Home

閲覧/開く - 日本大学リポジトリ

image

Contents

1. 3p 3p14 2 3p21 3 3p24 9p21 17p13 LOH 18 9p21 17p18 p76 p69 50 19 20 GS EF p 269 76 21 8p ET LOH ag77e histidine triad FHID 3p14 MutL E coli homologue of I MLH a
2. 2 1969 Harris H 6 1971 Knudson AG 2
3. 13 Comparative genomic hybridization CGH CGH 3p 43 EARR CE EB O s BI C CGH 3p 8p 3p 2 3 30 14 array CGH 3p14 3p24 44 3p
4. 52 2007 4E 10 17 PEE ie EN ERO BAER HO HERR ABS RED 1 17 2007 10 53 ig BRO Met we TAS 1 i BAZ EOLA AA 59 2007 11 im Mi Hy cg 1 H 55 2008 1 56 EE pu IH HY 57 i H gN 2008 3 109 H Th BRAAK 5e
5. Gene Locus Hereditary tumor Sporadic tumor Function OMIM FHIT 3pl4 B Bub AR AUS DNA 601153 MLH1 Sp21 EMS PEFR OR TERE DNA 120436 TGFBR2 3p24 JE AL ARES E BCS 190182 VHL 3p25 von Hippel Lindau BR 608537 APC 5q21 KWE AEI E 611731 p76 9p21 E 600160 RB1 18q14 614041 p53 17p13 Li Fraumeni 191170 OMIM Online Mendelian Inheritance in Man 21 Table 2 Clinical features of 28 cases of tongue squamous cell carcinoma Case Age Sex Smoking Alcohol Stage Grade 20 22 M II 1 21 25 M II 1 30 30 F II 1 31 30 F F II 1 33 32 M IV 1 34 34 M II 1 35 35 F I 1 36 38 F I 1 37 39 M I 2 51 54 F II 1 52 55 M II 1 53 56 F II 1 160 61 F II 2 161 61 M II 2 162 62 F I 1 164 63 F IV 2 165 64 F II 1 166 64 F IV 1 167 69 M M 2 168 66 M I 1 170 72 F I 1 171 73 M II 2 172 73 F II 1 178 76 M
6. Waber HOD VAL LOH 28 LOH VEL 1 SNP SSCP EL RFLP 26 18 VHL LOH Waber FE 2 1 LOH 8 LOH 1 3 PEJE 14 2 VHL Partrige M VHL 1 29
7. 14 SUH VAL AAMT OAM AW RRABREBOKRE BE EL RHO 1 1 V VAL ats FO LOH V7 VHL COS coim ERG VAL 1 VHL VHL MIM 193800 VHL 36 000 1 20 80 5 46 VHL V
8. 2005 9 T ROE EBORC 20054E5 EE TRAR Microarray DEEN Ja 17 TRAR KJKS BUSK RHE 63 EH 63 63 2004 9 ON JR SHELL TE ea 2004 27 TRE VHL H 7 J Gene i 2005 5 y sib ates cers R oR 2005 FAR CGH 64 31 TRAK H 32
9. 50 1998 11 6 100 1999 5 7 JIS FEF EJIRE EJEA 145 i ACE RR 2001 7 8 145 2001 7 9 2 147 2001 10 10
10. LOH VHL 2 2 LOH Chor fio C iii VAL 2 2 2 VHL V U1snRNA T1VS 5 PAL V 2
11. 55 2010 11 78 fuk 21 2011 1 79 BY FABLE EH 80 ARISE 6 Be 4 81 BA AE 8 112 1 f 2011 EE FF A h E 5 Be dE B LUMERRS F 34 2011 6 82 K 34
12. 5 AFM093xh3 BAT25 BAT26 APC Mfd15CA 37 No 30 No 165 Fig 5B n 4 11 7 3 LOH p 0 SNP VALE 45 5 06 40 VAL LOH bork HORACE REED VAL PG 26
13. Table 1 DNA 1990 Epigenetics 19 1 2004 SNP 1118 Hae Single Nucleotide Polymorphism 1415 16 3
14. VHL EKTO LOH VAL D3S1317 LOH 2831 3p 2 National Cancer Institute Surveillance Epidemiology and End Results http seer cancer gov SAMBO 3 D 2005 2009 12360 A TEMO 12770 10 3 4 C BHO S 20 20 34 35 44 0 0 0 4 2 7 0 1 1 9 5 896
15. 67 3 167 173 2008 6 23 2 243 247 2010 7 gt 52 Facial nerve research 31 89 91 2011 L fe Pa RJE 2000 3 2000 2 1 mene 74 8 523 526 2002 3 JI ANF SEC AIME BROS 1 JOHNS 22 3 493 497 2006 4 Amak BREAKER BBR Ud fe
16. 2008 8 1 65 SETS X E feos A 66 HBR ABS FPR T2NOMO 2009 5 CBDCA Fe xu BL BF OED ERR 19 n A AER SAS B E F 110 110 2009 5 67 HERBS H EH FA 2009 6 H 68 CO fit REJEUAECKBE JI IHRE BARZ
