Home
WO 2012/090978 A 1
Contents
1. fal
2. Bac Lus subt i Li s lt Lactobac iLLus rhamnosus WO 2012 090978 8 PCT JP2011 080151 00 19 0020 002 1 Lactobac Lus brevis Pseudomonas putida Escherichia coll Saccha r
3. gt lt corynebac terium efficiens corynebac terium ammoniagenes an co rynebac terium halotoLerance corynebac terium aLkano Lyt icum F Corynebac terium gLutamicum RK FERM P 18976 ATCC 13032 PR A TCC 13869 ATCC 13058 ATCC 13059 ATCC 13060 ATCC 13232 ATCC 1 loo loo WO 2012 090978 6 PCT JP2011 080151 15 16 3286 ATCC 13287 ATCC 13655 ATCC 13745 ATCC 13746 ATCC 1376 1 ATCC 14020
4. 0 1 10 ww v B1 B6 pH 5 8 A nui M et aL Metabo lic a naLysis of Corynebacter ium gLutam icum dur ing Lactate and succ inate pr oduct ions under oxygen depr ivat ion cond itions J Mo Microb iol Bio techno 7 182 1 96 2004 BT Omumasaba C A et a Coryneba cter ium g Lutam icum gLycera Ldehyde 3 phosphate dehydrogenase isoforms With oppos ite ATP dependent regu lat ion J MoL Microb iol Biotechno L 8 91 103 2004
5. 1 1 DNA Bac iLLus subt iLis NBRC 141444 50 DNA NBRC Medium No 802 po Lypeptone 10 g yeast ext ract 2 g Mg SO0 7HO 1 g 1L 37 DNA Genomic Prep CeLLs and Tissue DNA Iso lat ion Kit DNA Lactobac Lus rhamnosus NBRC 3425 DNA H I NBRC Medium No 804 po Lypeptone 5 g yeast ext ract 5 g glucose 5 g MgS0 7H 0 1 g 1 WO 2012 090978
6. 1 2 0 01 1 wv WO 2012 090978 14 PCT JP2011 080151 0032 0033 0 1 10 w v9 B1 5B6
7. ApE2 AM dosc DNA PcR PcR decsc 31 decsc BET Applied Biosys tems 394 D NRNA synthes izer desc 8 11 5 CTCT CCATGG ATTCTAGAACAGTTGGTATATTAG 3 32 b 11 5 CTCT CCATGG TTACTTGTTTTCTAGATAAGCTTCGTAAC 3 33 sa 11 b11 Ncoi WO 2012 090978 29 PCT JP2011 080151 0076 0077 EC 04083 EC 04082 EC 0408
8. WO 2012 090978 5 PCT JP2011 080151 00 11 00 12 00 13 00 14 I yr 2b 4S E F n 3 Ba rgeys Manua of Determinat ive Bacteriology Vol 8 5 99 194
9. N W JI Nz 1 2 0 1 10 w v S 18 WO 2012 090978 12 PCT JP2011 080151 0027 0028 2 0 01 1 w v96
10. WO 2012 090978 17 PCT JP2011 080151 0036 0037 0038 0039 pH
11. Brevibac terium ammon iagenes ATcces72 th a rthrobac ter gLobiformis ATcc80 10 ATcc4336 ATcc2 1056 ATCC3 1250 ATcc3 1738 ATcc35eg8 KER Mycobact erium bov is ATcc 19210 ATcc27289 th m icr ococcus freuden reichii No 239 FERM P 1322 1 Micrococcus Le ut eus No 240 FERM P WO 2012 090978 7 PCT JP2011 080151 001 7 001 8 13222 YF VOAYAA wicrococcus ureae IAM1 010 wicrococcus roseus IF03 764
12. Lo bA XYZ A FR J 1 2 0 1 10 w v
13. PcR DNA DNA PCR D NA Brevibacter ium Lactof ermentum 2256 pAM330 amp R58 67699 Miwa K et al Crypt ic plasmids in glutam ic acid produc ing bacter ia Agr ic Bio Chem 48 2901 2903 198 WO 2012 090978 10 PCT JP2011 080151 Yamaguch i R et al Determ inat ion of the comp lete nuc leot ide sequen ce of the Brev ibacter ium Lactof ermentum DLasmid pAM330
14. 0090 3 4 1 ANI 1 ANI 7 50g mL A NH CO 29 Hy 9804 79 KH P0 0 5 g KHPO0 0 5 g MgS0 7H 0 0 5 g 0 06 wiv Fe S04 7H 0 0 0 42 wiv MnS0 2H 0 1 mL 0 02 wiv biotin solut ion 1 mL 0 01 w v thiamin solut ion 2 mb yeast ext ract 2 g vitamin assay casam ino a cid 7 g glucose 40 g BR 15g 1L 33C 20 WO 2012 090978 36 PCT JP2011 080151 009 1 0092 ANI 1 AN 1 7 50 gm A 10mL SAR L 330c 20 aC 15 000 X g 10
15. 0034 lt gt WO 2012 090978 16 PCT JP2011 080151 0035 BHA CH DURBMRBGREVN CBr 200 mV 500 mv 250 mV 500 mv B ROADLEY JAMES ORP Elect rodes
16. DNA Sall Z pCRB22 4 1 kb DNA PgapA 0 6 kb DNA PgapA pCRB206 PcR PKK223 3 0 4 kb DNA 10 Ncol BspHl PCRB206 2 Ncol 70C 10 T4 DNA 10x amp lul T4 DNA 1 unit lL MRBRBKe1OuUL ELT 150 3 C C Journal of Mo Lecu Lar BioLogy 53 159 1970 JMt09 L 50 g m
