnaugapupnpnaagpBappadabou OU DU DU O 000000 000000 000000 0000 1 Oooo 2200000050 aa 53 0 0 0000000 log etc bk po0000000000000000 ete podd0 000000 00000000000000 00000000 0000000 log cetadick dat 000000000 D e DOD0 000000000000 M GetAdAlM indxget 000000 0 0 bo E ES SE SE ES 182 7 0000000 D e
159. KOK KOK OR ck ck KOR R R K if bin grep USERNAME etc passwd gt dev null then else bin echo SUSERNAME is not a valid Username 323 Dot 00 000000 if bin grep GRPNAME etc group gt dev null then bin echo GRPNAME is not a valid Groupname exit 1 BINPATH usr bin APPOPATH usr GroupAppo GMAXPATH groupmax bin ININAME usr bin AppoMan ini SCHEPATH bin grep SchedulePath ININAME usr bin cut 34 if test f SBINPATH AppoMan then bin chgrp GRPNAME SBINPATH AppoMan bin chown SUSERNAME BINPATH AppoMan if test f SBINPATH RoomMan then bin chgrp GRPNAME SBINPATH RoomMan bin chown SUSERNAME SBINPATH RoomMan if test f SBINPATH SV then bin chgrp GRPNAME BINPATH SV bin chown SUSERNAME BINPATH SV if test f SBINPATH RMSV 324 bin chgrp SGRPNAME BINPATH RMSV bin chown SUSERNAME BINPATH RMSV if test f SBINPATH aconsole then bin chgrp GRPNAME BINPATH aconsole bin chown SUSERNAME SBINPATH aconsole if test f SBINPATH roomconsole then bin chgrp GRPNAME BINPATH roomconsole bin chown SUSERNAME BINPATH roomconsole if test f SBINPATH brc appo then bin chgrp GRPNAME BINPATH brc appo bin chown SUSERNAME SBINPATH brc appo if test f SBINPATH brc Appoarea then bin chgrp GRPNAME BINPATH brc Appoarea bin chown USERNAME BINPATH brc Appoarea if test
160. 5000000000000000000 60 100 12 16000000000000 0 0 3 uu Version2 0 Version 3 Version 50 O Version 6 B HH D B H DDD 1 1 pOOOOOOOOODOOOOOOOOOOOOOOOOOOOOA ooo 19 3 1 0 0000 0 0 0 34 00000000000000 aconsole Groupmax Scheduler Server aconsole 18 et RD IRAT tfusr iki A7 1 LOIRA RT RH RR RAIF ELR 3 BIBS AMAIA BB 03830027 4 5 7 HAL RABE 11MB 2221 8 1 8 gt gt FEAT lt ARROB HET HEAL T TRAT AE 512 3 LABRAR TEAT 8 Ya JVBIUERESEU 018 0285005 8 788 Groupmax ddressServer 000888 gt gt Address 5 5 LBFRU 10 Address AZ F IP7 F LZ 11 FES 03 12 EB BRO HRT 5 13 EFDA MI ROSE 045007 14 HEAL 15 4ddress BRA 277a F HEAL 8881018 GT 9111 5 7 8 pih Ah GroupmaxAddress Assist 3 8 gt gt lt lt Assist iets HEAL 18 1 psg090000000000000000000000 10 2000000
161. AppoMang OO 000000 roomconsolel OO 000000 RoomMan OO aconsoled OO svp D 0 O N N LE E Et 1 E 0000000 roomconsolel 60 06 E EE DOO Ono Fn 000 E 00 t 030 Scheduler Server 0 000000000000000000000000000000 1 BOgo gogo 0000 000000000000 00000000000000 Scheduler Client 00 0000000000000000 1 Scheduler Client 000000 351 DO P Scheduler Server OOO 352 200000 3apo0000000000000000000000 0000080000000 0000000000000000000 00000 0 1 DO 000000000000 000000000000 aconsole O Svp oO 000000 AppoMang OO roomconsolef O RMSVII 0 000000 RoomMan O Windows 8 00 0090000000000 000000000000 L3 L3 L3 r3 ow 00 Groupmax Scheduler Server Groupmax Scheduler Server Tool Groupmax Facilities Manager Groupmax Facilities Manager Tool
162. Scheduler Server Facilities Manager 0000000000 Dodd 00000 0 000000000000 8 Object Server Address Server 11 01010101000000000000000 O O O Groupmax Object Server Version 6 Groupmax High end Object Server Version 0000000 4 Integrated Desktop C SOOOOOOOOOOOOOOOOOOOOOOOO 1 00000 000000 O 5 9 5 000 6 po000000000000000000000000000 Scheduler Server Facilities Manager 0000000000000000 EHS BRA el a 0000000000000 0000000000 OOOO 21 000000000000 22 00000000 2 21 1 oOo 5 9 O 00000000000 31 om O O ET O 0000000000 m32 D 0 OOo oOo OOo oOo LET ET T EE El OOo oOo OOo ooo a E EX EE H OO 5 3 Oo O Oo O OO OO OO 2 2 2 DODODODDO IAN OM 200000000000 000 1 00000000000 000000000000000 2 0200000000000
163. a 4046 212 E EE 4 4 Et 349 DO P Scheduler Server OOO 350 0 1 O ETT e SEG E E E E Ed E3 Er EET E 0000000060 aconsoleQ DO 000000 AppoMang OO 000000060 roomconsole OO O RMSVO 000000 RoomMan ODO 020 0000000 000000000 Version2 0 Version 3 Version 5 Version 6 Version 77 000000000 1 po OOOO 000000 05005000 0 0 000 000000000 0 aconsoled OO D 0000000060 WD roomconsole OO RMSVI D 00000000000000 00000 usr GroupAppo bin AppoSV ini 1 1 1 e usr GroupAppo bin SFagent ini 1 000000000000 00 D 00 Oooo D 0 0 0 0 0 Vusr iki 0 000000 0 9 00 1 8 0
164. 000000000 10000000000000 podd0000000000000 00000 1 Ooo Lr oo G T oo Lj E OOO 4d oaa oo oo 849800580 L3 L3 L3 L3 L3 L3 ooo T r3 E L3 L3 E oOo L3 L3 2 ws E O 0000 MMQQ 0000000000000 2000000 40000000000 pH O O 20Oooooooocooooooooooomooloola 19980 00000000000000 120000000000 19980 0000000000000 000000000 1000000000 00000000000 1000000000 4 poxp 0000000000000 000000000000000000000
165. 10 0100 00 0 poxp 0000000 0000000000 000000 000000000000 0 4144 Q000 Scheduler Client 0 OOOOOOOOUU00000000000000 c000000000000000000000 Scheduler Cliet 0000000 10 Scheduler Client 000000 1 po00000000000 116 4 00000000 Dal 454000 0 Scheduler Client 0 454 p00000 000000000000 LIE Den 0000 1 000000000 Scheduler ClientQOOOOOOOOOOOOOOOOOOOOOOOOO 3000 0000
166. 2111111011101 1 0 1 vusz bin svOOOOOOOO OOOO AppoManf 000 4000000000000000 usr bin AppoMan 0000 O Cy usus SE sm 0 0 0 EEE EJ EST 5 nar S 1 BE Ee DL Ea EI D 0200000000 poda 0000 000000000000 00000000 00000000 poda 00000000 0000000000000 00000000000 po00000000000 1 1101111000 rotp 000000000 2 ete localrec DOO DO 0D 00D 0000000000 etc localre if test usr bin brc appo then fusr bin bre appo fi HP UX AIXQ OOO etc localrcQOHOOOO000000000000 brc appo OO DO BO 00 000000000000 0000000000 37 3 1 0 0000 0 0 D O bre appo 00000000000 bin sh Licensed Material Of Hitachi Ltd All Rights Reserved Copyright C 1995 1999 Hitachi Ltd PWDPATH pwd ININAME usr bin AppoMan ini SCHEPATH cat ININAME grep SchedulePath cut c14 LOGPATH SCHEPATH og if test x usr bin SV then if test LOGPATH then cd LOGPATH fi lusr bin SV usr bin AppoMan cd PWDPATH 3 2 2 Facilities Manager 9 21 pog0000000000 000
167. 7 7 fsa aid SEL fl Att BIATADGAWRANE fh A0 3 WAKE E Sereno TWA 2 0000 sDoooooooogooooo 000000 8 000000000000 000 A00000000000000Dasya0 000000 3 pgug0000000000000000000000000000 200000 100 000000000000 000000004000 00000 4poxpog000000000000004000000 000000000000 podd0 000000 000000000000 po0000000000000 000000 0000000000000000004 1 AD000000000000000 0000000000000000000 4 00000000 IDO kantp 0000 000 0000000 0000 2 3 poxpgg0 000080000000 0000000000 000000000000 000000000 0200000000000 pod 00000 000000000000 sgg00000 00000000000000000000 00000 O480000 OO0000000000000g0 1H PEERAGE CAVA FAMA ka
168. A OG Scheduler Client grpname dat Scheduler Client ikifile dat AAA A Scheduler Client youfile dat O Scheduler Client appouenv ini Scheduler Client annilist dat Scheduler Client rikfile dat E Ead ryofile dat Facilities Manager Client 0 Facilities Manager Client J ROOMENV INI 10000 Facilities Manager Client rgrname dat Facilities Manager Client rgrmem dat Facilities Manager Client 0 mobile ini Mobile Option gamuenv ini 000000000 WWW for Scheduler 0 0 servenv dat e 00 WWW Appomouse 00000 1 nsd 1 000000000000 rsd emb roominfo rm pnpuaupnupnupapnapnan ngsche rm 000000000 img gg0000 0000000000000 RsvRule rm lt 04400000000
169. N EL ERE ESE oP Ee LS 26 80 m J 0000 1 1 Co E Co Co L3 LE a ooo gt 97 85 91 KFCG5085 ddress Server KFCG5091 Scheduler Server p p rn oOo oOo Un Un 000000000000 Server Address 000000000000 000000009000000000 53 a gooi R Ww gr gt gt 28 92 i 0 000 0000 0 00000000 c000000000000000000000 2 0000000000000000000000 00000000000000000 29 101 000000000000000000 000 000000 000000000 Co 254 8 00000000000 0 Scheduler Client J WWW 0000 for Scheduler 0000 30 498 499 i 000000000000000000000 0000000000000000000000 2 0000000000000000000000 31 501
170. Object Server Address Server 0000000000000 Groupmax Scheduler Server usr GroupAppo bin SFpakage s SV TEP Ss 1250 7 then exit 255 fi Pu uus c DE s AppoMan DO 0000000 if 57 1 O then exit 255 fi Groupmax Facilities Manager 1 D Facilities Manager 0000000000 usr GroupAppo bin SFpakage s RMSV 000 TES Tose mL then exit 255 fi usr GroupAppo bin SFpakage s RoomMan T 52 1200 then exit 255 fi exit 0 Dbn nmnadpu bin sh stop Groupmax Scheduler Server usr GroupAppo bin SFpakage e SV O00 usr GroupAppo bin SFpakage e AppoMan Groupmax Facilities Manager 1 Facilities Manager 0000000000 usr GroupAppo bin SFpakage e RMSV OOO usr GroupAppo bin SFpakage e RoomMan 00000000 Groupmax Address Server Groupmax Object Server L address Address Serverl Object Server J 0000000000000 exit 0 bin sh 1H U D U D monitor amp Groupmax Object Server Groupmax Address Server O Address 1 Object Server Address Server 11110100010 0000 00 Groupmax Scheduler server 1 usr GroupAppo bin SFpakage r SV if then echo monitor Groupmax Scheduler Server down exit 255 fi usr
171. a Bono o 6 5 1 PW e DT P o 4 wan Ey YH pen 45 ET E LE 0 00 00 gt gt nooo o a 31 1 sooo Q00 gt A a m a OOO 5 22 Server 00 i oooo 80pg 98 mnm93m HiBmumimumiumt mu 1 ES 14 0000 H etAdAll indxget O O Scheduler Server OU 0 0 0 0 Scheduler Server 0 O 0 1111110100 GroupAppolbin GetAdAll lck 99 Erre l 0000000000 0000000 xong DOXXxXxXppongg0000 0000000000000 errno Y Y Y Y Dg00 00000000 000000 000000000 100 Erro 00000000000
172. 0000000 4 000000000011 0 00 xxxf 2 o o 800000 1000000000 1000000000 01 1 TOPHIPHDDD 7 0000000000000 0080000000000 8 0 000000000000 0 00000000000000000000000 9 000 0000000000000 10000000000000000000000 xxx 00000000 10 00000000 0 10000000000000000000000 1 000000000000 10000000000000000000000 12 0 0 PSALLOCQ early 000 OOOO PSALLOC ealy0 000000000 000000000 E PSALLOC early D 00000000000 00 0 4 lt lt D gt gt DD D UL gt 0 000 11 1 1 D 347 QO O aconsole roomconsole 000000000 Dn 00000 0 5 68880000000000000 000000000000000 D I xxx 00 00 00000000000011
173. 200000000000000000000000000000000M00000 UUDDDDUDDDBDUDUDDUDDDBDBDDUDUDDDUDUDUIIDDBDDUDUDUDUDUDU 000000000 30090000000 000000000000000000 40000000000000000000000000000M000000000 podd0 000000000000 0000000000000 00000000000000 00000000000 1000000000000 20000000000000000000000000000000000000 OA 00000000000 20000000000000000000000000000000000g0 300 Oodo000 000000000000 poxp 00000000000000000000000000000000000 0 D 4 143 1 1 DD 00000000000000000000000000 000 10000 114 4 00000000 9 po00000000000 D1D0000000000 00000000 pod 000000000 00000000000000000000000000 00000 45800000000000000000000000000 0453
174. o O O o El o O O O O 5 9 O O 5 9 00 UUDUDDDUDDDDUDUDUDUDDD 6 L1 sss O 51 Ea EE 1 1 4 1 E ESTE EST O O O O 5 o 5 9 00 2000000000 Scheduler Server Facilities Manager 201 1 1 11 111111111 191101010000000 00 indxget Hl 00 000000 0D Scheduler Server Facilities Manager 0 1es eee Scheduler Server Facilities Manager 000000 etcOOOO0000000 0000000000000 iog etc xsp00000000000 po0g000000000138 00000000000 00000000000 00000000 indxget 0 D po0d000000000000000 og etc_bk podd0 000000000 000000000000 0000000000 pod 00000000000 000000000000 00000000 1100000 0 0 15 AddressQ 0000000000 GMAXSYS 6 Address 0000000000000 GMAXSYSOOOOOOOOOOOOOO
175. var opt GroupMail Groupmax GroupApp item def 0 0 r rrr Lr po00000000000000000000000000 Address Server 0000900000000 aconsole OO 0000000000 AppoMang OO 11000 1 roomconsolel OO RoomMan OO 00000 WindowsgOOOOOOOOOOOOOOOOOOOOOOOOOOO 0o Groupmax Scheduler Server Tool bo Groupmax Facilities Manager Tool t p400000000000000000000000 11 Windows 000000 UNIX 000000 Scheduler 0000000000 poda 000000000000 000000000000000000000 UNXDO00000000000UNIXpOo 000000 bitecgi 11111 D D 000 po0000000000000000 UNIX Windows po0d00001 000000000000000000000000000 12 UNIXQ 000000 UNIXIJ 2 13 00
176. 000 OO DU DU 000 DU 11111 1 01 LR http ww hi tachi co p sof t nanual 0000000 1 ROM 1100 0 00 ORAM 2000000000 00000000 00000 20000000000 000 0000000000000 00000000 00000 RMOOOOOOOOOOOOOO 00 00090000000 0000 E E PS Eh AEST 0 0 00000 vei 0000000
177. B d HB B HH D B D shift JISOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOO 1 0000 000000000 0100000 0 0 0000 0 000 0 00 e D00 WANO Dg00 00000000000 00000000000 0 L3 L3 9o 5 O oOo O 11 1200000 010000 0000 0 20000 00000 ABC 000 000000 00000 eduler Server D 0000 Facilities Manager 00 Serverppg0000000000000000000000000 DO 0 0 Oo Lr noo nooo 12 Foo 9 m m n 13 0 Lr Oooo 0 e E c 5 Sched EX eee re uE HosrcHGOOOOOOOOOOO
178. GMSCHCT System Agent TCPAPQODODO GMSCHRS System Agent TCP IP U GMSCHST System Agent TCP IP 000090 oo GMSTPSCHC System Agent TCP IP 1 000090 F yup oo GMSTPSCHC System Agent TCP IP U P usr GroupAppo SHistory inf Scheduler Server lusr bin AppoMan Scheduler Server Du SV Scheduler Server 000 nn aconsole Scheduler Server 000000 uu brc appo O A 2 Facilities Manager 0 1 00000000000 00000 OO OO groupmax SystemManager GMFCLDT IN System Agent TCP IP OOOO ppinfo F 0000 usr GroupAppo bin GMFCLCF System Agent TCPAPO0 O00000 00000 DD GMFCLCT System Agent TCP IP 00000 207 00A DDUDDUDDUD 110 10 0 0 GMFCLRS System Agent TCP IP I GMFCLST System Agent TCP IP D uuu GMFTPFCLCF System Agent TCP IP 00000 D uuu GMFTPFCLCT System Agent TCP IP B 10 D uuu usr GroupAppo FHistory inf Facilities Manager 000000 lusr bin RMSV Facilities Manager 400000 DO RoomMan Facilities Manager
179. po000000000000000 t0g Apporock daat 0000000000000 0000 Scheduler Server J0008000000000000000 293 00B 000000 HOB 11 1 n 0 ttl Scheduler Server Facilities Manager LH 00000000000 Od Og u t uU atat 0000000990 00 00000 0 100 000 IDINDX idx 00 0 00000 500 MAIN idx 922222 uid 3 2209229992 4 50 MAIN idx 922222 uid 3 2922999999 4 0000000000 500 GATEWAY idx 0080800000000 100 000 29929297 gst 5 OOO 131 1 1 1 0 500 guest idx 2 500 BOSS tbl 9818100111 500 00000000 200 Damm 20 KENNIN log 00000000 00000 100 ikifile dat uuu 100 youfile dat 1 1 1 1 80 grpname dat 30 grpmem dat 0000000 500 1 U 30 annilist dat uuu 10 000 IDINDX rmx 000 00 500 MAIN rmx Ger 222 vid 7 1 1 1 80 MAIN rmx 299999 vid 7 11111 10 t 128 EQP tbl 1 1 212000000000 OOO 100000000 Dx 1 1D0000000 294 18 000000 Dx 2 188880000 000000 0000000000 000000000000 000000 MAN idx p090090090000 000000 0000000000 2688200
180. 0 0 OO rr 0 O 0 O 0000 sockets timeout 600 Moo Q timeout DODBODO 0D 0000000000000 0000000000 2000000000000 00 SF32SYSini 0000000000 08g0000000000000c00000 000000000000000000C appomous bia O D 0D UD EJ 262 8 00000000000 8 2 Assist SFdatacp O ERE ES Assist 0 SFdatapgOOOOOOOOOOOOOOOOOOOOOOOOOO 821 Assist Assist Assist Viewer Address Server 1 O O Scheduler 10 11 1 1 1 O AppoMan RoomMan 0000000000 00001 000000000000000 0 AppoManf RoomManf 000000000 UUDUDDUDDDBDDUDDUDDDDBDDUDUDUDDDBDBDDDD Facilities Manager 100000000000000000kRomMaapgoo 00000000000 ugaguggauggggaggggaggguggauggggagdggagaguuutu 0000000 1eg agent ScheExec 1og 000000000000 usr GroupAppo bin SFagent f logfile name O 002 00002 2 Assit 00000000000000000000000000000000 5 1es asent Scheexec 1esg 00000000 usr Gro
181. 5 5 FO TERR e R5 DO 000000000000 0000000000 Address 15 Address 0000000000 GMAXSYS 15 00000000000000 podd0 000000000000 0000000000000 D poo0000000 0000000000000000000000000000 000000000000000 72 GetAdANQ OOOO 0 007 1 1 Assist 0000 Groupmax Address Assist GroupmaxJ 000 00000000000000 opa g00 0200000000000 00000138 08000000000 DODO 0000000 0000000000000 16 Assist D d 0 0 pogo 0000000000000 0 1300000000 000000000 Address Server 000000000000000 5 1 Groupmax Address Assist Groupmax OHOOO000000000H 24 3 0000000000 O20 000000 Scheduler Server 0000000000032 00000000000000000 000000000 03000000 Scheduler Server 1 0 O40 200000000000 00000000000000000 oooooooom32 0000 060 s80000000000000000000 6880000000000 03300000000 RF 8 QCPREATIA IBUER Em RAD TE BH S o PR RIE Pk RS 1 0000000 O4 0000
182. ou EJ Org E Gil 23 D 24 0000000 Gxxxx 000 O 2 0000000000 0000000 _stat xxxxx 00000000000000000D0ete0000000 00000000000000000 26 00000000000 1000000000000000000000000 27 000000000 DD 28 00000000000 DD 29 00000000 DD 30 00000000 DD 3 00000 0 DD 32 000000000 n 33 000000000 DD 34 000000000 DD 3 000000000 DD 36 0 000 000 DU 37 0000 666 0000 Address ServerOOOOOOOOOOOOOOOOOODD 000000000 000000 329 M 0 GetAdAll O indxget OOOOOOOOOOOOO D DDDDD DD D 38 00000 OO 90000 39 0000000 1000000000000000 0000000 100000000000000000000000000 100000000000000000000000 40 00000 00000 OO 4 0000000 1000000000000000 0000000 0 100000000000000000000000000 4 00000000 8000000000000000000 0000000 0000000000000000000000000 8 8 80800000000000000000 0000000 9800000000000000000000000000 1000000000000000000000 000 000000000000000000000000
183. q 1 d Q 3 3 3 6 Cd YN 2 2 s 1 Er ooo 10 OO Goo heduler Schedule Gt D U cheduler Scheduler 65 TYT r3 i i rac 111 1 L3 O Co oO PP m L POS J ruse Coy DLL mo 2 o ct Foon gq ELE y 4 c r moO 6 HE 3 O El 20000000 oO oO oO oO 000000 L3 HO HO O HO cheduler cheduler lodo ull saa Qnm tH E B 531 Eni E E p y r3 EJ E r3 1 L3 EJ E EJ Onno L3 r3 E r3 On 258 8 00000000000 DO Scheduler Client WWW 000090 for Scheduler 00000 44 13001 1 13002 13003 13004 Co IJ oO oO 11111 0 PC Scheduler Server ikisak1 Facilities Manager adOOOOOOOOOO O O O Services O OO
184. u ut DODO DO DO DO DO DO DO 0000000000 0 0 0 0 0 0 Iv 1 0 0 0 0 O 0 0 0 0 0000 0 O 0 1 Oooo ooo O 00 O O OSVO RMSV 0 000000000000000 podd0 00000000000 00000000000000 poo 000 0000000000000 podo000 00000000 0000000000000000 00 000000000000000000000 000000 o0 erechgd 0000000000000 p00000000000000000000000 Scheduler Server 1 ulimit 0000000000 000000000 1000000000000000000 podd0 000000 000000000000000 erechgpo000000000000000 00000 po000000000000 080000000000 rs 0 O 00000 O 00000 000000000000
185. 0 Oooo EE E E El Oooo u heduler e UUUDUUUDUuD 00000000 Assist 0000 acilitie 000 3290 Eig EH 12 50000000 s E c erver anager 0 O 0 0 E EE E ET DU DU 000 0000000 0 78 erpchep 0000 pod00000000000 0200000 e Scheduler Server Facilities Manager B Hl B i HB H B BH BH BL BE HL D D ssist JO 0000000000 00000 0 00000000 Assist Viewer O Address Server 1 H D DU 3 ogo 2 0 0 0 0 0 DX dE S mam EY E EE EY E Ooo sM uu u Ooo a gt ct O O O O
186. 00000000000 00000000000000 ool po t000000000000 gt gt 000000 ER 00 Uu 33 34 35 36 7 0000000 00000000000 000000000 Ctrl Break OO 0 Scheduler Server 0 Q 00000000000000 Scheduler Server Q 00000000000000 Ctrl C DO 00 3000001000000 00000000000000 0000 0000000001 E 40 41 42 43 236 7T 0000000 00000 1 8 0000000 0 0000 0000000000000000000000000 1 0000000000000 0000000000000000000000 0000000001 0000000000000000 0 000000 000 0000000 00000000000001 00000000000000000 0000000000001 ED00000000000000 000000 00 000000 00 1000000001800000 00 000 00
187. 100000 enn 0000000000 69 8 1000000000000000 0000000000000000000 70 E 10000000000000000 0000000000000000000 1 jE 10000000000000 72 1 96s DD 73 OO 74 OO 75 0 76 Ej E 000000 00000000000 0000000 369 QO 8 D SFimport 0 O SFexpor 8 ODO 00000000 uu OO 1 17 E 0 440000000 Psi d 000 pAadd 000000 00000000 78 E 0 440000000 Psi 00 0 uu 79 E 0000 11 11111111 11010 U 11 11111111 111001 80 E 9 1 1 0 81 E 0000000000000 0 0000000000 080 JE 09 0000000000 100009090000000080 83 E nooo 4 E nooo
188. 2 43 4 0000000000 SFimport 0000 SFexport 00000 UO 31 164 165 203 204 205 208 220 221 225 230 250 287 287 288 290 291 318 319 337 340 343 345 346 347 347 348 364 365 366 374 U 1 U 2 U 3 U 4 U 5 U 6 U 7 V 1 V 2 HP UXO D D l D AIXD BUD D OO D D D D D AIXD DDD 00000000 LJ I i I EE iio OO oO OO 1 oO OOO ajaja ata wani D OO 0 00 384 385 386 387 397 397 398 419 420 xi EHS L 11 TCPIPQOOUO 12 000000000000 13 00000000 1 00000 000000 0000 1 4 TCP IP 1 POOOOOOOO po0000000000000000000000000U0 Scheduler Facilities Manager QQOOOOOOOOOOOOOOOOOO P000 00000 0000 O20 0000000000000 po00000000000U0 Sc
189. AgentControl 0 000000000088080008808 0 08080 000800 040 Di n DD HDD LI 9 0000000 000000 0 Assist Viewer 0 000000 Address Server 000000000000000000000000 Scheduler Assist p000000000000000 JJI 0 D D Assist 000000 po0000000000000000000 p0000000000000000 Scheduerpg00 0000000000000 po0000000000000000000 H Assist 0 0 0 O SFdatacp D po000000000000000000 sis00000000000000000 00000 al Groupmax Address Assist Viewer Assist Viewer Address Server 0000000000000 Assist Viewer O 00000000 Scheduler Assist 00000000000 O O O Assist Viewer 0000000000000 0 Assist Viewer 1 D 0000000000 Groupmax 0000000 Scheduler 400000000000 po0000000 pod 0d 000000 00000000 147 5 Groupmax Address Assist 0000000000000 0009900009900 000 1 1 0 1 111 1010 0 0 ieg agent Sch
190. E 41 EL ES ET 3 1 E37 6 E Ed EE ma 5 H g as Er 01 71 a Ed oe eer ere Es Er 3 El E ee q E al Ooo Oo oo ODO Oooo OOO LEE LE OEEEgE gI CI cc 4 48 40 40 EET EER ET Ea ESI EST LZ ESI ooo DCI O O o 3 0000000000 D ugmagapngaggupnpnupngaunpnpsgsaupnpna apgaunn 00000000000 130 168000000000000 pIPg000000 os O ep 100 12000000000000 eu 10120000000 1 60 10 2000000000000 000000 os
191. Version7 800000000000 4 gt 6 000000000000 003 0 8 00000000000 Address Server 0000000000000000000 0000000000000 var opt GroupMail Groupmax GroupApp item def 9 AddressServr D 0008000000000000000000000000 1 Address Server 0 00 000000000008000000000000000 2 00000000000000000000 O BJ o O O 297 OOD 1 1 10 10 aconsolef OO 00000 sva 000000000 AppoManl OO 11 roomconsolef OO RMSV IJ RoomManl OO N Ea 0000 D000000000000000000000000000 Pr 00000 020 gt
192. checkid 1 chkorder nnnnnnnnnnnmn 1 1 O indxget Address 00000000 1 sortdate FL ET FL FT EL ET FL EL FEL 1 FL 1 1 3 ts2kana rul o usrchg 000000000000000 1 Eu Ooo param0 ini param1 ini 1000000000000000 1 00 WA og param2 ini n Aasya csv SFimport 0000000 og Casya csv oOo 0 Dasya csv OO 0 SFexport SFexport 0 SFimport SFimport OQ usr GroupAppo GroupApp item def sch2 Assist 000000 1 usr GroupAppo lib libgadr1 sl Address 0 0 DLLO OOO AIX 1 usr bin AppoMan ini apposv etc 000000000000 0090 2 apposv log 00000000000000 x 2 usr GroupAppo tmp 1 00000000000000 2 apposv log agent Assist 00000000 2 289 00A DDUDDUDDUD ud u uu 2 apposv room varlopt GroupMail Address 00000000000 1 Groupmax GroupApp 0000000 var opt GroupMail item def Address 0000
193. doo 000000 0000000000 0000000 E EE LS E 3 ES E malu C3 E3 EJ a DE OO 3 9 E cc 00000000 OUP tbl 1 00000 O0 ORGGROUP bI 00000 000000000 OFF tbl 0000 ORGGROFF tbl DB 1 D E E HE r EE SAFO RE 0 0 0 0 RGG 00 00 RGG D D 0 R 0 0 Lc DD n pp E EST ESTY ES 1 OO OOOO 00 125 127 129 129 132 133 134 136 137 138 140 216 223 226 229 230 231 231 231 271 272 273 274 278 281 282 283 381 385 386 DD 1 1 1 2 LL Scheduler Server O D Facilities Manager O 3 1 6 1 6 2 7 1 7 2 7 3 O 0000000 000000000000 log 0000
194. 0 2 2 3 Bo ea eo GOGO C3 rc 2 7 114 ORGGROUPRI tbli O 208 7 0000000 000000000 csvoogog00 0182000000000 7 4 ORGGROUP tbI DB D B OOD uu 000000 00000 0x0D 0x0A UU m9000 sgo000 000000000000 2200000000000000 D 200000000 0000000000 02030 400000000000 oppo0000 000000000000 00000000000000 2000000 0000000000000000000000000000000 4 SV mi OutOrgGroupSecurityQ OOOOOOU00000000000000 oOo DU 000 DU 000 Ere E Ke pol o 00000 podd0000000000000 00000 D mpnpnagapnunnugpunpn ugapapnpnadabou mu 200000 0000 tkar po 000000000000000 kanri a 0 0000000
195. 15 0000000000 F C D x x x X x x 16 0000000000 F G A O O O Xx x x x x 17 G C A x x x x x x 18 F G D 9 x x x x x x 19 1 0 0 F U x O x GO UO G O x gt 20 0000000000 F U C x lt x A x x 21 0000000000 F U C x x le A xxi 22 100 0 F U D xe x e x x 0000 CO 000000000000 090 eo 000000000000 00000000000 209 7 0000000 An DO FO 60 SEU O 0D 00 000000000000 O40 0000000000 000000000000 pod 000 0000000000000 pod 00000 000000000000 Jad e Scheduler Server Facilities Manager OO L usr GroupAppo bin Aasya csv e Scheduler Server Facilities Manager 000000000000 D D usr GroupAppo bin SFexport a QO000000000 SFexport 0 0 000000 I 7 10 3 000 0000000000000000 SFexpot 0000000000000000
