Home

pCold™ ProS2 DNA

image

Contents

1. v200908Da Woo o S a WCapux TaKaRa R DR
2. 3 1 New Jersey Code 3360 3361 3362 3363 3364 3365 3371 2 New Jersey Protein 5 Code 3371 3 QIAGEN His Tag Code 3360 3361 3362 3365 3371 4
3. pCold ProS2 DNA Code No 3371 Size 25 ug 0 5 OD Shipping at 20 C Stored at 20 C Lot No pCold ProS2 DNA tt Myxococcus xanthus Protein S N 2 Pro52 cs4 osp4 5 5 UTR translation enhancing element TEE His Pro52 multicloning site lac operator ProS2 MCS HRV 3C Protease Thrombin Factor Xa pCold ProS2
4. a license to use PRODUCTS for research purpose through purchase of PRODUCTS from TAKARA BIO its subsidiaries or its local distributors provided that PURCHASER shall enter into a prior separate agreement with TAKARA BIO for the transfer of DERIVATIVES to said third party NOTICE TO PURCHASER LIMITED LICENSE L13 pCold vectors This product is covered by the claims of U S Patent No 5 981 280 6 686 174 6 333 191 and their foreign counterpart patent claims assigned to the UMDNJ This product is covered by the claims of U S Patent No 6 479 260 6 897 042 and their foreign counterpart patent claims L16 His Tag Sequence This product is covered by the claims of U S Patent No 5 284 933 5 310 663 and their foreign counterpart patent claims Protein Purification Technology of His Tag used in some of pCold vectors is licensed from Hoffmann La Roche Inc Nutley NJ and or Hoffmann La Roche Ltd Basel Switzerland and is provided only for the use in resaerch Information about licenses for commercial use is available from QIAGEN GmbH Qiagen Strasse 1 D 40724 Hilden Germany L43 Protein S This product is the subject of the pending U S patent application and its foreign counterparts M9 pCold vectors This product is covered by the claims of U S Patent No 6 479 260 and its foreign counterpart patent claims Note This product is intended to be used for research purpose only They are not to be used for drug or diagnostic purpos
5. DNA 10 mM Tris HCl pH8 0 1 mM EDTA 8 5 025 bp OnE 1 Z covalently closed circular form RF 1 70 2 dideoxy 3 BIRER Madel Sach Koni Xhol BamHI EcoRI Hind Ill Salh Pstl Xbal 1 ORE op4 OF pCold ProS2 DNA pCold ProS2 DNA Vector map of pCold ProS2 DNA cspA 3 UTR Multicloning site Factor Xa site Thrombin site HRV 3C Protease site ProS2 Tag His Tag TEE G cspA PUTR lac operator cspA promoter pCold ProS2 DNA Z 5 025 bp gu ColE1 o 1 New Jersey QIAGEN 2
6. es nor are they in tended for human use They shall not to be used products as food cosmetics or utensils etc Takara products may not be resold or transfered modified for resale or transfer or used to manufacture commercial products without written approval from TAKARA BIO INC If you require licenses for other use please call at 81 77 543 7247 or contact from our website at www takara bio com Produced by TAKARA BIOTECHNOLOGY DALIAN CO LTD v200908Da 5 TAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAG TEE His Tag GCACACTTAATTATTAAGAGGTAATACACCATGAATCACAAAGTGCATCATCATCATCATCAC SD Met Asn His Lys Val His His His His His His ProS2 Tag 552 bp ProS2 Tag 184 aa pCold PrS2 F2 primer HRV 3C Protease GTCTCCAGCATCCGCGTCATCTCCGTGCCGGTGCAGCCGAGG Val Ser Ser Ile Arg Val lle Ser Val Pro Val Gln Pro Arg pCold PrS2 F1 primer Thrombin Factor Xa TCCGCGGGTCTGGAAGTTCTGTTCCAGGGGCCCTCCGCGGGTCTGGTGCCACGCGGTAGTGGTGGTATCGAAGGTAGG Ser Ala Gly Leu Glu Val Leu Phe Gin ey Pro Ser Ala Gly Leu Val Nde Sac Kpn Xhol BamHI EcoRI Hindill Sall Pro Arg sy Ser Gly Gly lle Glu Gly Arg 4 Pst Xba CATATG GAGCTC GGTACC CTCGAG GGATCC GAATTC AAGCTT GTCGAC CTGCAG TCTAGA TAGGTAATCTCTGCT His Met Glu Leu Gly Thr Leu Glu Gly Ser Glu Phe Lys Leu Val Asp Leu Gin Ser Arg End pCold R primer TAAAAGCACAGAATCTAAGATCCCTGCCATTTGGCGGGGATTTTTTTATTTGTTTTCAGGAAATAAATAATCGAT 3 transcription terminator
7. old Shock expression vector C pCold ProS2 DNA Code No 3371 Size 25 ug 0 5 OD Shipping at 20 Stored at 20 C Lot No Concentration 0 5 ug ul Volume ul Regarding protocol please refer to the product manual supplied with pCold ProS2 DNA Description Cold shock expression vector pCold ProS2 DNA is a fusion expression vector utilizing a promoter derived from cspA gene which is one of the cold shock protein and fused tandem N terminal domain of Protein S which is a kind of Myxococcus xanthus genes as a solubility promot ing tag ProS2 At the downstream of the cspA promoter ac operator is inserted so that the expression is strictly controlled In addition 5 un translated region 5 UTR translation enhancing element TEE His Tag sequence ProS2 sequence and multicloning site MCS are located at the downstream of the cspA promoter Between ProS2 sequence and MCS HRV 3C Protease Thrombin and Fac tor Xa cleavage sites are inserted so that the fusion tag can be removed from the fusion expression protein As this product utilizes the promoter drived from coli most E coli strains can be utilized as an expression host 10 mM Tris HCl pH8 0 1 mM EDTA Length 5 025 bp Form Purity 1 Contains over 70 double stranded covalently closed circular DNA RF I 2 Confirmed to maintain cloning sites by dideoxy sequencing method 3 Shown to be cleaved at a single site b
8. y restriction enzymes Nde Sac Kpn Xho BamH EcoR Hind Ill Sal Pst and Xba 1 Applications This is a vector for protein expression utilizing the promoter of cold shock gene cspA Vector map See the reverse side Cloning site of pCold ProS2 DNA Note The use of this product is limited for research purposes It must not be used for clinical purpose or for in vitro diagnosis Users must contact TAKARA when they plan to use this product for pur poses other than research use 1 PRODUCTS are for research or laboratory use only PURCHASER un derstands and agrees that PRODUCTS shall not be administered to humans or animals and shall not be used for pharmaceutical in vitro diagnostic or any commercial purposes other than internal research 2 PURCHASER shall not modify pCold Vector DNA sequences located between and including the CspA 3 UTR and CspA Promoter The adja cent multicloning site MCS is except from this restriction 3 PURCHASER shall not utilize any partial sequences from PRODUCTS for the purpose of new plasmid construction using the Cold Shock Expression System 4 PURCHASER shall not transfer or sell copies of PRODUCTS compo nents of PRODUCTS derivatives of PRODUCTS and or products ob tained through the use of PRODUCTS collectively DERIVATIVES to any third parties Notwithstanding foregoing PURCHASER may trans fer DERIVATIVES solely to a third party which has already been granted

Download Pdf Manuals

image

Related Search

Related Contents

decembre - Journal Larochelle  SuperFusion 3  Samsung 40" LED  

Copyright © All rights reserved.
Failed to retrieve file