17. 57 Abstract A transformant which is produced by introducing a gene encoding an enzyme having an aminobenzoate de carboxylase activity into ahost coryneform bacterium and which is capable of producing aniline and a method for producing anil ine comprising a step of reacting the transformant in areaction solution containing aminobenzoic acid an ester thereof and or a salt thereof under reductive conditions and a step of collecting aniline fixim areaction culture medium 67 aminobenzoate decarboxylase WO 2012 090978 1 PCT JP2011 080151 1 0001 0002 0003 H f
18. ot udies on the PcT vJP2011 080151 C12R1 15 2006 01 n GenBank EMBL DDBJ GeneSed A Sloane metaDo i sm of p arainobenzo i 1 9 acid by Mycobacterium Journal of Bio logi cal Chemi stry Vol 193 453 458 A McCul lough W G et al ic Decarboxylat ion of the 1 9 Aminobenzoates Journal of the Ameri can Chemi cal Soc i ety 1957 Vol 79 p 628 630 Mw C TA TE To TP BRR 14 0 SA JP 100 8915
19. ubipx decLR DNA PcR PcR decLR 19 decLR BEF AppU ed Biosys tems 739 D NRNA synthes izer 0066 decLR a 7 5 CTCT CATATG ACAGCATCACCTTGGG 3 20 b 7 5 CTCT CATATG TCATCTTAACGACGCTCCATTC 3 21 a7 b 7 Ndei WO 2012 090978 27 PCT JP2011 080151 0067 Lvis 198s7 LvlS 198 decLB DNA PcR PcR dqdecLB
20. F WO 2012 090978 2 PCT JP2011 080151 0004 0005 0006
21. aminobenzoate decarboxy lase H 1 aminobenzoate decarboxy Lase 2 Bac Lus subt iLis lt Lactobac iLLus rhamnosus Lactobac Lus brev is EFA
22. 3 1 DNA 34 DNA 16 19 22 25 28 31 34 DNA DNA M 0Lecu Lar Cloning A Labo ratory Manua l Second Edition 1989 VoL2 pi 1 45 m 5 1o Am Chem Soc 79 628 630 1957 WO 2012 090978 9 PCT JP2011 080151 0022 0023
23. 1 3 5 R FERM P 18976 ATCC 13032 ATCC13869 4 6 ANI 1 NITE BP 1 001 7 1 6 Ws 7 9 200 50 0 In 7 8
24. DNA Escher ichia coli K 12 Me1655 DNA LB tryptone 10 g yeast ext ract 5 g NaCL5 g 1 37 DNA M GenomicPrep CeLLs and Tissue DN A Iso lat ion Kit DNA t LEXI Saccharomyces cerev isiae NBRC 10217 DNA H Ik NBRC Medium No 108 glucose 10 g peptone 5 g yeast ext ract 3 g maLt ext rat 3 g 1 L 24 DNA GenomicPrep CeLLs and Tissue DNA Iso lat ion Kit 7 DNA WO 2012 090978 19 PCT JP2011 080151 0044 0045 0046 0047 KUR Enterobac ter cloacae NBRC 13535 DNA
25. Lacta te dehydrogenase LDH phosphoeno Lpyrvate carboxy lase ma Late dehydrogenase COB R FERM P 1 8976 he WO2005 01 0182A1
26. WO 2012 090978 26 PCT JP2011 080151 pCRB209 0063 3 bsdBcD AR deps DNA PCR PcR decjgs 16 docecjgs Appu ed Biosys tems 7394 DNA RNA synthes izer 0064 deces a 6 5 CTCT CATATG AAAGCAGAATTCAAGCGTAAAG 3 17 b 6 5 CTCT CATATG _ GATCAAGCCTTTCGTTCCG 3 18 a6 b 6 Ndei 0065
27. Streptomyces gri seus TSB Trypt icase Soy Broth 4 5 LAL 1 1 1 2008 274225 1 The Journa of BioLogicaL Chemistry VoL 193 1951 453 WO 2012 090978 3 PCT JP2011 080151 0007 0008 0009 458 Journa of the Amer ican Chemical Society VoL 79 1957 628 630
28. Corynebac terium gLutam icum ANI 4 pCRB209 de EC Corynebac terium gLutamicum AN 5 pcCRB207 dec SC WO 2012 090978 34 PCT JP2011 080151 0086 0087 0088 corynebac terium glutamicum ANI 6 pCRB209 dec ECL Corynebac terium glutamicum ANI 7 corynebac terium glutamicum ANI 1 2 5 8 292 08 18 SHA 2 010 11 16 NITE BP 1001 o 2 1 ANI 1 AN 17 s0gm A NH CO 29 NH4 980 79 KH P040 5 g KHP0 0 5 g
