Home

GenomiPhi完全テクニカルハンドブック

image

Contents

1. 0000000 OOOO GenomiPhid D D D pogo 0000000000000 0000000000000000000000000 popa 0000000000000 0000000000000000000000000 popa 0000000000000 0000000000000000000000000 podd000000000000000000000000000000000000M00 pod 000000000000 000000000000 0000000000000 200000000 000000 000000000000000000 00000000000 GenomiPhi 0000 11 0000 0 10 00 1ng DNAD D 1 3 Mbo Mycoplasma penetrans U D GenomiPhi 0 ng 30 f90 00000000 penetrans 1 D 1 p90 1071 O GenomiPhiJ 000000000000000000900 9 0D00000000000000000000000090 M penetrans 00000000000 5 140 0 5 220 poo 000010
2. 3D 0 0 9 000 30 qQ 0000000000000000 000000 GCOOOOAT Phi29 DNA polymerase 000000000 RNAQGOOG 6 0000 A 0000 0000 DG 000 0000000000 6 8 0 110000000000 0000000008 BACOOOO0000000000 A 00000000 TempliPhi Large Construct DNA Amplification Kiti 02000 25 6400 800 000000000 A LJ E rJ E O El Oooo O e LJ EF E EIE 0 0 0 O 0000 D GenomiPhi
3. 1 00000000001 lo 0 6 800000000000000000000DNADO 2 DNA 000008 0999000000880 3 000000000 88 00000000000000008 4 00000000 DNA0000000C00000000000000000 multiplex PCRO 0000000000000000 00DNApO 00000000000 111 1 1 1 1 1 Doo DNA D Doo DNAQODO uuu ID 001 ng DNAD OOO 111 0 DNA 00000 O GenomiP hi DNA Amplification Kit 25 6600 01 1 Typhoon DO 000000000000 O Tag DNA Polymerase 27 0798 04 O dNTPs O 100 mM 27 2035 01 O 100 Base Pair Ladder 27 4007 01 O KiloBase DNA Marker 27 4004 01 mM KOH 100 mM DTT 10 mM EDTA 400 1111 400 mM HCI 600 mM Tris HCI pHO 6 1 M
4. 0 0 0 DO 00000 Thermoplasma volcanium 000000000000 OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO DN 000PCRO0000000000 0O000000000000000 L3 000000000007 volcanium DNA uut Thermoplasma 9 0 0 00 0000000000000 0 60 C 0 O Thermoplasma volcaniumg 0000000 000000000000 GenomiPhiQ DNA O 0000000000000003840000000090 0000000000 TempliPhi DNA Amplification Kit A DD 5Hpoo00000000007T volcanium 95 ul O 10 mM Tris pH 8000000000 20 95 q 5000000000000000 30 0000000000000000 0 debrip B DNA 0000 Phi29 DNA polymerase g00000000000000000 10 00004A 030000000000001 M000 00000 9 ulr Sample buffer 00000 20 951 030 000000000040 000000
5. PEP utl Stretococcus DO 5 9 GenomiPhi U 0 O 0 0 O 0000 DU 0000 0000 000000 O GenomiPhi DNA Amplification Kit 25 6600 01 O TempliPhi 10000 DNA Amplification Kit 25 6400 01 O dNTPs 100 mM 27 2035 01 O 100 Base Pair Ladder 27 4007 01 O KiloBase DNA Marker 27 4004 01 o00000 US75817 O KTA explorer 0 18 1112 41 MegaBACE 4000 DNA Analysis System DYEnamic ET Terminator C ycle Sequencing Kit US81095 O Pfu DNA polymerase and 10x Reaction buffer for Pfu D Stratagene 1 6x loading dye Promegar 2 000000000000 IID New England Biolabs O 1296 Tris Glycine precast gel Novex Invitrogen Thermoplasma volcanium culture ATCC Operonr 10 CGGGGTACCGTGAGT GAAACAAAAAAATTTC 3 5 20000020 Operon 5 TGCTCTAGAGCATTATATATCAATTTCTAGC 3
6. 5 PCRO OO GeneAmp 24000 BUUUUUU 1 Uu Bu 0 2 cm O 0 5 cm 2 meg 0000 0 5 cmx 0 5 cmoo DO 0 5 cmx 0 5 cm T O 00 0 5 cmx 0 5 cm 20 DNAD O ISOHAIR NIPPON GENEQO O 0000000 D PCRO O0 GeneAmp 9700 0000000 ABI PRISM 310 Genetic Analyzer 80 O 0 DO ss4947490 s55013903 s56658727 554974799 552924060 554974729 554019224 5549749150 1 0 O O DABI PRISM SNaPshot Multiplex Kit Shrimp Alkaline Phosphatase Exonuclease I GeneScan 120 LIZ size standard 29100 2 10 STRO OO 30 0 0 DNAD O Polymerase 1110 00 000000 1 DNAD GenomiPhi DNA Amplification Kit 00 0DNAD B00000DN4A 0000000100 000 O STRO O PCRO O DNA 4 yf 40 ng T PCR Reaction Mix AmpliTaq Gold D Profiler Primers Set 0 06 5 0 00095 0 0 0 0 94 Q 190000059 q 100 72 Q 1000000284 0000009090
7. 8 000000 O GenomiP hi DNA Amplification Kit 1 Typhoong 000000000000 O Tag DNA Polymerase 25 6600 01 27 0798 04 O dNTPs 100 mM 27 2035 01 Q 100 Base Pair Ladder 27 4007 01 O KiloBase DNA Marker 27 4004 01 000000000 Becton Dickinson amp Company p PBSO D 0 D O QlAamp DNA Blood Mini Kit Qiagen mM KOH 100 mM DTT 10 mM EDTA 400 111111 400 mM HCI 600 mM Tris HCI pHO 6 1 M HCI 4 mig 1 M Tris HCIQ pH7 5 6 mlt 000000 a0g000000 o00000000000E000 00 EP300000 PTGER30 000000 SYBR Gold nucleic acid gel stain Molecular P robes 00000 0000 000 DO 00 DO TED OO OO 0 1 El 000 000 000 DNA 11 0 10 20W0 1 5 mI D D 40 ult 1x PBSpobg000000 000000000000 00000000 uan go000800090000000000000Phi29 DNA polymerase 0 000 000000 60
8. Puregene saltingout 0000000000000 OOingoADPNAOOO 4 5 d D D PEP 0000640000000 GenomiPhig 7 000100 00000000000000000 00000 DO0000000000000 000 GenomiPhig 0 D O PEPO GenomiPhif 0 11 1 000000000 800002000000000 DNADO 10 00000 000000000000 00000000000000000 PEPO GenomiPhig O D Streptococcus DN PicoGreen O O 0 D real time 0 0000000000 1 DNA 14n9 0000000000 00 0 00 0 0 00 00 0000 880 40001 000000000 0 00000000000000000 0 0 0 D00000PEP000007541000000000 cytochrome bf real time 80 000000
9. 000000 O GenomiP hi DNA Amplification Kit 25 6600 01 1 Typhoon OOOO0000000000 O dNTPs 100 mM 27 2035 01 O Tag DNA Polymerase 27 0798 04 O KiloBase DNA Marker 27 4004 01 O 903 Specimen Collection Paper O Schleicher amp Schuell Bioscience O 506006 Stix Card D Schleicher amp Schuell Bioscience FTA Card Whaan Bioscience O TA Purification Reagent Whaan Bioscience Chelex 100 Chelating lon Exchange Resin BioRad Laboratories O QlAamp DNA Blood Mini Kit Qiagen mM KOH 100 mM DTT 10 mM EDTA 400 111111 400 mM 600 mM Tris HCIO pH 0 60 1 M 4 mig 1M Tris HCIO pH 7 50 6 m 000000 oo0000000 SYBR Gold nucleic acid gel stain Molecular P robes O PicoGreen dsDNA Quantitation Kit Molecular Probes 3 PTGER30 000000 A DNAJ O Guthrie Card DNA 10 Guthrie Card 0000000000000000 0 0 0 3 1 3 mp 000000000090 20 3 35 300000000
10. DTT 10 mM EDTA 4 5 reaction mx 0000001000009 Reaction bufferg 1 uig Enzyme mixg O 00000 Reaction buffer Enzyme mix Phi29 DNA polymerase reaction mixg 0000000 60 30 C 160 180000 OOOO hi29 DNA polymeras GenomiPhi 30 C 169 180 0 00 0 00000000000 00000000000 00000000000 oo oo 000000010 pig reaction 00 004000000080800000000000 reaction mix 0 0 700000000000 65 q 1000000000004 000000 000000 00000000 Phi29 DNA polymerase D Phi29 DNA polymerase 0000000 Se o sS000DNAQO000000000000000004000 20q000000000 Du
11. 0000 11 F oooooooooooooooon 20000000 MBOUUUUOUU ABI GeneAmp PCR System 9700 ABI GeneAmp PCR System9700 Hoechist 33258 0 OO 00 D D D F 4010 oo0000 2000000 0 0 60 CTABO ood O O 00 Juncus effusus L 0040 DNAD 5 ngo O SsSsRro 0000000090 OC O00 000000000050 ABI GeneAmp PCR sxkpp0000400000000000000000 System 97000 00000300 18000000000000 Pca 3 Ethidium bromide 0000 20 plg TE Buffer 10 mM 5 4 EDTAOO 20 000000 OOOO Hoechist332589 0000000000000000 ng F 40100 DNAJ 0000 A Multiple displacement amplification MDAJO 0 0000 0 DNA 8188011198 GR A u o MDA 194 5 2 83 78 PCRO DNA 300 60 ng 8000000 1300 2700 3 0 8000 000 0000000000 000000000000 B 3 186 3 0 84