17. 472 43 16 2006 10 4 mu FHAR IREE EE 16 E 2006 10 2006 11 n 47 an 472 2006 11 44 45 JIMI EF H kE 1 2007 3 d TRANK 108 6 BF pr 15 16 ROT UD 2007 7 47 7 7
18. AFMIS3yc3 LOH 21 35 36 3p Fig 5 Fig 6 3p deletion map 3p VHL D3S1317 4099 D381609 50 D381800 50 3 10 LOH 19 1 LOH 12 63 2 10 Fig 7 Yet tk 3p LOH 3p LOH Hig 6 28 BIO VHL 8p LOH Table 4 40 VAL LOH
19. fu Micoroarray 63 2004 9 I S a mi RICKI 2 FORZE RU 5 Ae OO RN 53 1 27 32 2002 2 2002 7 171 174 2003 3 54 32 37 2003 4 Asakawa T Esumi M Endo S Kida A Ikeda M Tongue cancer patients have a high frequency of allelic loss at the von Hoppel Lindau gene and other loci on 3p CANCER 112 527 534 2008 5 Re
20. 3 1 38 LOH loss of heterozygosity Hig 1A DNA 1 LOH DNA Polymerase Chain Reaction PCR DNA CA
21. 3p21 Transforming Growth Factor Beta Type II Receptor TGFBR2 3p24 yon Hippel Lindau 3p25 2229 2 LOH 3p SUH 3p 1 I 3p 30
22. 39 VHL LOH VAL VHL 6 3p 3p 0 25 3p 27 8 50 8p 8p LOH D381609 47 D3S1612 4896 777 5 D3S1300 32 22 25 D881800 68 42 23 40 D381300 50
23. 2 E 1980 LOH 1986 8 p53 p53 APC K ras CC 9
24. Ah LE gt 2003 4F e RB 19 UA PP IW 2004 5 de Be las 105 L 7 RB T FERK DN 2004 1 2 2003 1 Gre ERIC H PERE UMA DIL OR SEA EX AER TAN 15 IA 16 62 VHL 12 H ux 14 PEAR TRAK 105 AS ene VHL 2004 5 21 Endo S Kida A Suzuki S Tsuji K Niwa H
25. D381612 Sw PERIE 27 48 D381300 Eee EBC 50 32 3p 1 3p RICHI Cit VAL D3S1609 50 D381300 50 D381609 TGFBR2 D381300 FHIT 5 TD381612 TGFBR2 7 7 LOH 22 23 25 41 3p O LOH 32 3p LOH
26. 1 66 4 337 341 2007 5 Nomura Y Tsuji K Noguchi Y Matsuyama K Onoda K Kudo I Asakawa T Matsuzaki H Hirai R Sekine H Kumagai M Furusaka T Ikeda M Oinuma T EPITHELIAL MYOEPITHELIAL CARCINOMA ARISING IN THE NASAL CAVITY The Nihon University Jouenal of Mediine 50 133 138 2008 W 6 a 102 11 903 909 2009 7T FERE TRAR EREK 7 sscirEXIIRO 2 fil HA 102 12 1039 1043 2009 T 8 JOHNS 26 809 813 2010 9 RY Bias A
27. 35 47 VAL 2 LOH VHL VAL V 1 1 7 VHL ATE BI OT i EE BEDS VHL Q 1 VHL mRNA 2 yh EUCHRE LAB CO VAL LOH 2 15 1 Table 2
28. 85 24 61 1 0 1 7 3 4 10 3 7 zb 43 I 1 WE Polaprezinc 10 F 3 1997 9 2 R 1 56 1997 10 3 Be ils DAME BBM ROGET Bill 37 1998 10 4 BUMS Amen n DKT Fil ee a ES FS SE DAR ART SS 50 1998 11 5
29. BFA H 2006 9 Ex REL 2006 9 E 51 Bel ug H 2006 9 38 16 39 T BRE DT pi FH 16 2006 10 40 SER FB iS HR 41 ZEO 2 Pil 42 JA TRAR EE FNR RAAR MWA
30. 5 909623 AE EORR C do 2 http ganjoho ncc go jp public statistics 2001 9612 AC ABER OD 1 69 5 50 C AUR OD 5 http seer cancer gov HET WE RE MERI
31. Z WE R Facial nerve research 31 115 116 2011 10 Asakawa T Esumi M Endo S Kida A Ikeda M A mutation at IVS1 5 of the von Hippel Lindau gene resulting in intron retention in transcripts is not pathogenic in a patient with a tongue cancer case report BMC 53 medical genetics 13 23 2012 54