29. pH 6 8 A nui M et aL Metabo Lic ana lys is of Corynebacter ium g Lutam icum dur ing Lactate and succ inate product ions under oxygen depr ivat ion cond itions J Mo Mi crob ioL Biotechno L 7 182 1 96 2004 BT Omumasaba C A et a Corynebacter ium g Lutam icum g Lycera Ldehyde 3 phosphate dehydrogena se isoforms With oppos ite ATP dependent regu lat ion J MoL Microb io L Biotechno L 8 91 103 2004 amp fa Jn JZR ERR TOM KU 2 6 3 mw 4 PP 2
30. 0 7 Bacillus subtilis 0 65 Lactobacillus rhamnosus 0 6 PS Lactobacillus brevis orynebacter ium ees glutamicum f 0 6 Pseudomonas putida i 0 5 Escherichia coli a 0 5 Saccharomyces cerevisiae 1 25 Enterobacter cloacae 0093 WO 2012 090978 38 PCT JP2011 080151 1 2 3 4 5 am i nobenzoate decarbox y Lase
31. 0053 DOA R FERM P 1 8976 H DNA PKK223 3 PcR GeneAmp PCR System 97000 TaKaRa LA Tag 0054 TaKaRa LA TaqW 5 units 4 1 0 5 10X LA PCR Buffer 11 Mg free 5u 25mM MgCl 5 5 dNTP Mixture 2 5mM each 8 u k DNA 5ul DNA 1 g 2 0 5 18M 25 5 50 PcR PgapA 8a 7 6 7 8 68 0055 PcR 94 C 60 52 C 60 72 C PgapA 45 30 1
32. 10 mL BT KNn CO 2g NH S0 7g KH P0 0 5 g K HPO 0 5 g MgS0 7H 0 0 5 g 0 06 wiv Fe SO 4 7H 0 0 042 wiv MnS04 2HO 1 mL 0 02 wiv biotin solution 1 mL 0 01 wv thiamin solution 2 ml 2 op 10 BT 15m 3 450 mv 4 s mm L 330 6 4 15 000 Xg 10 ec us ANI 1 AN 1 7 MRE BATRA 2 WO 2012 090978 37 PCT JP2011 080151 2 4 ANI 1 AN I 7 mM
33. 19 15 3 F G H J K 6 F e H I J K Nouma of MoLecuLar Biology 53 159 1970 J JM109 50 g mL LB as 0 5s 0 5 O1 5 BK Nona PCRB209 5 1 kb DNA dec BS F 2 3 kb decLR G 2 1 kb de JLB h
34. 4 1 4 1 2 WO 2012 090978 15 PCT JP2011 080151 0 1 10 wv 0 5 7 wv 0 5 5 wv 10 1 50 mu
35. N Bac Lus subt iLis Lactobac iLLus rhamnosus Lactobac Lus brev is Pseudomonas put ida Escherichia coll i gt accharomyces cerev isiae Enterobacter c loacae 1 ag bb DNA 1 3 a 16 DNA 19 DNA 22 DNA 25 DNA 28 DNA 31 DNA
36. REsEARcn Mz NA RW SD SL SZ TZ UG ZM ZW INSTITUTE OF INNOVATIVE TECHNOLOGY FOR F AM AZ BY KG KZ MD RU TJ TM THE EARTH JP JP T6190292 AL AT BE BG CH CY CZ DE DK EE g 2 kyoto Jp ES Fl FR GB GR HR HU IE IS IT LT LU LV MC 6UMITOMO RUBBER INDUSTRIES LTD MK MT NL NO PL PT RO RS SE SI SK SM TR PP 176510072 3 OAPI BF BJ CF CG Cl CM GA GN GQ GW ML 6 9 5 Hyogo JP MR NE SN TD TG 72 ea 0 YA y 2 2 s 2 kyoto up amp HF GA 13 UN gio aoe eee eee 2 4 a 1 48 2 a vii 9 2 Date MRAM MBO OBS E LTR kyoto P 52y 74 iwATAN Ryo 5soooos 2 1 3 3 Osaka JP 54 Title TRANSFORMANT OF CORYNEFORM BACTERIUM AND METHOD FOR PRODUCING ANILINE USING SAME 54
37. a 9 gt 5 CTCT CATATG AACGGGCCGGAAC 3 26 b 9 gt 5 CTCT CATATG TCAATCATCCACCCCGAAG 3 27 a9 b9 Ndel 007 1 WO 2012 090978 28 PCT JP2011 080151 0072 0073 0074 0075 purEK QM decc DNA pcR PcR LT decc 28 IJ Ydc Applied Biosys tems 394 DNWRNA synthes izer dec EC a 10 5 CTCT CATATG TCTTCCCGCAATAATCCG 3 29 b 10 3 5 CTCT CATATG TTAACCGAACTTACTCTGCGC 3 30 a10 b 10 Ndei
38. 7 200 50 0 7 8 WO 2012 090978 1 gapA promoter Ndel dec BS rRNA ON Ndel terminator gapA Ndel promoter pCRB209 dec LB 7165 bp W TRNA terminator gapA Ndei promoter pCRB209 dec EC ageciEc Ndef Km terminator gapA Ndel promoter dec ECL terminator Ndei 171 PCT JP2011 080151 9apA Ndel promoter PCASE1 ori pCRB209 dec LR dec LR pUC ori Ndel terminator gapA promoter Ndel pCASE1 ori dec PP Ndet YRNA terminator puc A Km gapA promoter Ncol pCASE1 ori pCRB207 dec SC dec c PUC pi rRNA Neol Kmr terminator INTERNATIONAL SEARCH REPORT International application No PCT JP2 011 080151 A CLASSIFICATION OF SUBJECT MATTER C12N1 21 2006 01 i C12P1 30 0 2006 01 i C12N1 5 09 2006 01 n C12R1 15 2006 01 n According to International Patent Classification IPC or to both national classification and IPC FIELDS SEARCHED Minimum documentation searched classification system followed by classification symbols C12N1 21 C12P13 00 C12N1 5 09 C12R1 15 Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched Jits