12. Millipore M ultiScree 384 5508 0 FA 0 6 DO O M egaBACE 4000 DNA Analysis System egaBACE Genetic JDDUDD5 7 Profiler v 2 00 0000000 LARA A 1 au T ab kr ixi uum 5 Y 1 1 al t L 33 5 15 0 0 D DNAD GenomiPhi DNAD 0 5811110100 00 0 0 DNAD GenomiPhig OO BJ STRO OOOO0000000000 STRO O MegaBACE4000 DNA Analysis System MegaBACE Genetic Profiler v2 0 000 0 5 7 MegaBACE 4000 DNA Analysis System 000 5 80 OOO Component Volume ul Genotyping loading solution 7 75 MegaBACE ET400 R Size Standard 0 25 Desalted STR loci sample 2 00 Finalinecionvoume 1000 MegaBACE 00000000003 kvg 45000 000000000 10kvg 700000000 00000 OU D0STROO0 0000000000000 4000 GenomiPhid enomiPhi 0 0 DNAJ Bu gt QQ ood DNA 94 0000000 enomiPhi 0 O O DNA 9496
13. P3DDODDOPTGER3000000000000 3 OO 6 D D DO DE DO oO 0000000000 30050 00109 amp GenomiPhil 0 O 5 PCROOOOOO0DNA 5 20 1 PrGER3OOOOOOOOOOOOOOOOOOOO po0po0000000000000DNA 10 ng O OOO 5 2 PCR 0 0 000 00 00000 Components Volume ul 10x PCR buffer 2 9 dNTP mix 2 5 mM ea 2 0 Primer forward 20 uM 1 0 Primer reverse 20 uM 1 0 Taq Polymerase 5 U ul 0 25 DNA PBS or water water to 25 O iE AT i gt a ES ES gt 0 N 1 O 1 OOOO gt E G OOH EE a 95 C 31 95 C 30 56 C 30 72 C 450 Ez x 0 72 C 20 heparin EDTA citrate lane M 12345 67 8 9 1011 12 131415 16 17 18 1920 21 22 23 24 25 26 27 2829 30 ul lysate l5 151515152425 15 1 5 1 51025 43 5 1 5 151515 dilution 6 3 2 15 12 6 3 2 15 12 6 3 2 15 12 ETEF 8 Ju RRA 053 000000000 GenomiPhiQ 0 0 O 0 DNAD 0 8 00000 00010100 000110200
14. 0 3 6 00 5 96 30 TEC O00 111 1 1 1 1 1 1 1 0001 10110 L ng 0 6 1 00000 1 ga Ep BE BEEBE gE EEE AB SANE ENE Phi29 DNA polymerase posbsppo000090800000000000000000 GenomiPhip D D O D O 0 0 DU Du 850 0000000 D D D D D L3 0 O 0 00000000001 ut 0 000000 Ex ES E Gy E E EJ Ei 00085000 o 3 3
15. 0 C4DNAQ O O D leop 0 0 D D D 0 5 16 GenomiPhig 0 DNAQ 0 5 17 D D loop 000000 200000000000 GenomiPhig 0 0 0 DNA 0 0 000000000000 DNAD den 28280000000 0000000 0000000000000 oopoApa capa 000 000002000000 0 5 12 0 DNAD 0 0 O 0000 PEPO GenomiPhig O Template GenomiPhi PEP Fold Amplification neat products products GPHi BER C 3 cMYC not detected 2 0 ng 2 0 ng _ CytoB 1 50E 04 3 98E 04 4 82E 06 2 65 321 Strep 0 0 0 C 4 cMYC 0 02 ng not detected 3 5 ng 175 CytoB 1 12E 03 8 12E 04 6 40E 06 72 5 5 714 Strep 0 0 0 WB cMYC 0 31 ng 2 0 ng 10 0 ng 6 45 322 CytoB 1 40E 03 5 72E 06 2 00E 07 4 085 14 286 Strep 0 0 0 20 0 00 DNA 00000 683 4000 O00 1000 PEPO GenomiPhig O O O O O cmyc cytochrome b0 OOO Streptococcus 16S 0000000000 PCR00000000 000 cMYCH CytoB Strep 00 U GenomiPhid J 00 DNAD OOO PEPOOO 0 GenomiPhiQ OOO OU DNA SNPO DNAD O podd0000000 0000000000 U GenomiPhiQ 4000000
16. 000000 D000000000000000000000000000000000090 uniplex multiplex 6 Pero OO OCD 000000 000000000000 000000000000 99 DO 000000 000000000000 00 0100 0000000000 00000 00000 2 3 Control DNA 000000000000 nguloo 2040000000 10 Sample buffed 400000000022 9 po00080000000001 10 ngi DUBapuganueanpupuauugagagnnpapapuudgagdgnpn3aowqiienpnp4 kan 10 Control DNA 1 ul 10 ng O Sample buffer D D 20 24 0 H GenomiPhi ooo 000000000000 00 B PicoGreen dsDNA Quantification Kit M olecular Probes O O PicoGrenQ 0 O 0200000000 Picocreng OOOOO0000000000000000000000000 000000000000 000D0NAg 000000000000 0000000000090 ooo PicoG reen 0 O O x DNAD 0 0 0 0 0000 0 0 000000 000 0 000000 000000000000 0000000000 0000000000000
17. PCRO000000000000 5 3 Components Volume ul 10x PCR buffer 2 5 dNTP mix 2 5 mMg 2 0 Primer forward 20 uM 1 0 Primer reverse 20 uM 1 0 Tag Polymerase 5 U 0 25 DNA PBS and water x Water to 25 95 C 30 95 C 30 iu 56 C 30 x40 72 C 450 i 72 C 20 5 ul SYBR God 000002600000 po000800000800000000000Typhoong paegg0000000000000052 nmi 000 D D D B 5 50 5 purified 0000 fe Citrate EDTA heparin blankcard 5 BE 1 000 2 3 5 6 7 8 17 18 19 ul lysate 10 02 10 02 10 0 2 1 0 0 2 Kilobase DNA Marker 5 4 lt 5 purified A 8 tei m 0000 5 Citrate EDTA heparin blank card B Q 8 5 5 ooo M 12 34 5 6 7 8 9 10 11 12 13 M 15 16 17 18 19 20 21 ul lysate 10 02 10 02 10 02 10 02 10 02 1 0 02 E 2 10 02 r k SS ee E E mum alll 05 5 0 00 000000 PTGER30 0000000 PCR lu 00 oo D 60 GenomiPhig 9000044900 0 000 00 Cad 0 0 0 2 ug Blood 8 0 0 0 0 0 uu O 5 6 Guthrie Card 903 Specimen Collection Paper GenomiPhi DNAD 97 00000000000 1 ul D O 0 2 ul Blood Ca
18. 1 11 1 11 111111 1 1 1 00000000 1 IU 1 200 po gg ogg 000000 00000000000 4 1111111110 E Co 1 4 E 1 1 4 Er 1 1 000000000000 TEL 339 00000000000 FAX 03 5331 9370 e mail Tech JPOge com Copyright 2004 GE Healthcare 00000000 GE HealthcaregOOOOOOOOOOOOOOOO O00 GE Healthcare 000000000000 UD 1 1 GenomiPhi GenomiPhi DNA Amplification Kit O GenomiPhin GenomiPhig O Phi29 polymerase 00 0 0 0 11 0000000 000 0000 0160 1800000000000000000DN4Ap0000000 DNA
19. A A E 53 go 000000000000 0000000 UD 81100 6666666666666666666568 0 DNA 6 0000 0 e 0 0 0 0 000000 0009000000 SNPE O 6 ceromiphin 00 000 YA o0000000000000000 Fp000000 11 1 1 PCRO O GeneAmp 9600 1 000000 PCR O O ABI PRISM 9700HT m 0 TaqMan RNase P Control Reagent 0 TaqMan Universal PCR Master Mix 000 DNA 1 mf 1 ng00 Sample Buffer 9 mig OOO Huu c guun DYEnamic ET Terminator Cycle Sequencing Kit OOO0000 95 300000000000 3 SNPs analysis 000 ABI PRISM 9700HT Reaction Buffer 9 mi Enzyme Mix 1 0000000 E Wa Products mulu 300 1800000000000 000000 PCRO 0 0 O DNA 1 mig RNase PO D D D primer amp probe Mix 0 5 mlQTaqMan 65 10000000000000000000 v O O HLA A HLA B O og O 2 Kong PERO DDD DDD aaa da ada Sample Initial DNA ng Final DNA ng OOOOONAngly OOOOOO000000000 DOP PCRO I PEPO
20. 6 100 0 0 0 qQ 000000000000000000000000 000030 Oooo oo Oooo oo 000000000000 00 0 0 09080000 08 OOO004 Q000000000000000000 20 0 0 70 DO 00 0000000000 6 8 65 100 0000000000 000000000000 000 00000 A 70 9000000000 80 9 85 900000000000000 0004 900000000 A p00000 GenomiPhi Enzyme mix Reaction buffer O0 0 0 0 0 000 0 00 0 00 Control A D DD L3 L3 000000 O D DU 001 O Control DNA 10 ngu 0000000000 0000 Phi29 DNA polymerase
21. ABI PRISM 310 Genetic Analyzer 0 0 0 0 0 O000 15 kvg 60 3000000000 00000000000 GeneScan Software Allelic Ladders 00 00000000 zur SNPs 0 0 STRO O AmpFISTR Profiler PCR Amplification Kit GeneScan ROX 350 standard 8r 0000 SNPs O SNPs 1 01 00000 0 PCROOOOO0000 DNAD OOOO dNTP Shrimp Alkalin Phosphatase Exonuclease 000000 OOO PCR 5 003000000 00004000 O O ddNTPO SnaPshot Multip 6 00 0 0 0 0 0 0 ABI PRISM Geneti AnalyerQOOOCOOOO0000000000000000 11000000000PCrO 0 PCRO D 0 00 0 DNA10 0 0 0 0 D 1x PCR Gold Buffer 0 2 mM dNTP Mix 10 pmol Primers 0 125 unit AmpliTaq Gold Polymerase Y 002540 95 Sq 100000 94 1 000000 65 300000000000 72 00 0003500000000 120000000 n 00 N 0 oO D 50 50 og 60 C 300 000 250 og u ABI PRISM 310 Genetic Analyzer 15 kvg 60 Q 250000 og og og C3 C3 OO OO og