196. 400000 000000000 40000000462 HOSTB 00000 00000 00 000000000 00000 OOOO gt 6 0000000 0DNspo00000000000000000 7 DNSPp000000 0000000 40000000000 2013000000 oO 2 oO OSTA 20013 40000000000 000000 BO 09900 00 08 06 000000000 62 OO GWOOOOO0UU0000 00 HOSTA 20013 00000 5 9 go mma EIE E ESI EI 121 12 ES o0 El EE 0 40 OO J 315 1 100000000000000 00000 00000 316 Duk
197. 9 Scheduler Server Facilities Manager 1 D 1 1 111 1 D H Dodo 00 000000000 00000000000000000 DODO 00 000 000000000000 00000000 1000000 001000 4mMBpo0000000000000020 3000000 3 0000000000 OOO0M32 go0000000000000000000000000 04d 20000000000 00000000000 poda 000000000000 00000000000000000 pogo 000000 000000000000000 e Scheduler Server D Facilities Manager O OHOU0O00000000000000 po0d0080000000000000000N po000000000000000 0500060 poda 000000 000000000000 00000 1 0 0000000000 Scheduler Server Facilities Manager 0000000 ooo OHOU000000000000000000000000000000000000 9000000000000 000000000000000O gag 000 00 0000 000000 000000 000000000000 1 0000 000000 000000000000 OHOU000000000000000000000000000000000000 OHOU000000000000000000 Scheduler Server 0 usr GroupAppo bin TraceSV lck Facilities Manager usr GroupAppo bin TraceRMSV lck 1 0000 00 0000 000000 000000 000000000000
198. O P Scheduler Server O 1 pap 0000000000000 0000000000 Scheduler Client 1 Scheduler Client 000000 200000 0000000000000 s 000000000000000000000000 2 000000000000000 000000000000 000000000 poddg 0000 000000000000 1000000000000 0 aconsole OO 00000 AppoMan OO 2 000000000000 CD roomconsole OO RMSVOOO RoomMan OO OOOO Groupmax Scheduler Server Groupmax Scheduler Server Tool Groupmax Facilities Manager Groupmax Facilities Manager Tool a3 pog0000008000000000000000000000000 0 000000 0000 0000 000 usr GroupAppo bin AppoSV ini 0000000 usr GroupAppo bin SFagent ui 0000000000000 WindowsQOQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOGO e 00000000000000 e 0000000000000 Ylog e 00000000000000 Yroom Facilities Manager 000000000 e 00000000000000 YbinYApposv imip 0000000 00000000000000 YbinYsFagent imip 0000000 O0OUO0000000000000000000000000000WOO000 ooo usr ixkilOOOOOG Duunugnuanuagapugmaunaugpnuapnadgpadnru u
199. OOU000000000 gt E 0 Gy ETE EIE EI LI LJ tA 21 E TER EJ sooo O L3 L3 0 D 3n 000 e 000000 e 100000 040 80 Address Server 0 010900900000 0000100 O 0 0 0 0 0 0 0 0 0 0 O 20 000 1 Address Server QQ 7 0000000 00 p000000000000000000000 po0000000000000inegetpo00000000 p00000000000000000000 Address Server 0000 0000000000000000Getad4a4g0 000 00000000000 indxeet00 0000000000 000000 0000000 Address ServerQ 000000000000 OOOO Address Server 0000000000000000 Address Server D 0 D 0 D W000 O O 0000000000000 Address Server 0000000 ddress Server Scheduler Server Facilities Manager 00000000 OOOGOOOOOOOOOOOGO D O Facilities Manager RMSVE D DD D RoomManf JU UH LU H e Scheduler OOOOOOQOU000000000000000000000000
200. ad HP UX O O HP UX0 000000000000 1 0 42000000 D 00000000 RFP UXO 000 un D 1 000 1000000000000000000 dev dsk c3t040 2 000 2000000000000000000 Idev dsk e3t0d0 1 Scheduler 0 00 Oo 0 000 000 000 7 Scheduler 0 0 0 dev vg03 lvol1 gmaxpkgd 5 Scheduler 00000 000000000000 6 Scheduler Server Facilities Manager 00000000 gmaxpkgd iki x Scheduler 1 0 0 O O O Scheduler Server Facilities Manager MC ServiceGuard GroupmaxOOOOOOOOOOOOOOOOOODO 000 384 U 2 00000000 IST TARA F gmaxhost 172 1 1 3 A aa Sk Wa qa yayaku Wa Sa ap aa 36 aa 25 eS A A 2 2 25 aS SZ ssp a NPP Sa Re iy fa F 0661 IP FLA 172 1 1 1 dev ve03 lvoll VOVREFALIRY gmacxpkgd Tki log AppoMan T gt 2 274 L iki log AppoSV ini usr iki usr bin AppoMan ini usr GroupAppo bi n Scheduler iy 7 Z FH 5747 D b AIX D D D fa F 0062 IPP ELA 172 1 1 2 JL 274 usr iki usr bin AppoMan ini usr GroupAppo bin AppoSV ini U2000 U 38000000
201. ck ck ck k k lt k k k k kkk d Note This file MUST be edited before it can be used kkkkkkkk For complete details about package parameters and how to set them consult the MC ServiceGuard or MC LockManager manpages or manuals k k k k k k k k k k k k k k k k ck ce k k k k k k k k k k k k k ARA k k k 1k ck k k k k k RAR k k AR KKKK Enter a name for this package This name will be used to identify the package when viewing or manipulating it It must be different from the other configured package names PACKAGE NAME gmaxpkg Enter the names of the nodes configured for this package Repeat this line as necessary for additional adoptive nodes Order IS relevant Put the second Adoptive Node AFTER the first one Example NODE NAME original node 409 410 NODE NAME adoptive node NODE NAME nodel NODE_NAME node2 Enter the complete path for the run and halt scripts In most cases the run script and halt script specified here will be the same Script the package control script generated by the cmmakepkg command This control script handles the run ning and halt ing of the package If the script has not completed by the specified timeout value it will be terminated The default for each script timeout is NO TIMEOUT Adjust the timeouts as necessary to permit full
202. e c Qa 5 1 E T 2E 5 4 gs Oooo Oooo ET ee El 0 O 0 0 C3 C3 C3 L3 r3 C3 C3 EJ EJ EJ E C5 E 0 LE C3 C3 C3 r3 L3 r3 C3 E 0 0 06 LE E C3 C3 C3 r3 L3 r3 C3 C3 0 0 0 0 0D 4 0 3 EI Ez EEE EE EJ LE B BAI 00 00 142 Groupmax Address Assist UUOLULUL 000000 Groupmax Address Assist 1 D E 1 1 1 11 1 1 5 1 Groupmax Address Assist Groupmax OOO 52 000000000000 3 D D 143 5 Groupmax Address Assist 5 1 Groupmax Address Assist Groupmax 1 11111 Groupmax Address Assist Groupmax 000000 Assist D 00000000 Address Server 00 00000000000000 Seheduler 00000000 Scheduler D Groupmax Address Server Version 6 Groupmax Address Assist Viewer Version 6 Groupmax Address Assist Service Version 6 Groupmax Scheduler Facilities Version 7 0100000 2009000000000 Scheduler Server Version 6 0 Facilities Manager Version 6 J 00 0000
203. q OOOO 158 5 Groupmax Address Assist 0 0 1 411 11111111114111 111 9 usr GroupAppo bin SFdatacp m filename f logfile name DO 0100 Im filename 000000000000000000 podd0000 000000 000000000000 000000000000 000 Assist 000000 0000000000000000000000000 0000 po000000000000000 etc mv tb1 000000 4ssist 0000000000000 000000000000000 0200 flogfile name 000000000000 logfile name 000000000000000000000000000000 0000 SFdatacp lgQ 0000000000000000 00 SFdatacplogQ OOOO a 0 D 0 1 0000 060 0000 SFdatacp 00 00000000000000000000000000000000 000 Dad 00000000 SFdataepQ 00 00000000000000000000000000000000 podd0 00000 00000000000 00000000000000000 00000000 Assist 0 00 0 SFdatacpf 000000000000000 159 5 Groupmax Address Assist po000000 0000000 000000 0 1es agent D 00 1
204. x w we aj aj A wl N e 11 12 13 14 000000 15 s2 16 17 tw 18 td 19 20 tx 21 cw 22 cd 23 tf 24 kf 25 pc 26 uf 27 28 29 30 318 31 9 00 JUD UUUDDUDUDUDUDUUDUUDUUDUDUDUUDULOGSV csv ook Do00000000000000 LOGRMSV esvH OM 8000000000000800000000000 100000000 O K 2 Facilities Manager 0 000000 0 0000 rt 000000000000 ro 000000000000 2 rw 00000000 3 rd 00000000 4 re 111090 5 rr 0000 6 rx OOOO 7 ra 1 8 ri 0000 9 rf 000000000 10 rz 11 rm 0000 12 kr 0000000 13 rp 0000000000 14 rj 000000000000 15 319 OL umnt Bau Scheduler Server Facilities Manager 00000000 roth EO D D U 1 D D pod0d
205. 0 EJ EJ EJ EJ EJ C3 EJ EJ EJ EJ EJ C3 EJ EIE 21 21 1021 21 1 21 2 6006050060604 C3 EJ T oo OO res 46 410 4 48 EST 5 E s ET ED E E EE 3 p 4 1 EI EL O DO DO DO Address 00 00000000000 8 0 pod00000000000 0 0 rrr O 00 UD 00 DO 00 OO000 OS Windows NT DU 000 BIT 0 0 D m Lr D DO D u L1 O 00000svg00 Windows 000000 UNIX P Scheduler Server O Object Server Address Server Do0g0000000000000000 00000000000 000000 O vetcQOOO00000000000 000 l romp 00000000000000 000 YbinYAppoSV ini 00000000 pAppo bin 0000000 YbinYSFagent ini 0000000 upAppo bin D DD 0 D U po0000000000000000 ID 0 40000000000000000000 0 Address Server
206. 0 00000 040000000 0000000000000 0 0 0 sr GroupAppo bin Dasya csv 0 00000000 podd0000000000000 Dad 0000000 00000000 DasyacsvB 0 AQ0000000000000000000000 podd0 000000000 000000000 DasyacsvQ 0000 0000000000000000000000000 0000 000000000 000000000000000000 I1D000000 218 7 0000000 00000000000000 00000000 00000000000000 1 00000 0000 0 O 0000 O O 00000000000000 t a E ua Bm s cd usr GroupAppo bin 3 0000000000000 SFinportOOOOOOO Dasya csv usr GroupAppo bin SFimport c Dasya csv usr iki 4 0000000000000 SFimport lH 000000 1101 01
207. 00000 224 SFimport 203 SFimpot 000000 214 SFimport 203 SFimport 0000 212 SFimport 0000 214 SFimport O00 216 SFimpot 000000 205 SFimport 00000 365 SharedMemory 32 sortdate 195 T TCP IP 2 171 TCP IP I DDD 2 Todo 120 W Windows 0000000 296 WWW for Scheduler 127 OOOO 122 428 DO 79 84 113 114 000000000 150 157 000000 11 51 4 163 345 328 00000000 245 20 0000 95 0000 116 118 120 000000000106 00000 11 248 00000000 37 8 000000000 167 uggaggaggagu g 50 0 0000 51 52 141 00000000 290 243 25 10 4 00000 21 000000000 11 41 00000000 54 0000000000 11 OOO 140 000 128 000000 130 000000 129 000000 129 DO 78 83 4 4 4 Oo 79 84 113 114 00000 380 1 010000000 380 ODO 401 08 246 108 111 111 112 O 109 0000 200 DO 111 1010 112 OOOO 112 L3 L3 L3 L3 L3 C3 0 0 0 D 0 0 LJ L3 L3 L3 L3 L3 E3 C3
208. 0000000000000 nn 000000000 km adi hon ru a e PA sa o 30 E 0000 Ms000000000000 00 0 81 E 0000 Ms000000000000 0000000000000000 0 32 E 0000 s0000000000 0000000000000000 33 E 580 000000 10000000000000000 84 E 00000000 pen0 0 D 100000000000000000 Pos lerrno al 00000000000000000 35 E mallocO OO lermo amp d 00 000000000 36 E 00000000 D 0 00000000000000000 Pos lerrno al 00000000000000000 37 00000000 rite 00000000000000000 Pos lerrno al 00000000000000000 38 000000 removed 0 D 00000000000000000 Pos lerrno al 00000000000000000 375 D O 8 D SFimport 0 O SFexpor 8 ODO 00000000 od DO L 39 E 000000 reatO 0 D s errno d 40 E 0000000 pO D D s to sl lerrno dl 41 E 0000 seek seekO O sl errno d 42 E 000000 Gename 0 O s to s errno d 43 E 00000000 ReadDBO OO OOOOOOO s errno d 11 11 1 0 0
209. D 10000000000000000 0000 usr GroupAppo bin AppoSV ini 1 1 1 e usr GroupAppo bin SFagent inilOOOOOOOOOOOOOO 000 Wndwpgo0ng8000000000000000000000000 Yetc Ylog Yroom Facilities Manager 000000000 Ybin AppoSV ini 1 LL Ybin SFagent ini O o O O EJ LEES 1 3 Ez3 a 4 40 ESI E ESI ES 0 00 D D D D 354 000 P Scheduler Server 0000000 vsr ixi0000000 poda 0000000000 000000000000 0001 00 podd00 00000000000 00000 Windows 00000080000000000 0 0000000000000 O1000000000000000000000000 DO podd00 00000000000 ities Manager 0000000000 uuu Address Server 000000000 111 1 00 0 O 0 Facil 000000 Scheduler Server O Object Server Address Server OOO000000
210. Eror DDDUDDUDDH 33381 YYYY 00000 3 prb 2 L3 r3 o O2DODOOO Ern OOOH L3 C3 Doo XXXXYYYY errno ZZZ 00000000 00000 e YYYYOOOO YYYYOOOO 0000000 U OO O 00 usr iki O O 1 Scheduler Server Facilities Manager 8000000 1 go 0000000000000 00000000000000000000000000 S gx L3 r3 kej m o 6 5 au Error GO 000000000 0 DD XXXX errno YYYY Ono Ono L3 mum a00 0 pa ka lusr GroupAppo bin 0 0 000000000000000 000000000000000000000000 XXXX00000000000000000000000 9 0 0 0 0 00 000000 880000 00 0 0000000000000 XXXX errno YYYY 00000000000000000 88000000000000000000000000 00000000000000000000000000 00000000 333 M 0 GetAdAll O indxget O 000000000000 D D 98 Error 90000000000 00000000 Ono Cee ee I 3 3
211. Groupmax Scheduler Facilities Manager Version E E 1 0 11 3000 3 83 1 0000000 m0 000 P 1B46 5151 Groupmax Groupware Server 07 320 O OSOD HP UX 11 0 1111 P 1M46 5151 Groupmax Groupware Server 07 32 OS AIX 5L V5 1 V5 2 2 00000 0000000000000 0000000000000 0000000000000000000000 0000000000000 0000000 000000000000 000000000000 0000 mi AXOOOOOOOOOO HACMPOAOOOOOOO HACMP 6000 0000 HP UXU DDD Hewlett International Business Machines Corp O International Business Machines Corp MS DOSOOOOUU0d0 UNIX X Open Company Limited 0 000000000000 Un Visual Basic Y 0000000000000000 Microsoft Corp 0 OO Windows 00000000000000000 Microsoft Corp 0 0000 E L3 International Business Machines Corp Packard Company 00000000000000 Microsoft 0000000000000000 Microsoft Corp OOOO Microsoft Excel O Microsoft Corp 1 1 0000000000 Microsoft Corp El ES E Co Windows NTO Microsoft Corp 0 0 Windows Server JO 000000000000 ml 00 160 6000 100 3000 3 4830 0 0 0 nn 180 4000 200 3000 3 A83 109 0 D D an 190 1000 80 3000 3 A83 21 m
212. HOsTCHCO 00000000000000 3 0000000000000000 00000 4 0000000000000000000000 5 DOBDO DO 41 2003 KFCG5703 000000000000 42 2087 00 257 8 00000000000 DO Scheduler Client WWW 00000 for Scheduler 00000 43 12060 12061 _ 1 svg RSV 000000000090 00000 pr 6 L3 B o a 0000 c Qr E o 11 OOO 11 Scheduler Server ikisaki Facilities Manager ppoarea L1 c D 0 D D Services YN 2 n E E Co Co ES STI gt v appoareal OO tsOO0U00000 1 DNS Server cheduler uu O El En qoidam Sooo 4 m SN nog N ton 13 Ed D E3 EHI E D C3 C3 2 a JO y E LM 1 oO
213. SEDAN Bri B ATAOGAVEA NE kikakuhost 40 G AMA F eieyouhost 2 FOS RE ma 7 7 ID sya uid Address181 C 381845 Gg Efi Bis C RDU GARO ESL evtl C 3 3 ID D UUUDDDDAddresIJIIUIIDDDDDUDUDUDBDDDDDDUDD Address Address 0 Oooo Edi dE ES ES E 0000 Address D D 000000000 8000 OO OOOO 4 ooo 0 0 0 O L3 6 00000000000000 0000000 0000800000000000000B000 00000000 000 Address 00000000000000000B000000 IDD bsya 000000001 Addres 90 000000000000000000000 po b0000000000 ID00000000000000000000 po00000000000000 000000000000 0 poo 100000 000000000000 00000000000 SF325YS mi 00000000000000000000000000000 SF328YS ini 0000000 lt SchedulerQ 00 000000000000000 gt bin 4 00000000 000000000 cxappomousXbin 0000 Option TableEnt
214. e 00000 901 1 0 GMAXSYSI D D U U OO gU Address Server 0 GMAXSYST 0000 Scheduler Server Facilities Manager 0000000000 1 85 51 D utantur e 000000 so 000000 OO s00000000000000 Address Server 000000000000 podd0 0000000 SOOOOO0000 Address Server 4400000000000 OO Address Server 000000000000000 O O O O n UD D LL DD D U 0 HU D D LU Ul UI D D indxeet 0 D D po0000000 Address Server 0000000000000000000 00 po0000000000000Getadangoo00 fl 0 Oo Y O O O O gt o UUUUUDD Oo 5 1 E Oo OO Oo OO EE ES Oo Oo Y 000000000imdegerp00000000000 DU E GC aan II an Ni was Ti EST ET Es ooo O O o o o 0 0 0 O O O E 5 O30 e 000000 180 7 0000000 e 100000 O40 00 5 11
215. 0 L 0 0 0 L3 E EE E21 5E L3 J sen oes Eh sen E EI E 3 E L3 pl L3 1 J L3 EI 5 O hostchg log O d LEGI E EE ET EI ET ETE O Ea Gal se E 1 4 0 01 a O O O O O 5 9 O O O O O 00000000 O WWW for Scheduler 00000000000 Scheduler Client 000000 000000000
216. 000 000 000 000 000 EET Fa Oooo 0 O podd0 000000 00000000000000 podd0 000000 00000000000000 a 3 AO OOO 48 55 OOO LE 5 1 E EJ EJ ETE l E Ooo L3 L3 E ES E EE E OO 1 1 00 pea a L L E Ata E 01 11 E ho L3 L3 L3 L3 L3 L3 OOOO OOO Ej LH B H dB PH BE 271 9 OOO000000 9 2 0 2 8 158 75 ROE 1615155 0 SATA SER BRUT TOS UT BE gt 272 9 COC 000000 92 1 1 9 2 1 UU 9
217. 000 0000000 hestehg 00000000000 7 3 808 0 1010000000000000 0 0 00 0 Scheduler Client 0 1 0 1 D U D I SFdatacph 000000 D D CDI hestsehgt OOOO 00000000 Scheduler M hostchgl c000000000000000000 SFdattap 0 0000000000 po00000000000000000 hostchel 00000000000 7 3 0 0000000 00000000 O30 0000 Dad 000000000 0000 00000 00000 D pnmpuapupnpupnpupnpupnpunpupnpupnpupnpupnBpuBDDBHUuDDUDD 5 oO e a LT DPW E Jm 0 0 0 Oooo Oooo I 0 0 O 157 5 Groupmax Address Assist 000 podd0000000000000 e 000000000 10000000000 00000000000000000 DO 1 000000000000 000000000000 0000 e Asiti 1 11000 00000000000 I D SFdatacp 0 D AssstOOOOOOOOOOOOOOOOOOOOOOOOOOS 1 Groupmax Address Assist Groupmax 00 000000000000000000000 Assist i 000000000000SFdateppg000000000000000 Assist i 00000000000000 000000 po00000000000000 etc mv tb1
218. 0000000000000 gg 0000 000000 000000000000 0000 0000000000 ftp00000000000000000000000000 00 0200000000 pod 000000000000 0000000000000 00000000 9 00 1 D O 0 0 0 O 9 0000000000 aconsole OO 00 U B D AppoMang OO O 0 D 0 0 roomconsole D RMSV D O 000000 RoomMan OO Oo D E E ES 60 600 E E m E EE EIE E E EE EE E El En FS E L3 r3 1 ES ES ET EST SES EE EI 362 Due 0800000000000 e usr GroupAppo bin AppoSV ini ED 1 1 1 e usr GroupAppo bin SFagent ini 0000000000000 apaougagagagagagagagagagagagagagagaggaggauu OHOO0000000000000000000 e usr GroupAppo bin Apposv inif 1 1 1 1 e usr GroupAppo bin SFagent ini 0000000000000 OO
219. 00u 000000000 380 QQ U 1 Scheduler Server Facilities Manager 000000 380 1 2 380 us OOOO 381 4 384 QQ U 5 Scheduler Server Facilities Manager 0 O O O 387 396 u e 401 1 405 u s DD ugue 0000000000 406 po 10 408 pov 000000 419 OO W oooooooooooooog 422 00x 424 427 UU vi 00 4 1 D 4 2 1 1 000 12 DD po00000100000000 podp00 00000000000 13 000 31 DDD 32 Address 00000000000 00000 0000000000 II aconsole 3300000000 5 4 indxget 000000 3 5 GetAdAIIE 0 0 0 56 000 000000000090 roomconsole 00000000050 4 3 44 J Assist 45 AD 46 AD 0000 000000000 0 000 OO B000000000000000 poddg0000000000000 1 I 1 I 1
220. 0x1 Dx 2 Facilities Manager 0000000000000000000 pod 000000000000 000000000 000000000000 Scheduler 0 00 00000000080000000000000 os o0000 00000 00000 000000000 Scheduler_FacilitiesQ 0000000000000 pod 000000000000 00000000000000000 00000 1P00000000000000000000000 Adress 0 0O 0000 00000 00000 roomconsole UO I Address Server 400000000000 000000000000 0000000000 aconsole OOOO Facilities Manager OOO pad 00800 000000000 00000000 000000000 1 1 1 Scheduler Server Facilities Manager QOOOO000000000000 00000 0000 Aaxg0000000000 BO000 0000000000000 000000000 00000 podd00000000000000smtpo00 00000000000 OO Groupmax 000000 0000000000000000000000000 000000 00000 000000004x00000000000000000000000 0000000 100000000000 2000000000 1 000 10000000000000 00000 Groupmax i 0 0000000000000000 smit cm add grp D TER JH D D OD 000000000 D O 17 node1 node2 401 2 000 0000000 Groupmax 00 0000000000000000 Groupmax smit claddserv dialog 0 3 00
221. 10 200000000 10 5 pogo 0000000000000 000000000000000000 00000000000 usr bin AppomanQ 0000000000 Facilities Manager 7 000000000000000000000 usr bin RoomMan 000000000 D 2 0 00000 1 048 57600 00000000 0000 00 0 O O 5 9 O E m H uu iki O 5 9 O EJ O usr iki OO MooG 5 o O o O O 5 oO O 0 ro 691 0 1 51 0 1 E ESI Sonn Oooo noo EJ 1 aa ele 4 DO DO DO 00 DO D 0000 I ct ESL OOOO Oooo 1101 EI GET 664 Oooo T o o EX L3 L3 0 0 000 UD 00 00 20 Ce CE E I 1 EE OOo Oooo Oo L3 L3 L3 OOOO 0
222. 5 j z FT 2 5 TAIANA TY REFS DEEDAT Y En 35 T KURA VEIT too gc pod0000000000000000 4 pogo 00000000000 00000000000000000000 00000 00000000000 URLOOOOUO UUDUDDDDDDBDDDUUDUDDDBDBDDDDUDUDUDUDDDDUDUDUDUDuDU 125 4 00000000 126 OOOOOOOOOOOO O O Groupmax Scheduler Client Version 6 0 0 Oooo L Ce 34 3 L3 L3 Oooo e E3 El Oooo Oooo 0 0 00000000000 O O oO 5 podd000000000000000000000 podd0 0000000000000 00000000000000000
223. D TraceSV nl log TraceRMSVInl log ng 19 160 DO O0 0000000000 000000000000 000000000090 DO O0 0000000000 0000000000 00 00 00 0000 000 DO O0 0000000000 000000 000 1MBQ 2147MBOOOOOO 4MB800000000000000000000000 0000808 399 111 0 000000 Scheduler Server 21 3 1 0 0000 0 0 22 N Facilities Manager 00000000000000 og E I 5 1 L3 Oo o E E OO Dg 1 O O O 1 O 5 D D O O 5 9 Oo 6 5 1 8 E3 EI E EI E E ET E17 ESI a a TTS PT Oo Oo Oo Ooo Ooo Oo O O O O Oo O O O OOOO Er 01 J 3 oH OOo oO CS E Ca E EpL E 3 OO E El eo e 00 FTO OOo oo
224. O O O 5 O O O O O ca El O L3 O O 000482 0000000000 4 00000000 80 WWW for Scheduler O WWW for Scheduler OOOOOOOOOOOOOOOOOOOOOOOOOOOOO 1 0 000000 ag WWW for Scheduler 0 000000000000 DO WWW for Scheduler 000000000000000 4 619 00 0 WWW for Scheduler 0000000000 000000000000 D WWW for Schedule 4 61 PRE Schedule Todo EDERE tra oq 426 Fah Eoin WWW for Scheduler CEA ENEE EET TH RE 388 2 _ FRONTS E FT TTD 222838 t Cain TS C AUI CIR Se S E EONS E DERF E BE C BESE M Iw 35 525 ATE SBD am CATS VOLE x AOL PER RT ATW 859 SANS j A kui S Hb 12 AH OK seo D n 0000
225. Ooo Ooo oO EX 1 6 E EI Ooo EST EEr Ooo O O O L3 0000 po0001000000000000 2 EJ ET EI E3 T ao 2 Exi en em rei D Oooo EE 1 L3 g Oooo Oooo 0 D 0 0 0 0 0 0 e a OOO OO 3 OO 00 00 7 0 BIT 00000000000000 151 5 Groupmax Address Assist 0 H r3 0 O EJ 5 9 O mood 49 000000000000000 o 5 o Zo 10 OOo EE Py mas EZT Ooo oo o O X 0 0 oOo 11 00000000000 HosTcHep 00000000000 CHGO 00000000000 erechgpo00 00000000000 MOD 08 8 6000000000000000000000 I
226. T E 5 HALT SCRIPT 1000000000000000 etc cmeluster gmaxpkg control sh 6 HALT SCRIPT TIMEOU TIMEOUT T 397 OG 0000 OO OOO 7 SERVICE_NAME 0000000000000 Schedulersv SchedulerToolSV FacilitiesSV FacilitiesToolSV 8 SERVICE FAIL FASTE 0000000000000 0 No YES NABLED 1111111111 1 1 1 SERVICE HALT TIMEO 000000000000 0 300 UT Dua 10 PKG SWITCHING ENA 00000 Scheduerd 00D won Yes BLED 000000000000000 0000000000 Scheduler 11 SUBNET paedo0000000000 172 1 1 0 00000000000 Hcd etc cmcluster gmaxpkg Hcmmakepkg s control sh Scheduler 0 400 0000000000000000000000 1 Scheduler 0400 0008000000000000000000 podd00 00000000 000000000000 000000000000 v 10 pu poodg0000000000000 u Og 1 OOOO TERM dtterm 1111000000 export TERM 2 VGCHANGE MO ServiceGuard 00000 gchange a
227. TT OF a al 173 6 00000000 6 5 Facilities Manager 000000 Facilities Manager 0000000000000000 1 OO Facilities Manager 0000000000000 Scheduler Server OO 000000000000 000 0 Scheduler Server Facilities Manager QQ Dodd 00000 000000 00000000000 2 Scheduler Server Facilities Manager Address Server 00000000000 Address Server 000000000000 aconsole O roomconsole OQ pod 0800000 000000 000000000000 3 Scheduler Server D 08 080000000000 00 000000000000 00000 Facilities Manager DODA DO 0D B B D B BD D B UH D D Scheduler Server 1 HN Facilities Manager O O O ooo 0000000000000 Scheduler Server 444000000000 D poda 00000 00000000000 od 0000000 000000000000 00000000 Scheduler Server 000000000000000000000000 OO00 0000000000 Scheduler Server Facilities Manager OOOO 00000000000 0 Scheduler Server Facilities Manager J Dodd 00000 0 000000000000 mpdd0g000 00 0000 000000 00000000000 Dodd 0000 00 0000 000000 0000000000000 Do0d0000000000000000000000 O O abe123 ABC123 Abc123 Du 000 000 000 0 0 oO oO OO OOO OO OO E E E Ea OOO es Lr En Ea ET ed EE Ed 174 6 6 6 00000000 I
228. VGCHANGE vgchange a e q n VGCHANGE vgchange a y VGCHANGE vgchange a e Default VOLUME GROUPS Specify which volume groups are used by this package Uncomment Ln and fill in the name of your first volume group You must begin and increment the list in sequence x For example if this package uses your volume groups v901 and vg02 enter VG 0 vg01 VG 1 vg02 The volume group activation method is defined above The filesystems associated with these volume groups are specified below VG 0 dev vg03 FILESYSTEMS Specify the filesystems which are used by this package Uncomment LV O FS 0 FS MOUNT OPT 0 and fill in the name of your first logical volume filesystem and mount option for the file system You must begin with LV 0 FS 0 and FS MOUNT OPT 0 and increment the list in sequence For example if this package uses the file systems pkgla and pkglb which are mounted on the logical volumes lvoll and lvol2 with read and write options enter LV 0 2 dev vg01 1voli FS 0 pkgla FS MOUNT_OPT 0 o rw LV 1 2 dev vg01 1vo12 FS 1 pkglb FS_MOUNT_OPT 1 0 rw The filesystems are defined as triplets of entries specifying the logical volume the mount point and the mount options for the file system Each 413 414 filesystem will be fsck d prior to being mounted The filesystems
229. Version30000000000000330000000000 0 cheduler Server GWOOOOOOOOOOOOOOOOOOOOOOOOOO ooo podd00 0000000000 000000 000000000000 poda 000000000000 000000000000 0000000 00000000000 S 0 0 0 0 0 Oooo OO 1 2 38 00 00000000000000000000 3 4 0000 1D0000000 000000000 0000000000000 20 000000000000000 Scheduler_Facilities 0000000000000 WJ9000000000 podd000 0000 000000000000 0000000 462 00000 pog000006Wo20 00000 00000000000 cqwppog0 000000 00000000000000 Scheduler Server Y 1 B B B dag 0 0 Scheduler Client Version 0 0 0 0 WWW for Scheduler Version 500000000000 00000 000000 0 0000000000000 Dodd 00000 0 000000000000 DODO 80 0000 000000 000000 0000000000000 Dodd 0000 00 0000 000000000000 0000000000 u