39. FLEA decLB 123 dec PP 45 dec EC 94 dec SC 103 decjECL 135 1 30 WO 2012 090978 31 PCT JP2011 080151 0079 10 0 gs dec gs 2 3 kb decLR 2 1 kb oecrLB 2 0kp decypp 0 6 kb IY decjEc 1 6kb d ec SC 1 7 kp oecEcL BETO 2 3 kb pNA 0080 4 _ PcRB207 3 pcR dec SC
40. WBS XYI 1 2 Nz BRR 1 2 0 1 10 WwW v
41. 18 33 2 Intact CeLL Intact CeLL HEPES pH7 0 25mM 4 5mM 33C 20 Orpm 6 0 22 m GC MS HPLC 16 19 22 25 28 31 34 90 95 98 DNA GENETYX ver 8 GENETYX 16 19 22 25 28 31 34 DNA
42. DNA Pkk223 3 _ rrnBT 1T2 AR DNA PcR PgapA ON lt 7 PgapA 8 0052 PgapA a 3 5 CTCT GTCGAC CCGAAGATCTGAAGATTCCTG 3 9 b 3 5 CTCT GTCGAC GGATCC CCATGG TGTGTCTCCTCTAAAGATTGTAGG 3 10 a3 sau b 3 SaLl BamHI Ncol WO 2012 090978 22 PCT JP2011 080151 a 4 5 CTCT GCATGC CCATGG CTGTTTTGGCGGATGAGAGA 3 11 b 4 5 CTCT GCATGC TCATGA AAGAGTTTGTAGAAACGCAAAAAGG 3 12 4 Sphl Ncol b 4 Sphl BspHI
43. 4 3 PCT ISA 2 10 2 YO T K TY 1 I amp X 03 3581 1101 3448 200 9 7 PC1 JP2011 080151 C JP 2008 274225 A 2008 11 13
44. 2 0 kb decyPP 0 6 kb gecEC 1 6 kb dec ECL k 2 3 kb WO 2012 090978 33 PCT JP2011 080151 0083 0084 0085 qecyjBs pcRB209 dec Bs gec LR pc RB209 decLR decLB pcRB209 dec LB dgecypp A pcRB209 dec PP gecyEc AZ pcRB209 deccEC geciEcL pcRB209 decrECL G1 5
45. 30 10 0 8 PgapA 0 6kb 0 4 kb DNA A WO 2012 090978 23 PCT JP2011 080151 0056 0057 PcR KR PgapA 0 6 kb DNA 10 pCRB22 H4 1 kb Sall 70 10 T4 DNA 1iox 1M T4 DNA 1 unit L RA RAK 10 lL 15 3 B B JournaL of Mo Lecu Lar BioLogy 53 159 1970 JM1t09 L 50 g mL LB oy bY 0 5 0 5 1 5 BR
46. amp us 1 9 2008 0242823 A1 amp EP 1975240 A18 DE 602008000176 D amp CN 101274996 A 8 RU 2008111877 A 1991 Vo 39 No 5 p 572 573 StotZ Agathe and Linder Patrick The ADE2 gene from Saccharomyces cerevisiae sequence and new vectors Gene 1990 Vol 95 p 91 98 Tiedeman A A et al Nucleotide sequence analysis of the purEK operon encoding 5 phosphor _ ibosyl 5 araino imidazole carboxylase of Escherichia coli K 12 Journal of Bacteriology 1989 Vol 171 No 1 p 205 212 Kahng H _Y et al Characterization of strain HY99 a novel microorganism capable of aerobic and anaerobic degradation of aniline FEMS Microbiology Letters 2000 Vol 190 p 215 221 NELSON K E et al Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas put ida KT2440 Environmental Microbiology 2002 Vol 4 No 12 p 799 808 MATSUI T et al Purification characterization and gene cloning of 4 hydroxybenzoate decarboxylase of Enterobacter cloacae P240 Archives of Microbiology Vol 186 2006 p 21 29 Lupa B et al Properties of the reversible nonoxidative vanillate 4 hydroxybenzoate decarboxylase from Bacillus subtilis Canadian Journal of Microbiology 2008 Vol 54 p 75 81 Wo 2011 050326 Al GENOMATICA INC
47. 0 5 UM Wh bs 2 B 7k 25 5 fi 50 PCR deo BS a6 b 6 decLR a7 b 7 decLB a8 b 8 dec PP a9 b 9 dec EC a 10 b 10 dec SC a11 b 11 dec ECL a12 b 12 PcR 94 C 60 529C 60 72 C dec BS 137 decLR 123
48. 15 45 1 7 Cli HRW Ol Fa 25 35 CTC WH 12 48 WO 2012 090978 13 PCT JP2011 080151 0029 0030 0031
49. 34 DNA b a DNA DNA 1 3 R FERM P 18976 ATCC 13032 X IkATCC1 3869 4 WO 2012 090978 6 7 8 9 39 PCT JP2011 080151 ANI 1 NITE BP 100 1 1 6
50. 1 2 T BAW IC IE BT fe Omumasaba C A et al Corynebacter ium g Luta micum gLycera Ldehyde 3 phosphate dehydrogenase isoforms with oppos ite ATP dependent regu lat ion J MoL Microb iol Biotechno L 8 91 103 2004 0 01 1 w v PH 6 8 pH DT 1 023 pH 7 pk Rl 20 40 25 35 1 7 1 3