22. 000000 0000000 GE imagination at work 9 Contents e e e X DE cra 5 1 1 GenomliPhi 5 Nu hn ho A a 6 zc RUN 6 PPP 6 P 1 1 O 7 FCR 7 22 GenomiPhi enne 7 2 33 Control DNADOD0000000000 Loser cito 9 9 25 NA ccce m ama oe irt boo Rot 11 Se 100 OSA 12 4 1 1111 1 rn a 16 5 J EPP E DJ D E DER T 8 9 8 8988 19 EX THP IEEE 19 Scott n m t b E E I EL E Qasa 21 5 3 Blood Card 0 CET 0000 0 rni 24 54 DODNAD DO POR daras alla 27 55 multiplex PCRQO OO OOOO DNAQ GO aan 31 5 6 GeneChip HuSN P Mapping Assay GenomiPhig een 34 57 GenomiPhi rte 37 58 DNA 8 0 0 Phi29 DNA polymerase 0 ee 39 5 9 GenomiPhig DNA 00 BEBE E DET HIP DJ ET EJ D EJ s 43 5100 0m 0m0 EROR A 46 1 ai T 48 000 0 1
23. OOO0 20 q 0000000 u gu D D 4D 7 un NA PicoGreenr O DNAD O 000000 000000000000 B GenomiPhi DNA real time PCR 10 0 0 0 0 GenomiPhig DDNADOD DNAD0 00213 1 O DNA 00000 OO 100000000213pm0 0000000 20 00000000GenomiPhiDODNADODO 0 D D 3620 36 20 3 620 0 3620 0 0362 ng 0500000000 DNAQ OOO real time PCRO 1000 0000 107 107 100 1001000000000 3 05 40 0000000 00PcRO00000000 6 40 ABI PRISM 77000 000 79000 00 5400000 D O real timePCRO 000090 0 5 4 real time 0 000000000090 Components Stock concentration Volume ul Eclipse Hybridization Buffer 10x 2 5 dNTPs mix 20 mM 0 5 JumpStart Tag polymerase 2 5 units pl 0 4 primer mix 20x 1 25 MGB Eclipse Probe 20x 1 25 water N A 2 1 DNA template N A 17 Total volume 25 oo 95 C 3 4 95 C 30 56 C 30 x 40 72 C 45 4 7296 2 OU 7200000008 000000000000090 0000550000000000000000090 O MGB Probe Epoch Biosciences Y 1 0 000 OOO00000 real time OO005 705 8000000000000000 Threshold Cycle alueg 1110 000 00000 08000000 OOOG000000
24. T TET Ww ug lt gt 5 5 o opot e oe hoe Soros See e e 1 x a ant 8 YA pe xS 0 NE ood 52 ras AO Po 0 200000 400000 600000 800000 1000000 1200000 1400000 1600000 2000 k MESA 0 gt 1 0 Genome position Q 5 18 GenomiPhig 0 11110000000000000000 0001305007 0 0 0 00 000000000090 00007 volcanium O0 D D D U ill 81 6 45 95 0 00 0 0000 758 C 450 O gt 4500 95 72 C 1200 0 0 35000000000000 72 40 10 D00000000000PCRO00200000000 0000000090 5 190 lt lt H gH BguBgHHTHHHEHH a 5 20 N KiloBase DNA Marker PCR product 762 bp w O 5 19 GenomiPhi 0 0 0 DNA 00090 T volcanium gang
25. 1 p000000000000000000015 mg 1 0000000000000 0000000 o 20 400 1xPBso 0000000000000000 400 30 400 40 B DNAQ 0000 0000000 Phi29 DNA polymerase ELE 000001 000000 DNAD 1n9 W0000000 rr 11 000000009 Sample 000000 000002 000000009 ul Sample 00000001000 1 9 930000000000000000000 20 0000 DNA OOOO 30 0000009 Reaction buffer 1 Ig Enzyme mixti dodo Reaction buffer Enzyme mix 000000 gado 00000000000 00000 add Cn On On On On oo oo oo oo BS 4j 30 160 180 000000000000 5 Phi29 DNA polymerase O0 0000000000 65 100 0000 20 ej l
26. 0 00 0 0 0000 0 0 0 0009 09 0 0 0 0 0000 00902300310000 000000008 GenomiPhi O 00000 5 10 DN O 00000000 000000000 d d B B B D D cmyc ugue D D DO cytochrome br 0 0 omiPhig 6000 0000000000000000 O GenomiPhid 00000 1 1 Streptococcus 0 01654 00000000000 111111 1 1 1 2 am ADORE S A real time PCR PEPO 5 0000 D Uu 000 CEPH cmyc 6 000 0 D D 0 Doo GenomiPhi DO 000000 DNA 00000 PCROOO 0205 1150 000000000090 0200000090 GenomiPhig 2 50 10 4000 0 0 0 0 PEP 0 4600 0 0 1 0000 0200000090 cytochrome 0 0 D O 0 26 0000 0 000000000000N 000000000000000 PEPO uu GenomiPhi 530
27. Phi29 DNA polymerase 000000000000000 reaction components dNTPs e e Phi29 DNA polymerase random hexamer primers GenomiPhiD 000 00 0 0 0 0 8 1 1 000 000080 D GenomiPhi DNA EX ES pj E E El OD co L3 0 DNA O 0 INR 1 GenomiPhi J O DNA 3 E Ono 01 ood uuu ood Oooo NA polymerase 0000 DNAD O L3 ee 08 du OOOO 0 oo 0 12 000000 0000 25 6600 02 25 6600 01 Sample buffer J 1x 09ml
28. D 00021930 0000000000 KiloBase DNA Marker DPCROO 5 0 0 SYBR Gold 0900002600 0 Typhoond 0000000000000000 526 nm 0000000000000 54m GenomiPhid OOOOS300000000000000000 PCRO0O0000000000000 05 4000010 lt gt T EST L I PCRO 0 GenomiPhip ODNAQ 3000000 po00000000000000000PTGER3DO 000000000328 bp OOO DOS400000PBS00000000000000 GenomiPhid DNADODODOPCRODODO 0 0 0 oO E 4 E E 000010 TAO DODODNADOD1 no 0000000 0 0 L3 C3 C3 L3 L3 C3 OOOO aq 1 E es uma
29. 30 200000000 15000 20 30 00 0 00 950 pod0000000000000000000000 44 5 Chelex 100 00000 00 0000000000000000 200 56 50 6 ej 15 000 20 3000000000000000 00000000 2 FTA Card DNA 10 FTA 0 3 1 5 mic 1000000000 20 000000000000000FTA Purification Reagent 10 00109 0 0 0 1 10 00000 100 30 4 O00 1000000000 5 100W0 g0000000000000000000 8 IsoCode Stix Card DNAD 10 00000000 IsoCode Stix Card 15 mg 000 000000000 20 500 WOOOOOO000 1020000050000 00000000 30 DO Card 90000 40 10040 0000000000000Cardgo 000 50 95 Q 200000000000 ei 0000000000000000 0000000 D D D 509 eor rm B DNA DNA polymerase 000000000000 10 0000000000000000 9 ul Sample buffer OOOOADOOOO1 Du 20 95 9130 LO 000 00 0
30. 000 og GeneScan Software she S E HI e Amplified products by GenomiPhi DNA concentration Amplified products by GenomiPhi protein concentration 4 Purified DNA by Centricon 0 DNA concentration Purified DNA by Centricon 100 protein concentration 00 00 GenomiPhi DNA Amplification 8 STROOD D 0 0 0 SNPs RU 8 80 LL L ad LI l Saliva GA AG C GA C ii x Blood stain G AG CT A CT Uu Semen stain 1 1 j Lol 11 1 1 I li Li 11 ia STRI DU 0 X 3 000 14 18 130 15 16 150 16 160 16 160 0351358 vWA 170 17 170 17 160 18 170 18 160 18 1 FGA 210 26 210 26 23 24 220 25 20 23 1 MAU ii Amelogenin XY XY XY THO1 7 10 7 10 e 9 7 9 60 7 il Li ji TPOX 80 8 8g 8 8j 11 80 10 80 8 DU CSFIPO 110 14 110 14 9 12 8 2 120 12 m 1 D5S818 119 11 110 11 110 14 119 13 100 10 wo D135317 120 14 120 14 om 9 8 2 80 10 1 l i D7S820 680 9 80 9 100 12 8 11 80 10 hi
31. LES qr EE ES E L3 p3 E3 E3 F3 EJ C3 C3 p wd p3 C3 C3 C3 0050050 aa EIL ESTEE ami I oo 2 0 2 2222522255 2 1 00 00000 Sample buffer Reaction buffer Enzyme mix 30 0000000 Control DNAQG J 000000 Reaction 0 0 00 000000000000 Phi29 DNA polymerase 1 9 Sample 0009590130 00 000000000090 000009 ul Reaction buffer 1 wif Enzyme mixg 0 3 0 0 160 18 0 0 0 OOOO DN ADOOOO00000000000000000000000000000000 2 2 GenomiPhig 0 DNAJ 000 GenomiPhig 4400000000000 l poo apo 000000000 00000000000000000100 popa d00 000000000000 00000000000000000000000 10 Sample buffer Reaction 800000000 20 Sample buffer 9 uig 0 5 30 0000000000 031 0 00000 0000000000 GenomiPhi 0 O 20 00000 GenomiPhig 00 000