230. errDumpRMSV log 0000 errDumpRMSV bak 420 UU V 000000 uu Od 00000 00000 TraceRMSV1 log AppoSV mi 0000 TraceRMSVIX log 58 00000000 1 1 8 15 OOOO Scheduler OOO CntlMan log 000 CntlMan bak mnugmgemgmmgnu pAadd 000000 84 OO 180 00000 errDumpMan log errDumpMan bak Facilities 0000 000000 CntIRMMan log 00000000000 00 CntIRMMan bak 000600000 84 UU 100 0000 errDumpRMMan log errDumpRMMan bak OOO indxget log u indxget bak gt 84 00 100 Assist 0 0 SFagent log SFagent bak 0 421 OOW Da W DO 00000 u atu 1 x KSFg00001 E 0000 089698 0 1 Xxxxunun nnYvvvun un errno YYYY 2 XXXX0 00000000000000 3 000000000000000000 Scheduler Server Facilities Manager 2 KSFg00002E
231. execution of each script Note The HALT SCRIPT TIMEOUT should be greater than the sum of all SERVICE HALT TIMEOUT specified for all services RUN SCRIPT etc cmcluster gmaxpkg control sh RUN SCRIPT TIMEOUT NO TIMEOUT HALT SCRIPT etc cmcluster gmaxpkg control sh HALT SCRIPT TIMEOUT NO TIMEOUT Enter the SERVICE NAME the SERVICE FAIL FAST ENABLED and the SERVICE HALT TIMEOUT values for this package Repeat these three lines as necessary for additional service names All Service names MUST correspond to the service names used by cmrunserv and cmhaltserv commands in the run and halt scripts The value for SERVICE FAIL FAST ENABLED can be either YES or NO If set to YES in the event of a service failure the cluster software will halt the node on which the service is running If SERVICE FAIL FAST ENABLED is not specified the default will be NO SERVICE HALT TIMEOUT is represented in the number of seconds This timeout is used to determine the length of time in seconds the cluster software will wait for the service to halt before a SIGKILL signal is sent to force the termination of the service In the event of a service halt the cluster Software will first send a SIGTERM signal to terminate the Service If the service does not halt after waiting for the specified SERVICE HALT TIMEOUT the cluster software will send out the SIGKILL signal to the service to force its termination This timeout value should be large enough to al
232. gt gt TimeOutRMMan 90000 000000 lt D00 gt DU Sockets TimeOutMan 60 TimeOutRMMan 60 UUDUDDDUDDDDDUDDUD 0000000 00000000000000 AppoSvim 40000000000 O TimeOutMan 30 TI TimeOutRMMan 3097 0 00000000000000 3000 00000 m a 61 0000000000 62 0000000000000 63 00000000000000 64 6 5 Facilities Manager 0000000 66 00000000 163 6 00000000 6 1 TRB R WBN BA 1 000000000 2 PDODO BO DO 00000000 lge00000000000000000000 0000000000000 apposv O O Scheduler Server 00000000 Scheduler Server D D D D D 000000 D D D 61 1101 00000 apposv log Scheduler 1000 LOGSV log 00000 LOGSV bak pad000 CntlSV log CntlSV bak D0000 errDumpSV log errDumpSV bak Facilities 0000 LOGRMSV log uuu LOGRMSV bak 00000 CntIRMSV log CntIRMSV bak 1 errDumpRMSV log errDumpRMSV bak Scheduler 000000 CntlMan log CntlMan bak tut errDumpMan log errDumpMan bak Facilities 000000 CntIRMMan log 000000 CntIRMMan bak 111 1 1 errDumpRMMan log errDumpRMMan
233. pod 0000000000000 00000000000000000 0 5 0 6 7 DD O30 0000000000000 0 0 l usr GroupAppo bin Casya esv 0 00000000 Dad 0000000 00000000 CasyacsvQO AOU 380000000000000000000 217 7 0000000 49 00000000 D 0000000000 0 vsr k 000000000000 000000000000000 Q0 usr GroupAppobia 900000000 0000 E 00000000000 0000000 0 EXER Ed ES Eb ESI Bi 0 0 cd usr GroupAppo bin 3 0000000000000 SFimport 000000 Casyacsv 00 0000000000000000 D Hi D usr GroupAppo bin SFimport c Casya csv usr iki 4 0000000000000 SFimport 000000 0080800000 000000 00000000000 usr GroupAppo bin SFimport i Casya csv usr iki poda 0000080000000 aaa 5 O O O
234. ppp 6668590000 XXXXQ OOO AppoSViniQ 111 3 KSFg00003 E Address API XXX 00 XXXXQ 22220 11 1 1 WWWW num YYYY re ZZZZ 00000000000 result WWWW 1 Address Server 000000000 00000 2 Address Server 0000000000 Dodo 0d 0000000000000 pogo gd 0000000000000 pogo gd 0000000000000 4 KSFg00004 E Xxxx 00000000000 O errno XXXX u atu 5 KSFg00005 E 0000 xxonun XXXX0000000YYYYgo00000 11 1 errno YYYY 1 XXXXQOO000 1 1 1 D 2 0 00 000000000 0 9 Scheduler Server Facilities Manager 6 KSFg00006 E 0000 8 0 XXXX0000000YYYYp0 0000 errno YYYY 7 KSFg00007 E 0000 amp xxyoog XXXX0000000YYYYp0 0000 errno YYYY 422
235. 0 0 0 0 0 0 a 4 OD DOO OOO L3 L3 L3 L3 L3 000 ID 12 2 OOU Wooo 102 0000 152 JOO 4 19 5 pod00000000000 142 OOOOOOOOOO 406 00000000000 19 29 31 243 1 303 292 242 10 2 000 14 OOOO 1Pgo00000000000 379 000000000 13 UUDUUDUDUDD 408 00 000 80 85 70 171 315 0 O 00 14 6 12 000 108 247 poo00000 337 313 93 C3 C3 C3 Ap A L3 L3 N L3 105 105 11 DO 74 DO 76 L3 L3 Oo Oo 7 al Doo 320 75 ID 5 76 76 7 00000 97 0000000 97 0000 4 20 EJ T L3 L3 1 C3 U 0 4 U 0 0 E E 2 fy L3 ooo Ooo
236. 000000 44 E 00 60000000 pago 00 000000000 45 E D000 6430000000 46 E 1 1 47 E 0000 Scheduler Facilities 000000 checkid 0 0 0 0 0 0 48 E 0000000000 s 49 E 9 0000000000 Scheduler Facilities 020 checkid 0 0000 50 E 0 000000000000 376 OO 8 D SFimport SFexportt 000000000000 u OO O 51 E 000000 oo00000 D OD uuu 52 E 000000 5 Scheduler Facilities 0000000 checkid 0 0 00000000000 53 E 0 0000 Ws Scheduler Facilities 0000000 checkid Q 0 00000000000 uuu EDO DO 0 0 0 0 0 0 0000000000 Tr D UL U CL 00000000
237. 000000000000 HOSTCHGODODO O DO c mb ce m 190 7 0000000 DUUUDUDDDBDBDDDUDUDUDDDDDDDUDUDUDDDDBDUD 2 4 O0OUO000000000000000000000000 O Groupmax Scheduler Server 4400000000000 0000000000 hostchg log 0000000000 e 0 4000000000000000000000000000000000000 uu O Groupmax Scheduler Server 000000000000 e PEO BOB 0D 00 000000000000 0000000000000 podmnood0 000000000000 000000000000 000 poo 000 000 0 usr iki usera 20005 ms d 0 usr iki usera 20006 msd l UU Mood D
238. 00000000000000000000000 2 00000000000000000000000000000000000000 DD Assist OO Assist Viewer 00000000000000 40 OOOO 000000000 0 3 0000000000 poDo000 D 0690000000 0000 OO GOO 000000000000 0090 8 2 2 SFdatacpd D 0 DO 0 WO B BEBE 7T 7E 7T 266 10 SFdatacp OOOO 0000000 0000000000000 0000000000000 1es asent DH 0 0 Ip SFdatacp 1og D 0000 0000 0000 1 IDDDUDUDDDDDDBDUDUDBDUDDDBDDDUDUDUDDUDDDDDUDUUDUDDDDUDU D 0000000000000000 log agent 0 OU Ip MVresult tbl mo001400 00000000 0000000000000 0000000 p000000000000000000M000H Assist L O O SFdatacpl D poda 000000000000 000000000000000000000 D 2 000000000 100000000000000000000000000g 0000000 0000 Pp00000000000000000000000 podd0 000000 000000000000 0000000 a3 000000000000000 00000000000000000000000 4 0000000000000 00000 AppoMan RoomMan 000000000 00000052 p000000000008SFdataerp 000000000000 SFdatacp 0000000000 8 00000000000 O 20 SFdatacp 00000000000 D 1 0 U AppoMan RoomManf 0000 001 00000
239. 01900000 000000 020000000 000000000000 120 000000000000000000000 1 000000000000 OOOO00 1000000000000000000000000000 og oO Do0000000000 800000 2500000 00000000000045 DNSJIDDDDDD 4 FE sen 3 Oooo Oo Ooo U 3 0 6 01 Ooo 732 DOOOOOOOO 0190000000 usr GroupAppo bin HOSTCHG filename SchedulePath logname 020 00 e0100 filename 0000000000000000 e0200 SchedulePath 0000000000000 0000000 189 7 0000000 logname 000000000000 0000 hostchg log 0 0000000000000000 hestehg log D D 00 O30 e 000000 e 100000 DO 0000000000 Moa0000000000 O0 0 OO 00000000000000
240. 080000 00 0000 000000 000000 00000000000 080000 000000 000000 000000 00000000000 Address Server III 0000000000000 ddress Server OO000 W000 Scheduler Server Q Facilities Manager 000000000 0 0 A 5 2 po000000000000000000000000000000000000 a3 pogo 000000000 000000000000000 4 0000000000000000000000000000000000 1 cherpQOOOOOO00C000000000000000000000000000 0000 DO 000000000000 0000000000000090 PI 5 1 51 2 groupmax bin S CHstpBK 4 fusr GroupAppo AFET 05 4 2 L 2 k U Z v4 gt 2 22 2 AB838324 LP gt 2 gt 5034 12 gt 2 F U Z PAN 74M 0 000000008800000 512 0000000000000 OO00031300000000000000000010000000000 DUUDUDDDUDDDDUDUDDUDDDBDBDDDUDUDDDDBDDDDUDUDUDUDDBDBDUD 2 5 e CRM B 320 00 00000 0 0000000 45841 0 0 1000 000000000 0 0 000 010 0 0 000000 00 40000000000000000000000000000 0 usr GroupAppo bin usrchg
241. 1 ol 8 0 880 000000 0M 7 3 08 00 1000000000000000 000 4 4 Bs wa TELILILJCIHLILILJ e a E o El o aes Ey 1 4 L3 COCO CI r3 LILILJI III ae 4 5 2 Fo Lares a Coy 1 r3 1 at r3 COCO CIC r3 tA p Lr L3 OE ey 5 2 1 1 L3 1 L3 LII LL L3 COCO L3 L3 L3 Izd bip LJ L3 LJIJIILTLJI LLLI PLI ep TE K aen w t T ES Co tah ero ea 3 Coy DLT 1 Ey la Eo LAU Coy 85 I LS IE or u uuuul Scheduler Facilities 0000000000000 0000 e Address Server 0000000000000000 00 0 SFimport J 000000 Address ServerQ 80 000000000000000000 DU 00000 Oooo oo L3 L3 Oooo Oooo oo Oooo Oooo oO L3
242. 195 7 0000000 OO 20 chkorder rsd smn msd ssd nsd usr iki 00 30 chkorder usr iki 00000 20000 30000000000000 e0200 1000000 sa 0 00 PDp0 000000000000 e 00000000000000 sm D DU MaxNo msd D DD Pp000000000000 0 ssa 000 g000000 000000 00000000000 e 1000000000000 0 g000000000000 000000000 e 08300 00000000 00000 e0400 flogfile name 000000000 00000000 logfile name 0000000 logfile name 1 B B D B U U e 0500 directory name 00000000000 0000900000000 directory name 0000000000000000 1110 00 0 7 6 2 sortdate O10 0000000 usr GroupAppo bin sortdate inputfile outp
243. 268000000 D 1 po000000000000000000000 10 Addresg0 0000000 podd00 000 0000000000000 0000000000000000 9 DU 0 4500A0000000000 46000000 D 45 AQoD00 AO ATE f FEF FA SPA 8855 1 ER UERR WA 8825 2 ER ERR ma D 46 Fin at n iF Biff kikakuhost 35 7 kaihahost 95172 95172 AFA 25 73 108 4 00000000 59 4 00000000 60 451 A0000000000000000000C0C00000000000000 podd0 000000000 000000000000 000000000000 podpo0 000000000000 000000000010000 pod 000000000 000000000000 00000 Oooo Ea Ea ey 4 Oooo 000 Lr OOo OECD CU 0 0 O 0 0 0 0 000000 200000000000 1 pag 00000 000000000000 0000 000000000000 podd0 0000000000 800000000000000000000 000000000 O04700000000000000000000 FP MOSS RB BE
244. 77 DO 7 99 90 88 121 000000 1 60 ID 5 2 Oooo EE MESE Oooo D D DO DO o N 000 63 000 63 El NE EI 104 OO 12 22 26 131 000 287 3 ET E 3 ET EST SES EE L3 C3 L3 L3 L3 L3 L3 L3 58 E EJ ES E 5 9 E3 aes RF 000000 26 244 000000000 00000 2 23 315 000000 5 po0000000000 146 158 po000000 151 156 0000000000000 0 0000 2 21 22 303 405 169 000 120 118 000 31 47 4 JOO ID 4 313 WU 3 000 245 244 180 58 27 11 00000 45 72 et 58 62 63 0000 56 DO 114 116 UUUUUDUDUUDDDBDU 115 16 00 po000000 115 362 DO 114 21 7 431 000 OOO
245. AppoMan ini ln s var opt iki log AppoMan ini usr bin AppoMan ini 9 Scheduler Server Facilities Manager 1 LH vi var opt iki log AppoSV ini Data HAHostName gmaxhost WriteThroughSV ON Ox uuu O MC ServiceGuard Scheduler Server Facilities Manager 10111 0 0 0000000000000000 0 392 ln s var opt iki log AppoSV ini usr GroupAppo bin AppoSV ini 11 Scheduler 8080 00000000000000000000 H cd umount gmaxpkgd vgchange a n dev vg03 00020000 1 Scheduler Q HO DODO DO DO DO DO DDD 000000 mkdir gmaxpkgd 2 Scheduler QV OOOOO000000000000000000 vgchange a e dev vg03 000000 3 Scheduler 40 090000 00000000000000 mount dev vg03 1vol1 gmaxpkgd 4 ln s gmaxpkgd iki var opt iki 5 Scheduler Server 000000000 4 etc hitachi setup i dev rmt 0m 6 Facilities Manager 0000000000 Facilities Manager JO UU Ul Ul Ul d d d B au 4 etc hitachi setup i dev rmt 0m
246. Assist Viewer 04000000000 000000 Groupmax Address Assist Version 6 00000000000000 O Scheduler 00O 1 1 1 0 00 00000000000000 00 0000 DO 00 0000000000000 hostchgd 00000 HOsSTCHCO 0000000000000 0000000000 podpo0 000000000 0000000000000000 0 3 Assist Viewer U O Address Server 1 HH HH B H 1 1 4 Assist Viewer 0 000 Seheduler Assist 0000000000 149 5 Groupmax Address Assist 150 5 Scheduler O0 0000000000 Assist Viewer D 0000000000 6 00 U B 00 Groupmax Address Assist Version 60 00000000000000 Qt 7 0 AE cU E 00 8 0 00 DO 00 7 9 DU Oooo oO Ooo O0 dg Scheduler DO 900000 2 0 0 5 0 w Scheduler 000080000000 00000000000 1 809 10000000000000000000 000080000000 000000 UUDUDDUDDDDDDUDUDDDBDBDDDDUDUDUDUDUDDBDUDU 0000 UUDUDUDDUDDDBDDUDUDUDDDUBDBDDDDU
247. B Aa 0 3 2 8 7 0 00000000000 0 000 0 0 00 0 0 pbdrms Z 100 0000000000 9 090000000000000 090000000000000 0 gt 4 vt OQ ft 0 0 0 0 gt 4 1 7 8317 980 0000000008000 00000000 00000000000000 M0000 0 gt 0 0 gt 6 pao Wo 000000080000 00 000000000000 000000 0 gt 0009 0039000000 0 0 gt 0 00000000000000000 60000000000000 0 00000000000000000800 0 G gt 00 00 00000000 0000 U 6104 640 00000000 0 EA po gog0000 0000000000000 40000000000000 9 COC 000000 098 0O000000000000000000000000 48 2 2 ARES 882 28 BEAR 88511 OSes DEAT 5 QS RIBS LH Lino BOI FRE RT 4 DAHLE RTT 3 2 gt 14 2 283 UU gt UJ 000000 Windows 0000000
248. B B DB DU D 0 0 MC ServieeGuard 0000000 1 AIX BH HU B D HACMP O 0000 aconsole roomconsole LU Scheduler Server 0 0 0 0 SV AppoMaa T O Facilities Manager U RMSV RoomMan OOOOOOOOOOOOOOOOOOOOOOOOOOOOO 0 0000000 0 ugaguuggaauggaggaaugagagagaguuegeauulltttuttlu uu 000000000000 0 0 0000000000 GetAdalOOOO OOo usr bin AppoMan inil 000000 0000000000 0000000000 00000000000 U8 pod000000000000000000 L3 L3 L3 L3 Ea ees CEST L3 L3 L3 L3 L3 r3 L3 L3 L3 L3 L3 0 D OOO e CODECHG I O00 BITECHGO 000 grpchg OOO SFdatacp SFimport 000 indexgep000000000000000 pod 000000
249. D 171 6 00000000 9 DU D za oo SOG ES E O O O O Er ES DC Of 00000 heduer j DNSOOOOOOOOOOOOOOOOOOOOOOOOOOOO e 0 0 00 8 Address Server 000000000 11110 0 1010 10 00 9 81000 0000 00000 000 80 ooo 0000000 0DNSH 0000 200000000000000000000000000000000 po0o0o0000000000 000000 000000000 Address Server 0000000 00000000000 0 0 ete DNSHOSTS tbl 1 101 0 dad 200000000000000000000000000000
250. Eve a E pd 1 ES 4 40 OO T E ES FT ne ETT us ET Gs Ne Dc me E217 EEE CSP 1 Ce ESI EST zo PO JO mas a mu Eee JE 5 9 O oO po000000 po000000 po000000 O o OOOO 4 L3 r3 OOOO 4 CJ r3 L3 OOOO 4 L3 OOOO 4 r3 OOOO 4 r3 Ooo OOOO 4 r3 L3 L3 1 r3 EJ LJ L3 r3 LJ r3 anan EJ L3 L3 L3 1 1 A L3 41 r3 E Ea 1 1 E ET ELI EI L3 L3 1 r3 em WN em EJ Oo po00000000000
251. GroupAppo bin SFpakage r AppoMan 1 11111 1 if 0 then echo monitor Groupmax Scheduler Server Tool down exit 255 fi Groupmax Facilities Manager D Facilities Manager 0000000000 usr GroupAppo bin SFpakage r RMSV 000 if 57 0 then echo monitor Groupmax Facilities Manager down exit 255 fi usr GroupAppo bin SFpakage r RoomMan 00000000 Tf 15 2 1 0 1 then echo monitor Groupmax Facilities Manager Tool down exit 255 fi 417 exit 0 418 HOV QUUUOO INA apposv log 00 Scheduler 1 O Facilities 7 00 0 0 9 0000000 po V 00000 podo0000000000000 tbegog0000000000000000000 000000 apposv 00000000 00000000000000000000 po000000000000000 OOOO Sexec1d DO SFdatacp 0 O0 0000000000000000 020070 1 23000 40 560 120 0 SFdatacp 0 0 0 0 0 D CD execldQ OO 20070123045612 00000 00000 LOGSV csv LOGSV bak CntlSV log CntlSV bak errDumpSV log errDumpSV bak TraceSV1 log TraceSV X log 1 LOGRMSV esv LOGRMSV bak CntIRMSV log CntIRMSV bak errDumpRMSV log errDumpRMSV bak TraceRMSV1 log TraceRMSVIX log 1 Scheduler 0000 CntlMan log CntlMan bak errDumpMan log errDumpMan bak Facilities 0 0 0 ooo CntIRMMan log CntIRMMan bak errDumpRMMan log errDumpRMMan ba k indxget log ind
252. HP4xXp 000000000 1800800000000 00 Scheduler 0 400 000000000000000000000000000000 poda 000000000000 000000000000000000000 10 396 0 Us pod000000000000 uu OOOO OO 1 MAX CONFIGURED PACKAGES 00000000000000 0 Scheduler 9 VOLUME GROUP Scheduler 000000000000000 D VOLUME GROUP dev vg03 3 FIRST CLUSTER LOCK VG 2000000 oo 0000000000000 O20 200000000000 U SchedulerQ 800 0000000000000000000000000 Scheduler 0000000000000 emaxpkg 0 000000 1 Scheduler 0000000000000000000 Hmkdir etc cmcluster gmaxpkg Hcd etc cmcluster gmaxpkg 2 0000000000000000000000 Hcmmakepkg p gmaxpkgconf ascii Scheduler 3 10 pus po0g000000000000 0o00 po poo 1 PACKAGE_NAME pao 0000000000 gmaxpkg 2 NODE NAME nodel JOGO node2 3 RUN SCRIPT 100000000000 0002 etc cmeluster gmaxpkg control sh 4 RUN SCRIPT TIMEOU ugggggggmggggmm NO TIMEOUT
253. L3 L3 oo 000000 O Address ServerQOOOOOOOOOOOOOOOOOOOOOOOOO Address Server 0 D 0000000000000000 Groupmax Address Mail Version 7 O O 000 0000000000 00000000 e AddressServer OOOOOO00000EMalQOO00000000000 Address Server 0 0000000 Address Server 000000000090 Address Server DOOOOOO00000000000000 204 7 0000000 e Groupmax Scheduler Server 07 32 QQ SFimport 00000000000 Dodd 08000 00 0000 000000 000000 0000000000 1 gg 00 00 0000 000000000000 00000000 73 O 7 3 Groupmax Scheduler Server 07 32 0000000000 oo 1 OOOO 19 0 0 00 ID 111 11 01 00000 00100 0 0 11 9810000000 DOO 0 3111111001 0 2 8 000 ID ooo 000000000 4 Groupmax Scheduler Server 07 32 00000000000 780000 AppoSvimg 00000000000 000 SFimport OldCheck ON 0000 usr GroupAppo bin AppoSV ini 7 9 2 SFimport 000000 SFimport 0000000000000000000000 018200000000 0000090000 SFimporrtQOOO
254. O SFdatacp Assist 0 SFdatacp 00 YYYY MM DD D U D D CH 100000 D HH MM SSp0 0080000 OOOO ID 0000 ID050000 00000 ID 00000 10050000 0000 1000000000 e E000000000 MO 6000080090000000000000x0000000000 00000 10 Assist 0000000000000000000000000000 SFagent log J Assist 0000000000000000000 AssistO 000000000000 D ScheExeclogQ 000000000000 dad OOO 1og agent SFagent 1og 0 0 0 1000000000 OOOO log agent ScheExec log e 000000 Assist O J e 0000000 Assist J 0 O 308 DU H Assist OO 00 SFdatacop 1111001000 D D LaL 4 5 2 Assist D O 0 OOO 000000 SFagent f logfile_namel SFagent f logfile name SFagent f logfile name SFagent f logfile name SFagent f logfile name SFagent exe f logfile name agtcout 000000000 00000000000 000 0000000000 0000 6
255. OO 000 HH BHH Dnm Ooo WOOO 0 0000 0000000000000000 00000000 0 Scheduler Server Facilities Manager 000000000 Address Server 00000000 10 Address Server 000000000000000 00000000000 Q0 Facilities Manager 0000000000000000 Facilities Manager 00000000000 1 1 D D SV RMSVO 000000000 AppoMan RoomManf D 0 Do 000000 000000000000 000000000000 aw 00000000000000 0M 0 SVg RMsv 000000000 AppoMan RoomManf 0000000 Oooo L3 L3 oO DU CODECHC0 0000000000 5 CODECHGIJU 00000000000 DU 0 2 Address Server B Address Server 0 000000000000 Mo0000000000000000 000000000 Facilities Manager 000000000000 D D I Facilities Manager 00000000000 1 O SVO RMSV 00000000000 AppeMan RoomMan 000000 D u 0 00000000000000000000000000000 aw 0000000000000000 ServerQO00000 0000000000 3 26 000000000000000
256. OOO Oooo Oooo OO Oooo OOO Ooo oe Boo KA kaaa E Gan L3 L3 r3 L3 L3 g 82 4 00000000 0 4 25 000000000000000 FUT Mee AAIL TEAL lo wa evt ic podd0 000000 00000000000000 ooo 0 ooo Oo 0000 4 26 podp00 0000000000000 O00 podp00 0000000000000 0000 L3 L3 L3 L3 CJ L3 C3 L3 L3 C3 C3 CJ L3 L3 L3 L3 L3 C3 L3 C3 L3 Oooo L3 L3 L3 L3 L3 L3 L3 C3 u L3 L3 L3 C3 O ELE 0 0 Oooo O O O O O 4 D 0 O 0 U O O C3 u L3 o tara 4260000 I REP ERG TIP Wh asya RADE ROERE ES 8 AS E Dd H TOREN TH e 00000 UUDUDDDUDDDBDDUDUDUDDDDDD 4270000000000 xxxxm 00000000000 0 OO00M
257. Server D0000000000000000000000000000 po0000000000000000000 0180000000 poda 0000000000000 0000000000000 0000000 pod 000000000000 00000000000000000 00 0 020000000000 e 000000000 DUUDDUDDDUDDDBDDUDUDUDDDBDBDDUUDUDDDUBDDDDDUDUDDUDDDBDUD podo00000 000000000000 po000000000 276 9 000000000 926 OOOO 0180000000
258. Version 5 Version 6 Version 70000000000 00 1 E aconsoleQ l SVI D AppoMang OO W roomconsolel O O RMSVO 0 D 000000 ReomMan OO 0000000000000 e usr GroupAppo bin AppoSV ini 0000000 e usr GroupAppo bin SFagent ini 00000000000000 DODO 00000000 00000000000 vsx ixi0 000000 1 7 0000000000000 4 Version 7 0 0000000000000000 5 6 3 8000000000000000 7 Address Server 1 Address Server 2 00000000000000000000 s 0000000000000000000000000 1 Foo OOOO 00000000000 D OOO 4 4 ZI 2 1 FD l
259. a fully qualified resource path name and one or more RESOURCE UP VALUE lines are required A RESOURCE POLLING INTERVAL line how often in seconds the resource is to be monitored is optional and defaults to 60 seconds An operator and a value are used with RESOURCE UP VALUE to define when the resource is to be considered up The operators are gt lt gt and lt depending on the type of value Values can be string or numeric If the type is string then only and are valid operators the string contains whitespace it must be enclosed in quotes String values are case sensitive For example Resource is up when its value is He aoe eae A C eee RESOURCE UP VALUE UP UP RESOURCE UP VALUE DOWN Any value except DOWN RESOURCE UP VALUE On Course On Course If the type is numeric then it can specify a threshold or a range to define a resource up condition If it is a threshold then any operator may be used If a range is to be specified then only gt or gt may be used for the first operator and only lt or lt may be used for the second operator For example Resource is up when its value is RESOURCE UP VALUE 2 55 threshold RESOURCE UP VALUE 5 1 greater than 5 1 threshold RESOURCE UP VALUE 5 and 10 between 5 and 10 range HH HE HE HE HEH 411 412 Note that an
260. bak u D Ud dut indxget log 1 1 indxget bak 111 1 1 KENNIN log 1 1 1 1 backupfile log aconsole aconsole log 164 6 00000000 0000000 un un 00000 roomconsole roomconsole log uuu apposv log tmp 1 m uu apposv log agent OOO Assist O B Scheduler Server Scheduler Server 0000000090 00000000000000 3 O roomconsole OOOO 0 62 00000000000 00 Scheduler O00 po00000000000000 NL aconsole OO podd0 000000 00000000000000 L3 1 00000 LOGSV log N 14 LOGSV bak 000 CntlSV log CntlSV bak errDumpSV log errDumpSV bak 00 Facilities LOGRMSV log N 14 LOGRMSV bak CntIRMSV log CntIRMSV bak errDumpRMSV log errDumpRMSV bak Scheduler 0000000 CntlMan log N 84 CntlMan bak errDumpMan log errDumpMan bak Facilities 0000000 CntIRMMan log N 84 CntIRMMan bak errDumpRMMan log errDumpRMMan bak indxget log N 84 indxget bak Assist 000 SFagent log N 84 SFagent bak 165 6 00000000 DUDDDUDDUDDBDDDBDBDDBDUDDBDUDUDBDUDBDBUDDDUDDDUDUDDUUDU 166 6 00000000 62 LDIULDLLULLULL uL podd000000000000000000 1
261. customer define functions You should define all actions you want to happen here before the service is started You can create as many functions as you need function customer_defined_run_cmds ADD customer defined run commands do nothing instruction because a function must contain some command Address 000000 ObjectServer Address Server 0000000000 OO usr GroupAppo bin SFpakage s SV usr GroupAppo bin SFpakage s AppoMan 0000 Facilities Manager 000000000 usr GroupAppo bin SFpakage s RMSV usr GroupAppo bin SFpakage s RoomMan test return 51 This function is a place holder for customer define functions You should define all actions you want to happen here before the Service is halted function customer defined halt cmds ADD customer defined halt commands do nothing instruction because a function must contain some 415 416 command usr GroupAppo bin SFpakage e SV usr GroupAppo bin SFpakage e AppoMan 0000 Facilities Manager 000000000 usr GroupAppo bin SFpakage e RMSV usr GroupAppo bin SFpakage e RoomMan Address 7 Objectserver Address Server 0000000000 test_return 52 END OF CUSTOMER DEFINED FUNCTIONS 20 AKO U7H0000000000000000000000000000000000 000 Heu 0000000 bin sh DODODODOO start Groupmax Object Server Groupmax Address Server 000 address
262. data in memory wasnot updated Data from nn before the update will be 2 0 0 00000000000000 1111111101 1 1 1 1 IDINDX idx KENNIN log ORGGROUP tbl ORGGROFFtbIg 0 0 0 2000000000000 3 usr GroupAppobin O00 0000000 AppoSV ini RetryInterval 0000000 00000 4107000000000000 45107 I An attempt to re read the Xxxxx0 0000000000000000 file was successful nnmnnmnmnmnmmmnnmnmnnnnnnrnnrnmnr TA XXXX PAE TASA S EO 339 DON DODDO ID OO ud OO 45108 E An error occurred during 0 0 0000000000000 memory initialization 000000 Access control based on 0000000090 organization groups will Dunn 0 oo oog be disabled until ORGGROUP bIJ ORGGROFFtbIQ D initialization succeeds XXX 2000000000000 3J usr GroupAppo bin B 0 B 1 B 0 D AppoSViini RetryInterval 0000000 1 1 60301 E Service entr