51. A LdhaA PLdhA PgapA rfRNN rmB T1T2 trpA KZ Jn N Brev ibacter ium Lactof ermentum trp rrmB T1T2 0025 DEAE WO 2012 090978 11 PCT JP2011 080151 0026 BAN KIA 50H ATE Kurusu Y et aL ELect roporat ion t ransformat ion system for Corynef orm bacter ia by auxot roph ic compLementat ion Ag ric Bio Chem 54 443 447 1990 Vertes A A et al Pre sence of Mrr and mcr Like rest riction systems in Corynef orm bacter ia Res Microb iol 144 181 185 1993
52. 0 8 pCRB207 5 1 kb DNA PcR pCRB207 5 1 kb DNA 10 Ndei 70 10 T4 DNA 10X 1 T4 DNA 1 unit L RMBRBkKeE1OUL 15 3 D D Journa L of MoLecu Lar BioLogy 53 159 1970 JM109 L 50 g mL LB a 0 5 0 5 1 5 BR DNA Ndel LE PgapA rrnBT1T12
53. 1 Mycobacte rium smegmat is 4 1 1 4 2 Escherichia co Li 0111 2 BBE 4 2 2 4 1
54. 1 PcR pGASE1 or ij a1 b1 PpHse298 a2 b 2 PcR 94 C 60 52 C 60 72 C pCASE1 or i 150 PHSG298 180 1 30 10L 0 8 pCASE 1 ori 1 4kb pHse298 2 7 kb DNA PcR pCASE 1 ori 1 4 kb DNA 10 pHseG29 8 2 7 kb DNA 10 Bii 70C 10 T4 DNA 10x lul T4 DNA 1 WO 2012 0909
55. 6 ac 15 000Xg 10 WO 2012 090978 35 PCT JP2011 080151 ec MS ANI 1 AN 7 Hl BREE 1 0089 1 ANI 1 AN 7 FAIR AA ii nM 0 75 Bacillus subtilis 0 7 Lactobacillus rhamnosus Corynebacterium ZA ree 7 TEA 0 6 Satan A Lagrobaci lus Brevis 0 6 Pseudomonas putida 0 5 Escherichia coli el 0 5 Saccharomyces cerevisiae 0 5 Enterobacter cloacae
56. H Ik NBRC Medium No 802 poLypept one 10 g yeas t extr act 29 MgS0 7H 0 1 g 1 L 37 DNA Genom icPrep CeLLs and Tissue DNA lsolation Kit DNA 2 PCRB22 JcM12072 pcAsE DNA pcASE 1 ori pHSG298 DNA PcR PcR UT pcAsE 1 ori pHse298 1 pcASE1 ori 2 piSG298 pCASE 1 ori a 1 5 AT AGATCT AGAACGTCCGTAGGAGC 3 3 b 1 5 AT AGATCT GACTTGGTTAC
57. Pseudomonas put ida ee scher ichia coLi Saccharom yces cerev isiae Enter obacter cloacae 1 WO 2012 090978 4 PCT JP2011 080151 0010 3 ag 5b DNA 1 a 16 DNA 19 DNA 22 DNA 25 DNA 28 DNA 31 DNA 34 DNA b a DNA DNA 4
58. pCRB209 dec BS pCRB209 dec LR pCRB209 dec LB pCRB209 dec PP pCRB209 dec EC pCRB207 dec SC pCRB209 dec ECL Ag ric Bio chem VoL 54 443 447 1990 Res Microbio L VoL 144 181 185 1993 R so gm L A DNA CORR bcRB209 dec BS pCRB209 dec LR pCRB209 dec LB pCRB209 dec PP pCRB209 dec EC pCRB207 dec SC BU pCRB209 dec ECL pCRB209 dec BS corynebac terium gLutamicum ANI 1 pCRB209 decLR Corynebac terium gLutamicum ANI 2 pCRB209 decLB corynebac terium gLutamicum ANI 3 pCRB209 decPP lt
59. 1 7 kb pNA 10 L PgapA pcRB207 2L Nco 70c 10 T4 DNA 10x 1 T4 DNA 1 unit 10 15c 3 E E uournaL of MoLecu Lar Biology 53 159 1970 J Jimo L 5s0gm L Lg a 0 5 A 0 5 1 s BRK Mna PcRB207 5 1 kb pNA ELE gec sc E 1
60. 22 decLB BEF AppU ed Biosys tems 394 DNAR NA synthes izer 0068 decLB a 8 5 CTCT CATATG GTAAATGATCCTTATGATTTACGAAAAG 3 23 b 8 5 CTCT CATATG _ CTAATCTCCCTCCCAACG 3 242 a8 b8 Noei 0069 ubiD AB dope DNA PCR PcR decjpp 255 R EFA decjPP AppU ed Biosys tems 394 DNA RNA synths izer 0070 decPP
61. ATCC3 1831 MJ 233 FERM BP 1497 MJ 233AB 41 FE RM BP 1498 R FERM P 18976 ATCC 13032 ATCC 13869 mrevibac terlum fLavum Brevibac ter ium Lactofermen tum lt Brevibac teri um divaricat um corynebac terium LiLium corynebac terium gLutaMicum LAE bK nT UD LiebL wW et al Transfe r of Br evibac terium divaricat um DSM 20297T Brevibac terium f Lavum DSM 2041 1 Brevibac terium Lactofermen tum DSM 2041 2 and DSM 1412 and Coryne bac terium gLutamicum and their distinction by rRNA gene restriction p atterns Int J Sys t Bacteriol 41 255 260 1991 45 944 963 1987 3 ACG 13869 MJ 233 FERM BP 1497 MJ 233AB 41 FERM BP 1498