32. 0 5 13 0 000000 UB Do GenomiPhi ATCC 5699 0000 400 Y 000000000000000 2030 Y 0 2030 Y 21400 0 0 000 Y GenomiPh 0 0 O B 1600 Total time 04060 0 16 50 0 05 20 000 000000000000 0 SDS PAGEQ 000 og 0001050 q 200000000000000 OOO20000000000000000 OOO3000000000000000000 OOO4000000000000000 11050000000000000000 110 60000000000000 0 07000000000800000 OOO8do00000000000000 000000000000 T volcanium 16 DD 000001 101 000000 000900 9 000000 DO 0000000000D0NA 900000000000 GenomiPhi D0NA 0000000016 000000000000 00000000000000000000090 185 Dado gg 0 og 0000 0000000000000 NCBI T volcanium 0000000000000 O O GenomiPhi 1 0000 0 GenomiPhi 1 00 DN 0 000000000000 OO OO OO O 6 oa x L3 L3 OOOO 5 10 0000000000000
33. 1111101000000000000008008007 0080000009000000000 260 0000000000 UY DNAU 2000 60 010000 0 0 0000 0000080 PicoGreen PicoGren NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 10 TE OO O00 PicoGreeng 20x TE buffeg 20000001x TE 000000000 20 Picocrenr 00 250000000 10000000 100 DO PicoGreng 000000 000000 DO PicoGreen 0000 PicoGreenl 0000000000000 3 duplicate buffe O0000000000000000000000 10 9 0 Du Standard DNA ng 10 ng ul DNAD ul 1x TE buffer 1 600 60 y 40 2 500 50 H 50 H 3 400 40 y 60 H 4 200 20 H 80 5 100 10 y 90 H 6 50 5 95 7 25 25 y 975 H 8 0 Ou 100 y 40 99 pln TE buffer 0000000 GenomiPhid 0o DNA
34. 4ngul 20 30ng DNA 12 6 0000PCRO 00000Twen20 00000000 OO BAD 5 60 p 5 6 PCR 00 000 Component Volume ul 10x Buffer II 1 25 25 mM MgCle 2 50 2 5 mM dNTP 2 50 AmpliTaq Gold DNA Polymerase 0 25 10x PCR additive 1 00 Wale 075 total 8 25 10 mM Tris pH 8 0 0 1 Tween 20 and 37 5 ug ml BSA D multiplex PCRO 0 O0 PCR DL B BHL H H EL OOOOOOOOO0000 7 000000 0000000 E 00000 GeneChip HuSNP Mapping Assayp 000000000 OU multiplex GenomiPhi O 51 30 pgg DNAD D DNAQ3000000000000000SNPQO000g DO0000000000000000 00 GenomiPhiQ 1200 120 100 1000 80 800 600 60 Calis Accuracy 400 40 200 20 0 gDNA GPhi from 10 pg GPhi from 1 ng GPhi from 100 ng clear calls il accuracy O 5 14 GeneChip HuSNP Mapping Assay SNPO CEPH D
35. O 0 D PTGER3 OO O GenomiPhi 0000 DNAD0O0000000000 DEO0000EP3000000PTGER3D D PCR t 6 PTGER gob 05 19 PCR 0 00 00 00 00000 Components Volume ul 10x PCR buffer 2 5 dNTP mix 0 2 5 mMg 2 0 Primer forward 20 M0 1 0 Primer reverse 20 Mp 1 0 Taq Polymeraser 5 U uig 0 25 DNA PBS or water water to 25 95 C 3 0 95 C 30 56 C 300 x 40 72 C 450 72 C 20 OPCROO 5HIDDDSYBR 60 0 2 00 Typhoond D 526 amplified DNA 100 Base Pair Ladder blank swab blank swab 2 ng purified DNA 20 ng gDNA 2 ng gDNA polyester M 1 2 3 4 5 6 7 8 9 lane ul lysate 500 bp 300 bp 100 bp 051 0 00 C 000 PTGERSE DO HO D PCRO D D 0000000 DO OO 00 000000 000000000000 O00 GenomiPhi OOPCROOOO 831000000000 8 bp
36. 4 mig 1M Tris HCl pA750 6 m 000000 O SYBR Gold nucleic acid gel stain Molecular P robes o00000000000E00000EP300000 PTGER30 000000 O PicoGreen dsDNA Quantitation Kit Molecular P robes U GenomiPhi SNP 6 000 0 0 000000 0 000000000000Phi29 DNA polymerase 00000000000 DNAT D 0 kbd OO Phi29 DNA polymerase 10 000000000000 GenomiPhigf OOOO000DNAQOOO OOOOOOOOOOOOOOOOO L3 L3 L3 C3 C3 C3 1100 001 1000000000 000 2 9 000000 Picogcreen 0 8 p000000000000000000 5 10
37. AD 0 GenomiPhi 1 2000 00 2 9000 0000 5 PEPO 0 8 0 0 0 0000000000 GenomiPhig 2 5000 0 0 D 5 10 CEPHO O O D O O PEPO GenomiPhi 0 O Template GenomiPhi PER Fold Amplification neat products products GPHi PEP CEPH 1 cMYC 1 8 ng 8 360 ng 596 ng 6 430 458 CytoB 1 10E 06 7 28E 08 6 05E 09 661 5 500 Strep 0 0 0 CEPH 2 cMYC 1 8 ng 6 300 ng 518 ng 4 500 398 CytoB 1 10E 06 6 62E 08 6 15E 09 601 5 590 Strep 0 0 0 CEPH 3 cMYC 1 8 ng 6 320 ng 658 ng 4 861 506 CytoB 1 6 5 84E 08 6 45E 09 530 5 863 Strep 0 0 0 PEP 0 GenomiPhig CEPH DNAQ 39 00 CEPH 1 2 39 00 0000000 real time PCR cmyc cytochrome b Streptococcus 00 00000 000000000000 0 5 11 0 0000 30000 0 4 5 60 0 0 PEPO O GenomiPhig 0 0 Template GenomiPhi RER Fold Amplification neat products products GPHi PEP po000 4 cMYC 0 418 ng 4 360 ng 236 ng 10 430 564 CytoB 4 36E 04 1 28E 08 1 13E 09 2 935 25 917 Strep 0 187 ng 867 ng 278 ng 4 636 1 486 5 cMYC 1 7 ng 4 336 ng 784 ng 2 550 461 CytoB 5 75E 05 3 06E 08 3 60E 09 532 6 260 Strep 0 409 ng 1 038 ng 531 ng 2 537 1 298 00000 cMYC 0 288 ng 2 724 ng 309 ng 9 458 1 073 CytoB 1 05E 05 2 92E 08 1 51E 09 2 181 14 381 Strep 0 318 ng 2 199 ng 925 ng 6 915 2 908 cmyc cytochrome b0 0 0 Streptococcus 16SQOOOOOO00000 PCROOOOO00000000
38. Rd 000010 n90000000DNAD OOOOOO00 O 00 GPhig 30ngg 0000000 ul O GenomiPhij DNAQ 0 GeneChip HuSNP Mapping Assay 000000000000 enomiPhi 0 0 0 SNPQ 5 7 GenomiPhi 0 0 STRO 0 0 Sh 0 0 UD 0 0 0 0 GenomiPhig DNA O 4000 STROOD O Phi 29 DNA polymerase 11 O 000000 O MegaBACE ET400 RJ 00000000 25 0205 01 O Tween 20 O GenomiP hi DNA Amplification Kit 25 6600 01 MegaBACE4000 DNA Analysis System O genotyping loading solution 0 1 v v Tween 200 O ABI PRISM Linkage Mapping Set v2 5 10 cM density D Applied Biosystems O MultiScreen384 SEQ 000000000 O Millipore O PicoGreen dsDNA Quantitation Kit Molecular P robes CEPHQQ000 DNA 1347 D Coriell Institute for Medical Research GenomiPhin ort Tandem Repeat STRO 010 800 5 5 O 0
39. 0000 0000 30 9 ul Reaction buffer 1 ull Enzyme mixg 0 0 O OOOO Reaction buffer Enzyme 0000000000000000 4j 30 160 1800000000 50 65 C 0 100 000000000000000Phi29 DNA polymerase 0000000 60 0000040400 20 4 0000000 T volcanium B 1 H D cH H D U GenBank OOOO GenomiPhi 0 00000 DNAQG 20 4 kbp L3 mn c3 pucis 9 000000000000 10000 DNA Amplification Kit 0000 Do000000DYEnamic ET Terminator Sequencing Kit 000000000090 M egaBACE 4000 DNA Analysis System 0 0 0 O O O 0 0 00000000 13050 DNA 0900000090 0000000000068690000090 volcanium DD 1 6 5 GenBankg OOOOOOOOOOOOOOOOOOOOO 6860 1 5 38 11 1 111 110 0 u uu GenomiPhi 000000000000000000 0 12000 10000 8000 5 6000 40001 uc 26 d D m eet agat ot i e ett egot t gu ee UE S cvy
40. 0000 DU 00000 0000 O 00000 R N 0 O gag Oooo H F A A DNAQ D 0000 Phi29 DNA polymerase 0 0 0 0 00000 000000 0000000 10 9 Sample buffer 141000000 DN AG 1 ng ul 20 95 41 030 CO 0 000000000400 00 0000 0000 DNAD DD OOOO DO 000000000000 003000000000 30 9 pig Reaction buffer 1 uig Enzyme mix 0 0 O dodo Reaction buffer Enzyme 0 mxO 1 110 0 40 30 160 188 000000000000 59 65 9110000000000000000000090 000000000000 29 DNA polymerase 000000000000 D0NA 0900000000 20 c OOo 7 00407 p90 OOOOOOO PicoGreeng 0 B CEPH DNA 0 0 0 0 GenomiPhi DO DNA 60 0000 5 8 00000000000000000ABIPRISM Linka Mapping Set v2 50 0000000000000