263. details about cluster parameters and how to set them consult the cmquerycl lm manpage or your manual KKKKk k k k k ce k k k k k k k k k k k k k k k k k k ck ck ck ck cock ck ck KA k k KKKK Enter a name for this cluster This name will be used to identify the cluster when viewing or manipulating it CLUSTER NAME cluster2 Cluster Lock Device Parameters This is the volume group that holds the cluster lock which is used to break a cluster formation tie This volume group should not be used by any other cluster as cluster lock device Warning No volume groups were found on all nodes A cluster lock volume group is required for clusters of only two nodes FIRST CLUSTER LOCK VG dev vg03 Definition of nodes in the cluster Repeat node definitions as necessary for additional nodes NODE NAME nodel NETWORK INTERFACE 0 HEARTBEAT IP T723 Del ST Warning No volume groups were found on all nodes A cluster lock device is required for clusters of only two nodes FIRST CLUSTER LOCK PV dev dsk c3todo List of serial device file names For example SERIAL DEVICE FILE dev tty0po H Primary Network Interfaces on Bridged Net 1 lan0 Warning There are no standby network interfaces on bridged net T NODE NAME node2 NETWORK INTERFACE lano HEARTBEAT IP 1727 1 2 Warning No volume groups were
264. el HOSTCHG 0000000000 7 3 BOSTCHGOOOOOOOOOOOOO 000 el BITECHGO 0000000000 74 BITECHG 0000000000000 00 000000000078 00000000000000 DO 006 DO OO 000000 000000000 11142 111 1111111141111011110110110111111111111111 1 1 aconsole roomconsole 2 1 1 1 0 e ete DODODODODODODO e logi 000000000000 romp 0 00 00 000000 00 e 00000000000000 Groupmax Facilities Manager 3 aconsole roomconsole OOUOOOOOOOOOOOOOOOMOOOOOOO 1000000000000000 4 s DU 307 QOH Assist D 9 DO H Assist
265. found on all nodes A cluster lock device is required for clusters of only two nodes FIRST CLUSTER LOCK PV dev dsk c1t2d0 List of serial device file names For example SERIAL DEVICE FILE dev tty0po Primary Network Interfaces on Bridged Net 1 lano Warning There are no standby network interfaces on bridged net F HE Cluster Timing Parmeters microseconds HEARTBEAT INTERVAL 1000000 NODE TIMEOUT 2000000 Configuration Reconfiguration Timing Parameters microseconds AUTO START TIMEOUT 600000000 NETWORK POLLING INTERVAL 2000000 Package Configuration Parameters Enter the maximum number of packages which will be configured in the cluster You can not add packages beyond this limit This parameter is required MAX CONFIGURED PACKAGES 2 List of cluster aware Volume Groups These volume groups will be used by clustered applications via the vgchange a e command For example VOLUME GROUP dev vgdatabase VOLUME GROUP dev vg03 Denggapapnpnadgpau ck k k k k k k k k k k k ck k k k k k k ck ce k k k k k k k k k k k k k k k k k k k k k k k k k AA k k k k k k KKKK HIGH AVAILABILITY PACKAGE CONFIGURATION FILE template KKKKKKK k ck ck lt k ck lt XXX lt k lt k lt lt lt k k K k k k lt ke
266. ihahost v a3 D BESRID pon saaa fA ADA E 3 74 J ase devel EAD 2 0000000000000000045 pod 0 00000000 000000000000 000000000000 pod 0 00000000 000000000000 000000000000 po0000000000000000000000000DNSgo00000000 po00000080000000000000000000000 kaihahost 0 D co000000000000000000045 DNSgod000000000 DODO 000 00 000000000000 0000000000 3 OOO 80000000 000000 odo 00000000000 D00000000000000000 0000000000000000000000000000000000000 4 0 100 120000000000 2200000 5 61 4 00000000 e 400000 049 D oxpp00000000000000000000000000000000 20000000000 aaa 10000000000000000000000000000000g DU 000000000000000000 po0000 00800000000000000000000000 09000000000000000 90000000000000
267. o RED E EE D dg aaa OOM 842 00000000000 000 00000 0000000000000 0 0 00000 4451 OOOO 0000 00000 4152 DODODOO DO HH DB UU 6400000000000000 131 4 00000000 464 DO000000000000000000000000000000000 OR 2 j gt E FARAD EQ use FEE OOOOOOOOOA
268. roomG 000000000 291 00A DDUDDUDDUD 2000000000 0 000000000000000080080000000000 00 8 1 20 9 9 D usr iki usr01 199509 ssd 199509 msd password psw usr02 199509 ssd 00 101 O room02 O O usr01 usr02 0 0 IDO O U room01 20002 00 IDO uua 00 400 2 e 000 1mg0000000000000000 0000 0 nsd 0000000000000000000000000 rsd 000000000000 ssd 000000000000 msd 000000000000000 smn 00000000000000000000 emb 000000000000000 todo lst 000000000000 todo num 00000000000000 contact Ist 0000000000000 holiday tbl 00000000000000 password psw 0000000000000 kbnordr dat 00000000000000000000000 0000 ID ENV D D DE D D C D C D C U CI U CI U I 292 00000 grpmem dat
269. s 0 B gt Q ao lt Q O 0000000000000 O HACM 000000 HACM FU ct O 45 4 mkdir HACMPdata iki 0000000000000 000000000000 0000000000 OOO gmaxpkgd iki 00000000 cd var opt iki cp pr HACMPdata iki go000 0000000000000 00 0000000000000 0 5 8008000000 0000 00000000 0000000000 0000 0 rm rf var opt iki ln s HACMPdata iki usr iki 9 Scheduler Server Facilities Manager 0 0000000000000000 1101 cp usr bin AppoMan ini usr iki log AppoMan ini mv usr bin AppoMan ini usr bin AppoMan ini bak ln s usr iki log AppoMan ini usr bin AppoMan ini 10 Scheduler Server Facilities Manager 0 000000000000009090 UUDUuupDpuuupnuu vi usr iki log AppoSV ini Data HAHostName hacmphost WriteThroughSV 0N 11 12 13 0 x 10101 uu O MC S
270. 0 0 Scheduler Server0 0000000000000000 00000000 roti 0000000000000000 000000000000 000000000 O aconsole Y roomeonsole 1 000000000000 000000 0000000 aconsole s t u d i gl un 1 100 sp0000000000 0000000000000000 9 Address Server 0000000000000 200000000000000 0200 00000000000000000000000000000000 gt 0000 ps0000 2000000000000000000000000000 3 0000000000 aconsole 000000 l indxget T 1 0 0 D dna OOOO0000 1 iQ OOO YMO00000 tmp y txt 00000 2 aconsole u lt tmp y txt 00000000 000000000 acosdegog 0000 0000000000000000 lt lt Groupmax Scheduler Server gt gt 0000 000000 D D D DD OOO 0000 000000 000000 000000 0 OM 00 90 DUUDUDDDUDDDDDUDUDDDDBDBDDUUDUUDDDBD 100000000000 100000000000000000acosdeppa00000000000000
271. 0 0 Facilities Manager B B D 1 HU D Facilities Manager 70 B 0 00 HB D B 0 B UL D D JU UI CD mount r v cdrfs dev cdo cdrom cdrom aix setup cdrom Scheduler Server Facilities Manager 0 0 0000000000000000 Dodd 00000 00000000000 cp usr bin AppoMan ini usr iki log AppoMan ini mv usr bin AppoMan ini usr bin AppoMan ini bak ln s usr iki log AppoMan ini usr bin AppoMan ini Scheduler Server Facilities Manager 1 DDD Hu BHL D B 11 D D D 00000000000 vi usr iki log AppoSV ini goae00 0000000000000 000000 0000000000000 000000 HAHostName hacmphost WriteThroughSV 0N 10 11 12 0 uu O MC ServiceGuard Scheduler Server Facilities Manager OOOOOOO ln 8 usr iki log AppoSV ini usr GroupAppo bin AppoSV ini cd umount HACMPdata podd000000000000000000000 varyoffvg HACMPvg Oooo Oooo O O 0020000 390
272. 0 0 0 0 usr GroupAppo bin Aasya esv O 00000000 7 0000000 Oal 0000000 00000000 DADO OOO 000 00000000000000 po0000000000000000000000 Aasya csv 00000000000 podo0000000 000000000000 Aasya csv i 0 00 00000000000 00000000000000000000 Scheduler Facilities 40000000000 0 0 0 000000000000000 000000000000 Q0 usr GroupAppofbn 900000000 000000000000000 0000 tj 0000000000000 0000000 E Oooo Oooo o 5 9 O 0000000000 sr GroupAppo bin Q o u 3 0000000000000 SFimporth 000000 Aasya csv i DD 000000000000000 00000 usr GroupAppo bin SFimport c Aasya csv usr iki 4 D000000000000 SFimport lH 000000 Dod000000000000000000000000 usr GroupAppo bin SFimport i Aasya csv usr iki
273. 0 1000000000000000000000 00 1 00000000000000 rse1000000000000000000 smit cm cfg res select ENTER OOOOOOOOOOO 00000000000000000 rsgi O 00000 ENTEROOOOOOOOOOOOOOOOGO 0000000000 rsgl nodel node2 0 Svc1r 000000000 O HACMPdata HACMPvgl DD O apsi 1111111011 UU 402 00000 rsgl 4 000 10000 podd0000000 000000000000 Scheduler Server Facilities Manager Address 0 0 Address Server Object Server HACMP ES D po000000 00000 HACcMP po 00 0000000000000000 pod 0000080000000 0000000000000 podp00 0000000000000 smit clappserv_to custom_monitor select 0000 ENTER 00000000000 000000000000 ENTER0 0000000000000000 00000 pad0 00000 apsi tmp monitor 301 15 on fallover 0 vio 00000 0000000000000 goa000 0000000000000 00000000 00000000000 000000000000 00000000000 go000 0000000000000 00000000 00000000000 000000000 5 OOO 1000000000000000 200000000 OOO 1900900000000 0000000 200000000 smit clsyncnode dialog
274. 0 AA 00 0000000 Ctri C Ctri Break 0 00 0000000000000 U sagd SCHogimp fA d filename QOOOOOG00000000000 logfilename pao 080000 6 EJ 0000 filename 0000 S pas ri Oooo oO ES now ou Zo Qu So ga ero cn a o aq c B gt 2o00 8 c ESE EAS 3 EEE TETAS T 16 ENS Bs m o c3 5 5 L3 L3 L3 00000000000 000000000000000000000008 0 0 0 00000 00000 errno X MessagelD Y noo nlooooo noo 53 noo 5 riii noo ie noo y o noo Co noo ooo oono H noo CJ noo noo noo i noo noo ooo noo noo ooo noo noo ooo noo 237 7 0000000
275. 0 Scheduler Server Facilities Manager 0O00 0000000000000000000000 ps 61 grep usr bin SV ps 65 grep usr bin AppoMan ps ef grep usr bin RMSV 4 ps ef grep usr bin RoomMan 10 2 1 2 Facilities Manager 1 0 0 0000000000000000000 Scheduler Server Facilities Manager podgo0g0000000000000000000000000000000000 O30 00000 0000000000000 00 Scheduler_FacilitiesQ B 00000000000 pod 0d 080000 00 0000 000000 000000 0000000000000 P20000000 000000 0000000000 Address 000000000000 Address ServerQ 00000000000000 podd08 00000 000000 00000000000 aconsole Facilities Manager O O roomconsole DO 00000000 0008 usr bin 500000000000000000000 10000000000 pg000000000000000000000000000000
276. 0 d d d D d d C D Sizen d D U d 0 opodg000 0000000000 16 3840 0000000000 000 33 3 1 0 0000 0 0 34 TraceAfter Error O oNpp O O 00000 Ooo Oo O D 3 5 2 O EIE E SES ESL se O 000 DU 0000000000000000000000000000000 Tracel0 O00 Trace 0N Size 1024 Il Filecnt 109 000 TraceAfterError ON OO O30 0000 podd0 000000 00000000000000 Dugmsa2 go0000000000000000000000000 000000000 2 a3 00000000000 erver Facilities Manage Y 0000000000000000 100 16000000000000000Fiecespo00000000000 111 1010 000000000000 000000000000000 9
277. 00 pod000000 tmp data csv 0 0000 0000 e 0000 ID S U kaihtl uid 224 7 0000000 7 11 SCHogimp OOOO 7 11 1 SCHogimp 00000000 SCHogimnQOOOOOOOOOOOOOOOOOOOOOOOO 1D000 ID000 7 7 SCHogimp 00 00000000 1 2 8 4 000 000 1D0000000 5 11 1 1 000000000000 00000000000000000 7 11 2 SCHogimp 000000 e 0000000000000 pod 000000000 000000000000 000000000000 Ctrl C CtrltBreakQ 000000000 Ctrl C Ctrl BreakQ OOOOOOOOOOOOOOOOOOOOOOOOOO 000 po0000000000000000000000 ORGGROUP bak po00000000000000000000000 ORGGROFF bak odo 000000000 000000000000 000000000000 pod
278. 00 0 3 4 indxget 000000 lt BIBS HANES gt AddressServer Q ZE 3B 01838 0 RR SE UE KALI COTM YorN Groupmax Address Server 2 Y HO 275 35 36 8 Ok 82 A MONA Ok Bx gt OA Ok 3 y 4 IL 00000000 138 Ok EXD gt 4 00000003 138 Ok ED 4 0000000 138 Ok IRTEERA GA LPO 1 Aasriikillogiindxget log Hit return key 4 Da d d 0000 0 e Scheduler Server Facilities Manager 0000000000000 e Version2 0 Version 7 1 0000000000000 e Address Server 111100101000000000000 0 e Address Assist C 000000 5 1 Groupmax Address Assist Groupmax 00000000000000 OOOO Address Server 00000000000000 e 00000 71 Get4dA MO 0000 0000000000 3 OOOOOOOOOOOOOOO pad g000 000000000000 log indxget 1og 00000 GetAdAlQ O indxgetO 00000 1 gg 00 00 0000 000000000000 000000000 1 Address Server O0 000000000000 e Scheduler Server Facilities Manager HO e Address Server 0000000000 Scheduler Server 0000000090 0000000 Facilities Manager Y 0 0 00 00 LL Address Server O 0000000 Scheduler Sevepag4 00000
279. 00 0000000 0000 5 Groupmax Address Assist 0 OOOOOOOOOOOOOOOOO 0000000000000000 etc mv tb1 000000 usr iki etc MV tb1l 00000 80000000 000000 000000000000 0000000000 USER001 HOSTA HOSTBO 000 USERO02 HOSTB HOSTAJODO O USERO09 HOSTA HOSTCO 000 ODO 0000000000 0000000 Assitl DO000000000000000000000000000000000 000 AssistOpgg 000000 000000000000 00000000000 9 Oa Assist pp000000000000000000000000000000000 000 0000000008SFdatap0 0000000000000 pep 0000000000000 000000 1 Scheduler Server Facilities Manager O 0000000000000 Facilities Manager 0000000 Oo 00000 00000 podd0000000000000 19 0 00 69 00000 oO O O 0 AppoMan RoomMan RoomMan 0000000000 E a EST CET EI sap E TE J Ej era EL 1 q Jm OooooReo Oooo Ooo EX El E Ea
280. 00 GroupAppomouse Server 01 00 Server 0000000000000 Server 1 0 0 0 oldserverlist 0000000000 5 Version 60 00000000000 0000000 0000000000000 080000000000 000000 000000 00000000000 podd0 000000000000 Version 4 0 00000 000000000 Version 0000000 Version 6 Version2 0 Scheduler Server 7 Version2 0 1 1 1 1 FacilitiesManagerQ Scheduler Server Facilities Manager BH BH B0 H D D U D D HU indxget 0000000000 Version 5000000000 Version 30000 8 indxget 0 00 0000000000000 000000 000000000000 indxget Y 00000 7 Version 5 Version 6 0 O Version 000000000 da0 00800000000 000000000000 Address Server OOO0O0000000000000000000000 GetAdAll indxget 00000 Version 3 J Version 5 Version 6 Version 7 uu 1 0 0 1 10 Version 3 AppoMan ini 00 00000000000000000000000 OO Version 5 SockOptSV ON SockOptMan ON SockOptRMSV ON SockOptRMMan ON 1
281. 00 00 D 0 0000000000000000000000000 1000 00009000000 0000000000 egtcout0 0000000000000 2 0000000 ago CODD UU UO DO OD 3 00000000 00000000000000000 0000000 000000000000000000000000000 0000000000 agtcot 00000000000000 O00000000000000000000000000 0000 000000000000000000000000 agteout 00000000000000 5 0000 UU SFdatacp 0 0000000000 0000000 0000000 agtcout 0O 0 00000000 O 300 SFdatacp 000000000 000000000000 0000000000 1eg asent D D Ip SFdatacp log 00000 0000000000000000 1400 IDD D 0000 310 QOH Assist OO 00 SFdatacop 1111001010 D D Dn D 0000
282. 00 000000 1200000000000 DO 00 20000 00000 9900 aad D zQ000000 D 8 5 1200000000000 u 6 000000000000 00000000000 000000 188800000 Dx 7 1200000000000 u Dx 8 Version2 0 3220000000000 Versions 0000000000000 00000 270000 Dx 9 Address Server 70000000 Address Server 000000000090 10 Groupmax Facilities Manager ppo00000000000000000000 111100 1 295 O00 6 WindowsQOOOOOOO DOC Windows D Windows JJ 00 GroupAppomouse Server Windows NT Y Q P 2446 141 01 00 0 Groupmax Scheduler Server Version2 Windows NT 0 GMAX SSVW 02 00 Groupmax Scheduler Server Version 8 Windows NT GMX3 SSVW 03 00 GMX5 SSVW 05 00 Groupmax Scheduler Server Version 6 Windows NT GMX6 SSVW 06 00 0 Groupmax Scheduler Server Version 5 Windows NT 0 0 7 7 El SEJ r El LJ QU Er E 1 EJ EI EI E El 3 Groupmax Scheduler Server Version 7 Windows NT 0200000 Windows 00000 P Scheduler Server 0 OOOOOO OO0O000000000000000000M0 9 0080000000 00000 000 00 0000
283. 00 Scheduler Server Facilities Manager 8 0000000000 Scheduler Server Facilities Manager 000000000 2 0000000000000 AppoSVini 0000 WriteThroughSV ONT OO 000000000 WriteThroughSV ONJ 1 0000000000001 WriteThroughsV OFFD 000000000000 pod 0080000 00 0000 000000 000000 00000000000 pod 000000 0 00000 000000 000000000000 3 0000000 Scheduler Server Facilities Manager 000000000090 080000 000000 000000 000000000000 0000 1P000 000000000000 OOOO 4 000000000000000000 dad e Address Server 000000000000 Scheduler Server UU D Scheduler 7861888 B D D Scheduler Server 1 0000 0000000000000 pod 04080000 000000 000000 000000 00000000000 381 382 000000 5 Assisti 0000000000 020 00000000 1 HP UX 000000 0 Scheduler Server Facilities Manager 0 SVO RMSV 000000000 AppoMan RoomMan 00000000 MC ServiceGuard 1 1 1010111010 0 00000000 860886 0 roomconsole
284. 000 0000 poddo0 000000000 00000000000000000000 podp0 0000000 00000000000000000000 99 2 oOo 0 0 DO 00 00 0000 O40 000000 pcog00000000000000000000000000000Td00000 Dal 121 4 00000000 p4 sp0000000 000000000000 Schedule DEERE 6 ES BHOEAT Todo DR DERE c EEE C ERE C BAR RB weno mo 5 1 p0000000000 podd0 00000000 000000000000 000000M000000 2 0000 000000000000 oxp00000000000000000000000 00000000000 g1 1 1 2 Todo ADO OO BE BDO DO OD DO DO 0000 0000000000000 os 0000000 pogo 0000000000000 000000000000000000000 000000000 po00000000000 122 4 00000000 Dal 458000
285. 000 SFimport 00000 O un SFimport LU OOOO Groupmax Scheduler Server 07 32 000000 7 4 7 5 7 6 D 7 7 7 8 8 1 A 1 A 2 000000000 100 11000 SFexport OOOO 0 u SFexport OOOO L 1 Uu SCHogimp 0000000 0000 ORGGROUP tbI 0 Scheduler Server Facilities Manager L UDDUDDUDDBDUD A 4 A 5 K 1 K 2 111 1 Facilities Manager 00 0 UD Scheduler Server Facilities Manager 0 0 L Facilities Manager 0000 N 1 N 2 N 3 0 2 0 3 0 4 0 5 C yo L D 0 SVIRMSVI D 000000 AppoMan RoomMan 0000000 aconsole roomconsole 0 0 UD D D OU OU 1
286. 000 5 O O 0 S 00000 0 000 21 E Ei 0 oO El oOo Ex El o 2 gt 00 OO 00 156 5 Groupmax Address Assist 0 0 0000000000000 Scheduler Server 0 OOO 000000000000 DNSOOOOOOOOOGO 0000000 Oooo Oooo L3 L3 L3 Oooo Oooo EI Gal iE EE E EEE 0 podd000000000000000000000 podd0 000000 00000000000000 podd0 000000 000000000000000 000 109 agent 0 0 D p 00 000 G ELEA GENEE L3 L3 L3 LJ L3 L3 4 L3 L3 L1 L3 L3 L3 L3 EX OH 0 0 0 0000 000 DU DU DU 000 UUUDDDBDUDBDDUDBDUDDDDDDII SFdatacpO DO 00000 hostchg 00000000000 I hostschgl 000000000000000 0 0 A hostehed 00000 000 0000000 SFdatacpg 00000000000000
287. 000 pImpgo01000000000000000000000000 000000 po00000000000000000 lo9 agent 0 0 D 1D0 result txe1p40000000000000000000000000000 0005 00000 I B D a UD po00100000000000000000 161 e Groupmax Address Assist O O O 4 SFdatacp 0000000000 Assist 0 0 D SFdataepD O 1 1 D 82 DUUDDUDDDUDDDBDDUDUDUDDDBDBDUUUDDDUDDDDUDUDUDUDUDDDBDUDU D 0 0 SVE Facilities Manager J ODO DO 00D0000000000000 RMSV 0000000 00000000000000000000000000 Assist 000 0 SFdatacph OOO SFdatacp c0000000000000000000 0000000000000 00000000008SFdateepod0000000000000000000 Aog agent U H IDO O00 00000000000000 000 0098 gt kooro 00000000000 Un 0 0000 usr GroupAppo bin AppoSV ini 7 HB 00000000 000000000 0000000000000 ApposviaigOOOOOOOOOOOOOOOOOO 0000000 AppoMan RoomManl 0000000000000 000000000000000000000000 Sockets TimeO0utMan 0
288. 000 0000000000000000 1 0000000000000000 ogfete gt k 00 OO 000000000900 00000000 000000 0 0000000000000000 eget 0 00000000000000 OO00 D usc iki D 000 2000000000000 GetadaanOOOOOOOOOO 6 0 Scheduler Facibaest gdg00 0000800000000 000000000 000000000000 0000000 0000000000000000000000000 000000 dta 0000000 Nog Replication 0000000000000 Cob EXE EE UE 0 00 D u DO usr iki OO00 1 0 Scheduler Server Facilities Manager 07 300 00 000000 000000000000 00000000 Scheduler Client Facilities Manager Client WWW for Scheduler Scheduler Mobile Option Scheduler PDA Option Client Light Collaboration Schedule 00000000 ti Scheduler Server Facilities Manager 0000 JPOOOO
289. 0000 1 00 2 pogo 000000000000 0000000000000000000000 00000000000 1 aaa 9 D 2 Address Server DO DO DO DO 1 DO DDD 0000000000000 041 8 090 20 gb0 000 0000000000000 podd0000 000000 000000000000 000000000000 Oa 20000000000000 10000000000000 DO 1 00000000000 1000000000000 0000 0000 0000 L3 L3 L3 64 4 00000000 po0o00000000000 0000000000 0000000000000 2080000000000 00 2 00000 2000000000000000000 D
290. 0000 115 E 0000000000000 000000000000000000 00 0000000000 0000 p0000000000 0 9011011100 00000000000000 O checkiag O0 0000000077 O checkid O0 0000000000000 OO R 3 SFexport O 0000000 4000000 373 QO 8 D SFimport 0 O SFexpor J DD 00000000 DD 1 R 4 SFexport 1 00000 00 I 0000000 00 I xxp00000000000000 2 I 3 I 4 I 5 I 6 I 7 I d H1 D D D 8 IDINFO2 idx 000000 E Mail 1 9 E uggugnagg Mspado0000 10 LudLudLudL idi E p4000800008000000000 11 E 12 000000000 O SFexport log DU dut E OO GO gg00000000 8 et
291. 0000 0000 0000 ID 0 2 5000 0 2s0p0000000000000 10000000000 podd00000000000000000 Oooo J O 463 DODODODO 72 4 00000000 pod0 0000 000000000000000000000000 0000 170000000000000000000 00000 00000000000000 47 3948189002 200000000000000000000 OO0U00000000000000g 73 4 00000000 II ANO AAA Pp0080000000000000000000000000000 5000000 2600000 1 O 000000000
292. 0000 000000 000000000 0 E p 3 I D D D D D 0 0 seri ID xxx GroupID yyyy UserID ssss GroupID tttt J 0000 0 0 0 D x O O rpinpx idxJ 0000000000000 ez JO ED E EST gt xxxx 0 yyyy O sssst 1 tttt0000000000000000 l 00000000 WOOO 2000 0000000000000 Address Server 00000000000 1 0000000000000 2 00000000000000000000000000000000 000 e OOO DDUDITIDDDBDUDDUDDDDUDUULU Address n 000000000000000 D 15 Address J 0000000 O Groupmax System U O00 Groupmax System 0000 11 01 0 U GmaxsYSOOOOOO 0 9 0 0 1 1 D 0 D D Address Server 000000000000
293. 0000 00000000000000000000 4 pop0000000 0000000 00000000000000000000 podd00000000000000000 5 po00000moxp 000000000000 000000000000000 4 00000000 4 13 11 1 0 0 UUDDUDDD DDDDUDDDDDDBDDUDUDUDDDBDDDDUD 4480000000 O00 0 mwanaanga 443 000000000000000 fier aa OO 018200000000 0 44pg0000008000000000000000000000000000000 105 4 00000000 l 444 es ORE BRT rye ABAD 1 000000000 O pH O 1 pH oO pH O O 5 ES Ooo O DU
294. 00000 0 e0200 SchedulePath 0000000000000 700000 3 0000000 193 7 0000000 pod0d09 000000 0000000000000 e 0 300 logname 000000000000 109886 0090000000000 000000 000000000000 00 0000000000 000000000000 090 una codechg log j JO 0000000000000000 L0 eedechg log 1 0000 O30 000000 100000 040 00 100000000000 m000000000000000 00000000000000000000000000000000000000 codechglog D DDDDDDD 000090000000000 09808000000000000000 DD 1D O000000m0000000000000000000000000 AAAAA BBBBB BBBBB CCCCC 0020 88888
295. 00000 8 Address Server OOO Address Server JODOD000000000000000000 pod 0000000000000 00000000000000000 00 00 000000 GetAsagOOOOOOOOOOOOOO Address Server 110110080000 0000000000000 0000 D var opt GroupMail Groupmax GroupApp item def DU po00000000000000000000000000000 Address Servr 000000000 000000000000 000000 10 O 000000000 aconsolef OO 0000000 AppoMang DO 000000000 tli roomconsolel OO 0000000 Ro Mani O O 0 O 12 0 00000 esp Windows UNXOOOOOOOOOOOO 6 1 1 0 808 30 OO DO 0o N E Er Boe cct O 60 60 0 6 671 LE E El 13 0 BIT 14 0 Zo e HO 15 0 00000000 roomconsole OO O RMSVO LH Ee 0 p Et os 0000000 Scheduler Server 0000000000000000 356
296. 00000 00 MH OD 000000 000000000000 D UUDDDDDDDDUDUDDDUDDDDUDUUBDUDDDBDBDUDUDUDUDUDUBDUDDDBDUUL 0000 O 191 Scheduler Client WWW for Scheduler OU D 0000 000000000 amp 1000000 oon mu EX EX E E 11 11 1111 umi 249 8 00000000000 081 0 Scheduler Client WWW for Scheduler 00000 l 1 KFCG5001 1 Scheduler Server 00000000 000000 Address Server OO Server 000 Y C 2 c a c E o codo Un 000 000 000 D B D U U U U O O Address 00000000 53 g Soon 3 g 2 28 mm E Ooo u L3 HO L3 HO O HO 000000 0 0000 ouau gp C ai pr nooo nooo co 5 m Saa S El nooo r4 C3 m oO r3 oH o nooo E nooo 2 OO 00 OO 00 UL r3 oO E E rr A 2000000 ADO C3 F3 a aa Co L3 r3 LLL lt c 53 c 1 O o 3 ODO r3 r3 r3
297. 00000 000000000 Scheduler Facilities 0 0 0 00000000 O O Scheduler 00 00000000000 16 54 KFCG5054 i DO000000000000000000000 2 00000 Scheduler oo 000000000 IPOOOOD 000000 Hossg 000 00000000 17 55 KFCG5855 1 Facilities Manager 00000000000 2 Facilities Manager H B B B 111111111111 1 111 1 1 10 1 11111 1111111111 1 1 10 1 11111 1 1 1 1 1 18 57 KFCG5857 23 8 00000000000 oo Scheduler Client WWW 0000 for Scheduler 00000 19 58 KFCG5858 20 61 KFCG5061 21 70 KFCG5870 Bog 22 71 KFCG5871 23 72 KFCG5872 24 73 KFCG5873 25 80 L3 r L3 r L3 L3 L3 r El Ooo ELE EJ Oooo Oooo Oooo Oooo Oooo Oooo Oooo Oooo L3 r3 Ooo 5 L3