62. Pfenig N et al 1981 The dissimiLatory suLfate reduc ing bacter ia In The Prokaryotes A Handbook on Habitats Iso Lat ion and Ident ificat ion of Bacter ia Ed By Star r MP et abl p926 940 Ber lin Springer Ver Lag BS 1990 F 260 10 mmHg 5 mmHg 3 mmHg 1 60 5 40
63. 2011 04 28 p 19 9f FIG 2 amp US 2011 0097767 Al BaP CT 1ISA 4210 2 2009 7
64. 7 kb gecsc pcRB 207 dec SC 1 008 14 PcRB209 WO 2012 090978 32 PCT JP2011 080151 0082 5038 3 CM pcR gec BS ia 2 3 kb DNA decLR 2 1 kb DNA decLB 2 0 kb DNA decyPP 0 6 kb DNA decEC 1 6 kb DNA dec ECL 2 3 kb DNA F 10u LR U Pgapa PCRB209 2 Ndel 70C 10 T4 DNA 1 0X 1 T4 DNA 1 unit
65. MgS04 7HO 0 5 g 0 06 wiv Fe S04 7H 0 0 0 42 wiv MnSO 2H 0 1 mL 0 02 wiv biotin solution 1 mL 0 01 w v thiamin solution 2 mL yeas t extract 2 g vitamin assay casam ino a cid 7 g glucose 40 g BK 15 g 1L 33C 20 ANI 1 AN 1 7 s0 gm L 1omL 33C 2o 4 15 000Xg 10 10 mL BT Cnu CO 2g NH 80 7g KH P0 0 5 g K HPO 0 5 g MgS0 7H 0 0 5 g 0 06 wiv Fe SO a 7H 0 0 042 wiv MnS0 2H 0 1 mL 0 02 wiv biotin solution 1 mL 0 01 wv thiamin solution 2 ml 2 op 10 Br 1smL 450 mv 25 mw L 330
66. 1 dgecjEcL DNA PcR PCR gecEcL 34 decEcL BEF AppU ed Biosys tems 394 DNA RNA synthes izer dec7ECL a 12 5 CTCT CATATG AGATTGATCGTGGGAATGAC 3 35 b 12 5 CTCT CATATG TTACAGCAATGGCGGAATGG 3 36 sa 12 b 12 Ndel OOA NiTE Biological Resou rce Center NBRC NBRc 14144 DN A NITE BioLogicaL Resou rce Ce nter NBRC NBRc 3425 DDMA American Type Cul ture CoLLection ATCC A
67. 18 PCT JP2011 080151 0040 0041 0042 0043 30 DNA GenomicPrep CeLLs and Tissue DNA Iso lat ion Kit 7 DNA I Lactobac Lus brevis ATCC 367 DNA Lactobac illi MRS broth BD 28130 30 DNA GenomicPrep CeLLs and Tissue DNA Iso lat ion Kit BAA SRE DNAS BK LE Pseudomonas put ida KT2440 ATCC 47054 5M DNA LB tryptone 10 g yeast ext ract 5 g NaCL5g 1 L 37 DNA GenomicPrep CeLLs and Tissue DNA Iso lat ion Kit
68. 2012 0909 Al UUNIN OUR NINUN UTIN OURO OOR TA OR DD INNT 12 2 a E i Z AACA EY IOM RL A A A AK EWI NMA TMH 10 43 WO 2012 090978 A 1 2012 7 A 5 A 05 07 2012 WEPOIPCT 6 81 BEB C12N 1 21 2006 01 C12N 15 09 2006 01 a J Tj BE AE AG AL AM AO AT AU AZ BA C12P 13 00 2006 01 C12R 1 15 2006 01 BB BG BH BR BW BY BZ CA CH CL CN CO lenges alates CR CU CZ DE DK DM DO DZ EC EE EG ES Fl 21 GB GD GE GH GM GT HN HR HU ID YL IN IS 22 201 1 12 27 27 12 201 1 JP KE KG KM KN KP KR KZ LA LC LK LR LS Ee LT LU LY MA MD ME MG MK MN MW MX 25 MY MZ NA NG NI NO NZ OM PE PG PH PL PT 6 QA RO RS RU RW SC SD SE SG SK SL SM ST SV SY TH TJ TM TN TR TT TZ UA UG US UZ 30 3 VC VN ZA ZM ZW 2010 293972 2010 12 A 28 28 12 2010 JP oy 71 m D FW FE aRIPO BW GH GM KE LR LS MW
69. 78 21 PCT JP2011 080151 unit L RARAkKTi0oul 15 3 A A guournaL of MoLecu Lar Biology 53 159 1970 JM1o9 L 5s0 gm LB a KY 0 5 0 5 1 5 BR CBA LE DNA Ballui Z PHse298 2 7 kbp DNA pCASE o ri 1 4 kb DNA pCASE 1 ori pcRB22 005 1 3cRB207 R 3 gLyce ra Ldehyde 3 phosphat e dehyd rogenase g apA PgapA
70. CCTCTAAAGATTGTAGG 3 15 a5 b 5 Ndei pA gapA rrnBT1T2 PcRB207 PcR eeneAmp PCR System 9700 TakaRa LA Taq WO 2012 090978 25 PCT JP2011 080151 0061 0062 TaKaRa LA Taq 5 units I 0 5 lox LA PCR Buffer 11 Mg2 free 5 25nWM MgCl 5 dNTP Mixture 2 5mM each 8 DNA 5 DNA i1ffg 2 lt 0 5 m eR Bk 2 54l 50 PcCR pCRB207 a 9 b 9 Dies PCR 94 C 60 52 C 60 72 C 307 1 30 10
71. GATGGAC 3 4 a1 b 1 BggLll PHse298 a 2 5 AT AGATCT AGGTTTCCCGACTGGAAAG 3 5 b 2 5 AT AGATCT CGTGCCAGCTGCATTAATGA 3 6 a2 b 2 BgLll fk DNA k Japan CoLLection of Microorgan isms JCM WO 2012 090978 20 PCT JP2011 080151 0048 0049 0050 JcM12072 DNA PHse298 PcR eeneAmp PCR System 9700 TakaRa LA Tag TaKaRa LA Taq 5 units MI 0 541 10X LA PCRW Buffer 11 Mg2 free 5 25mM MgCl 5 dNTP Mixture 2 5mM each 8 fk DNA 5ul DNA 1 g 2 0 5 1 MM 25 5 50