41. 03 pl 000 143 pl 0 0000 00 9 55 30909000000000 0 0 0 DNA 1 ng ulniri OO GenomiPhig D 1 pl v 0000000000000000000000 008 000000 8 y 95 C 30s Reaction buffer 9 ulg Enzyme mix 1 OO O 00 10 pigg 550915 010 6 905 7290 2 min gt 4 C overnight 000300 1800000000000 s 25 cycles 65 C 199 0000 00000000000000 80000000 5 0 000 0 0000002 agarose in 1x TBE TI OOOO Du 0 o ETT ETAT A Figure 10 PCRO 00 0 D 0 00 PCRO Q 1 pl B Figure 2 PCRO D 00000500000 lane10 500 0000 DNAD 0110 00000 GenomiPhig 000000000020 00001 pl 0000000 langg 1200000000 lane 1 No 1 DODDNA 1 3ng lane 1 No 1 QOODNA 1p0 13ng total 100 0 u u LIGenomiPhil 0 0 0 20 0 No2 0 0 DNA NN MI 12 080 20 D No2 Dag DNA MD 12000 Pcro D 00000 1000 PCRIE 7B 7 E U No DNA 9 n O O No s 9 PCR O 0 No 4 IT DNA SUMMA le Tenzi 4 D No4 TAA DNA rm ME OGenomiPhid 0000000 2 0000 D controlDNA octyl tong Gi agg DO PROD DD 00000000000 0000 70 0000 70 No enomiPhi ss 111 D D No enomiPhi zs pl Ph
42. 0 6 0 4 2911 00000000000000000 00 8 BI Prism Linkage Mapping set v2 59 4000 000000000 6000 EE ES SA gt UU GenomiPhi 00 0000000000DPNA0Q0O000 0D00000000DNAQ0O00po000000000 a a 5 5 8 000 DNA 00000 Taq 0 0 0 Phi29 DNA polymerase O O DO 00 000000000000 000000 0DNADO GenomiPhin O O DNA OC 000000000000 000000 00 000000000090 OOOO000 oOo Oo Oo EE EE 5 9 5 9 O Coriell Institute O primer extended preamplification Y O PEP 0
43. 3 DDD D O B DNAD J ug r 0000000000000000000DNAJ TE buffer 00000000000 gd 000000 00000000000 50500000 Picocrenp 100 ur 2 6 910000000 TO0O000000000000000000000 480 nmg 000000520 nmn 000 OOOOOOPMTQO000O000000000000000000000000000 1010 Typhoong Typhoon 94000 O O Typhoon 92000 O O 00090 488 nm 532 nm 0000000 520BP 526SP 000000 PicoGreen 90000005 toppo00900000000000000000000000000000 god 0 00000 0000000000 80 000000000000DNAp0 0000000 2 5 0 0 DNA 00000000250mM EDTAD pH 8 00 00000000000000000000 100000002200 000 77 00000 000000000000 00 2020W0 0000000000020 GenomiPhi 0000000000000000 304W015M00000000250mM EDTAD 8000000000 00000 000000000000000000000070 000000 10 100 49 gogo gg 0 gg gg go g00000000000000000007500000000000 gon 00000
44. 0800000000000 60 20 60 30 wo 90 00090 00000000000000180 B DNAQ 0000 hi29 DNA polymerase 000000000000 El Ea EIE ENE EE tr EIE ov 00000 0000 0 0 0 0 0 0 00 189 00000000000000 10 0000000009 Sample buffer 000000 000090 000000000000000000000000000000 000000140 00000000000000 20 95 C 300 0000000000000000 Q 000000 0000 uan 30 00000009 ul Reaction buffer 1 wl Enzyme mix dodo Reaction buffer Enzyme mix m 0000000000000 00000 OO 000000000000 40 30 C 160 180 000000000000 50 Phi29 DNA polymerase 000000000000 65 C 100 0000000000000000 6 20 0 00000 PTGER3Q 0 0 J PCRO 0000000 GenomiPhig 0 DNAD PCR
45. 1 2 GenomiPhi 3 3x 10 cells 4 85 900000000 800 0 0 0 0 0 0 701 Phi29 DNA polymerase Control 0000 5 Lp 6 1111111111 3 0002 GenomiPhij 0 0000000090 11 1 1 1 11 11 1
46. 1 0000800 00000000 000000000 RNase PO 0 DNAg 400r 9 9 0000 0000 0 1 1 871 9123 830 5 0000000000000 000000000000 0 1 454 DNADD 00 PCR 2 kog DNAgggo000 8 1 2 037 1972 58 1 6 1 1 925 B 10 4 427 3 783 35 22 10 2 127 e 00000 0 0 00 00000000 000000000000 u 0000000 000000 00000 Immunogenome OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO E EH E LCS TB URL ET TERR UE PT S a ac 6666666 6666666666668666 nuggmggmggunmm TH ood e euUUUUN 000000000000 eU00000 ei uuu EBERT 6 00900 a ouu MJ RESEARCH MiniCycler Doo pe Mastercycler gradient 000000000 Takaka Tag mil U 00 000000000000000100000000 DNA mugdgudn 00000 100 000000000 PCROOOO00 200 0000 000000000000 000000 E 9 0 O 10x buffer 2 pl eprimer 2 10 uM 0 3 pl 260 nmm 0000 0000009N4000000 1 O e dNTP 2 5 mM each 1 6 gt TaKaRa Tag 5 U pl 0 1 pl 198 41 DNAD O 1 pln DO Sample buffer 9 pl e primer 10
47. Db dn 1 056 1 056 1 056 1 056 1 056 1 056 1 056 020000000000 2 112 2 112 2 112 2 112 2 112 2 112 2 112 000000 1 727 1 519 1 275 1 408 1 239 1 244 1 132 M penetrans 1 00000 1 727 1 519 1 251 1 401 1 094 187 4 D D D dn 0 0 24 7 145 1 057 1 128 po000000000000000000000 GenomiPhid 0 0 0 0 DNA OO 0000000000 00000000000000000000000000 o WA Ma 1 358 633 bp 000000000000090 1ng 000000 GenomiPhi DNA 000000000090 05 23 0000000000000000000000 0000000000000000000000 000 M penetrans HD gugaggagagagugagaggggagagaga aatdedtu Tae nae S a 000000000 05 219 230 0 5 4140 000000 0000 2000000000 000 OOO Unt Zhang L et al Proc Natl Acad Sci S A 89 5847 51 1992 W LeM archand L and Lum A Cancer Epidemiol Biomarkers Prev 7 719 724 1998 Ml Trace Genetics Davis CA DNA extraction with N phenacylthiazolium bromide PTB www tracegenetics com m Morin P A etal Mol Ecol 10 1835 1844 2001 Martin E R et al Am J Hum Genet 67 383 394 2000 Esterbauer H et al Nature G enet 28 178 183 2001 Hugot J C et al Nature 411 599 603 2001 Kruglyak L Nature Genet 22 139 144 1999 Telenius H et al Genomics 13 718 725
48. Es Ee E E 0 non B No non 9 amplified a blank DNA 8 amplified purified 8 T v TEM CER GenomiPhi amplified 8 EY b 5 2 amp 5 heparin EDTA citrate 5 8 6 g a 5 6 a 5 3 lane 123 4 5 6 7 8 9 10 11 1213 M 15 16 18 19 20 21 2 23 yl lysate 10 30 50 10 30 50 10 30 50 005 005 005 400 bp 300 bp Sa gg 8 6 p d ka PTGER30 0 00 05 4 000000 O 0 G 0 Oo OO OO OO OD El o O enomiPhi 4000000000000000000 LE O o 0 ul O GenomiPhig Y 0 000 D 20 ul 0 0 180000000000 D D gt 5 3 05 OD Oo rp oo m a OW E 0000000 PCRO oo oo ao Dp oo oo Dm 2 Bo Bo oo mmn o az oo rn o oo oo Ou 000 000 000 000 5 3 Blood Card 0000000000 Blood Card LO 000000000000 00000000000000000000090 0 u D GenomiPhi D Blood Card
49. 000 400000 000 00000 D 0 0000000 Locus Copy Number 4 strass ett x E as a r 5 ay E E per pe Isi m 0 0 2900 0 84 0 20q13 33 0 0 0 0 0 D DNAD GenomiPhi DNAD 2002900 05 7 0 0 00 7822 30 0 0 DNAD GenomiPhi DNA UD 8 00 30 6 00 1362 ng 1 mul 11 0 5 00 5 9 0 0 0 DNA GenomiPhi 3 00 0 0 8 00 00000 S 20 836 2 ng 1 1 00 Tas 29247 202733 I 79221 ui B 36 2 ng 2 100 me ER 9 1 wr 9978 20002 3 62 ng 1 P 3 00 3 62 ng 2 5 EM 0 362 ng 1 oon 0 362 ng 2 8 00 Loci AA Oe pes dili IL II ee R Se e RIC Tu TW Sai pP TT Ts v e 5 PN XXX X 4 k A YA 69404 ave tid v m 20042000 o 5 36 0 C4DNAJ 00 D loop 000000 20042000 05 17 0 0 OOOO D loopr D D D GEAJVAZ7 NAFTA AMB TS El 0 0169 0073 B 000000000 3 251000000000 TEL 03 5331 9336 FAX 0 e mail Tech P ge com q g
50. 00000 00 0 00 C 0000 uan 30 0000009 Reaction buffer 1 wl Enzyme mix uuu Reaction buffer Enzyme mix 0000000000000000 4j 30 160 180 000000000000 50 Phi29 DNA polymerase 000000000000 65 C 20 ej 0000000 0 PTGER3 00000 PCRO D Blood Card GenomiPhi 0 0 0 DNA PCR DH D 1 21 821 10 100 0 101 10 uuu Guthrie Card UD d PicoGreeng O 000000 GenomiPhid OOO DNA 000 0 000000009090 0 0 008 1 U DNAD QIAamp 531 PTGER3