32. VL VHL LOH 2 VAL Y77 VHL 2 VAL HEIC VAL 2 44 32 1 LOH 35 VL 1 12 ifo VEGE mRNA 38 LOH
33. 2011 35 rest HET FE 83 m I PE T 2012 10 4 H f i O 51 BARRA E ARRA 2012 5 H FR 4 Bn 22 84 BRANES BR 2 197 2012 11 85 64 2012 11 1
34. Hy H sb fus 62 N E em gk 63 BSR ABB F 2008 9 YS LS Mt ZN HHR A 7 2008 10 Ex H FA 21 JE Bx MET BME 18 Us 49 2008 10 109 70 PHAR IRE 2 Bil SN A B 53 Bx 64 FARE MBE KBB
35. IVS1 5G gt C VHL mRNA RT POR VL mRNA 1 1 5 85 VHL 17 5 Ae4y Gas Gaoo Taoo Ale2 Ales Ge Team 7 1 U1 snRNA 3 UCCAUUCAUApppGm 5 U1 snRNA 5 4 6
36. PCR 2 PCR 167bp PCR 144bp DNA fiii VAL LOH HL 2 LOH SNaPshot PCR SNaP Table 5 3 No 52 TIERE L URMO DNA c 340 5G gt C Hig 8 HABE total RNA VHL mRNA 16 RT PCR Tig 9 No 52 144 bp 167bp fig 9C 1 5 Hig 9B
37. T3 T4 p53 64 B H AF 4 2005 9 F 15 46 33 Asakawa T Endo S Nomura Y Kishida S Noguchi Y Kida A Ikui M Intra arterial chemoradiation our method The International Workshop on Intra arterial Chemotherapy for Head and Neck Cancer Chicago USA 2006 8 Springfield 34 19 35 1 Bil 19 2006 9 36 fa BARE 37 Eder Tet 2006 9 51
38. Pig 4 sn 4 LOH forward primer reverse primer tailed reverse primer PE Applied Biosystems PCR ABI310 Genetic Analyzer PE Applied Biosystems Table 8 0 67uM 240uM 4dNTP 2 5mM MgCls 1 6U Amplitaq Gold PE Applied Biosystems 60ng DNA PCR 95 10 94 C15 52 60C15 72 C80 24 30 72 40 KERO PCR Table 3 LOH 66 LOH 5 3 7
39. V 3p DA OSEE Ze A Sie fg DNA Q VHL von Hippel Lindau V7 VHL 3p25 3 12 3 213 VHL hypoxia inducible factor HIF 1 alpha 3 HIF vascular endothelial growth factor VEGF REA PRL VHL 4 VAL 5
40. p 0 06 by Fisher s exact probability test 40 VAL 8 No 30 No 165 1 89 64 30 3 Stage LIL 3
41. 1 147 2001 10 44 11 T FA Tan d 2 149 i a 4 NA 12 7 13 13 2 14 EE HR m 2003 6 H 15 2003 9 16 LATI vi 2003 9 H 2002 9 PE SP HELIS H H 17 26 18 s Ex a 1 pj
42. 3 1 LOH VHL 3 SNP 32 VHL LOH 3p VHL 3p 2 1 28 12 16 55 8 22 81 cancer staging classification 6t edition of the International Union Against Cancer UICC
43. PCR 35 0 3MM 100uM 4dNTP 1 Amplitaq Gold PE Applied Biosystems 100ng DNA PCR 1 10 dimethyl sulfoxide PCR Table 3 DNA Thermal Cycler 9700 PE Applied Biosystems 95 C5 95C20 55 2 72C2 2 95C30 60 C30 72 1 838 72 7 PCR Microcon 100 filter Amicon Inc Beverly Mass Big Dye Terminator Cycle Sequencing kit PE Applied Biosystems ABI310 Genetic Analyzer PE Applied Biosystems 6 SAS statistical software package version 5 0 SAS institute Cary NC 3p VHL TO LOH Fisher exact probability test 3 1 VHL BEFORE VHL LOH
44. PCR 2 PCR Hig 1B DNA DNA2
45. v5 VEHL 1 1 5 AG GTACGG 3 1 4 6 2 U1snRNA VHL3it T Cli U1snRNA VHL 1 5 VHL VHL 11 Table 6 3854 11 YV77 1 VHL 1 VAL 5 VHL 2 VHL 62
46. ABE ABB HLA m OPI ERAO CBDCA 20 2010 1 73 TRAR 50 111 2010 5 74 FURE 23 2010 9 H 75 IRENI RAJI A BIKE JAE BRO ME BRT ZZ THA 20 2010 10 76 24 2010 10 77