72. ICA INC 28 Apri 1 2011 28 04 2011 a whole art icle page 19 line 9 fig 2 amp US 2011 0097767 Al Form PCT ISA 2 10 continuation of second sheet July 2009 INTERNATIONAL SEARCH REPORT International application No PCT JP2 011 080151 Conti nuat ion of B FIELDS SEARCHED Elect roni c data base consul ted duri ng the inte rnat ional search name of data base and where practi cabl e search terms used REGI STRY STN Form PCT ISA 210 extra sheet July 2009 A IPC IntCI Cc12N17 2K2006 01 i B PC Int Cl C12N1 21 C12P13 00 C12N15709 C12R1 15 CA BIOSIS MEDLINE WPIDS STN JSTPlus JMEDPlus JST7580 JDreaml REGISTRY STN UniProt GeneSeq SwissProt PIR GeneSeq c N H et al Sraegraat is 195 1 p Enzymat C12P13 00 2006 01 i C12N15 09 2006 01 n
73. L LB oy 0 s 0 5 1 5 BK WO 2012 090978 24 PCT JP2011 080151 0058 0059 0060 DNA PcRB206 4 7 kb DNA 0 4 kb DNA rrnBT1T2 pcRB207 PocRB2og lt R gapA gLyce raLdehyde 3 phosph ate dehyd rogenase A CCAR PgapA DNA PcR pcRB207 13 pCRB207 PCRB207 a 5 5 CTCT CATATG CTGTTTTGGCGGATGAGAG 3 14 b 5 5 CTCT CATATG GTGTCT
74. Tcc 367 DDMA American Type C uLture CoLLection ATCC ATcc 4705 4 DUMA J K 12 MeG1655 DIA NITE BioLogicaL Resou rce Center NBRC NBRC 10217 DNA NITE Biological Resou rce Center NBRC KWA NBRc 13535 DNA PcR GeneAmp PCR Sys tem 9700 R TakaRa LA Tag WO 2012 090978 30 PCT JP2011 080151 0078 TaKaRa LA Taq 5 units 1 0 5 10X LA PCR Buffer 11 Mg free 5 25mM MgC l 5 fi dNTP Mixture 2 5mM each 8 fi k DA 5f DNA 1 g 2
75. and the ana Lys is of its genet ic informat ion Nuc Leic Acids Symp Ser 16 265 267 1 985 ATCC13058 pHM1519 Miw a K et aL Crypt ic DLasmids in glutam ic acid produc ing bacter ia A gric Bio Chem 48 2901 2903 1984 pCRY30 Kurusu Y et aL Ident if icat ion of DLasmid part ition funct ion in corynef orm bacter i a App L Environ Microb iol 57 759 764 1991 A T250 pcCG4 57 1 83799 Katsumata R et aL Protop last t ransformat ion of g Lutamate produc ing bacter ia With pLasmid DNA J Bacter io 159 306 31 1 1984 J pAG1 pAG3 pAG14 DAG50 B HA 62 1 66890 pEKO pEC5 pEKExI Eikmanns B J et aL A fam iLy of Corynebacter ium g Lutam icum Escher ichia coLi shutt Le ve ctors for cLoning cont rol Led gene express ion and promoter prob ing Gene 102 93 98 1991 0024 R 3 A gapA PgapA mh P mdh
76. here appropriate of the relevant passages Relevant to claim No Masayuki INOUE Synthe sis of Bio Ani ine Reducti on of Ni troben zene by Immobi i zed Baker s Yeast Chemi cal Educati on 1991 vol 39 no 5 page s 572 to 573 IA Stot z Agathe and Linde r Patri ck The ADE2 gene from Sacchar omyce s cerevi si ae sequence and new vecto rs Gene 1990 Vol 95 p 91 98 Tiedeman A A et al Nucleotide sequence analys is of the purEK operon encoding 5 pho sphoribo syl 5 ami noimi dazole carboxyla se of Escheri chi a coli K 12 Journal of Bacte ri ology 1989 Vol 171 No 1 p 205 212 Kahng H Y et al Characteri zation of strai n HY99 a novel mi croorgani sm capabl e of aerobi c and anaerobi c degradati on of ani line FEMS Mi crobi ology Letter s 2000 Vol 190 p 215 221 NELSON K E et al Complete genome sequence and comparative analys is of the metabo lI ical ly ver sati le Pseudomonas puti da KT2 440 Envi ronmental Mi crobi ol ogy 2002 Vol 4 No 12 p 799 808 MATSUI T et al Puri ficati on characteri zation and gene cloni ng of 4 hydroxybenz oate decarboxyl ase of Enterobacte cloacae P240 Archive s of Microbi ology Vol 186 2006 p 21 29 Lupa B et al Propertie s of the rever sibl e nonoxi dat ive vani l ate 4 hydroxybenz oate decarboxyla se from Baci Ilus subt ilis Canadian Journal of Mi crobio logy 2008 Vol 54 p 75 81 wo 2011 050326 Al GENOMAT