51. 159 175 178 182 246 250 MW 4 neat 1 0 ng 0 82 ng XX 20 24 163 71 178 182 194 198 MW 4 PEP 0 34 ug XY XY 19 20 24 low signal 178 182 194 198 MW 4 Phi 5 1 ug XX 20 24 163 71 178 182 194 198 MW 5 neat 1 0 ng 0 91 ng KY 20 20 163 71 186 186 190 250 MW 5 PEP 0 62 ug XY 20 20 low signal 186 186 190 250 MW 5 Phi 5 8 ug XY 20 20 163 171 186 186 190 250 MW 6 neat 1 0 ng 0 41 ng KY 20 20 163 71 186 186 190 250 MW 6 PEP 0 61 ug failed XY 20 20 low signal 186 186 190 280 MW 6 Phi 5 1 ug XY 20 20 163 71 186 186 190 250 C 3 neat 26 3 ng C 3 PEP 0 58 ug C 3 Phi 44 ug C 4 neat 25 3 ng C 4 PEP 0 38 ug C 4 Phi 3 5 ug WB neat 0 67 ng FAILED no signal WB PEP 0 16 ug WB Phi 6 5 ug water 1 Pep Okb 0 ug water 1 Phi Okb 0 ug water 2 Phi Okb 0 ug 10 0 1231 00 0 000000000 00 0 0 000000 neat 0 PEPO BD GenomiPhiQ 10 0000 300000 0 260 606 0 0 0 000 00000 00000000000000000NA 00000000000 Gende 9000000090
52. 23 41 46 19990 0 0000000000 OO000 3000 1 000 bases 0 0 0000000000 080 0 35 0000 00 00000 o EI EI E El 34 1 2 4 4 tl Guthrie card FTA paper 56006 Card 0 d rd GenomiPhig O 000000000000 A D0000000000000000000240000000000000 GenomPhi 00000 00 18 8 8 DNAQ GenomiPhig 0000000000000 10 A 000000000 10000 U DU 1 ng 1009 000000000000 6 00000000000 SNP Genotyping 00 HO El pgoo000000000000000
53. 5 x 09 ml 70 C 0 20 C Reaction buffer u 1x 09 ml 5 x 0 9 ml 70 q 0 0 20 C Enzyme mix 0 1 x 100 ul 5 x 100 yl 70 C Control DNA 1 x 20 yl 5 x 20 ul 70 C 0 0 20 C 10 nglulA DNA O 10 mM Tris 1 mM EDTA pH 8 00 1 100 O00000000000000000000000000000 O 70 000000000000000000000000000000 o00000000EDTAQ00000000000000000000000000 3M000000000 5M EDTAQ pH 80 000000000000000 mM 400 DD KOH 100 mM DTT 10 mM EDTA OOOOOOOOOOOOOOOOOOOOOOOOOO 400 mM HCI 600 mM Tris HCl pH 0 60 1 3 00000 PNA 10 0000 030 18000000407 DNAQOOOO 00000000500000000000rel timePCcR 0 Oo 00 000000000000 0 real time 00000000000 44 000000000 www gehealthcare co jp lifesciences GenomiPhi 0000000 00000 Note O Sample buffer 0 D Reaction buffer U Enzyme mix 0 Control DNA 0 xp OOO000001 200 OOO p a os os RO oon oon oon on 22
54. 75 00000000000 C 3 209 7 10 29 84 D B 219 1 8 8 B 5580 0 0 0 00 00 0 00 0 0 5881000000000000000 00 0 800 000 000000000000 DNAJ MDAD D D DNAD O SSRO D 00000000000000000 055800 0 0 2 07F0 0 0 D OOOO 4000000000 00000000 0000000 00000MDAopPreoo0000000 10000000000 00000000000000000 5580 DO0D0000000000000000000000000000 DNA polymerase slippage 0 0 0 0 D 2 018 2 06F 2 07F 2 07G 000000000000000000000000MDAD O 0 DNA 00000000 10000000000000000000000 000 0 0 cone 2008 30 9000000 00000 00 80000000000908 4 00 D Moooo 000 sooi U U ga 000000000000000 2000000 0000000 0 0 00 00 000 000000 20000 DNA OOO mulli OOOO STRO O SNP yw ep o000000000000 Dum 1111 ng 0 0 SNPs STRHBHBDDDBUOUDODU 0000 GenomiPhi 0000
55. D D DNAQ real time PCR O O co 0000 00000000 Corellg 0 0 0 DNA code NA 146600 000 0 DNA D Corielg Y NA14660 000000 GenomiPhi 0000000000 0000000ABIPRISM7700 00000000 m DAA 0 5 8 0 0 0 0 O 20q13 33 0 000000 DNAD GenomiPhi DNO 10101100000000000000 B00000000 ONAQ GenomPhi 000000000000 8 00000 e 29 e 30 8 00 6 00 362 ng 1 5 2 00 362 ng 2 g i pem E 1 90 69251 sm ima CU mr 2091333 3 62 E 1 5 06 3 62 ng 2 35 00 0 362 ng 1 706 0 362 ng 2 8 00 Loci D 5 9 0 D D DNAQ GenomiPhi 0 real time PCR DB U GenomiPhir 90000 000000 Threshold Cycle OO gnaungabpwagnaudnagaugnadgcainudgaganagaanabNAgcain ubNAncasunaadgadnauutu 0000000000 0000 DNAD CAD 1000000 DNA 1 cH 00000 Ci for GenomiPhi Amplified DNA T T T T T 20 22 24 26 2
56. GenomPhij 00000000 A 00000000000000 ABI Prism Linkage Mapping Set v2 59 0 O 400 09 3 8 00000000 00 00 Allelic loss GenomiPhig 0 DNAD 0040 0 0 0600000 O EE El GenomiPhig Y DNAQ RFLPO A 0 DNAD 6 OO 0000000000 0000 0 0 RFLPIJ 0 0 0 0 0 0 0 0 0 00 0 00 0 00 00000 6 1n GenomPhij 00000000 A Q 100003 9 0 0 GenomiPhig O podd0 000000 0000000000000 Dun 000 0000000000000000 00DPNA000 0000 Oo GenomiPhid 0 000 000 0000
57. O 0 0 0 0 cytochrome 0 cytochrome bl DO0000000000000 000 GenomiPhiQ O U D 0000000 1 0000000 0 0 D loop LI U D DNAQ 2 OO DNA 0 00000 Dynamic ET Terminator Cycle Sequencing Kit 000000000000005 160170 0090 0000000000000000D0NA 000000 GenomiPhi DNAD 0200000000 ONAQG 00000 D Ioop 00 0000000000000000 GenomiPhi
58. n 100 310 poo e 33 5 6 GeneChip HuSNP Mapping Assay GenomiPhi DNAQ 0 0 000000 O oO G D D D D DO 000000 O GenomiPhi DNA Amplification Kit O Tween 20 O GeneChip HuSNP Mapping Assay Affymetrix 1 CEPH DNA 884 02 Coriell Institute for Medical Research O PicoGreen dsDNA Quantitation Kit Molecular P robes O AmpliTaq Gold DNA Polymerase Applied Biosystems 1 1 100 70 0110 OO 3 0M DD D D pH 8 00 0 0 0 5M EDTA 000 pH 8 000000000000 eneChip uSN P M apping Assay Kit 10 000000 1 4940 00 SNPO Og DO00000000000000000000000000DNADQDOSNP NADOO0000O0000 multiplex PCROO00000000000 enomiPhig DO 0000000000 multiplex D 1 1 1101111 enomiPhig 0 O 0 Hl GeneChip uSN P M apping Assay 000000000 uppuuguppagupnpabuaAngng
59. 0 6 9 090080 000000000000 00000 0000 000 0 00000000000000000PEPO000000 00000000000 cytochrome 5000000000 DNADOTHO 10Q00000000000000000 0 0 0 0 cytochrome 50 000000000000 1 11 10 cytochrome bO 00000000000000 0 DO 0000000000000000000 GenomiPhi 0 0000000000000000000003000 DOODNADODOPEPDODOD 000000000 real time PCR 00000000 Streptococcus 1 111111 1691 00000000000000000000000 UL ae 5 GenomiPhi 0 0 0 0 real time PCR O cmyc cytochrome b Streptococcus Q 5 9 GenomiPhi 0 0 J J DNAJ I U D Sample A 260 Gel Pico Green Gender Androgen THO 1 D5S D10S lambda 1 ng PEP 0 64 ug no signal no signal no signal lambda 1 ng Phi 7 2 ug no signal no signal no signal lambda 10 ng Phi 5 8 ug Ceph neat 1 7 ng 40kb 160kb 1 4 ng XX 20 24 159 175 178 182 246 250 Ceph 1 PEP 200bp 2kb 1 3 ug failed XY 20 24 low signal 178 182 low signal Ceph 2 PEP 200bp 2kb 1 12 ug XX 20 24 low signal 178 182 246 250 Ceph 3 PEP 200bp 2kb 0 75 ug XX 20 24 low signal 178 182 246 250 Ceph 1 Phi 16 9 mg 2kb 20kb 5 2 ug XX 20 24 159 175 178 182 246 250 Ceph 2 Phi 13 5 mg 2kb 20kb 6 64 ug XX 20 24 159 175 178 182 246 250 Ceph 3 Phi 33 4 mg 2kb 20kb 6 0 ug XX 20 24
60. 0 DNA 0 00 00 0 10 mM Tris 1 mM EDTA pH 8 00 0 1 ng ul 0 0 0 0 0 DNAD 1 ul O 1 OOO Sample buffer 9 1111 001 80000 0810 00000000 0 0 40 00000 PBSIJ 20 0 O U 0 O 400 mM KOH 100 mM DTT 10 mM EDTA p 60 000000000000 400 mM HCI 600 mM 0 000 1000000000 111 111 ris HCI pH 0 60 060 YO 000000000000000000001 uli Sample buffer WI 2U B B 40000 ono C3 5 1 Oo ne T T 2 gt o m 3 32022 BAOG DOO m ono00p000 000 ar Fi 3 3 o0 4000000 oo ona 2 1 PBS 000000 400 ul 0 400 WA 1 1 d 4 gt p0000000000008000000000000000000000000000001tx 000000000000 400 mM KOH 100 mM 0000000000000 100000000 400 mM HCI 600 mM Tris HCI pH 0 69 0 400 uy 00000000000 1 D D Sample buffer 9