298. 00000 000 0000 s 0 0 0 0 0 Scheduler Facilities 000000 checkid D 00000 11 1 0 0 0 107 E 000000000000 XXXXQ 000000 yYYYOO0d00 000000000 0 YYYYpo00 2 errno ZZZZ usr GroupAppobinQ 000000 Xxxxx0 00000000000000 e fusr GroupAppobin 000090 00000000000000000 XXXD00000000000000 108 E 000000000000 XXXxXp0000000YYYpo0000 pggaggaggu YYYY og 00 Z2222000000000000 lerrno ZZZZ 1 1 000000000000000000 109 E 0000 IDIXXXXI 00000 XXXXQO000 DXXXXp000000000 11110 1D00000 YYYYOOO i DO0000000000000000 0 0100 OOOO 2 DODO DO DO 00D 000000 Wood 00 P0000 0 0 0000 OOO 110 E OOO000 000000 lerrno YYYY po000000 pad g 000 00000000000 111 E Facilities Manager 000000 1 00000 Facilities Manager 000000000 000000 pa dd 0000000
299. 00000 UUDDDDDUDDDUDUDUDDDDBDBDDDUDUDD s70000000000000 000000000 97 4 00000000 000000000000 437 1 EBSETER 1 9 98 di Fey EIKO HRA BIET dj 9 9 00 9 0 Oo Lr Oo L3 L3 L3 L3 L3 L3 L3 L3 0 0 O 0 uana naa aaa 000000 00 00 podd0000000 000000000 sspo00 000000000 po0000000 4 00000000 00
300. 00000 00 0000 000000 000000 0000000000 ssist 00000 Assist Viewer D B B UU D U Scheduler D O O 1 1 Dodd g 000 00 0000 000000 000000 00000000000 Assist Viewer p00000000000000000 0 Assist Viewer 1 O O 0000000 0 0 l Assist Viewer ssist Viewer JO 000000000000 Scheduler 00000000000 poda 0000 000000000000 00000000000000 0000 Assist D000000000000000000 Assist Viewer D O podd0 000000000000 000000000000 0000000 gt ssist OOOO Assist Viewer 0 p000000000000000000M000H Assist O O SFdatacp 000000000000000 00 D lt nodo so 5 9 lt gt 000000000000 4ssisg0000000000000000000 000000000 0 O30 0000 Dal Assisti 1 10100 0 00 0 0 etc bNSHOSTS tb1 DO O0 000000000000 000000000000 000000000090 000000 2 DO00
301. 00000 0000 5681 1 1 1 1 1 1 1 1 560 1 1 1 1 1 1 1 checkid 0000000077 DO 00000000 checkid 0000000000000 377 OOS OOOOOOOOOOOOOA 1 2 21111114111111 101111111 111111111111411111 Lu t s8p000000000000000000000000000 Scheduler Server Facilities Manager JJ 00000000000000 AppoSVim 00000000 00000000SvprmMsvp 0 0000000000000 Password LONG PASSWD ON e AppoSVini usr GroupAppo bin AppoSV ini DOOOOOOO00000000000000000000 e AppoSV inif 0000000 Password 000000 LONG PASSWD OOOND 900 000000000000 OFF 0 00 AppoSV inif 00000000000000 LONG 101000000 0 9 OOOO 0000000000000000 Scheduler Server Facilities Manager 000000 Version70000000000000 Address Server 7 0000000 Address Server 0 00000 Version 7 ood0002000 000000 000000000000 000000000 00000000000 Groupmax Address Mail Version 7000000000 ooo dd 00000000000 378 DO Sched uu Er LE EX ES 0 00T OOOO uler Server Facilities Manager 0000000000 IPO000000 0000000000000 000 Schedul
302. 000000 Windows 0000000000000 OOO P Scheduler Server DO 0 0 0 0039 00000000000000000 GMX7 SSVW 07 00 Windows 0000000000000 UNXgo 00 0000000000000 OOO P Scheduler Server 0 000000 30 0000000000000000 0 D 296 Dub DO BD 200000000000 Version2 0 Version 3 Version 5 Version 6 Version 7 0000000090 100 1 DO E aconsoled OO AppoMang OO W roomconsolel RMSV OO 000000 RoomMan L3 bo O O O O HOO uz OI 0 0 3 EEE ESTEE ap S ESP a mE OOOO 4 1 L3 i usz ixilOOOOOO
303. 000000 00001 0000000000000 7 000000000000000 000000000000 00000 0 Groupmax DDD Scheduler Server 0 0 0 0 00000000000 0 1000000000000000000000008 8 800000000000000 000000000000000000000000 00000000 00000000000000 9 8000000000000000 00000000000000000000000 00 000000 10 000000000000000 00000000000000000000000 000000 n wooonnonnononn 000000000 0000000000000000 000000000000000000000000 1001000088 in 12 ExQO00000000000 000000000000000 13 300000 000000 x00000 00000000000000000 10 ID 000000x00000 00000000000 DD 14 ExDDDUU x00000 iooooooooxooooo wooo 10 ID 0000000000 234 7 0000000 DD 00000 00 oo a oola e 2 oo oo oo m 2 2 E ES a oo oo oo m oolo m EE oo BH 3 E EE oo a EE E m oe oo m us oo ooo Bla oo LES oo m v oo oog SA mE ca H oola oo SoS 5 yu oo oo oo O x oo 200 oo Ha ogo m oOyoo o oo poo nolo ou Bu oOo oA Chie
304. 000000 1 Groupmax GroupApp uu 1 Scheduler Server Facilities Manager D 1 D D 0000000 0000000000000 2 apposv Scheduler Server Facilities Manager 0000000000000 O20 00000 4 000000000000 uu MAIN idx XX uid 000 gst DOU 1 ENV tbl env EnvCheck tbl pad 000000 00000000 kbn DODO 000 0000000000000 kor dado 000 00d 0 0 0000000000000 KBN tbl 111 1111 001 0 SEC tbl SEC2 tbl BOSS tbl po000000 ScheDel tbl MV tbl IDINDX idx 000 900000 290 00A 00000 00 GATEWAY idx gst0 0000 WJa0g 0000000000 guest idx 080900000 1D0000000 IDINFO idx HOO 19 DNSHOSTS tbl NOU KENNIN log grpmem
305. 000000 412 OOO e Address Server OOOOOOOOOOOOOOOOOOOOOOOOO 0 0 1 101 11000 35000000 27 3 1 0 0000 0 0 GetAdAIl 000000 3 5 lt 2 HERBIER gt 2 50 0 511 535 2 2 CTH Yor N gt y Groupmax Address Server Y o 187 SRA 36 422 6 Ok gt 7 ya Ok fA CARE Asya EMBA UU 4808 RARER kaihatu 039 fat B 1 G kaihatul MEHR UUUNUUUUU B W 88 2 G kaihatu2 MEHR UUUUUDUKU fa G kaihatu3 EME H UUUAUUU Gateway MAIN idx EMBER 8 Gateway 05 E IDINDX idx MIB 6666 ENTER 4 818 gt Ok 1 13 5 fusrfikiflogsindxget log Hit return key 3 1 3 Facilities Manager 000090000000 Facilities Manager 0 00000000000000 0000889000 roth HOHOOHOOU0000000000000000000 O aconsolel QO roomconsole VO 000000 000000 0 OOO roomconsole s t u d i g n D 1DD sp0000000000 0000000000000000 Address Server 0000000000000 200000000000000 e0200 jsp p0000000000000000000000000000000
306. 0000000 11 11 11101000000000000000000000000000 00000000 Address Server L3 Lr 0 0 Scheduler Server Facilities Manager 000000000 g 000 00 0000 000000 000000 000000000000 0000000000 0000 000 000 041 20 Address Server Scheduler Server Facilities Manager 00000000 Dodd 00000 0 000000000000 e Address Server 0000000000000000 svp RMSVITI D U D U AppoMan RoomMan 00000 GetAdAll Address Server JO e Address Server 000080000000 00 0000000000000 0 08 101000 088 GATEWAY idx guest idx 0 podd 0800000 000000 0000000000 pod d0000 000000000000 e Address Server 000000040 0000000000 0 Scheduler Server 0 Facilities Manager 0000000000000 e Address Server 000000000000 000000 000000000000 e AddressServer r
307. 0000000 0000 9 3 3 00000 DO000000000000000000000000000000 018200000000 9 9 200 9 COC 000000 096 00000000 487 JL 7 A SERBS 48607 JL 7 B BRAT 48487 J B ck ol UTERT FERRI 2 2 88 88 6 DESIRE 48607 JV 7 A 07 IRAE EK FAT WSS Ra 2 O20 000000000000000 O970000000000000000000000000000000000 OO 0000000000000000000000n0 281 9 4067 J 2 282 097 881 886 GRD amp EL A MUA Ju 2B ARUSI 404807 JL 7
308. 0000000 Facilities Manager 00000000000 I1D0000000000000 1 OOO LE 92 E3 E ta E Er ECL E 10080000000 1 1 0 0 0 0 0 bin etc log room BING ETC LOG ROOM poda 110111 0 000000 0 6 Scheduler Server 8004000000 000000 000000 00000 000000 00000000000 7 00000 1 DO0000000000 pod 000 00000000000 2000000000000000000 0004 00000000000 0000000000000000 Scheduler Server Facilities Manager 00 000008000000000000000 pod 000000000000 0000000000000000000 100900000088 8 Address Server 1 podd0 000000 000000000000 00000 12 Scheduler Server Facilities Manager 0 0 00000000000000000 00000000 000000 IDQDO60000000 000000 Address Server 000000 8 0000 ID Facilities Manager Y 800000000000000000000000000 0000 0000000000000
309. 00000000 000000000 00000000000 Facilities Manager Version 6 000000000000 e Scheduler Server 00000000000 Address Server 00000000 AddressQOOOOOO0O0000000000000000000000000 00000000 Address ServerQOOOOUOO0000000000000 OO000000000000 00000000 0 AppoMan RoomMan OOOO RoomManfOO000 AppoManp0 0000000000000 Scheduler Server Facilities Manager O Address Server O O upnnugggpnaggggaaggnnagggunpnumuud 0200000 Assist Viewer OO A ddress Server 0 Scheduler YODODO 000000 00000000000 0000 doo 000000 0000000000 0000000000 000000000 00000000000000000000 Assist 000000000 Address Server 0 0000000000000 SchedulerQ 800 0000000000000000000000000 14 5 Groupmax Address Assist 0 0 indxget 0000000 Dodd 00000 00 0000 000000 00000000000 e Assist DOOOOOOUOO0O0000000000000000M000 Get dAu Assist 0000000000 Scheduler JO OOOOOO00000000000000 0 0000 AssstOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO
310. 00000000 090000 00800 0000800000890000000 10 0 0000 errno X 61 EJo000 00000000000 11111 10110 0 111 11 1 1 1 1 12800000000 62 0 0 0000 pagdg o gon 0d 0000000 0000000000 1000000000000 1280000000000 0000000000000 6 EDODODOD00000000 0 0 000000000000000000 noooooon 0000000000000 000000000000 JUUUUUUUUUL 0000 00000000 W000 256000000 238 7 0000000 209 81 00000000000 8 2 Assist 9 000000000000 241 8 00000000000 8 1 DODODODODDO poda 000000 000000000000 000000 0000000000 D O10 0000sva o 0000000000 AppoMman IO D DE D D l D sevies 00000000000000000000 0000 services 0 0000000000000000 000000M11 TCPAPQOOO 00000000000 020 200000000000 O01 0000 1 Scheduler Server 0000000000 3 2 1 Scheduler Server O 3 2 2 Facilities Manager o0000000000 DO 2 000000000000 Tcr1epg 00000000 00002 00000000000000 TCPAPO0O000000000000000 0 1 1 recr1Pgo000000000000000 Dus 00003 00000000000
311. 000000000 009009000 0 Facilities Manager 0000 000 200000000 019 1 ret D 0 B D D D D DO DI 2 roomconsole U 0000 usr bin roomconsole 3 DOOORMSVOOOOOOOO 000000 200000000000 0 uscz bin RMsv D D BD D OO 4 DOO D RoomManf 0000000 1 4000000000000000 usrz bin Reemvan 0 D 0 0 0 38 3 0000000000 0200000000 9 9 po00000000000 1 BO gp 000000000 reet D 00000000 2 etc locairc 0 0n H0 ug D B BB HH D 00000000 etc localre if test x usr bin brc Appoarea then lusr bin brc Appoarea 2 f 0000000000000000 1 HP UX AX J uultu brc Appoarea OOOOOOOOOOOOOOOOOOOOOOOOOOOO OOOO bre Appoarea 0000000000 bin sh Licensed Material Of Hitachi Ltd HAN Rights Reserved Copyright C 1996 1999 Hitachi Ltd PWDPATH pwd ININAME usr bin AppoMan ini SCHEPATH cat ININAME grep SchedulePath cut c14 LOGPATH SCHEPA
312. 000000000 AppoManf 00000000 D Facilities anager 0000000000000000 0 RoomMan 000000 coo00d0000 0000000008100 000000000 Facilities Manager po0000000000000000000rMSvp 0000000000000 052 000000000000 000000000000 SFdatacp D 002 O O 0 53 z0 Oo O 0002 Assist 0 00 000000000000000000000000000000 4 5 2 SFdatacpp 00000000000 000000000000 0000000052 Q SFdatacp 0000000000 O 30 SFdatacp O OOOO 0000000 0000000000000 D UUDDDDDDDDDUDDDDDDDUDUDUDUDDDBDBDUDUDUDUDUDU 0000 0 9 1 O00 5Dpnugpunnuapaupnpnaanu 2 00000 log agent OU zn Wresuit te10 80000000 0000000000 207 8 00000000000 O 1 SFdatapOOOOOO0OOO00000000000000000000000 SFdata
313. 000000000 000000000000000000000000 0000000000000 0 log tmp_bk ORGGROUP blI 1 B pn aa 0 0 225 7 0000000 000000000 0o0000000000000000000 poda 000000000000 000000000 000000000000 0000000 ORGGROUPtbII 000000000000 0000000000000 880 ORGGROUP tmp 07 3 WEpk Z y TV 7 47v BRIT TAN eXtmp ORGGROUP tb c XGroupmaxYXapposv c Groupmax apposv etc ORGGROUP tmp etec ORGGROUP tb enusetul bsya enusetul bsya enusetul bsya eigyoul asya 4 eigyoul asya 4 eigyoul asya 4 eigyou2 asya 3 oda eigyou2 asya 4 enusetu2 bsya 4 enusetuZ bsya Viid000000000 5 00000 D signal 000000 D signal O 5 9 O O O Ke pol o YN EE 00 O L3 L3 L3 r3 5 cg OOOO OO OO 3 4 E OOOO rn O gt OO ES AEST wa Ea DD 0000 DD SIGINT 2 Ctrl C Ctrl Break 000000 SIGHUP 1 0000000000 3 SIGTERM 15 D
314. 000000000 Aogletc bk pod0000000000000000 6 10 0 0 0 legGetAdLck dat 0 00000000000 0 0000000000000000 M GetAdAlf O 000000 070 000 1 H usr GroupAppo bin indxget Groupmax Address Server 1 1 11 1 1 1 1 1 1 ok ok O Oooo L3 A L3 ok 00000000 D 00000003 0 00000007 D Ok D DD ox O00 ok D D D 187 7 0000000 080 000 2 usr GroupAppo bin indxget s Groupmax Address Server 000000000001 0000000000 ID Asya 100 Ok ID kaihatu J Ok OO ID kaihatul 1000 ok OO ID kaihatu2 1000 ok ID kaihatu3 1000 ok ID MAIN idx JO DO ok 0000000000 uu 188 7T 0000000 7 3 HOSTCHGII O 9 7 3 1 0000000000000000000000000000000000000000
315. 0000000000 O20 49 00000 U 4 32 pp00000000000 0000000000000000000 SAD Aika ETETETETETETETETETETETETETETETETETETETETETETES x s e ok e e e e 6 e e De e D e e D UG xix x x x x e D D d XX x x ke o E D DP UG Xxx x ke e e D D ae 4 kk ae BEES HE BERE E ES RE SEA Dn ERU Es l joe pe pe poe oe oe poe poe poe joe poe pe pe pe pe oe oe oe poe pe joe pe pe poe poe pe pos poe poe poe poe poe oe oe oe we os he he jos jos joe ELIT LE EI Er RRR LULL AE 2 000000000000 poda 000000 000000000 000000000000000000 poda 000000 000000000000 0000000000 e 000 00000 0 00000
316. 0000000000 0000 0000000000 7 L3 LE EI Lt o Ooo 1 1 L3 E EI LL o Lac oa EE alga 4 od 8 o0 on o EE ELE ET Hp sami ea CS maa EI o 309 DU H Assist D 000 9 I D 0000000 10 0000000000000 0 000000000000000 51 000 00000 100000000000000000000000000 000051 0000000000000000000 12 0000000xxxx000 D00000000000000000000000000 0 JO0000000000000000000000000 SFagent l f logfile_namel 20 00000 4ssist 00000000 po000000000000000 log agent SFagent log Assis po d 1000000000 po0d0000000000000 log agent ScheExec log D 00000
317. 0000000000 4 38 PEED 8 15 RR OKO di ryto ERA 8107 d 9 podo00000 000000000000 El OO 000000000000000 0x000000000000000 0 0 DUUUDDDUDDDDUDUDUIJDUDUDDUDDDBDBDUDDUUDUDDUBDDDDUUDUL 000010000000 s0pg000000000000000000 OOO00010000000 27000000000 4 El D 000 00000000000000 ox 000000000000 0000000 0 0 5 OOo O 0 0 El 10241 217 0 1 020 200000000000
318. 00000000000 403 ol 13 oo ol Ic ol Co ENTER 00000 00000 LE OGRI nooo nooo EAEE LEES mi OOOO 010000000000000 mit clverify dialog D 000 00000000 00 00 0000000000000 000 D D 0000 D mit clstart dialog Ooo oon E 000 N Go SEE ea I EI mu Co mu Co 404 po00000000000000000000000000000HACMP O O 00000000000 usr sbin clusterfclstat 00000000000000 0200000000000 0 0 00000009 00 4000000000000000 00
319. 000000000000 Assist 70 0 SFdatacpg OOOOOOOOOOOOOOOOOOOOOOOO 001 000 IDHAA nos Dg 0 Dd 0D 0 DD 0D 000000000000 OOK pot D O M GetAdAI indxget D GetAdAN O O 248 DO DOD 000000000000 00000000 gado d0 0000000 0000000000000 DO O aconsole O0 roomconsole 00000000 aconsole roomconsole 11 000000000000000000 P Scheduler Server 1 Scheduler Server 00000000000000 poe 0000 00 R D SFimport 0 SFexpotg 000000000000 D SFimport 9 D OOS 1 0 0000
320. 000000000000 Scheduler 00 pod 000000000 000000000000 000000000000 odo 000000000 000000000000 000000000000 pod 000 000000000000 0000000000000000 3 00000000 0000 Address Server 0000 0000000000000 00 0 9 0000000000000000014 000 00000000000 oooooooooooooocoooooooooooooooooolooag invxgep000000000000000 indxget OOOOOOOOOOOOOOG po000000000000000000000 00000 p000000000000000 100 M OQ GetAdAllQ O O indxget OOOO pod00000000000000000 Address Server 00000000000000 Address Server 0 0 000 SchedulerQOOOOOOOOOOOOOOOOSVO eMsv 00000000000000000 podd0000 000000000000 000000000000 0000 podd0000 0000000000000 F 0000000000000 D D D 00 0 0 Co 5 0 0 0 Oooo Oooo edule OO OO indxget e 3 00000 34000000 L3 J EJ 2 LJ L3 O E ES El 26 3 00000000
321. 0000000000000 e usr GroupAppo bin ApposV iniN 0 000000 e usr GroupAppo bin SFagent ini D D DH Hl Hl HH D 000000 00000 Windows 000000 0000 e DOBO0 BDO DO 00000000000 ete 00 000000000000 Yete pd 000000 00000 00000000000 g0000 0000000000000 0000000000 e D0O00000000000000000 os Af 0 0000000000000 0000000000 199800000000000000000000000 g00000000000000 roomG 00000000000000 9 0 0 0 0 000000000000000 0 1101100000 00000000000 00000000 00000000000 e DOBO DDD OD 0000000000 xeingApeosv inil 00000000 0000000000 usz GroupAppo bin 00000000000000 00000000000 00000000000 e D0O00000000000000000 bin sfagent ini 0 0000000 00000000000 usr GroupAppo bin DD BD D D B D B UL D D FU U TI e DOBO BO DO DB 0D DO 0000 000000000000 000000 1D 355 DO P Scheduler Server OOO 0000 00000000000
322. 0000000000000 20000000000000 2000000000 Scheduler Server 000000020000 Facilities Manager Scheduler Server 000000000000 Address Server aHa 0 000 A Q oO or 1es eee xpp0008000000000 000000000090 p00000000000000000000U0 Scheduler Server 0 Facilities Manager Y 0 800000000000000000000000000 etegodo 000000000000 000000000000 1es 000 DO O 181 7 0000000 etc_bksQOOOO000000000 0000000000000 000000000000 000000000000 0000000000000 0000000 988 DO DO DB 0 0000000000000 0000000000 000000000000 a 00000000000 1 0 00 00 00 0000000 0 0 0 0 GetAdaanOOOOOOOO 100 00 0 00 15 Address 0000000000 GMAXSYS 1101001000 s000000000000000000 15 Address 0000000000 GMAXSYS
323. 00000000000000 0000000000 00000000 0000 00000000000 1 1 0 1 0 0 241 0000 100 120900 000000000000000000 Version 50 Version 3D 00000 Verson5Q 00000 000000000000 DU 0000000 Versien 5r 00000 0000000 Versiond5Q 0008000000 00000 e 0000000000000000 Version 00000000000000 000 M00 00000000 000000000000 0000000000 00000000000 e D0O00000000000000 Versions 00 0000000000000 00000 e D0O00000000000000000000 00000000 0000000000 13 Version 50 Assist YODO DO DO DO DO DO DD 00000000 Assist O gd00 0000000000000 00000000 0000000000000 8516X DOOOOOO00000000000000000 14 Version 50 0 AssstOOOOOOOOOOOOOOOOOOOOOOOOOOOO AgentContri0 0 0000000000000051 000000000 0000000000000 000000000 0000 301 OOD 302 DOE 111 E 1810080000000 BE Scheduler Server Facilities Manager ppog04000000000000000 9 0 00000000000000008000 000080008
324. 000000000000000 O D Address Server 000000000 Address Server 0000000000000000 0000000000000000 0 0 Address Server 0000000 p00000000000000000000000 0 Address Server Scheduler Server D O0 0D0000000000000000000000000 15 Addressi 00 000000000 1 0 080 0800 80080 880080 88 0000000 0 9 poo0m 15 pgo0g000000000000000000000000000 0000 584 4 asa y E 23 3 1 0 0000 0 0 0 Address Server 0 11 1 poo 1 uu 2 00000000 000 D00000000000000000 000000 DO000 0000000000 0000000000000 uuuuunuunuununummpuuunuun Address 0009000000000 32000000 D 3 2 Address ODO 000000000 lt 15 Address EASA lt lt BR TEORIE F BAL tH IDE F BAL LA Big GMAXSYSEBA LI FOER ak tah 5 V 8176 E 8 gt 1 1 2 ty F 2 81 F 9 888585 2 4
325. 00000000000000000 00 809 4 00000000 890000000000000000000 B0000000000000 pod ooo oo ooo 0000000000000 000000000 0000 o oo0000000000000000000000 C0000 00000000000 Os ODA 0000000000000 pian pod 000000000 000000000000 0000000000 soa poda 00000000000 000000000000000000 139 4 00000000 416 11111 ULU L 140 D gpupnugapupnnuuapunnuapugnnugapnguagnadpu 100000 000000000000000000000000 2 229000008000 0000000000000000000000000 00000000000 3 poxpgo000000 000000 m0000000000000001 00 podd00000000000000000000000 room D 00 0 4700 00 000000000000 UTOY MBELE TS kaihahost poda 000000000000 aaa 4 00000000 4 17 IB D DU U EI C 0000 g0000000000000000000 6
326. 0000000000000000000 00000 po000000000000 415000000000 000000 OH E E GH EE rr rr oOo 0 0 0 0 Lr Lr O Lr 0 0 13 5 9 O D u O 5 O O 14 D O O Ooo O 40 E E D D D D 15 0 0000 1 5 9 16 OO ooo o0 ooo E EX ETEO Ed TO E OO OOo ooo UU OO OOo ooo rmn 5 8 5 1 0 E E E 40 4 E pod00000 00 4170000000000000000000 11111 11 1 11 1 EDE 0000000 0000000 000000000 31 0000000 32 000000000000000 3 nunnnnnnnun 31 DILULDLUDL 311 podd0 0000000000000 PP000000000000000000 PP 0100000 po PP p0000000000000000000000000000000000 02000 UU 0 1 1 0 000 00 00 080 0 00000
327. 0000000000000000000000 Moo 420000000000 000000000 u3 uu 172 1 1 1 OOO 1 HUU 1000000000000 nodel 2 1Pg000 172 1 1 2 20 000 3 HOU 2000000000000 node2 4 172 1 1 8 0000 00000 5 paa 0000000000000 gmaxhost 6 386 0 D b AIX J D D axgogoo0g0000900900009000000000000000000 00 38000000000 4 00 0000 D 1 000 11 oood 172 1 1 1 2 OOO 1000000000000 nodel 3 111 20 IP0000 172 1 1 2 4 OOO 2000000000000 node2 5 0000 IPO000 172 1 1 3 6 1111111111 hacmphost es BO BA 8 Be BEB podd000000000000000000000 roepog0000000000 00000 10000 20 ree pod0000000 1000000000 ID000 U 5 Scheduler Server Facilities Manager O Scheduler Server Facilities Manager Y 000000000090 O O Address Server 0000000000000 Address Server 000000 Address Server 00000000000000 Groupmax Address Mail Version 79 000000000 000000000000000 0100000000 D ag HP UX O P4xpo0000000000000000000000000000000 root H 0
328. 0000000000000000000000000000 DO00C00C00C00000 000000 0000000000 L3 145 5 Groupmax Address Assist 146 0000000 pog000000800000000000000000000000000 4 bL Assist 0 Assist 0po00000000000000000000000000M0000000 00000002 00000000000000000000 0 Groupmax Server Setup Wizard DO0D00000000000000000000000000000 0000 1 00000000016 AsssOOOOOOOOOOOOO D D Assist 0 OO 00000000000 lI ver 0000000 0000000 Address Server 00000000000 podd0000000000000 Groupmax GroupApp item def ee Ba e E C3 C3 C3 rd LE Ey C3 C3 C3 C3 O 2 200 3 E 2 00 gy CJ C3 O 0 ct V r op roupMai DO 0000000000000 Address Server 0000000000 000000000000 Assist 0p000000000000000000000000000000000 000000000 0 6 0 000090080 0000080000 0 45 AssstOOQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 1 po0000000000 ge E Seen 4 O o E Wwg000000000000
329. 00000000000000000000000000000000 o00 0000000000000000 ong O38 00000000 po0d00000001000000000000 D 0 O Oo Y o O O 0 0 OBO 4 El 0 0 50000 edul poo poo poo cheduler Server 0000000090 aconsolqd OOOOOOOOOOOOOOOOOOOI OOOOOOOOOOO r3 c m r LJ EJ Eo Ez DP eo ES E E oS EJ EJ 0 0 EJ El Bea ea ee r3 L3 r3 r3 r3 g EJ C 20000 C3 C3 C3 L3 1 C3 C3 C3 LE EJ EIE EJ 0 60 E C3 C3 LJ 1 C3 C3 C3 noo 25 3 e Facilities Manager 0000000000 roomconsole ODOOOOOOOOOOOOOOOOOOI OOOOOOOOO e Scheduler Server Facilities Manager 000000000 roomeonsole 1 1 1 1 0 1 000000000 aconslef ga 0d d00000000000000000 2 0000000000 0 0000000000000 9 00000000000000009 0 OO020000000000000
330. 000000312 000000030000000000000 DU 00 30 podd0 000000 00000000000000 5 9 0 0 0 42 00000000000000 00 312600 0000003130 00 0000 000000000000 00000000090 00000000000 3 14 JUD D DO D DD Ut O10 D 000000000000000000000000000000000000000 000000000 541 00000000000000088000 00 00000 000000 1 IDINDX idx 000 2 KENNIN log 000000000000 31 3 CODO0000000 DD 00000 0000000 3 ORGGROUP tbl 000000000 000000000000 000000000 0000 4 ORGGROFF tbl 0000000000000 000000000000000000 00 0200000 1 000000 usr GroupAppo bin AppoSV ini 2 000000 000000 Memory SharedMemory ONO QO OFF 000000 OFFOOOOOOO00000000000 e RetryInterval O O 0 360000OOOOOOOOOOOOOOOOOOOOOOOOO 30000000 3 Memory 0000 SharedMemory ON 0 0 O RetryInterval 5 0 O O30 0000
331. 000090 00 R19 00900 00800 00000000000 O30 9 000 738000000 OO nooo 20000 wo o 07 4 0000000000000 oooooooooo 1 2 3 4 5 6 7 8 9 1 1 111 1 0 N OOOO u 0 0 0 0 0 0 00 un E n dopo gag ug 4 8 OG 4 0 0 OO ring O uini n a D p D D H U l D p 1 S C AO O OX x x 0 1 1 1 1 1 1 1 Q gt O O O x x x x x x 208 7T 0000000 0000000000 1 2 3 4 5 6 7 8 9 1 1 1 13 1 uu 0 1 2 4 OOOO p 0 0 0 0 10 0 0 0 O B 0 ug uin O 0 0 0 0 0 OD DO 0 0 mH 0 n u n nnn 0 0 B a O D p 0910 1 HB O D 8 00090000000 8 UC x x A x 9 000000000 S U C x x A x 10 ngdngEMaliD 8 UC x e x x 00 00 1 mgu l gEMall 8 U x x x D 12 000000 U D x x 0 x 13 0000000000 FC A oio O x 14 0000000000 F 86 A x x x x x x
332. 0xxX000000000 D0 0000000000 xxx D00000 xx00000000 D00000003x00 yyyy 00000000000 0000000xx000yy0000000000000000 UserID xxxx GroupID yyyyl UserID ssss GroupIDItttt 000000 OW IDINDX idx 0 OO OO 00 xxxx sss HO O 000000000000 O yyyy D D 040000 podd0000000 000000000000 198 7 0000000 usr GroupAppo bin checkid Groupmax Scheduler Server check 00 1 a lt IDINDX idx gt 0000 199 7 0000000 7 8 grpehgl 114111 JUG OOOO Address Server 0000 0000000000000000000 0 0180000000 usr GroupAppo bin grpchg d SchedulePath v 1 l s 1 logname 020 00 Id SchedulePath O0 0000000000000 SchedulePath e0200
333. 1 Groupmax Scheduler Server Version2 0 02 300 0000000000000000 01 2200000 10100000000000000000000000 0 0000 000000000000000000000000000 300 Dub B OOO000000000000000000000000 0000000000000 000000000 0 00000000000000 0008000000000 01 100 02 200 0 0 OOO0000000000000000000000000 000000000 00000000 1 0 000000000000 023000000 OOO0000000000000000000000000 OOO00000000000