77. omyces cerevisiae Enterobac ter cloacae 2 4 16 DNA 19 DNA 22 DNA 25 DNA 28 DN A
78. particular relevance the principle or theory underlying tiie invention earlier application or patent but published on or after the international X document of particular relevance the claimed invention cannot be filing date considered novel or cannot beconsidered to involve an inventive document which may throw doubts on priority claim s or which is step when the document is taken alone cited to establish the publication date of another citation or other y P document of particular relevance the claimed invention cannot be special reason as specified considered to involve an inventive step when the document is document referring to an oral disclosure use exhibnion or other means combined with one or more other such documents such combination document published prior to the international filing date but later than being obvious to aperson skilled in the art the priority date claimed document member of the same patent family Date of the actual completion of the international search Date of mailing of the international search report 14 March 2012 14 03 12 27 March 2012 27 03 12 Name and mailing address of the ISA Authorized officer Japane se Patent Office Facsimile No Telephone No Form PCT ISA 210 second sheet July 2009 INTERNATIONAL SEARCH REPORT International application No PCT JP2 011 080151 C Continuation DOCUMENTS CONSIDERED TO BE RELEVANT Category Citation of document with indication w
79. uyo Shinan Koho 1922 1 996 Jitsuyo Shinan Toroku Koho 1996 2012 Kokai Jitsuyo Shinan Koho 1971 2012 Toroku Jitsuyo Shinan Koho 1994 2012 Electronic data base consulted during the international search name of data base and where practicable search terms used CA BI OS S MEDLINE WPI DS STN JST Plus JMEDPlus JST 7580 JDreaml l GenBank EMBL DDBJ GeneS eq Uni Prot GeneS eg SwissProt PIR S c DOCUMENTS CONSIDERED TOBE RELEVANT sess CONSIDERED TO BE RELEVANT Category Citation of document with indication where appropriate of the relevant passages Relevant to claim No S loane A Studie S metabol of p aminoben zoic aci d by ad ar Smegmat is Journal of Biol ogi cal Chemi stry Vol 193 1951 p 453 458 McCul lough W G et al Enzymati c Decarboxylati on of the Ami nobenz oate s Journal of the Ameri can Chemi cal Society 1957 Vol 79 p 628 630 JP 2008 274225 A Sumi tomo Rubber ndus trie S Ltd 13 November 2008 13 2008 example S 8 US 2008 0242823 Al 8 EP 1975240 Al amp DE 602008000176 D amp CN 101274996 A amp RU 2008111877 A Further documents are listed in the continuation of Box C L See patent family annex Special categories of cited documents T later document published after the international filing date or priority document defining the general state of the art which isnot considered date and not in conflict with the application but cited to understand to be of
Download Pdf Manuals
Related Search
Related Contents
USER MANUAL Areca ARC-1680ix-16 Samsung AM18A1E2 Manuel de l'utilisateur Graco 312797P User's Manual ds160 series servo and dsr/dsrf rack Webconnect Plants in SUNNY PORTAL - User Manual Benvenuti a bordo! - Brunswick Marine in EMEA Center Copyright © All rights reserved.
Failed to retrieve file