61. 00 00000000 A Phi29 DNA polymerase 00000000000 100 8 30 5000000000000000 0000000000 0 0000000000000 0 Phi29 DNA polymerase 000000000000 0 50 7 kop A GenomiPhig 50 000000 A DDD 0 090000000009000006 8000000900000000 O GenomiPhig O O O Nucleon PhytoPure RPN 8510 RPN 85110 GenomiPhi O Cy30 CySOOOOOOO00000000000000000000 DNAg 0 000000000000 A GenomiPhig 0 00 00 000000000000 000000000000 uwana aaa aaa aaa aa aaa DOC 000000000000 000000000000000000 Genomihi GenomiPhig 66 Microarray B D D D U D A 0000000205 ug GenomiPhig DNA I 0 Cy30 Cy5n 0 Nick Translation Kit O O O Invitrogen Bioprime Labeling kit 0 O D Pollack et al Nat Genet
62. 000 GenomiPhig PEPO 8000000000000000000000001 0 0 00000000000 000000 00000 ou GenomiPhigOOOOOOOODNAOOOOOOOOOOOOOOOOO GenomiPhig O A 000050 80 50 00000 000080000 GenomiPhid 0 J D 100 50 kbl O singe cell 0 GenomPhi 0000000000000 A 10000000DN4Ag00 000000000000 DNAg 0 0000000000 GenomiPhig 0 DNA multiplex PCR A 00D00000000003100000000 00 multiplexg 00000000 0 8 8 8 PCRO O OOO Taq polymerase 0000000 multiplex PCROO0000000000000000000 GenomiPhig 0 DNA 58 A GenomiPhip SNuPeJ GenomiPhig DNAn PCRO SNP 0 00 5 0 0000000 0000000 Allelic dropout D
63. 0000 0000000000000 50 12 000 150 000000000000000000000 2 500x 9 3000000000000 604 000 00000000000960 00 000000 00000 000000000000 000000003009 100 0000 0000000000 70 2500 500 wig 70 0000 0NA DODO 0000000000 0 remgog0 100 000000000960 0000000000 0000000000 3 200x90 500008000000 80 0000000000020 500 O Speedvaco 000000000000000 DNAQO 5 9 00 Q amp A 000000 0000000000000000 OOOO TemplPhi TempliPhi LCD OO DNA OO nooo GenomPhi Phi29 DNA polymerase OOOOOOOOOOOOOOOOOOOO A 1 309 300 0000000000010 nmol dNTP II DDD D 0 960 A 200000096000000000000000000000000000000 1 D Sample buffer OOOOOO0000000000000DNAQO A lngoDNAQOOOO000000169 1800000000000000000 pg00900900000000000000Phi29 DNA polymerasen 0 0 0 0
64. 00000 CytoB Strep 00000000 OOO ONAQG OOOO 000000000000000000000000090 0 0 00 D DNA 0 0000 0 DNA D000000000DPNAD000000000000 GenomiPhi 0000000000000000 0200000000 GenomiPhi D00000000DPNAQD0000000000000
65. 0000000090 GenomiPhi 0 0 000 DNA 0000000090 00000000 multiplex PCR 0000000000 0000 5 12 6 Taq polymerase 0 OOOO u multiplex PCR 0 0 Tag DNA polymerase 6 000000005130 primer set 0 0 PCR ga 00 00000000000 0000000000000 OU GenomiPhid 0000000 multiplex PCRO OO PCR D Tween 200 BSAD 0 000090 multiplex 0000000000000 GenomiPhi 0 DNAD OO 0000 bp 1125 878 bp 762 1125 878 762 444 444 250 178 159 178 159 O 5 12 GenomiPhi DNAD multiplex PCR O 5 13 GenomiPhi DNAQ multiplex PCR 2 00000 DNAD 0 GenomiPhig DNAD 0 0 multiplex PCR GenomiPhid 0 0 ONAD 800000000000000 Ta OO0000000 100 000 1 125 bpp 878 bpp 00 0000 polymerase DNA OOOGG00000000000 20 10x multiplex 00000000 0 100 Base Pair Ladder 0001000000DNA og 0 DNA 0002000000 Do 1x PCR primer 3 2x PCR primer OOO 40 100 Base Pair Ladder 0000540 Do
66. 000000GenomiPhip 0000000 0 0 0000000000D0NA 000000000000 0 0 00 000000000000 00 5 21AM 000 00000000000000000000000090 0 0 0 0000000000000000000000 5 18 00000 1 0000000000 0 0000000000 0 O10000000000000000000000000 0000000000 0 5 23 E Pa M De 8 m 7 Run 100000 1600 a M penetrans DUO 0 H 53 1000 2 O 5 21 M penetrans DNAJ O O GenomiPhig 0 O O m 1 90 10 0 0 100 0 0 0 0 0 0 000 0000 e 00000000000000000000000000GenomiPhi tong ing 100pg 1Opg 1 10fg 10fg 0 000000000000000000000000000000 DDDDNAD 1 00 1 p90000000000000000010f000000 00000000000 522 000000000000000000000 BO 0 DNAD II 2 a m 5 14000000000000000000000 08 000000 0000000000000000 1000000000000000 ro ocu aa 0000000000000 0000000000 5 05 14 g0080000000000000000 1 pg 00 DNAU D DU D 90 0 0 d M penetransg d 0 00000 000 10 ng 1ng 100 pg 10 pg 1 pg 100 fg 10 fg 6 713 522 671 352 67 135 6 714 671 67 7 D
67. 005 90 5 00 00000000 0 0 O 0 a a o gt D 5 5 real time PCRO I 00000 Gene Name Locus Flavin containing mono oxygenase 3 1324 3 Intergrin beta 6 precursor 2924 2 Collagen alpha 3 VI chain precursor 2937 3 Estrogen receptor 1 Actin cytoplasmic 1 7p22 1 Glycine dehydrogenase 9p24 1 L Lactate dehydrogenase a chain 11p15 1 Collagen alpha 3 IX chain precursor 233 u OOO00 GenomiPi OOOO0000000 O O O real time PCR 000000 GenomiPhig 0 DNA 00000009090 0000000DNADO 0000 0009000000000 000000PCcRO00 70 00000000000000600000000090 0 00 GenomiPhiQ 1 0800800000 00000000000 GenomiPhi 0000000000000 00000 0p0000000000000000DNADODO 80 10 8 0 000000 1 0 0 000 0000000 00 00000 ad 111 pete BN err E 58 piat 8 enm pas 7p22 10 00000000 DNAD GenomiPhi DNA 0000 0 5 7 PCROOC OC OOC OOOOC OOOOOO ADo0000000DNA Proemega O real time PCRO OO 800000000 Promega 00 000 GenomiPhig D
68. 0MG6GBJ 000000 Eclipse Dark QuenchengOOOOOOOOOOOOOOOOOOOOOOOOOOODOOOOOOOO uultu O GenomiPhi DNA Amplification Kit 25 6600 01 O DNA Polymerization Mix 27 2094 02 OHOH uut O MGB Eclipse Probes Epoch Biosciences O ABI PRISM 7700 Sequencing Detection System D Applied Biosystems O ABI PRISM 7900 HT Applied Biosystems O umpStart Tag DNA 0 0 Sigma Aldrich O PicoGreen dsDNA Quantitation Kit Molecular P robes DNA 61521 61471 Promega DNA code NA 14660 D Coriell Institute for Medical Research 0000 M GB Eclipse Probe 0 0 0 real time PCR 7200000008 0000000000000090 A DNAQ 0000 Phi29 DNA polymerase 0 000000 000000000000 00000000 10 9 ul Sample buffer 141000000 DNA 1 ul j oo0000 20 95 41 0 3100000000 0 8 4 00 0000 0000 OOOO 30 9 pig Reaction buffer 1 uig Enzyme mix 0 O uuu Reaction buffer Enzyme 0000000000000000 40 30 qg 160 180 000000000000 50 65 C 100 000000000000000000 00000000000000 Phi29DNA polymerase 000000000000 DNAD
69. 1992 B Struan F A et al Nucl Acids Res 30 e125 2002 Lizardi P M et al Nature Genet 19 225 232 1998 B Dean F B et al Genome R es 11 1095 1099 2001 Nelson J R et al Biotechniques Jun Suppl 44 47 2002 Patki A H and Nelson J R Genomic Proteomic Technology 2 28 31 2002 Blanco L et al J Biol Chem 264 8935 8940 1989 Blanco L and Salas J Biol Chem 271 8509 8512 1996 Estaban J A et al Biol Chem 268 2719 2726 1993 Dunning A M et al Nucl Acids Res 16 393 1988 Walsh P S et al Chelex 100 as a medium for simple extraction of DNA for PCR based typing from forensic material BioTechniques 10 4 506 513 1991 m 5 amp SIsoCode Card Stix Protocol Schleicher Shuell 2001 Hi at LT T im muni Phi Circles GenomiPhi DNA Amplification Kit 11 1 00000 GenomiPhi DNA Amplification 11 000 0 00 00000000000 50 gt 6 0000000000000 00000000000000 aaa aa aaa aaa aa AA AA AA OOOO OO OOD serrer 31 200000000 88 8 00 JOTI BA EDINA DD DOO sin 52