334. 1 1 14 3 1 2 Scheduler Server OOOO 18 3 1 3 Facilities Manager 0 0 28 314 31 3 1 5 33 32 D 37 3 2 1 Scheduler Server 37 3 2 2 Facilities Manager 38 0000000 41 4 1 Address Server 000 0 42 411 42 41 2 0000 42 4 1 3 Address Server 000000000 45 4 14 Address Server 0000000000 45 415 0000000000 55 416 0000000000 417 000000000 49 50 4 2 51 43 ooo 52 4 4 UB 54 4 5 000 55 46 UB 58 10000000 58 1 0 0000000000 6 0000 0 65 72 4 7 00 74 48 UD 77 77 00000000000 77 1000000000 81 49 UD 88 88 00000000000 92 00000000 95 4 10 ooo 97 4 11 og 102 4 12 00 104 4 13 000 105 4 14 0000 108 100 0 108 100000 113 100000 114 1 116 100 0 128 131 4 15 131 0 1 131 135 4 16 ooo 140 4 17 0000 141 4 18 142 00
335. 14 00 0000 O P Scheduler Server 15000000000000000000000000000000000 1000000000000 00 aconsolef OO 00000 svi 2 00000000000 0 roomconsolel OO 00000RMSvV l 00000 Windows 000000800000 0000 000000000000 oo Groupmax Scheduler Server Groupmax Facilities Manager eiGetAdAUu DD di 7 1 O 000000000000 00 el hostchg 0000000000 7 3 D hostchg 000000000000000 el biteched 0 LL D LO D CD 74 Mbitecho 000000000000000 361 poe 11 111 01 1 0 018000000000 1 000000000000 aconsoleg OO svi AppoMan DO 00000000060 M roomconsolef OO RMSV D O 0 gt OOO LC ow 0000000 ReomMan DO 0 00 e usr GroupAppo bin Apposv inif UU UU DU e usr GroupAppo bin SFagent inif
336. 14 _ORGGROUP tbI 0 0 228 7115 ORGGROFFttbI 0 D D 230 7116 0000 232 7117 1 234 11111 7 241 81 O0000000000 242 8 2 Assist 0 00 5 0000000000 263 821 Assis JO 0 000000000000 263 8 2 2 SFdatacp 000000000000000 266 000000000 269 91 270 92 273 924 DD 273 92 2 000 274 923 000 274 924 000000000 275 925 0000000000000000000000000000 276 9 2 6 277 9 3 1 0 000100 0100100000 00 278 93 1 DD 278 93 2 000 279 UU 00 933 00000 280 285 00A 0000000000 287 008 000000 294 JO 6 Windows JI Da DU D 296 OOD 297 00 5 303 OOF 305 00c QOO000000000000000000 307 DO Assist 9 000000000000 308 00 IDD DD 313 UU J 315 OOK 00000000000000 317 10 320 O O M GetAdAll indxgett 0000000000000 328 DON 00000000000000 337 DO O aconsole roomconsole 345 OU P Scheduler Server 349 0g 0000000000000 362 00 RO SFimport SFexport 1 000000000000 364 00 R1 000000000000 364 OO R2 SFimport 00000 365 OO R3 SFexport 00000 373 OOS 900 000000000000 00000000 378 0000 PO00000000000 379
337. 182 Ha 8458 IES mimi 5415 5953 545 ll 84 Bi imi jas mimi E Ei 7 s 88 Ei El E Ei 28 El El Bi El M A ela Moko 000000000000 2 e 000 000 000 000 2000 0000 X00 0000 pod 000000000000 0000000000 0000000000 09 0 podd0 00000 000000000 D D 2525525555 O 0 L3 LC cd L3 cd c r 0 0 0 0 L3 3 cd C L3 LLL LLL O 1 1 4 Ea E san 5 1 alte E 1 1 L1 LLL CO OOOO 89 4 00000000 pog000000000000000000mo0x0000
338. 2 9 KFCG5002 Facilities Ma 2 55 ge Y c Y 2 H um 4 4 EH 52 gt o e H o m Ono 3 Ooo 53 Ia p4 C3 C3 p4 F3 Co J PST EF 4 4 E Br 3 3D4 KFCG5003 KFCG5004 4 50 6 KFCG5005 KFCG5006 oo oo Lr oo 5 7 KFCG5007 cheduler Se 2 Address Server 000000000 p r D OY eae EJ lt lt o 2 a Y lt c O A 5 2 St EE ETE E o gt o m o eo 2000000 2 4 On 6 8 KFCG5008 O Co EJS E Co Co L3 5 TE 11 08000000 250
339. 20000000 1000000000000 20000 Scheduler Facilities Manager 0 000000000000000000000000 0000 100000000000000000 aropt ki 000000 0 0 0 E 240 4 0 23 E E El YN D 4 L1 5 LE EI IE 391 000 10000 1 Scheduler 4080 0000000000000000000 mkdir gmaxpkgd 2 Schedulr jt D OD 0D 0D 00 0000000000000 vgchange a e dev vg03 000000 emrunclQ BOB 000000 000000000 3 Scheduler 11 11111 0101010000000000000 mount dev vg03 lvoll gmaxpkgd OO mkdir gmaxpkgd iki 5 POB BO DD 000 00000000000 0000000000000 0000 gmaxpkgdikiQ 00000000 cd var opt iki cp pr gmaxpkgd iki 6 O00 5808000000000 0000000000000 00000000 OO00 rm rf var opt iki 7 ln s gmazpkgd iki var opt iki 8 Scheduler Server Facilities Manager cp usr bin AppoMan ini var opt iki log AppoMan ini t L3 LJ rm usr bin
340. 4 00000000 2 FO SIE gy h REESE PE OD IL F ane E 88 dE BIS 7 DL ATA 0 0 9 Version 300000000 0000000000000 53 4 00000000 44 II D D D UI EE C 54 11111 110 11 111 1111 1 111011011 1111110110111 42000 O42000000000000000 IRs IDR TACO NAGU MANGU FAL w set 1 00000 1Pg0000000000000 podBd0 000000000000 00000000000000000 2 00 ET ga o El 5 9 O L3 O El po0d0000000000000 Ysftete O E P TI E L3 L3 L3 Oooo pod0000000000000 Ysftroom 0000 4 00000000 45 51 1 11 00000000000 bNSU UU D D U D Scheduler Server O 000000000 GWOOOOOOOOOOOOOOOOO Scheduler po0000000000 000 Facilities Managers 0000000000 0000 16
341. 482 po0000000000000000 20000000000 83 4 00000000 D 427 0000000 exmqi 00000 8 8 DERE asya Hk 1 E DO DO 1H 2A r3H gt 5 8 8 gt i 5 84 5 1 2 7 D e s 4 do E mw de 3 kh I p cw EE 13 14 15 16 17 18 19 10 11 12 13 14 15 18 10 11 12 13 14 15 16 20 21 22 23 24 25 26 17 18 19 20 21 22 23 17 18 18 20 21 22 23 27 28 29 30 31 24 25 26 27 28 24 25 28 27 28 29 30 81 AH 5H H HAHXXAXZL 8 8 i2834 Laag 1 ze awi j A M 9 g wn saage 14 15 16 17 18 19 20 12 13 14 15 16 17 18 9 10 11 12 13 14 15 21 22 23 24 25 26 27 19 20 21 22 23 24 25 16 17 18 19 20 21 22 28 29 30 26 27 28 29 30 31 23 24 25 26 27 28 29 3 ES FAL GO e 00000000 428000000000000 00000x0p000000000000000000000000 D D D DO D D
342. 52 agtcout LL LL 310 Assist 24 144 145 147 148 153 263 308 Assist 00000000000000 263 Assit JO 0 000000 308 Assist 0000000000 56 B BITECHG 192 C checkid 198 chkorder 195 CODECHG 193 D 0080 11 55 DNSOOOOOOO 55 F Facilities Manager 1 174 Facilities Manager 0000 28 Facilities Manager 38 G W 65 171 171 69 4 65 O 315 GetAdAll 180 244 328 Groupmax Address Assist 70 O00 143 Groupmax Address Assist Groupmax unu 144 grpchg 200 H HOSTCHG 189 hosts 169 3 0 0 48 indxget 184 244 328 22 O ORGGROFF tbl 230 ORGGROUP tbl 228 OrgGroupOmitMark 279 OrgGroupSecurity 279 OutOrgGroupSecurity 279 R RetryInterval 32 roomconsole 345 S Scheduler Facilities Manager 7 00 00 OOO 6 Scheduler Client 116 427 DD Scheduler Server Facilities Manager OOO 387 Scheduler Server Facilities Manager 1 0 0 0 380 Scheduler Server 349 Scheduler Server 8 Scheduler Server 37 SCHogimp 225 services 2 SFagent 153 SFdatacp 156 263 266 308 SFexport 220 SFexport 1 220 00000000 220 00000000 224 SFexport 00 000 220 SFexportO 000 222 SFexportOOOOOO 373 SFexport 0 SFimport
343. 69 4 00000000 6 poxpg0 000000000000 1M00000000000000000000 pobp0000 000000000 00000000000000 I1D00000 000000 0 000008000000008 0 000 0000 000000000 000 po000000000000000000000DNsp0 00000000000 O20 200000000 ID lI L 000000000000000 Scheduler 00000000000000 pep o0000 000000000000 0000 I1D00000000000 pod 000000000000 000000 1000000000000 ooo 0 Mp000000000000000 1 1000000000000 I1D0000000000 godd00 0000000 M0000 00000000000000M000000 pod 00000000000 00000 0000 100000000000 000000 140000GWpog000000000000000000 70 4 00000000 U 414 G ANF 7 p 8 guest guest guest guest DpIggnaugpnuanudupnu rngpapnpnggpupnpnagadgu 200 000 4 0 0 Ey
344. 8 4 00000000 0 44 0000000000000 CAME 0200000000 Dad 0000 100000000000 0000000000000 448000000000000 pod 000000000 000000000000000000000000 0000 2000000 100000000000000000 0 4 48 p00000000000000 OKON 2 00000000000 0xp00000000000000000000000 00000000000 4490000000 00000000000000000 D 109 20000000 4491 1 1 11001000000 ODIETR OT swung RARA BU EE 8 e 00000000 pog000000 0000000000000000 000000000 00000 000000000 poddo0 000000000 000000000000 0000000000 00000000
345. AN podd0000000000000 1 0000000000 ikisaki appoman appoarea roomman DD D DO 00 000000000000 SVO AppoMan RMSV RoomMan 10 00 11 1 Scheduler Server Facilities Manager Version 7 0 00 0 0 Groupmax O O po00000800000000000000000000Groupmaxp 00000 00000000YVersio6gg0 0000000000000 Groupmax 00000000000 Groupmax 0 00000000000000 Scheduler Server Facilities Manager 00 0000000000000000 0000000000 Groupmax System Agent TCPIPO 00000000000 OO 1 Yete 1es OOOOOOOOOOOOOOOO room os 000000000000000 ugaguggaaugagugaggagggagmuugag
346. Assist 0 00000 agtooutQ 000000000000 ES 00000 8888 000000 0000 000000005204 0000000000000 00000000 000000000000000000000000000 00000000 00000000000SFaatap 000000000000 000000005200 00000000000000 10000000000000 0000000000000 00000000000000 10000000000000 00000000000000000000000000 000 0000000 8 888 00000000000 0000000052104 0000000000000 000 00000000000000000000000000 000 00000000000000000000000000 000 0000000000000SFdatap000000000 000000000000000000000000000 00000000520 0000000000000 00000000 000000000000000000000 SFatacp O D 00000000 000000000000000000000000000 0000000052mM0 0000000000000 000000000 100000000000000000000000000 000000000 000000000000 erreasO 000000000 000000000 1 0 00000 80 0 00 0 00 000000000 100000000000000000000000000 000000000 000000000000 seh 000000000 311 DU H Assist D 000 9 I D UD D 12 00000000000000 00000 8 0 DD 0000000 00000000000000 D 13 00000000000000 XXXXO0 0000000 ScheExec log D XXXX 0000000000000000000 XXXX 0000000100 1000000000000000000 Derecho 0000 900000000 14 00000000000000 XXXX00 000 0 0 0 0 ScheExec log D 000000 Xxx 1000000000000000000 XXXX erpchg 0000 000 100 1000000000000000000 Derecho 0000 900000000 1000000000000000000 312
347. AssistO 00000000000000000000000 Assist QO 000000000000 Scheduler Server 0000000000000000 p00000000000000000 4ssisg000000000000000 cheduler Server J0000000000000000000000 600000 00 DO D nooo Exp E 10 1 erver Lr 0 Y O10 1 p0000000000000000 80000DNsp000 00000000 0000000000 H kaihahost T kikakuhost 00000000000 U 430DNSOOOOOOOOOOOOO ONS HAc Eik Terre Assist ERA tn ESPERA 2 0000000000PNs000000000000000000M000000 0000 0000 000000 25500000000 55 4 00000000 00000 3 0000000000000000 00000000000 DNSpo0 000000 DUUDUDDUDDDBDDUDUDUDDDBDBDDUUUDDDBDDDDUDUDUDUDUDUDDBDUDU 000 4 poogo0000moxpo000000000000000000000000000
348. D srdatacp log OO 14 1 00000 0 gg 000000000000 srdatacpOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 00000 QD000000000000000 lo9 agent 0 0 0 ID Mvresult tbl Dx 00 100 140000000000 0000000 00000000000 ugar OO 080000000 000000 00000000 000000 0000 OOO 000000000 USEROO1 HOSTA HOSTB OD 0 USERO02 HOSTB HOSTA OO 000 D D USERO09 HOSTA HOSTC x 210000 20000000000000000000000 2000000000000000000000 220000000000000000000000 0000000000000000000 230000000000 24 00000000000000000000000000000 30000000000000000000 25500000000 0778000000000 pep ogodd0 00000000 000000000000000000000 0000000000000 160 5 Groupmax Address Assist 0 0 Assist 70 0 SFdateaepgd Dai 1 ooo k sapa SE 2 3 000 OO EEE D 3 SFdatacp f logfile name 900000000
349. DDDBDDUDUDUDDDBDBDDDUDUDUDDUDDDDUDUDUDUDuDU 1 1 0 1 1 94 4 00000000 00000000000
350. DDUDDDBDUDUDUDUDDDBDBDIDIDDDDUDDUDDDBDBDDIIIDDUDU 40000 po000 podd0 0000000000000 103 D 4 12 000000 104 Dg 1 Facilities Manager Chent Dg 2 10000000 4420000000000000000000 cog000000000000000000000000000000 0 ORP pod 000000 0000000000 00000000000000000 44200000000000000000 0 VSR 504 FRE OHP EIL C A Fe ELC m ET 16004 BD 2 3000000 150000000000000000 po0000000000000000000000000000000M000 pogo 00000000
351. DDUUDUDUDU 00 DO 1 22000000000 12000000 4 14 5 000000 D100 00000 000000000 200000 000000000000 00000000000000000 000 462000000000000000000000000000000000 D 128 4 00000000 4 000000000000 O20 000000 Dai 0000 1111 11 1 1010010100101010010000 4680000000000000000 000000000000 463 6 a o m oO aaa D ggusengpnaug 2300000000000 3 p0oxpg00000800000000M00000000000000000000 poda 000000000000 000000000000000000000 podd0 000000000000 000000000000000000000 poxp2g0000000000000000000000 40000000000000000000M00000000000000000 Ub 000000 O 129 4 00000000 130 moxp00000000000000 0000000 000000000000 2 Oc 000000 20000000000000000000M00000000000000000 Dnsnuinnuunpnagupnagdnpad DUUDDDDDDDDUDUDDUDDDDBDUDUDDUDDDBDBDUDDUDUDIDDBDUDDUDUDDuNU 4 00000000 415 rd Epp p
352. DUDDDBDBDUDUDBDUDDDBDBDUDUDUDUDUDUDDDDUDUUL podd0000000 0000000000000 1 D 3 Ao O O D 000 000 00000 000 050 00 E 000 ooo EJIIS 05 u EXE Xue 0 letc param ini ES ED ET El LEE Tp p El ET 3 0 O 0 O HDUDDDDDDUD fusr GroupAppo bin param0 ini lusr GroupAppo bin paraml ini usr GroupAppo bin param2 ini 0 B DL D O 000000 O00U0000000000000 0 0 O O O O O DU 00000 O O O podd0000000 000000000000 9 COC 000000 po00000000000000 e 0000000000000 paramin 00000000000 a3 po0000000000000000000000000 gt gt 4 00000000000000000000000000000000000 0 144 0000000000000000000 511011 009000000 gt gt Scheduler Server B H 090 etc param ini
353. DUDUDUDUDDBDUD 00 hostchg 000000000000 OT hestehgr 00000 HOSTCHCO 0000000000000 0000000000 DODO 000 00000000 0000000000000000 Assist Viewer D 70 O Address Server 0 000000000090 Assist Viewer 0 O O O Scheduler Assist 000000000 Scheduler 11 0000000000 Assist Viewer 0000000000 000000 Groupmax Address Assist Version 6 0 00000000000000 O Scheduler 480 000000000000 000000000 7 9 51 6 pgodgo0do 0000000000000 00000000000 00000 E Se Lr oo Lr oo 8 0 L3 L3 L3 L3 L3 Lr Lr 0 0 00 O 060 0000 0 O 1 7 3 0 808 00 00000000000009000000 0 0000 manaa 00 HOSTCHCO 000000000000 0 I BOSTCHGO J 00000 Dean 000000000 Assist 00000000 Assist 000000 Address Assist 7 000000000000 0000000900090000000090
354. F0000000 1 Scheduler Server 00000000 000000000 2 Facilities Manager U D Facilities Manager 0000000 uat tl 372 DU R D SFimport SFexportt 000000000000 UU 88 112 W O HO L3 O CI LIA IDINDX idx 000000 2 a ES oo oo On aaa aa tr 1010101 o 3 oooO malun rn a SA TCT LL LT 54 nooo 2 Co oo o olooooooo x a DODOO so 2 2 B ricnrnmguzrmrnrpmrmuuunurnmirriuuuuuumunmsar 113 W 0000 IDINDX rmx 0000000000 EJ E HO HO DOU Un Oo Un D OOO a L3 E3 C3 4 una C3 C3 EJ nas EJ nooo jono m 1 D IDIND 0000 0000000000 0100 0000000000 0000 0000000000 0000 14 W 00000000000 MANNzim 0000000000000000 00000 MAN 0000000 000 000000000000000000 10000000000000000 00000 100000000
355. Fimport QO SFexpor J ODO 00000000 8 3 SFimport 00000 DD 00 0000000 1 I 2 I xxx 00000000000000 3 I 1 0000000000000000 4 I 00000000000000000 0000000000 5 I 1 000000000000000 6 I 1 0000000000000000 7 I 00000000000000000 8 I 1 0000000000000000 9 I 1 0000000000000000 10 I 0 0 0 0 Mo 0000000 1000000000000000 11 E gugpgaugursspougggugg 00 000000000000000 00000000000 10000000000000000 12 E 00000000000000000 0000000000000 00 000000000000000 DDete log 0 room 5 E mnnnnmnonnunnnuunun 14 E 1 0000000000000000 0000000000 O00 SFimportlog Y 000000 000000000 15 E 000000 0000000000000 0000 16 E 000000 0000000000000 0000 0000000000000 o0000000000000000 17 I 000000 wi 0 000 00000 18 E 000000 errno d 366 DD 19 OO 8 D SFimport OOOOOOU00000 00 0000000 000000 0000 20 DODO 0000000000 s to s xo 21 E cmpFileName0 0 0 22 E FindNextFileO lerr
356. I YA ES ma ma I 3 P aS O 6 10 11 7 0000000 0 0000 0000008 200000000000000000 000 0 0 000000 0 en 0 OOOO 0 gt O OO000M 00000000 0 i020 1 000000080 e Tr OOOO 0000 0000 er 0 Scheduler Server Facilities u uuu OOOOO000 5000000000 an e 09 EX EJ Ej EJ 2 2 0 EST ET EE 0 0 2 g D 2000000 M450 8 8100 000000000000000000000 0 00 000 0 DO 0 podo00000000000000000000000 pod 000000000 000000000000 000000
357. KFCG5501 1 Scheduler Server 00000000000 10 Address O 0 0000000000000 2 0000000000000000 90000 32 505 KFCG5505 1000000 6W0000000000 aw 000000 0 00000000000 2 DODOD00000000D ikisaki 0 000 000000000000000 00 10000 00000 000000000 000000003 000000 10000000000000000000 55 5060 507 KFCG5506 1 11 0 0 00 800000000 000000 KFCG5507 000000 00000000000 0462200000000 3900000000 2 0000000000000000000000 00000000 9000000000000 0462200000000 3900000000 34 509 KFCG5509 0000000000000000000000 0000000000000 000000000 000000000000000 0000000 00000000000000000000000 00000000000000000 00000 000000000 255 8 00000000000 oo Scheduler Client www 0200000000 00000 for Scheduler 00000 35 550 KFCG5550 1 Address Server OOOO 0000 0 000000000000000000000 10 0 0 11 Address 0 000 1P000 2 Address Server 0D 0000000000000 0000000000000000000000 0000000120000000000000 3 DOOOOOOO00000 11 Address 0 0 0000000000000000000 1000000000 0000000000 36 551 KFCG5551 1 Address Server 00000000000 2 Address Server 0000000000000 000000000000 Address Server 3 0000000000000 11Address 0 0
358. LE 41111 podo00000000000 280000000000000000000 220 7 0000000 9 SFexport 000000000000 75000000 0 76 SFexportU 0000000000 0000 uu la sf gu sfgu O O O O Isfg 0 O Isfu O O Is 20 sgu O O Iff Agu O sg O su 2 E fg 5 0 ifu 0 OOOO 00000000000000 1 2 8 st OOO Scheduler Server QO Scheduler Server 0 0 0 00000000000 e0200 e 08300 OutputFileName 0000000000000 0000000000 Scheduler Server Facilities Manager 0000000 g 000 00 0000 000000 000000 000000000000 1 schePat O0 0000000000000
359. MP Address Server 0 000000000 00000000 0000000000 29000000000 000000 0000000000000 OHOOO0000 Dodd 0000 00 0000 000000 000000 000000000 000000000 Scheduler Server Facilities Manager 0000000 08000 00 0000 000000 000000 0000000000 HO 2 poada doo 0000000 000000000000000 0 Scheduler Server Facilities Manager OOOO O D DDD Scheduler Server Facilities Manager 000000000090 Oooo Oooo 000000000090 SO Scheduler Server Facilities Manager 0 O ddress Server 1 Address Server 0 0 0 PPO Object Server O 0 0 ma YA ma Sra ce ESTE E O DU 380 va Object Server Object Server Object Server Address Server Address Server Address Server 8735 TB 2 nA Scheduler Server Scheduler Server Facilities Manager Scheduler Server Facilities Manager ZFS LA Facilities Manager 270754 82 70754 Z EF2 OH MN FAA JH AD ADA 4 2 11 us OOOO 01 0000000000 1 00000000000
360. O 2 5 1 DO DO 00 DO 00 00 00 3 Hu 0 0 0 O I 0 2 2 2 2 2 6 4 00000000 indxget 0000000 E E E SJ 5 3 we 2 2 1 4 I ea 1 4 indxgetl pbpo0b00008000000000000000000000U0 mdxget O O OOOO O OOO 10 Imdexgepo000000000000 tre EJ D 4 DE E DB EI p a as F 1 6 4 E El
361. O000000 93 IU D DH BLU D DE UO D DE CEU D UI 9 3 1 9 0 poda 0000000000000 00000000 0000000000000 00000 00000000000000000000 00 0 000000000000 000 000000000000000 0 0000000000000 000 200000000000000000000000000000000000 pes 48822 IL T A SERIES 4860 7 2 B BRR RI Feb RATELY Feld 70 DFID DIL HERAT PMERAOM fp pA DAL Lal 88 Ly lt 0 0 2 jL FITIKBIML CU VU Bis HERA 278 9 000000000 9 3 2 NOOO O 10 AppoSV ini O O 9 000000000000 0 00 0 0 Security 1 000000 usr GroupAppo bin AppoSV ini 2 000000
362. O0000000000000000000000 1 0 SFimport 9 Scheduler Server Facilities Manager 1 1 L LI D 020 200000000000 1000000000 14000000000000000000000 00000 14g0000000000000000000000 205 7 0000000 206 Mpo0000080000000000000000000000000000000 pod 0000000000000 000000000000 00000000 1 0000 00 poo00000000000000000000000000000 0000 000000 00 6 0 00000000000000 DODO 0000 0000000000 G 0000 0 co00000000000 4000000000000000000000000 0000000000000 000000000 000000 pogo 000000000000 00000000000000000000 pogo 000000 0000000000 000000000000 OOOO ID pogo 000000000000 0000000 1P000000000000
363. O00O000000000000000 lu 1 1 TCPAPO0O00000C0000000000 DOY DD DO DO 0000000 GetAdAI indxget 000000000000 000000000000 u Address Server 0000000000 uu Address Server 0000000000 4 1 3 Address Server 00000000 O00 41 4 Address Server JO DO 1 1 DO enu 111 tl indxgetr U D LU U LH U U LU LUI U Address Server O 0 U Scheduler Server O Uu 1 Address Server DO 0000000000000000 oooO 1 00000000 Address Server 000000 1000000000000 Address gg000000000000000 0000000000000 indxget 111 11411411 1111 11 11 1 1111 DO 2 Address Server 0000000000000 Scheduler 000000000000 00002 Address Server 0000000000000 Scheduler 000000000000 000 D u 9 244 0 0 0 D 0 0 0 0 0 0 0 0 0 0 8 00000000000 asr Groupappo tmp 0 O 0000
364. OAXODO N E 4 SIGDANGER 33 1 11 1 0 0 SCHosimp lggOOOOOOOOOOOOOOOOOOOOO 000000000 226 7 0000000 DOBO DO OD Dd 0000 00000 O 0 SCHogimp log 0000000000000000 SCHogimp log 0 O O ORGGROUPtbl ORGGROFFtbl Windows OO0000000000000 0 0000 ORGGROUPtbI ORGGROFE tb1 0 0 Windows 0 000 ftp D 7 11 3 SCHogimp O O 111 0000000 SCHogimp i c filename logfilename 020 D e0100 6 00000 0200000000000000000000 0200 filename 4000 00000000000000000000000000 p00000000000000000000 ORGGROUP bID 0000000 00000000 ORGGROFFtbIgQ 000000 00000000000000 poda 000000000000 00000000000000000 po000000 1280000000000 000000000000 O usr GroupAppolet OO 000000000 000000000000 O 0 0 0 0 0 DO DO DO 00 e080 logflename p D 0000000000 0000000000000000 000 DO logfilenameQ 0000000000 DUUDDDDDDDDUDUDUDUDDDBDBDUDUDUUDUDDDBDBDUDDUDUDUDUDUDUDDBDDUL
365. OFF tbl 7 116 000 01000000 podd0 000000 00000000000000 1 0200000000 Scheduler Server 07 30 0000000 ooooao o7 s00OOOOOOOOOOOOOOOOOOOOOOOOOOOOO Scheduler Server 07 30QOOOOOOOOOO 2 OrgGroupSecurity ON 00000000 3 ORGGROUP tbl ORGGROFF tbl 000000 Windows 1 c1 0 00000000000 ORGGROUP Hl B B U DD unmaumgyoRncGcGRorEtcbrtttudatdatadztatztttitiil Scheduler Server 1 4 SCHogimp 0 0 0 ORGGROUP tbI ORGGROFF thh 7 1 1 D SCHogimp 0000 lt 000000000000000000 5 ORGGROUPtblg ORGGROFF tbI OO D U B SCHogimp D SCHogimp 0000 A000000000000000000 6 DOBO DO DO O OO OOO 0 0000000000000 O Groupmax Scheduler Server Tool Groupmax Facilities Manager Tool 7 1 6 O Groupmax Scheduler Server Groupmax Facilities Manager 0000000 020
366. OO 000000000 00 363 QO R D SFimport O SFexpor J ODO 00000000 UU R O SFimport O SFexpot O D D D U OER ERS aa HU 11101 D p1900000000000000000 pogo 000000 0000000000000000000 21000000 ORIQO0000000000000000000 00 00000 00 1 E01 0000000000000000000000000000000 2 E02 000000000000000000000000000 3 E03 000000000000000000000000000 4 E04 000000000000000000000000000 5 E05 00000000000000000000000000000000 6 E06 0000000000000000000000000000000000 7 E07 000000000000000000000000000 1000000000000000 100000 000000000 0000000000000 O00000 0000000000 0000000000000000000000000 8 E08 0000000080 000000000000000000000000 000000000000000000000000 9 E09 00000000 8 8000000000000000000000000 00000000000000000000 10 E10 0000 000000000000000000000 00000000000000 792 SFimport 00 000000000000 DU 20000000000 020 2000000 364 OO 8 D SFimport SFexportg OOOOOOU00000 OR2Q00000000000000 oo 00000 OOOO 1 E100 DO 4 L3 HO oo ono ono oo ono ono oo oo oo oo ono ono oo EE ono oo
367. OO th r3 5 gt gt E Ll E E E D EJ LE m n SS ODO e 5 H appoarea D D I I U osts 0000000 HOOUdgooO DNS was WA ss E ES ESPE zao c Co g 5 i ooo HI a L3 rcgni OO DD 0000 00 OU 00 e 2 c a c c 0 erver S D 1000000 8 00000000000 Scheduler Server 1000000000000000000000 11000000000000000000000 100000000000000 3 4 000000000 PCO 000000 s 0000000000000000000000 Groupmax 0000000000000000 0 000000000000 00 00000 O O Scheduler Server HH B H e 000000000000000000000 1 0 0 0 NATO 00000000000 1 0 0 0 0 0 GroupmaxO 0 0 D 1000000000000000000000 00000000000 0 00000000 000000 0 0 0 0 Scheduler Server 0 00 00000000000000 1000000000000000000000 0000000000 000000000 0000 00000000000000 200 Group
368. OOO000 ooo 1000 0 000 0000000000 54 00000000 00000000 000000000000000000 4 0000000000 100000 o 54000 55 E 100000000000 0 4400 0 00000000000000000 368 DD 00 OO 8 D SFimport OOOOOOU00000 56 E 0000000000 anon 100000000000000000 0000000000 57 E 1000000000 0 anon 100000000000000000 0000000000 58 E 000000000 00000009 000 0000000000000 6910 00000000 0 44900 00 59 8 000000000 0000000 000 DO0000000000000 610 0000 0 00 0 54000 00 60 00000000 00000009 000000800000000 00 000000000008 0000000000 100000 D 540 6 amp 8 00000000 ann gt 10000000000000000 62 E 1000000000 ann gt 10000000000000000 63 E 00000000000 0 nnn nn gt 0000000000 64 E 00000000000000000 O00000 00000000 00000 lt 590 gt 000000 6 8 0000000000000 0900 00000000 ann gt 0000000000 6 E 000000000 9000000 000000000000000000 lt 40 gt 0000000000 67 8 10000000000000000 00000000000000000 1000000 en 0000000000 68 E 10000000080000000 00000000000000000
369. OOOOOOOOOOO 002000000000 2 19000000000 000000000000000000000000000 D UD Bun Exec OO OOO Assist 00000000000000 D SFagent im 00 D D 00000 Exec 00 po0000000000 000000 20 SFagent ini 0 Exec OOOOOOOOOOOOOOOOOO O Assist 000000 0000000000 0100000 al 0000 000000000000000 6 Assist Assist O00 yyyy mm dd hh mm ss xxxxxxxI 1 0000000000000 000000000 gd00 0000000000000 00000000 000000000000 Oo AssstOOOOOOOOOOOOOOOOO 00 O O O ies E OO a o0 Oo Oo Oo Oo ep OD ES 1 xe EE Ez E DE E ESE E EsI E Oooo Oooo L3 r3 Oooo Oooo L3 r3 117 1 Et Oooo 154 5 Groupmax Address Assist 0 0 AgentExclusive RetryCount 30 0000000000300
370. OOOOOOOOOOOO 14 ct C 5 00 DO DO 00 DO OO HH E Oooo Oo Oo 176 6 00000000 15 Groupmax Scheduler Client PDA Option Version 60 0000000000000 OOOO Scheduler Server 000080000 1000000 1000 300000 1600000000000 0 0 O 0011 11 11 1119 17 GroupAppomouse Client OO 01200 O O o O Oooo oO O O Groupmax Scheduler Client Version2 0 0 HH B 02 3100000 OHOOO000000 18 11110101 00000 10000000 00010000000000000 30 000 0000000000000 Groupmax Facilities Manager U t uginpnguggapnagagugagadguduuad 800001000 0 00000 0 1900000000000000
371. P 4xp0 0000000000 0000 PPOOOO PP NO PP NAME 001 GMX7 FMGH Groupmax Facilities Manager 002 GMX7 SSVH Groupmax Scheduler Server F Forward B Back J Down K Up Space select unselect D Delete Q Quit 2 Ppo000000000 Pgo00000000000000000000000 0000 PPp00000 lt gt pp00000000000000 PP00000 3 0D0 0000000 g000000000000000000 Delete PP y delete n cancel gt PPOOOOOOOOOO 0 UD 00000000000 400000000000 USU PPO0000 Ppo0000000000000000 1 p00000000L 00000000 Ppo00000000000000000000000000000 PP0000 17 3 000000 PPp00000 PP No Install date PP Name 001 GMX7 SSVH 2004 06 01 21 42 Groupmax Scheduler Server 002 GMX7 FMGH 2004 06 01 21 44 Groupmax Facilities Manager F Forward B Back Q Quit P Print to tmp PPLIST gt PPO 00 D tmp hitachi PPLISTO OOOO 0000 20000000000 3 1 2 Scheduler Server 000000000000
372. SFg02002 1 KSFg02003 1 KSFg02005 W 2 3 4 KSFg02006 W 5 336 DON DON 11111 11 1 1 1 Scheduler Facilities Manager 0ODOD000000000000000000000 DUUDDDDDDDBDUDUDDUDDDDBDDUDBDUDDDBDBDUDUDUDUDUDUDDDUDUUL u uu 000000000000 EDI D UO U CEI TU CU U 7 U 7 U CU U CU U U U U U U U Scheduler Server Facilities Manager Y 0 0 Server HH D DDD 0000000000000 N1 OOOO SVIRMSV J 00000 ID uu po 31006 E Possibility of discordance 1 0 000000000000000000 18 the user data ooog Oo8s190000000000000000 45001 I The trace function is 10000000000000000000 suppressed Hu 45002 E An attempt to open a trace file has failed nnnnnnnnnnnnnnnnnnnn XXXX YYYY 00000000000000000000 45003 W An invalid value was AppoSVini TraeeQ 0000000000 specified in a trace 000000000000000000 set
373. SFimport DOO0000000000000000 Scheduler Server Facilities Manager 1111111101 111011 u O20 00000000000000 UUDDDDDDDDUDUDDDDDDDUDUDUDUDDDDBDUDDUUDUDUDU 111 0 D D UD D D U 1 aconsolef DO DODOSVODO D00000000 AppoMang OO 2 1 1 00000000 roomconsole OO 00 e 11 1 1 RomManl OO O30 200000000 UUUDDDBDDDDUDUDDDDD etc po000000000000000 room D 40 SFimport O O 00000 SFimprt 0O00 0000000000000000 0000000000 0000000000000 Scheduler Server Facilities Manager OOOO OO 0 1 7 9 5 SFimportOOOOOOOOOOOOOOOO 213 7 0000000 1000000000000UD aconsolel D D 000000000 AppoMan OO 2000000000000 roomconsolel OO e 10080000000 RoomManl 0 060 20000000 podd0 000000000000 00000000000 100000000000 00000 07000000 1000000000000UD aconsolel D D HUDDSVJDD 2000000000000 roomconsolel OO OOOORMSVOOO 7 94 SFimpotQ 1 1 0000000 SFimport 00000000000 e SFimport SFexport 0 SFimport SFimport 0000 SFexport U SFexport OOOO
374. SFimport 00000000000000 OOO0000000000000 SFimportOOOOOOOOOOOO 0000 00000 SFimport D 10 0 0 0 0 0 0 SFimport D 00000000000 un 7 9 5 SFimport 0 O Uu 1 0000000 usr GroupAppo bin SFimport i c InputFileName SchePath 1ogname 020 D 5 11 4111 M000000000000000000000000000000 214 7 0000000 e0200 InputFileName 1 11 101111 1 0 0000000000000 000000000000 0000000000000 0 300 SchePath 0O 0000000000000 0 usr iki 118114 logname 000000000000 0400000000000 000000000000 0000000000000 g0d00 0000000000000 00000000 0000000000000 0000000000 0000000000 28000000000000000 SFimport log 0 OOOOOOO000000000000000000000000 000000 O30 0000000 000000 110000 O40 0000 0000 SFimport 0 D 00 DD 00 D SFimport log 0 00000000000 0000000000 SFimport log 0 00 0000000000000 SFimport 0 0000000000000 82 SFimpo
375. T 0 and increment the list in sequence For example SERVICE NAME 0 pkgla SERVICE CMD 0 usr bin X11 xclock display 192 10 25 54 0 SERVICE RESTART 0 Will not restart the service SERVICE NAME 1 pkglb SERVICE CMD 1 2 usr bin X11 xload display 192 10 25 54 0 SERVICE RESTART 1 r 2 Will restart the service twice SERVICE NAME 2 pkglc SERVICE CMD 2 usr sbin ping SERVICE RESTART 2 R Will restart the service an infinite number of times Note No environmental variables will be passed to the command this includes the PATH variable Absolute path names are required for the service command definition Default shell is usr bin sh SERVICE NAME 0 Schedulersv SERVICE CMD 0 usr GroupAppo bin SFpakage r SV SERVICE RESTART 0 SERVICE _NAME 1 SchedulerToolSV SERVICE CMD 1 usr GroupAppo bin SFpakage r AppoMan SERVICE RESTART 1 z 000600 Facilities Manager 000000000 SERVICE NAME 2 FacilitiesSV SERVICE CMD 2 usr GroupAppo bin SFpakage r RMSV SERVICE RESTART 2 z SERVICE NAME 3 FacilitiesToolSV SERVICE CMD 3 usr GroupAppo bin SFpakage r RoomMan SERVICE RESTART 3 DTC manager information for each DTC Example DTC O dtc 20 DTC_NAME 0 START OF CUSTOMER DEFINED FUNCTIONS This function is a place holder for
376. TH log if test x usr bin RMSV then if test d LOGPATH then cd LOGPATH f usr bin RMSV usr bin RoomMan cd PWDPATH fi 39 L 4 1 Address Server 1 DD D 4 2 4 3 UUUUUDuD 4 4 UUUUUDD 4 5 0000 1 1 4 6 4 7 4 8 4 9 4 10 000000 4 11 D000 4 12 4 13 4 14 000 4 15 4 16 0 4 17 0 4 18 O 0 O 0 6 0 E ser ES EE UE ES 0 0 O 0 ELE EL EP o rrr O D D D D D 0000000 41 4 00000000 4 1 Address Server 0000000 411 OOOO Address Server 700000 O D 0 Address Server OOOUOO000000000000 Address Server Address Server 00000000000 co000000000000000000 10 Address 00000000000 412 OOOO 20000000000 1 Scheduler Server LJ 0000 Address Server UID D 1 D 00000000 Scheduler Server 00000000000 Address Server J 0000000000000000 2
377. UDDDDBDUDUUDUDUDU 1 PPpo000000000000000 000 OOO PPO0O000000000000000000 00 00 HP UX DU 000000000 Oo oOo oOo Hitachi PP Installer 04 06 L List Installed Software I Install Software D Delete Software Q Quit Select Procedure CAUTION YOU SHALL INSTALL AND USE THE SOFTWARE PRODUCT LISTED IN THE List Installed Software UNDER THE TERMS AND CONDITION OF THE SOFTWARE LICENSE AGREEMENT ATTACHED TO SUCH SOFTWARE PRODUCT All Rights Reserved Copyright C 1994 2006 Hitachi PPOOOOOOOO PP NO PP NAME 001 GMX7 SSVH Groupmax Scheduler Server F Forward B Back J Down K Up Space select unselect I Install Q Quit 2 PP000000000000000000 0000 PPp00000 lt gt p0000000 30100000000 g000000000000000000 Install PP y install n cancel gt Y po 00000000 0000000000 000000 000000000000 PPPO0D0 00000000 000000 y0000 y0 00000000 000000000000 000000 3 0000000000 400010000000 O40 PPI II D RMSVJII AppoManl l RoomMan 000000 1 0O0000000000000000 PPpo00000000000 Ppo00000000000000000000 H
378. UDUDDDDBDDUDDDUDDDBDBDUDDUUDUDUDUDDDIDDUD J 1 p0000000000 2 000000000000 ID000 a3 D0000 000 00000400 B0000000 8 00 4000000 D 410 D D D OOOO 411 DD D 1 BDO DU Scheduler 00 4 00000000 411 ADO Bp00000000000000 Ft 3 38 1 738 6 GAN Hn eigyouhost 552472 5 5547 93172 1 Gwpgg TCPrAPpo 0000000 0000000 D 2 uuuuuupuunupuuupuuupuuupuuupnuuupuuuupuu PB000 0000000 00000000 00000000000 11 1111 9
379. _NONAM OOO D OD D E NAME 3 g x1 Integrated Desktop O0 000000000000000 x 2 sii 00000 GetAdANQOOO00 DO Dx 3 Scheduler 000000000000000 15 Address O0 0000000000000C0000000000000 48 4 00000000 uu e Integrated Desktop 000000 pod0d08 00 0 0 0000 000000000 000000 000000000 OHOOOO0000000D e Groupmax WWW OP 00000000000 groupmax gmaxwww schema gmax etc config Windows 1 0 U Groupmax WWW 000000000000 YschemaYgmaxYetcYconfigl gml_userlist_sort 0 0 0 NAME POSITION POSITION_NONAME NICKNAME NOSORTITI 000000 NOSORTO D 0000 Groupmax WWW 00000000000000 O0 gmluserlstsort0 00000000000000 00000000000 Groupmax World Wide Web Desktop Version 00 000 opa 00000000000 OHOU000000000000000000000000000000000000 Dodd 0000 00 0000 0000000000000 416 Address Server ODO0000000000000000000000000000 OOOO Address Server DODg800000000000000000000000
380. a 000000000000 00000000000000 00002 20000000000000000000g ReplicationQ 200000000000000000000000000d0 0 15 Scheduler Client Facilities Manager Client 1 D 1 1 1 Client O O O OU 00000000 0 H XXXXXIJ J 1 1 11 U DU D DU 0000 8 000090080000000000000 01600 0000000000000 0000000000 D ORGGROUP 00000000 00000000000000000000000 00000 IDO s108p000000000000000000000 IDO 451050 0 208 8 00000000000 0000 DO00 0000 0 0000000000 DDDUSVRMSVII OOOO 00000000 IDO 451080000 000000000000 0170000 00000000000 0000 000000000000 1010 kGakoFFitblQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOGO 00 451080 0 00000000000000000000 190 451050 D 00 000 00000000000000 0000 Ni OOOO SVRMSVIT OOOO 0000000 IDO 4510800000 000000000000 1800000000000 00000 UI L 0000 0000000 000000
381. ailed M GetAdAII T O indxgetd O 000000000000 14 FindClose failed 10000000000000 0 15 GetRegValue xxxxx xxxxx 000000000 AppoManini 200000000000 failed 10 00000000000000000000000000 16 RegOpenKeyExO 100000000000000000000000000 failed RC xxx xxx xxx 000000000000000000 Windows NTO 17 RegQueryValueEx 100000000000000000000000000 failed RC xxx xxx 000000000000000000 Windows NTO 18 putenv UXPLDIR 1000000000000000 8000000000 0000000000000000000000 19 GASInit xxx xxx Address Server 0000000000000000 Address Server 1 000000 Scheduler Server Facilities Manager 20 21 000000 Groupmax Address Server 0 0 Address Server 22 00000000000 1 gt ddress Server D var opt roupApp 00000000
382. ange a n dev vg03 Aaxpobg0 00000000 0000000000000000000 root OO 010000 OOO 3 L3 3 L3 20000000000000 oO oO ES oO oO oO oO Oo oO oO oO oO oO Oo oO oO oO Oo oO oO 5 Q lt J Q OO g lt 3 Lu 3 Ea l K lt B 4 Q gt Q lt gt Q D 0 d Q FU o O EJ O O E O O 5 389 Data mkdir HACMPdata iki ln s HACMPdata iki usr iki Scheduler Server 00000000 mount r v cdrfs dev cd0 cdrom cdrom aix setup cdrom 1 0 0 0000 0 0 0 0
383. ata csv usr iki 020 8000 0000000000000 po00000000000000000datacvpp000000000000000 00000000000 usr GroupAppo bin SFexport u tmp data csv usr iki 200000000000 000 po00000000000000000datacvpo000000000000000 usr GroupAppo bin SFexport su tmp data csv usr iki 223 7 0000000 7 10 5 SFexport 00000000 e SFeport i p000 0000000000000 00000000000000 O SFimpet JO 000000000000000000000000000000 po0000000000 0000000000000000 SFimport D DU 7 10 6 SFexport 000 SFimport 1 0000000000 p0000000000008000000000000000000000 9 9 e 00 10000000000000000000000000 OOO 0000000000 tmp datacesvd 000000000000 UUDUDDDUDDDBDDUDUDUDDDDBDDUDUDUDDDBDDDDUDUDUDUDUDDDBDUD 018200000000 usr GroupAppo bin SFexport su tmp data csv usr iki Itmp data csv QO 0000 0000 OOOO ID S U kaihtl uid O20 000000000000000 tmp data csv 0 00000 C L 0000 18000000
384. auuugadudgetttlul 1 1es 1 0 0 0 los tmp 11110100 0 1 0 1es asent 1 uu OO Du 2 OO 1000000000000000000000000000000000 po000000000 200000000000 0007 usr croupappo bin Apposv ini DO 000000000000000000000000 175 6 00000000 00000 Scheduler Server Facilities Manager 00000000000 001000 Rename List 0N OO 2000 Rename List OFF 0000 2000000000000000000000000000000g 0 1esa D 0000000000000 eduler Server Facilities Manager O0 000000000000000 10 Scheduler Server Facilities Manager 0 1
385. ax 0 0000000 2 0000000000000 3 po0g00000000000000000000 oo000 O O UU Groupmax Scheduler Facilities O ooo 4 Oooo L3 L3 L3 E EI L3 EL L3 L3 L3 Ooo oOo o LEE EF ESI LETT L3 L3 L3 L3 L3 0 0 0 0 0 000 DU 020 20000000000 podd0 000000 00000000000000 0000000000000000000 Q Scheduler_Facilities 51 4 00000000 4 3 IBID D ILU EE E 52 CE Greupmax 00000000 D D D Scheduler Facilities Scheduler Facilites DHOOOOOO0000000000000000000 uU 41000000000 00000 0 000000 000000000000 0000 odo 000 000000000000 000000000000 000000 041 000000000000 IIKO EGO 32773700 MIT FEF ONE for Facilities Manager E ED BH
386. ax Address Assist 0 0000000000 Scheduler Client 940000000000 00000 Scheduler Chent 000000000000000 2 0000000 000000000000000000 000 000000000000000000 000 000000000000000008 0 000 Scheduler 0 Oa 1 2 6 4 5 Assist 000 0 0000 9 000080000080000000 Assist Viewer 0 0 O Address Server HH B HH DB H Assist Viewer 0 O O O Scheduler Assist 000000000 Scheduler 4 11111 10 0 0 0 0 Assist Viewer 008000000000 000000 Groupmax Address Assist Version 6 00000000000000 O Scheduler POD 0 00000000 000000000000 pep 0000000000 0000000000 Assist 000 O 0 5 1 6 8 OOO 000000 oO EE DU DU DU DU 0 0 0 0 0 6 0 0 Ooo oO Q cO Scheduler OO 1 0000000 260080000 Assist Viewer 00 0 O Address Server 0 000000000090 Assist Viewer 0 O O O Scheduler Assist 000000000 Scheduler 11 111 10 0 0 0 0
387. cpp 0000000000 O OOOO 0000000 0000000000000 D SFdatacp 0000000000000000 0000 2 OO00M51e00000000000000000000000 a3 pop000000800000000000000000000 4 SFdatacp 0000000000 268 11111 1 1 1 1 OD 0000000 0000000000000 00000000000 91 92 93 269 9 Dn UOTE B 9 9 po0000000000 200000000 9 1 9 9
388. d is required between the lower limit and upper limit when specifying a range The upper limit must Dbe greater than the lower limit If RESOURCE UP VALUE is repeated within a RESOURCE NAME block then they are inclusively OR d together Package Resource Dependencies may be defined by repeating the entire RESOURCE NAME block Example RESOURCE NAME net lan lan0 res1 RESOURCE POLLING INTERVAL 120 RESOURCE UP VALUE RUNNING RESOURCE UP VALUE ONLINE Means that the value of resource net lan lan0 resl ill be checked every 120 seconds and is considered to be up when its value is RUNNING or ONLINE dt 5 5 db m db k db db Uncomment the following lines to specify Package Resource Dependencies RESOURCE NAME Full path name gt RESOURCE POLLING INTERVAL numeric seconds RESOURCE UP VALUE op string or numeric and op lt numeric gt The default for PKG SWITCHING ENABLED is YES In the event of a failure this permits the cluster software to transfer the package to an adoptive node Adjust as necessary PKG SWITCHING ENABLED YES The default for NET SWITCHING ENABLED is YES In the event of a failure this permits the cluster software to switch LANs locally transfer to a standby LAN card Adjust as necessary NET SWITCHING ENABLED YES The default for NODE FAIL FAST ENABLED is NO If set to YES in the event of a failure the cluster software will halt t
389. dat DODO 000000000000 grpname dat ikifile dat youfile dat annilist dat appouenv ini appomngr ini param ini gamuenv ini 0200000000 WWW for Scheduler 0 ORGGROUP tbl ORGGROFF tbl A 5 p0000000U0 Facilities Manager 0 O O un MAIN rmx IDINDX rmx rid RMSEC tbl FScheDel tbl EQP tbl MANAGERSrmx atb
390. e 3 vGl0 Scheduler 000000000 dev vg03 4 Lvlol Scheduler 000000000 dev vg03 1vol1 5 FS 0 Scheduler 400000000 gmaxpkgd 398 0000 FS MOUNT OPTI0 Un o rw IPlol 172 1 1 3 SUBNETIO 172 1 1 0 SERVICE NAMEIO SchedulerSV 10 SERVICE CMDIO usr GroupAppo bin SFpakage r SV 11 SERVICE RESTARTIO 12 SERVICE NAME SchedulerToolSV 13 SERVICE CMDI1 usr GroupAppo bin SFpakage r AppoMan 14 SERVICE RESTARTI I1 wu 15 SERVICE _NAMEI2 500505 pon joa fo jae nooo Doa oo oo FacilitiesSV 16 SERVICE CMDI2 usr GroupAppo bin SFpakage r RMSV 17 SERVICE RESTARTI wu 18 SERVICE_NAME 3 nooo nooo 60500 nooo 300 oo oo FacilitiesToolSV 19 SERVICE CMDI3 usr GroupAppo bin SFpakage r RoomMan 20 SERVICE RESTARTIS3 399 lun function OOOOOOOO usr GroupAppo bin 21 customer defined run c 00 00 0000 0 0 SFpakage mds O D O Object Server Address sv usr GroupAppo Server Scheduler Server bin SFpakage s D Facilities Manager 0 0 0 0 AppoMan 0000 O O Facilities Mana
391. eExec 10og LI 1 LI O 0000000000 O O Address Server NL 0000000000000 0000000000000 Scheduler Assisti DOOOOOOUOQ0O00000000000000000000 OOOO log agent ScheExec loglOOOOOOOOOOOOOOOOOOO O00 Groupmax Address Mail Version7 0000000000 00000000 0000000 pea 000000000000 00000 00090900000 0000 Address Server 000000000000000 gmaxset 0000000000000 Seheduler Assist 00000000 10110 0 0 0 1es agent ScheExec 1os OSO Assist 000000000000000000000000000000 Address Assist 0000000000000 Scheduler Client 0000000000 Dodd 0000 00 0000 0000000000000 1 Scheduler Client 000000 2 ppo0o00 4000000000000 s 000000000000000000000000 1 00000000 2 00 3 00000 4 10 00 9490000 1000000000000000000000 po000000 1 Scheduler Client Y 0000080000080 0000000000000000 podd0 000000000000 00000000000000000000 00000 Scheduler Chest 00000 0000000 0000000000 148 5 Groupm
392. el D 0000008000000 000000 0000050000 00000 oo oo 0 0 0 UUUDUDUuD 100000000 10000000 120000000000000 1880000000000 0 0 0 OOOO oo oo EH FT LE 4 Aa a 4 OOO oo oo LL 1 amp b 424 OO x DDUDDUDD 14000000000 1588 0000000000 1 1680 0000000000 2 e DliLogFileSize opod0000000000 10485760 1073741824 00 D 0 U DliLogFileSize Y PO BO 000000000 00000000000 10485760 00000000000000 DilLogFileNum O opo00g000000010 990000007 00000 0 O30 0000 podd0 000000 000000000000 1 0000000000000 00000 1 00000000000 2 8 828 8 91 00000 3 00000000000 O40 0000 po000000000000000000000000000 SFTLog_001 log l 425 UU UD G Q O0 0000000 310 O SFimport SFexport 0000000 364 UU SOOU00000000000000000 000 378 A aconsole 345 Address Server 11 42 agtcout 1
393. er Server Facilities Manager 1 120000000000 hests D d D Ud D po00000000000000 0 Scheduler Server Facilities Manager Y D Hc B B B B B B B B B B B D 0 U Address Server 00000000 Address Server Y IP HO D 1 U LH 0000000000000 Address Server 0 IP00000000000 0000000000000 9 Address Server 0 IPO0 0000000000000000 0 00 Groupmax Address Mail Version 70 000000000 000000000000000 0000000000000000 4 1 3 Address Server 00000000 000000000000 cetAaAum 0 000000000 7 1 O GetAdA1I J go000000000000000000 379 Do VU Scheduler Server Facilities Manager y 0000000 HACMP 0 0 HP UX O MC ServiceGuard AIX 1 1 1 High Availability Cluster Multi Processing for AX D O O U 1 Scheduler Server Facilities Manager O 0 0 oO Scheduler Server Facilities Manage Y e Address Server 000000000000 MC ServiceGuard HAC
394. erviceGuard Scheduler Server Facilities Manager D U 000000000000 U uuuuuuuuunununuunuunuuuuunuun ln s usr iki log AppoSV ini usr GroupAppo bin AppoSV ini uua cd umount HACMPdata Oooo Oooo L3 varyoffvg HACMPvg 00020000 1 0000 HACMPdat m m poddg0 000000 00000000000000 E oO gt oO O aryonvg HACMPv O 5 O Q 0000 ount HACMPdat ln s HACMPdata iki usr iki E 0000000000000 LI D LJ Scheduler Server 0 0000000090 mount r v cdrfs dev cdo cdrom H cdrom aix setup cdrom 1 Facilities Manager 0000000000 Facilities Manager 1 L1 0 0 B0 D D 0 0000000 H mount r v cdrfs dev cd0 cdrom H cdrom aix setup cdrom 1 1 1 101
395. f SBINPATH AppoMan ini then bin chgrp GRPNAME BINPATH AppoMan ini bin chown SUSERNAME BINPATH AppoMan ini OOL DDBUDDUDD 325 Dot 00 000000 if test f SBINPATH SFstart then bin chgrp GRPNAME SBINPATH SFstart bin chown SUSERNAME BINPATH SFstart if test f SGMAXPATH SCHpreBK then bin chgrp GRPNAME GMAXPATH SCHpreBK bin chown SUSERNAME GMAXPATH SCHpreBK if test f SGMAXPATH SCHstpBK then bin chgrp GRPNAME GMAXPATH SCHstpBK bin chown SUSERNAME GMAXPATH SCHstpBK if test f SGMAXPATH SCHstrBK then bin chgrp GRPNAME GMAXPATH SCHstrBK bin chown SUSERNAME GMAXPATH SCHstrBK if test d SAPPOPATH then bin find SAPPOPATH print usr bin xargs bin chgrp GRPNAME bin find SAPPOPATH print usr bin xargs bin chown SUSERNAME if test d SCHEPATH then bin find SCHEPATH print usr bin xargs bin chgrp GRPNAME bin find SCHEPATH print usr bin xargs bin chown USERNAME 326 OOL 00 00000 0 327 M 0 GetAdAIll O indxget OOOOOOOOOOOOO UU M J GetAdAlll indxget 100000000 00000 Groupmax Scheduler Server 00000000000 00 Scheduler Server DO OO 000000000000000 00000 0000000000000 00 0000000000 log
396. ger pao 0000000 UU usr 1 1 GroupAppo bin SFpakage s RMSV usr GroupAppo bin SFpakage s RoomMan usr GroupAppo bin function 22 customer_defined_halt_c 000000 Scheduler Server SFpakage e mds Facilities Manager T Address SV usr GroupAppo Server Object Server DO OD bin SFpakage e AppoMan Facilities Manager usr 0000 GroupAppo bin SFpakage e RMSV usr GroupAppo bin SFpakage e RoomMan O40 podd0 000000 000000000000 000000000 1 cd etc cmcluster cmcheckconf v c 000000000090 gmaxpkgconf ascii NO ERROR FOUND 2 0000000000000000000 cd etc cmcluster gmaxpkg chmod x control sh rcp control sh node2 etc cmcluster gmaxpkg 3 D00000000000000000000000000000000 cd etc cmcluster cmapplyconf v c gmaxpkgconf ascii 4 00000000000000 emrunpkg 00000000000000 0 Seheduler 00000000000 00000000 P gmaxpkg P gmaxpkg 400 ps 61 grep usr bin SV ps 65 grep usr bin AppoMan 48 ps ef grep usr bin RMSV 4 ps ef grep usr bin RoomMan 1 2
397. gt lt 0x0A gt exoD oxoA rj d 0000000000000 1 U 30 00 ORGGROUP tb1 ORGGROUPth1G 0 7 5 00000 ORGGROUP bI 00000 0x0D 0x0A e viC 0000000 866 800 5810 0000000000000 lt 0x0D gt lt 0x0A gt 0000000 ORGGROUPtbIQ Windows 00 000000 fee d d d d d 7 11 5 ORGGROFF tbli OOO poda 00000 000000000000 000000000 000000 000000 ORGGROFE pg 0000080000000 000000000000 00000000 230 7 0000000 076 00000000000000 4882 A 8 8 2 B S88 RID Ht RATELY 886 La 885 gt 0 lt 2 2 7 7 UD lt 0x0D gt lt 0x04 gt 0000000000000 0 lt 0x0D gt lt 0x0A gt 00000 lt 0x0D gt lt 0x0A gt Q 0 0000000000000000 01000 OC OO 0000000000 00000000000 00000 ORGGROFF tbl c0000000000000000000 ORGGROFF 210 000000000 podd000000000000000000 7 8 00000 ORGGROFF bI 00000 231 7 0000000 0x0D 0x0A 1 11 1 1 1 1 ORGGROFE 19 0000000000000 lt 0x0D gt lt 0x0A gt 0000000 ORGGR
398. he node on which the package is running Adjust as necessary NODE FAIL FAST ENABLED NO 000000000000 A 10 10 SRevision 80 8 Date 97 07 17 08 45 04 k k k k k k k k k k k k k k k k k k k k k k k k k k k k k K k k k k k k k k k k k k k k k k k k k k K k k K k k k k k k AR KKKK HIGH AVAILABILITY PACKAGE CONTROL SCRIPT template Note This file MUST be edited before it can be used k k k k k k k k k k k k k k k k k k k k ck k k k k k k k k k k k k k k KKK k k k k ce k k k k k k k KKKK UNCOMMENT the variables as you set them Set PATH to reference the appropriate directories TERM dtterm export TERM PATH sbin usr bin usr sbin etc bin VOLUME GROUP ACTIVATION Specify the method of activation for volume groups Leave the default VGCHANGE vgchange a e if you want volume groups activated in exclusive mode This assumes the volume groups have been initialized with vgchange c y at the time of creation Uncomment the first line VGCHANGE vgchange a e q n and comment out the default if your disks are mirrored on separate physical paths Uncomment the second line VGCHANGE vgchange a y if you wish to use non exclusive activation mode Single node cluster configurations must use non exclusive activation
399. heduler Server Facilities Manager 1 H1 D LH services 0000000000000 podd000000000000000000 o 3 0 D 000 0 1 1 0000000900 Scheduler Server 1110 00000 Dun 2000000000 000800 000 ikisaki 20013 tcp 0000 000000 UUUDUUDUUDUUUUDUU appoman 20014 tcp Dunn 1 0 0000800000000 0 12 0000000900 Facilities Manager OOO 00000000 00000 UUUu uuu appoarea 20102 tcp 00090 00 00000 000000000 POT aa 20103 tep OOOO Dopg 0 0000000000000 00000000000 0000 8 soo QOOO0O000000000000 1 0 50000H00000000000000000 1 DO0000000000
400. i 1 El 1 iL All Rights Reserved Copyright C 2004 2007 Hitachi Ltd 000 00000 Microsoft Corp 000000 111 111 O D 3000 3 A83 21 Groupmax Scheduler Facilities Manager 07 32 0000 3 1 5 000000000 00000000000 200000000000 indx 0 0080 000 0800 72 O 23 e 1 L3 L3 1 0000000000000 00 U qn 00000000000 00000000000 L3 a O O O 3000 3 A83 10 Groupmax Scheduler Facilities Manager 07 30 000000 0000000000000 00000 SCHoginp 00000000000 D 1 000000000 Groupmax Version 70 0 0 0 GroupmaxOOOOOOOOOOOOOOO O O Groupmax Scheduler Server Version 7 Groupmax Facilities Manager Version 7 mulli 0 Scheduler Server Facilities Manager J 000000000000 0 9 TCPAP O D 1111 1 1 1 uui 010 DUDUDUDUDUDUDUDUDUDUDD