70. 8 30 32 34 36 38 40 C for Human Genomic DNA 5 10 GenomiPhi DNAD D 0 DNAJ real time 0 so0000000000000000000000000004000000 GenomPhi 0 DNAD0O0000ODNAQDOOO 0000000000000 duplicate 0000000000000000 Threshold Cycle CH 000 5 5 multiplex PCROD000000000DNAJD GenomiPhin 6 PCROD 0000 GenomiPhig DNA GenomiPhi DODNAD OO multiplex 0000000 GenomiPhid 0 0 0000900008 8000000000000 multiplex PCR 00000000000000 OOO O O L O GenomiP hi DNA Amplification Kit 25 6600 01 DNA Polymerization Mix 27 2094 02 dNTPs 100 mM 27 2035 01 100 Base Pair Ladder 27 4007 01 O O O O L O O PicoGreen dsDNA Quantitation Kit O Molecular Probes 10x PCR buffer 10 mM Tris HCI pH8 3 50 mM KCI Applied Biosystems GeneC hip reagent kit Affymetrix GeneChip CYP 450 primer seti Affymetrix AmpliTaq Gold DNA Polymerase O Applied Biosystems O DNAD O O Promegal O DNAD O O O Promegal 10x multiplex 0 0 10 mM
71. B D 00000000 Coriell Instituteg 100000000000000000 Coriell Cel Repositories sample NG158000 0 0 0000000PEP 0 0000000000 DOOUGODNAGOOCOUCOCCO PEPO O degenerate pentadecamer Taq polymerase O ell podega 00000 00000000000 00000000Phi29 DNA polymerase 8 0 GenomiPhip Dad dB OOOO Phi29 DNA polpimraseg 00 0 0000000000 0000000000000000000090 GenomiPhi PEPO 0000000000000000 E 00000 00000 0000000000000000CEPH 000090 00000D0NAg000000000000000090 GM 066900 0 0 0 0 PEPO 0 GenomiPhig 0030 00 30000000000 0 1 0555920 008 1055261 00000000 30 3000 2000000000 SNP 0000000000 CAGO DNAQDOOOD2Z000400000000000000 n D B B U 0 00000000 LeMarchandg O 00000000000005 900000090 000000000000 Puregene saltingout PureG ene Blood Kit Gentra Systems Minneapolis MN OOO20000000000000000000000
72. DNAD OO 20 10 20 000004H4000000000EDTAD 00 1 10 0 1006 100 30 4 000000000 15 000 rem 151 0096000000003800 0000000000 2 500 0000000300000000 50 gt 3 5 9 E D u 00 DO DO Oooo 10 E Ep a 60 DNADOOOOOOU0000 70 000 0 3 200x 9d 00500000000000 0 15 000 rem 100000000 OO E fe El O 0000 70 0000000 0 5 mg 00800000 2500 500 ug 961 0000000100 pig 3840000000 50 ea 70 DC 000 000 00000 000000000000 El EY EI u au OOOO uan Oo 0000 uaa 80 poo00000080000000000020 ng g 0000000 1009 250 Wa 0 0000000090 O Du 5 90 000000000000000 GenomiPhi 000 PicoGren 000000000 GeneChip HuSNP Mapping Assay 0 multiplex PCR 1
73. DO 000000000000 5851 0000 00000000000000005 200004 40 18M PCR 000000000000 5 10 000 30 60 5 9 N S r3 r3 r3 l Lr ES E Ei B woot GenomiPhid GenomiPhig Hj D D D D 000000000D0NA 000000000090 PCROOO 00000000000 polyester tipped applicators polyester tipped applicators cotton tipped applicators 2 ng purified DNA cotton tipped applicators 2 ng purified DNA 50 ng gDNA 100 ng gDNA 200 ng gDNA 400 ng gDNA KiloBase DNA Marker no template lane ul lysate 11 12 13 14 15 16 17 18 1 3 la A e wn uw Bo o 1 L 10 kb 05kb o NJ mm 0 5 2 0 0 000000 GenomiPhid 52 6 GenomiPhiD 8
74. O Sephadex G 50 000000000 30 qj 180 00000 65 100 DNA 2 ng 10 50 ngo O O AmpFLSTR Profiler PCR Amplification 8000080000000 94 C 1 min 95 C 11 min 59 C 1 min 60 C 45 min 25 C Soak 72 C 1 min 28 cycles Ec PCRO O plg loading Buffer 3 pO 0 140000000 IA GenomiPhig OOOOOOOOOPNAOOOOOOOOOOO ETE 000 u GenomiPhig DNAJ 000 D ONADOOOO mE 1 i GenomiPhi 0 DNA 000000000000 _I et 0d pg 00000000 00000000000 3 gari sm m RE 4UDDDD U 1 00 8000000 0000 0 0 00 0000 00 000000 gt 0 DNAD REN m O 00000 00 Juncus effusus 1 DNA 0 000000000000 E udi e PCRO OOO 1 slippaget 00000000000 Simple Sequence Repeat SSRDO O
75. Qu GE Healthcare GenomiPhi DNA Amplification Kit GenomiPhi DNA Amplification Kit 1 D D DNA OOO MAE GenomiPhi DNA Amplification Kit 00000000 poOdo00000000000000DNAg 000 DNA Sample buffer 1 ul 1000 9 ul 95 300000000 4 q I D reaction mix 10 ul Reaction buffer 9 ul Enzyme mix 1 wl 30 91 000 016018000 65 10000000 GenomiPhig JO 1 D 0 0 0 00 00 DNAD 0 A 000000000000 GenomiPhi DNA Amplification Kit 111 1 1 ver 2 GenomiPhid 000000000 GE Healthcare GenomiPhig 00000000000 03 5331 9370 0 00 0 0 email 0 0000 D O
76. Tris pH8 0 0 1 Tween 20 37 5 ug ul BSA OOOO000 DNAQO 0000 0000000 Phi29 DNA polymerase 000000000000 ul Sample buffer 1 pl 10 00000 9 3 9 20 ug 0000 30 9 Reaction buffer 1 WO Enzymemix O00 dodo Reaction buffer Enzyme mix aa 4j 30 C 160 180000000000000 50 6 DD 06 6 5 5 878 62 444 250 159 171 GenomiPhi 1125 762 444 e 878 159 MEM nds ii Genomic DNA O 5 11 GeneChip CYP450 primer set PCRQ GenomiPhiD OOO 6 000000 GenomiPhi 0000 DNA O multiplex PCRO OO 000000000000000090 multiplex PCRO O GeneChip CY P450 primer set 0007800000000 00000 5 11 primer multiplex PCR 10x multiplex 000010 mM Tris pH 8 0 0 1 Tween 200 37 5 BSAJ
77. gaupnaaguguswPuupnadaduda DO0000000000000000000000 DNAQ0 OO multiplex PCR DO DNA multiplex 6 5 25 6600 01 L3 Oo gt lt I L3 L3 L3 000000 CEPH DNA 884 0200 TEL 00000000 100 ng ul 1 ng ulfj 10 9 3000000000 DNA 00000000000000000000090 DODO 0000 000000000000 000 0000 000000000000 multiple D D PCR GeneChip uSN P M apping Assay D D DNA 0000 0000000 Phi29 DNA polymerase 000000000000 9 ul Sample buffer 1 ult 0 D 20 95 C 3000 D 00 000000000000 0000 OOOO 30 00000009 Reaction buffer 1 ul Enzyme mk 0000000090 uuu Reaction buffer Enzyme mix 0000000000000000 4j 30 161 180 0008000000000 00000000000000000 100 65 50 B
78. i Nga D Wa Samia MET locust JGenomiPhi 100 0 No 3 GenomiPhi D 1 pl 10 D No 3 GenomiPhig QO 1pl PCRO 0000000000000000 110 No 4 GenomiPhi D 1 pl 110 D No 4 GenomiPhi U O 1pl PCRO O 120 No 5 GenomiPhi D 1 pl 120 0 No 5 GenomiPhi D 1pgl PCRO 130 control DNA GenomiPhi D 1 pl 130 control DNAGenomiPhi 0 Q 1pl PCR D 14 template 00 negative control 00000 U 0 OO 0000000 00000000 000000000 000000000 U 0 00 0000 00 00000 00000000 000000000 0 DNAD ODD D 80000 D B D U D D DNA e 20000000000 111011109 e nested PRO 00000000000000 PCR 1 11 1 0000 ceromPrig nn ann YA ooo00000000000000 5 0 00 0 0 0000000 6 Amp str Profiler PCR Amplification Kit Applied 2000000 Biosystems PCRO Cycler BIO RAD 00000000DNAD0 7 pln 000000 ABI PRISM 377XL DNA 4 Sequencer Applied Sample Buffer 9 ul 0 95 C 30000000 Biosystems v Reaction Buffer 9 yl Enzyme Mix pig D O O 000000 1900000000000 Multiplex PCR GenomiPhi 0
79. rd 1 O GenomiPhir go 0000000 DO Card OOOO 000000000 ONAQ O GenomiPhi pDppnuuuuaggagganmnmnppappuud g000000005 60000130160 00000090 PCRO 00000 9000000550 0 0 71 80 uu 0 PCRO0003000000000000000000 O 328 DNA 55 02 10000009 0 80 00000000000 00000 Blood Card 2 D GenomiPhid OOO 5 4 0DNAQ O 0000 PCR GenomiPhig DO 0 PCROO OO OO 00000 0000 00000 000000000000 00000 0000 GenomiPhin DNA GenomiPhi 6 000 1 MGB Eclipse real time PCR probe real time PCR9p000000000
80. t Wana Hiii 6 150 9001 20009 0 0 0 Home Page http www gehealthcare co jp lifesciences 04 12 10 NS

Download Pdf Manuals

image

Related Search

Related Contents

    Sima Products UDC-2 User's Manual  TDS-12A [更新済み]141218.ai  Bazooka VSE-SCI-TC-04 User's Manual  videotext-betrieb  Istruzioni per l`uso  スクール・バトラーズ 【SB】    

Copyright © All rights reserved.
Failed to retrieve file