401. ikisakifl appoarea 0000000000000000 0 O30 0000000000000000 Address Server OOO DO Address Server U Scheduler Server 020000000090 242 8 00000000000 0000 UUDDDDDDDDDUDUDUDDDBDUDDDUDUDDDDDDBDDUDUDUDDDDUDHI44 co000000000000000000000000000 4 1 3 Address Server Address Server 0000000000000000 414 000000000000 po000 0000000000000 Du 1 services i 00000000000000000000 0000 1 po00000000000000000000 services 00 D U 0 appomanll 0 roomman 00000000000002 DH ri po000000 DO 2 00002 c0000000000000000000000 321 Scheduler Server 0 OOO 8 2 2 Facilities Manager 000000000000 0OS5S8 OD o 00000000000 0000000000000 D 0000 0000000000000000 000 3 21 Scheduler Server D 0000 3 2 2 Facilities Manager O0 00000000000 10110 1010 10000009 O01 0000 1 0 1 3 2 1 Scheduler Server DO L1 9 2 2 Facilities Manager 0000000000 DO 243 8 00000000000 DO 2 00000000000 TCPr1P 000000000 00002 00000000000000 TCPAP
402. k Windows NT Operating System Version 4 0 Microsoft R Windows R 2000 Server Operating System Microsoft R Windows R XP Professional Windows XP Operating System Groupmax World Wide Web Desktop for WWW for Scheduler Scheduler Version 6 Groupmax Scheduler Facilities 0 O 00000 Version 7 000000000 0 Windows GUI Graphical User Interface O0 0000000000 111 1111 11 11111 1 11 1 n nununmananmungungna mnunnnun 1MB0 00000m 108000000 m0 18000000000000 000000 000 1 024 O 1 024 0 0 0 0 10244000000 1 024 VI 00000000000 1 1 1 TCPAP 2 1 2 4 1 3 6 131 6 1 3 2 Scheduler Facilities Manager 0900000090 6 UL U OO UO 9 2 1 1 1 10 2 2 1 000000000 13 3 1 14 3
403. low all cleanup processes associated with the service to complete If the SERVICE HALT TIMEOUT is not specified a zero timeout will be assumed meaning the cluster software will not wait at all before sending the SIGKILL signal to halt the service Example SERVICE NAME DB SERVICE SERVICE FAIL FAST ENABLED NO SERVICE HALT TIMEOUT 300 To configure a service uncomment the following lines and fill in the values for all of the keywords HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HH SERVICE NAME SchedulerSV SERVICE FAIL FAST ENABLED YES SERVICE HALT TIMEOUT 300 SERVICE NAME SchedulerToolSV SERVICE FAIL FAST ENABLED YES SERVICE HALT TIMEOUT 300 SERVICE NAME FacilitiesSV SERVICE FAIL FAST ENABLED YES SERVICE HALT TIMEOUT 300 SERVICE NAME FacilitiesToolSV SERVICE FAIL FAST ENABLED YES SERVICE HALT TIMEOUT 300 Enter the network subnet name that is to be monitored for this package Repeat this line as necessary for additional subnet names If any of the subnets defined goes down the package will be switched to another node that is configured for this package and has all the defined subnets available SUBNET 172 1 1 0 The following keywords RESOURCE NAME RESOURCE POLLING INTERVAL and RESOURCE UP VALUE are used to specify Package Resource Dependencies To define a Package Resource Dependency a RESOURCE NAME line with
404. max Scheduler Client 00000000000000 DOBO 0000000 000000000 00000000000 0000 Groupmax Scheduler Client DODO00DO0 00000000 0000000000 9 209 8 00000000000 D 1 000000 PCO D D E 0 Greupmax Clients Scheduler setup O 110 2 10000000 00 0 000 000000 00000 000 1 Scheduler Client y 2 000000 0 Groupmax Clients Scheduler setup 00000000000 O padg 000000 0000000000000 3 Scheduler Client 4 Scheduler Client 5 000000 Groupmax Clients Scheduler setup 020000000090 uaa 000000000000 0000 DO 6 Scheduler Client 021000000000000 000000000000 OOOOOOOOOOMOOOOOOOBOOOOOO O01 0 oH oO oH oo oO
405. n 000 usr GroupAppo bin GetAdA11 Groupmax Address Server 000000000009 000000 ok 10 0 ok sya D U D kaihatu IL kaihatu1l J kaihatu2 D 0 O ogc 9 9 nat kaihatu3 MAIN idx IDINDX idx 111 ok D D D D D ct z ISI jai mo 11 111 1 1 1 mo 163 a a 6 i AKMOOOU0000 ALTI Scheduler Server0 000000000000000 DU D Scheduler Server 000000000000000 NA Scheduler Server 1 HH BL D Scheduler Server poda 000000000 SI CL D O BI O 00 WOOO 163 7 0000000 7 2 indxget O 184 Address Server JO DODO 0000000 000000000000000000 000000000000000 00 D 0 Address Server 000000000 000000000000000 0000000000000
406. nformation notification process noo L3 r ETE 5 L3 LEE L3 1 1 tr 3 33811 I Current process is ceased to retrieve the modified information notification process in Groupmax Facilities Manager Tool noo zd L3 El m B L3 HO L3 Co 1 Lr 33903 E Fail to perform disused schedules process L3 L3 r Er Lt CI EE EJEA L3 L3 CHE EJ L3 L3 L3 L3 EJE EME ELE TES 33904 E Fail to perform disused schedules process 33905 E Fail to perform disused schedules process 33906 E Fail to perform disused schedules process 33908 E Fail to perform disused schedules process 33910 E Fail to perform disused schedules process 33911 E Fail to perform disused schedules process 33912 1 Disused schedules poo000000 process has been started 33913 I Disused schedules have been successfully deleted 000000 33914 I Current process is ceased to retrieve disused schedules process in Groupmax Facilities Manager Tool 00000 AppoMan 40701 E Fail to perform control data retrieval process oo oo E LJ GIE ELE EJE 342
407. no d 23 E FindCloseO errno d 24 40000 00000 25 00000000 26 E oo ooo oo oo oo mg mn 0000 000 0000000 ore 1 Gira 27 E 0800000000 7 28 E 29 d 0 30 40U 0000000000 dr 31 08000000 32 oo x DS 33 E 000 DNSO00000000 Scheduler Facilities 00000000 t 000 DNSH 000000000000 JUUDDUDUUunu 34 E 11111111111 1101 11 JUUDUDUUUDGUDUUDUDU unu OOOO 0 55 E 0000 19 5 0 ID s 0 11 1 1 00 36 E 800000 0000000000 JOO 00 JUUUDUDUUUDUGGDUUDUDU unu 1111101111 367 QO 8 D SFimport 0 O SFexpor 8 ODO 00000000
408. nterface JIS Japan Industrial Standard OS Operating System PC Personal Computer PDA Personal Digital Assistants TCP IP Transmission Control Protocol Internet Protocol Web World Wide Web 0000000000 DDD Groupmax Address Server Version 7 DD Address Server Groupmax Address Assist Service Version 6 Assist Service Groupmax Address Assist Viewer Version 6 Assist Viewer Microsoft R Excel Excel Groupmax Facilities Manager Version 7 Facilities Manager Groupmax World Wide Web Desktop Version 6 Groupmax WWW Groupmax Object Server Version 6 D Groupmax High end Object Server Version 6 Object Server Groupmax Scheduler Client Version 7 Groupmax Scheduler Client Light Version 3 Scheduler Client Groupmax Scheduler Server Version 7 Scheduler Server Groupmax System Agent TCP IP Version 5 System Agent TCP IP Groupmax System Manager TCP IP Version 5 System Manager TCP IP Microsoft R Windows R 2000 Server Operating System Windows 2000 Windows Microsoft R Windows R Server TM 2003 Enterprise Operating System Microsoft R Windows R Server TM 2003 Standard Operating System Windows 2003 Microsoft R Windows R 95 Windows 95 0000 0o00 po Microsoft R Windows R 98 Operating System Windows 98 Microsoft R Windows R Millennium Edition Windows Me Operating System Microsoft R Windows NT R Server Networ
409. oO oOo oo co au od ogo E eo EFE colo E pl Oo 52 5 oo m EE nolo oo oOo oOo E Ea gt 2 oog coolo2 800 au cc oo E 2 2 62 5 Oo E gt gt Ou 2 oo oOo oo 2 2 2 Ou au a oo od oolong ooloo Das Sol oo oo y ma AA Es l ti uem oo BO 5 4 r3 2 a o0 2 2 Bo oo oOOOO n oo oo os gt oO oo oo gt mn LE HO 1 0 on H o ij Oo Oo l ogo iy oa oo oa LL ogo oo o coa Io Ooo od x 3 3 7 a x Co x Co x co x Co x Co x Co x oO ooo oo r3 r3 Qi EE a E 3 EE Holo a oo 3 ooo 0 0 C3 tj Cj C3 a8 3 3 i a E oao O 280 0 Ert 9 oo olg oo Oa mnogo r3 c r3 r3 BO
410. oOo OO Oo Ooo OO Oo Ooo Oo OO OO Oo Oo Ooo oOo OO T E Ooo Oo O O 5 O O O O O 5 O Address Se U auct etet 000000000 1 1 1 2 O O E 5 ooo 415 0000000000 Address Server O0 0 0 00000 Address Server 000000000000000 poda 00000000000 0000000000000 00000 000000015 AddressQ 0000000000000 W GetAdAllj 0 D D OQ indxgetd o pH O ooo 0 m00 I 0 p000000000000000000 GetAdAng OO 000000 0 pop000000000000000 O 0 000 000 DU po000000000000000000 GetAdAng gg D D 0000 po
411. opod000000 00000000 Scheduler Server Facilities Manager 0000000000 Scheduler Server 4400000000000 0000600000000 Dodd 00000 0 0 0000 000000 00000000000 0000000000 uu aceAafterErrorQ OOOO OFF cheduler Server LE E23 eT Ex E 1 e MoO 5 9 5 O 35 3 nunnnnnnnun usr GroupAppo bin TraceAfterErrorSV dat Facilities Manager usr GroupAppo bin TraceAfterErrorRMSV dat 0000000000000 errDumpsSV logg OOOOOOOOGO errDumpRMSV logQOOOOOOOOOOOOOOOOOOOOOOO 36 3 0000000000 32 1 111 1 111 1 0 3 2 1 Scheduler Server 9 21 pogg00000000000000000000000000000000 co00000000000000000000000 Scheduler Server 0 0 TcPaPOOOOOOOOOOOOOO 00 01000000000 I D i roth D D UU U D D U 2 aconsole 1 D 0000 D usr bin aconsole SVo d pan
412. ostList failed Address Server Scheduler Server 0000000 rc xxx uid xxxxx result xxx Address Server Scheduler Server Facilities 000000000000000 82 GSSGetAddPostListO ID O OOOO Gx 88 GSSGetComInfoO 0 0 000 OO Gxxxx 84 GSSGetComListO 10 O O O HD Gxxxx 85 GSSGetOrgInfoO 000000 1 xxxxx 86 GSSGetOrgListO 0 0 IDO O O O Gxxxx 87 GSSGetOrgListO 000000 1 OOO Gxxxx 88 GSSGetOrgListO 0 D O O O O Gxxxx 89 GSSGetServerInfo20 7 000 DD OOO Gxxxx uid xxxxx 90 Groupmax Scheduler Server O 91 ERROR Address Server Address Server 0000000000000000000 pad 0000000000 OOOO Address Server 92 Assist 000000000 Assist JOO OOOO0O00000000000000000 D DD m 0000000 ada ag go o 0 00 0000000000000 051 D00000000000000000000000 8 332 M 0 GetAdAII O indxgetd OOOOOOOOOOOOO uuu uu 0000 PSALLOCT 0000 PSALLOC eary 0 0 000000000000 111111 11 1 uu 0 0 PSALLOC early 0 1111111111 11 1 1111111111 1 1 1 1 11 1 1 O log etc bk u OOO etc LJ EE N N N O Ll E
413. other processes control data could not be retrieved 44704 Due to unsuccessful communication with a parent server control data could not be retrieved 343 DON 00000 ID 44705 DU E 0000000 Fail to perform Control data retrieval process Co E 44801 Disused schedules process has been started 44802 Disused schedules have been successfully deleted 44803 Because servers are currently performing other processes disused schedules could not be deleted 44804 Disused schedules could not be deleted Either the user does not exist or fail to read user information files 44805 Fail to perform disused schedules process 44905 The user information creation process has been started 44906 44907 Because servers are currently performing other processes the user information creation process could not be performed Fail to perform the user information creation process oo CE 44908 The user information creation process has succeeded 44909 Fail to perform the user information creation process
414. oupAppo bin SFagent ini 1 1 1 1 1 Exec 0 0000 O BO 0000 00000800000 0000000000000 DODO DODO 00000000000 log agent ScheExec 1ogH OOOO Pot 0 usr GroupAppo bin SFagent logfile name 8 00000000000 117 Address Server D U D D Scheduler Server 00000000000000 OOOO OOO L 00000000000000 0 Scheduler Server 000000 Address Server g0000000000000000000000000000000000 po0000000000000000000 Aoglagent ScheExec log 0 000000 00000 usr GroupAppo bin SFagent 5 logfile name O 20 Assist Assist Viewer Scheduler Scheduler 000000000000 O DU 0 45 Assist 0 00 og 0000 000000000000 000000000000 000000 Assist Viewer 00000000000 Assist Assist Viewer 1 HH B HH B 0000000000 30 Du 1 Assisti 0000000000 0001 pod00000000000000000000 log agent ScheExec log EJ t L3 2 Assit0 DO0000000000000000000000000 00002 0000000000000000 1eg asent Scheexec 1oes 00000000 000000000000 0 Assist 000000000000 00000000 podd0 000000000 000000000000 Assist 0000000000 0 265 8 00000000000 1 0 00000000000000000 000 51689
415. pod 0000000000000 000000000000000000 O 2p0000000000000000000000 0000 0000000 OD 0000000000000000000000 0 461 000000 0000000000000000 88 00 00 0 I 0 0 0 0 EJ E Lt 0 0 0 0 0 0 75 4 00000000 76 D gBanpi mpug Pp000000000000000 8BDOBo0 0 0000000000000 poda 0000 000000000000 0000000000000 0 00000000000000000000 4616 00000000000 podd0000000 0000000000 0000000000000 9 00 0 4626 go0000009009000000000 46168 OO os 000000000 podd0 000000000000 00000000000000000000 04617 p0008008000000000000 4619 00000000000 4 00000000 48 1 481 OOOO Scheduler Server Version 7 Facilities Manager Versin70000000000 10 40000000000 0000 DO0000000000 000000 Scheduler Server Version 7 0 Facilities Manager Version 70 Y Y DO uu Ha DO DD ODO 000000000000 OOOOOOO Facilities Manager Version 7 YO B B 00000000000 o O e Scheduler Server G W 0 0 J Version 6 O O Scheduler Server 00000 Scheduler
416. r Migh gt gt 10 Address CODEZSE 11 AddressR A F IP7 F LZ 12 3 2528 FER 13 ZEEE A DET 14 4 BT SRA Sz 15 00 5551 8 2 HEAL HEALS 3 11F03B 0483005 TIPUS KALI fA IDB F BALL RET ARE GMAXSYS2 5 28 1 lt lt Groupmax ddress Assist 0888 gt gt 18 Assist 31 SI O 36IDDDDDDUDDDDDDDDUDUDUDDUDDDDUDUD 10 2000000 10 200000000 10 5 poda 000000 000000000000 00000000000000 00000000000 us bin RomMang 0000000000 D 2 0010 160000000000 312000000000 000000 020000000 Facilities Manager 0 0 00000000032 Dg000000000000000 000000000 O30 000000 Facilities Manager 000000 O40 00000000000 pnu uggunnagagugunaaguguma2 00000000000000000 000000000 30 3 0000000000 1511101011 00 1 060 0000 031 26000000000000000 8319 31200000 313000000000000000 10 00 000000000000000 10 Addresgg0000000000000000 OOOO00OO0000031200000000000000000010 AddressQOOOOU000000d0d00 0 20 gt 00000 OOOO000
417. ress Server 0000000000 YYYY XXXX result YYYY 00000000000 Address Server 00000000 00000000 Address Server 000000000000 0 D D Address Servern 000000000000 GSSGetUserList20 faild rc XXXX Address Server 0000000000 YYYY XXXX result YYYY 00000000000 Address Server 00000000 00000000 Address Server 000000000000 0 O Address Server 000000000000 GSSGetComListX0 0 0 IDO 88000000000 DOD000000000000 000 xx 100000 GSSGetOrgListX0 Q 888000000 0000000000000000 000 XXXX uut GSSGetUserList20 0 O ID XxxxpuugmmagugamgEgugagunugadguuu 000 xxx O O GSSGetUsertist20 0 0000 XXXD00000000000000000000000 0000 xxx 00 0000 000000000000 335 0000 00 ONI lID OFFOOOUOO ppoSV ini LET L3 ro TO 1 ai SES 10 3 1 i gt Ogg 1 1 30 1 11 1 sot JOAO Ol Ino ad 0 0 0 0 00 000000 00000 00000 ID KSFg02001 E 1 M Get dAII 0 O indxget OOOOOOOOOOOOO DD 1 D PARTIAL SORT 0000000 0000000 PARTIAL_SORT K
418. retrieved Due to unsuccessful communication with a parent server control data could not be retrieved 31115 Fail to perform Control data retrieval process 31116 Current process is ceased to retrieve the control data in Groupmax Facilities Manager Tool roo goo o rr Soo Poo eo Ll oo Dow 3 T eas El Co 1 y El 4 5 oO oO r3 r3 oO r3 33001 Scheduler Server Tool Facilities Manager Tool has been stopped to process 33803 Fail to perform the modified information notification process 33804 Fail to perform the modified information notification process 33805 Fail to perform the modified information notification process 33806 Fail to perform the modified information notification process 33807 The modified information notification process has been started 33808 The modified information notification process has succeeded 341 DON 00000 ID DU 0000000 33809 E Because servers are DO currently performing og other processes The oo modified information notification process could not be performed 33810 E Fail to perform the modified i
419. roughSV ON 00000 OOO MC ServiceGuard Scheduler Server Facilities Manager J g0000000000000000 0000000000000 8808000000000 10 0 ln s usr iki log AppoSV ini usr GroupAppo bin AppoSV ini Scheduler 7 OOOOOOO000000000000000000 11 cd umount gmaxpkgd vgchange a n dev vg03 00020000 388 D AIXD O O Scheduler mkdir gmaxpkgd 9 11110000000000000000000 0 vgchange a e dev vg03 0 000000 cmrund 000000000 000000000 Scheduler mount dev vg03 1vol1 gmaxpkgd ln 8 gmaxpkgd iki usr iki Scheduler Server 0000000090 4 etc hitachi setup i dev rmt 0m D Facilities Manager 0000000000 Facilities Manager 0000000000000000000 etc hitachi setup i dev rmt 0m U 11111114 11 01111111111 1111111141 1111411 Scheduler Server Facilities Manage 0 00000000000000090 usr bin AppoMan ini usr bin AppoMan ini bak In s usr iki log AppoMan ini usr bin AppoMan ini ln s usr iki log AppoSV ini usr GroupAppo bin AppoSV ini Scheduler 1 11111100000000000000000008 0 cd umount gmaxpkod vgch
420. rt00O000000000000000 000 00 0 0 60 00 0000 00000000000000000 0000 0000000000 810 000000000000000000000000 0000 6 0000000000000000 00000000000 R12 D0000000000000000000000SFimpor 00 00 00 0000 0 0000000000000000 000 SFimport 0 M 000000000000 0000000000000000 2000000000000000 SFimport 0 215 7 0000000 000000000 SFimportQOOO000000000000000000 podd00000000000000000 T E E 7 9 6 SFimport 216 019000000 sFimportOOQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO AD Scheduler Server Facilities ManagerOOOOOOOOOOOOOOOOOOOAOOOOOO 7 iOOOOOO D 71 AOOOO SERIO LIS Scheduler Server Facilities Server 0200000000 000000000000
421. ryMode 1 QQ 01 100000 1900000000000 00000000 4183000000 0 OQ Version 6Q 800000 412000000000000000 O413Q0000000000000000000000000000000000 F FWOS RE SHE Address3 amp 1 F 7 MD 0 d C 86008 AR C 381805 ARO BL G uid C RIL eps m f Bet BPXrAOG AWE NE kikakuhost y xTA0 GAMER E eieyouhost y Fey BIL 29100 010009 0000000000000 1000000000 D00000000 000000 000000000000 0000 00000000 2000000 1000000000000000 4 pNSOOOOOOOO 000 25000000000000000 pod00000000000 045 DNSOOOOOOOO pod00000000000 D ADO GWO000 kikakuhost 000 00045 pDNsSOOOOOOOOOOOGO 000 podo00000 000000000000 wpoo0000000000000000 000 238000000000000000 BOO GWOOOO 000 0000000000000000 0045 DNSPQgo0000000000000000000000 34 pH 5 4 Ga FH OO E E rT ET Ed Ea Ed Fr
422. ting UUDDUHUDUUDHBUApp oSVini D D U 337 DON 00000 ID u OOOO 45004 E An attempt to write trace xXxpoopbo0000000000 information has failed 0000000000 0 000000 000 XXX 45005 E An unexpected error ugugggaggguaggagggagagga occurred 45006 E An attempt to make a uggggaggguggagggaggag lock object for the trace file has failed 45007 E An attempt to allocate 1 00 0000000000000000 memory has failed 45008 E An attempt to acquire xxxxuupdgagagggggguggum trace file information has failed XXXX 00000000000000000000 45009 E An attempt to set the xxpooo00000000000000 writing location in the 00 0000000000000000 000 trace file has failed A AN XXXX 0 000000000000000000 45101 I The cache memory 0 0 function is enabled 0000000000 338
423. upAppo bin SFagent f logfile name DO 3 OOOO SchedllerQQOOHOOOO00000000000000000 263 8 00000000000 264 3 Assist Viewer Scheduler OO SchedulerQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO u uuu Uu 4 00009000000 Address Server 00000000 OOOO 4 Address Server 000000000 Assist Viewer L D 1 B D B B D Address Assist 0000000 Groupmax Address Assist Version 6 OOOOOO00000000000000 Address DOOOOOO0000000000000000 Assist Viewer O O O 000900000000 Scheduler Assist 1esg agent ScheExec 1os l 0000000000 DO 5 16 AssistOOOOOOOO Address 105 6 Address Server 0 0000000000000031 000000 000 0 0 oO O FL E 541 El 0 D 006 SFagent ini 00 000 xee 00 0000000000 00006 usr Gr
424. ut2 0 000000 300 0000000000000000000000 00000005 60s spp0000000000000000000000 ReplTimeOut2 7 0000000000 AppoS Via 0000000000000000 OOO ReplTimeOut2 300 00000000000000000 60000000 gd 0000000000000 UL DOBO0 0000000 00000000 00000000000 0 00000000732 0000000000000 60000000000 DU 1200 0 ELE LE E 41 0 4 CE Oooo rr DO DO 000000 00000000 0000000000 go 000000000000 po0000000000000 paramimQ 00000000 paramani D UD 1 O E Eo YE E Lar E po00000000000 ete param ini 0 Lr O 0 0 O 0 0 usr GroupAppo bin param0 ini usr GroupAppo bin paraml ini usr GroupAppo bin param2 ini O 0 O 0 0 8 00000000000 1 0 D 2
425. utfile 196 7 0000000 02000 inputfile outputfile 00000 inputfle outputfile J 0000000000000000 0000000000000 000000000ovtputilego 0000000000 po00000000000000000 inputfleQ 0 0000000000000 00000 90 008000000 smni 0000000000 msi 4000000000000 sd 0000000000 nsdl 0000000 inputfile 0 0000000000000000 AD inputfileQ 000000000 DU u usr GroupAppo bin sortdate 199905 rsd workfile 199905 rsd 0 DODO DO DO DO DO DO 0000 0000000000000 workfle J OOOOOO0000000000 197 7 0000000 7 7 1 11 1 1 2 checkid 0 O O 00 0 checkid 0180000000 usr GroupAppo bin checkid 0200000000 e 000000 e 100000 O30 0000000 0 0090000000000000000000000 0 00 6 3 0 00 0 0 000000000 UserID xxxx GroupID yyyy Different zzzz TDINDX idx 0000000yyy0 0000 IDO 0 IDINDXidx 0000000 IDINDX idx 1 1 1 1 0 U 1 1 LI U LI U LU U C U C CDI UserID xxxx GroupIDlyyyy Not Exist zzzz 0000000yy00000 UserID xxxx GroupID yyyy Not Exist OOO IDO xxxxD 00000000 yyyyt U LU U C LU U DU D 70000000 00000000 xxx 0000
426. will be mounted in the order specified during package startup and will be unmounted in reverse order during package shutdown Ensure that volume groups referenced by the logical volume definitions below are included in volume group definitions above LV 0 2 dev vg03 1voli1 FS 0 2 gmaxpkgd FS MOUNT OPT 0 z o rw IP ADDRESSES Specify the IP and Subnet address pairs which are used by this package Uncomment IP 0 and SUBNET 0 and fill in the name of your first IP and subnet address You must begin with IP 0 and SUBNET 0 and increment the list in sequence For example if this package uses an IP of 192 10 25 12 and a subnet of 192 10 25 0 enter IP 0 192 10 25 12 SUBNET 0 192 10 25 0 netmask 255 255 255 0 Hint Run netstat i to see the available subnets in the Network field IP Subnet address pairs for each IP address you want to add to a subnet interface card Must be set in pairs even for IP addresses on the same subnet IP 0 172 1 1 3 SUBNET 0 172 1 1 0 SERVICE NAMES AND COMMANDS H Specify the service name command and restart parameters which are used by this package Uncomment SERVICE NAME 0 SERVICE 0 SERVICE RESTART O and fill in the name of the first service command and restart parameters You must begin with SERVICE NAME 0 SERVICE CMD 0 and SERVICE RESTAR
427. xget bak 00000 backupfile log apposv log tmp ooooo 419 000000 0000000 Uu uu 00000 apposv log uxpl 00 0000000 2 apposv log agent 00 Assist 0 2 Sapposv log agent Assist 000 ScheExec log SFagent SFagent log SFagent bak SFagent msg bitechg log apposv log agent execId SFdatacp 000 SFdatacp log 0 1 180000000 400000000 2 OOOO 0 Scheduler Server Scheduler Server O0 00000000 11 111 11111 1 1 1 1 1 0 D v2 u u Scheduler 0 0 O OOOO LOGSV csv LOGSV bak gt 4 UU 100 CntlSV log CntlSV bak errDumpSV log 100000 errDumpSV bak TraceSV1 log AppoSV ni 0000 000000 TraceSVIX log Siz 0200000000 0000 0000315 Facilities OOOO OOOO LOGRMSV csv LOGRMSV bak po0006000000 14 po 1080 CntIRMSV log CntIRMSV bak
428. y could notbe found uii TCPAPO000000000000 60302 E Error in the socket 1 00000000000000000 0 function 60303 I Scheduler Server 000000000090 Facilities Manager has been started to process 60304 E The setup file 000000 paramini 0000000090 param ini does not ezist 0000000 or there must be some 08103 000000000000 ID eR 60340 000000000000000 60401 I Scheduler Server 000000000090 Facilities Manager has been stopped to process N2 0000000 AppoMan RoomMan DODDO ID OO Od 31103 E Fail to perform Control 1 0 000 00000000000000 data retrieval process uggggggggpnggggggggega 31104 E Fail to perform Control data retrieval process 31105 E Fail to perform Control data retrieval process 31106 E Fail to perform Control data retrieval process 31108 E Fail to perform Control 340 data retrieval process 00000 ID 31109 00 E 0000000 Fail to perform Control data retrieval process DON DD 31111 Control data retrieval process has been started 31112 Control data have been successfully retrieved 31113 31114 Because servers are currently performing other processes control data could not be

Download Pdf Manuals

Related Search

Related Contents

Base avec bride de carrelage moulé intégré avec cache drain  Skopje Bicycle Routes Simulator Software user manual  取扱説明書 U JA LED 光源 FS 4601  Sopar 5240 projection screen  2 - Korg  GREASE - Alcoa  

Copyright © All rights reserved. Failed to retrieve file