47. 95C5 94C30 50 1 72 1 35 72 7 100 Amicon Inc Beverly Mass 0 8pmol DNA 0 8pmol SNaP SNaPshot ready reaction premix PE Applied Biosystems DNA Thermal Cycler 9700 PE Applied Biosystems 96C10 50C5 60C30 25 Sigma spin post reaction clean up column Sigma Aldrich St Louis MO ABI310 Genetic Analyzer PE Applied Biosystems SNP AG AG AG 60 LOH SNP REFLP LOH 34 PCR 200ng 4ccl 37C90 55C90 4 Nusieve agarose gel A 110 bp G 90 bp
48. VHL VHL 26 65 97 55 VHL VAL IVS1 5 VHTL 56 VHL 2 VAL 1450 G HEA 18 LOOMIS BEERS VHL
49. H H 58 JE T3 AP IAA FR Ne ES 59 Fh TRAR SREZ R V oE T4 2008 5 H BE EHR ERA Hi Ri 18 i BOE TE D Ein EE m Ws Ds 20 WX Ds EZR 70 60 F 61 f O HE Ed Fe TE HER BREA LL BIS A mE 2008 6 Ria AH 2008 6 E DW PD JER DW POD JR 2008 TIVA BBE AES BFA ER 18 WA ABE ABB HLA 2008 5
50. stageT 7 stage II 16 Pil stage Mit 2 Hi stage IV 3 l grade 1 20 grade 2 7 Pil grade 3 1 Table 2 1 2 2 DNA lysis buffer 50mM TrisHCl pH8 0 0 1M NaCl 20mM EDTA pH8 0 1 SDS 250ug ml proteinase K 37 phenol chloroform DNA John SWM DNA 33 3 VHL LOH V 7 3 SNP GSNP rs1642742 LOH 32 Fig 3 Table 3 PCR SNaP 0 3uM PCR 100uM 4dNTP 2mM MgCls 1 Amplitaq Gold PE Applied Biosystems Foster City CA 100ng DNA PCR DNA Thermal Cycler 9700 PE Applied Biosystems
51. 1 VAL VHL 1 19 IV 3p VAL LOH 8p 1 VAL 1 VHL LOH 1 VHL 20 V Table 1 Tumor suppressor genes described in this article
52. No 52 55 1 FROEDE X ER 20 35 2 35 FR T2N0MO 2 12 2 Total RNA RT PCR Trizol Invitrogen Carlsbad CA total RNA DNase I 2 ug total RNA random primer 50 pmol 5 AMV reverse transcriptase version 2 2 Life Sciences Florida FL cDNA ABI7000 Applied Biosystems 95 C15 fb 609C60 40 SYBR Green PCR Applied Biosystems Tables CRT glyceraldehyde 3 phosphate dehydrogenase GAPDH
53. 2010 2012 3 35 87 Hig 29 50 90 30 40 1 40 17 2 VAL LOH 1 Restriction Fragment Length Polymorphism RFLP 28 LOH SNP
54. 2007 7 le 48 ey ME ERE LTE HOE TERRE D Bil 2007 10 49 Z AFTE WE WEARS n 1 REFERIR 50 ER AR T MEREK we HOAs EE 2007 10 51 BRAKS BHRZ BHT Wit DMSAWAA Bi His TE HHO ME H 17 52 oE RIR RSET Metals O TE BI 17 2007 5 de 69 HET ATRL BRAAK WMH 69
55. 3p 1 67 7 24 24 3p hMLHI 25 3p FR D381609 D3S1300 VHL 2
56. c Mh MZ ui B 11 li John Wiley amp Sons Inc 231 2 Asakawa T Esumi M Endo S Kida A and Ikeda M Tongue cancer patients have a high frequency of allelic loss at the von Hippel Lindau gene and other loci on 3p Cancer 112 3 527 534 2008 BioMed Central The Open Access Publisher 2 Asakawa T Esumi M Endo S Kida A and Ikeda M A mutation at IVS1 5 of the von Hippel Lindau gene resulting in intron retention in transcripts is not pathogenic in a patient with a tongue cancer BMC Medical Genetics 13 23 2012 3p 2012 mt ERPS SUT DUE 3p 2012 I 1 pl OFS PEE HPO B 8 4
57. AS RRAIN 2009 10 69 HERA KB BRN RZ XE 2009 10 70 H x aa E mx H ey eh HEZE HF cd SHB de H SET HE R FH 2X 18 22 d un SIGH Rl AJR Bo RE Ge fal wy 19 A du SF 54 2009 10 71 R ker TREO 1 493 2009 11 72 fk RR KE APRA
58. VHL mRNA cDNA c 840 T5G gt C fig 10 VALE TO LOH No 52 VHL 8 LOH Fig 6 Fig 11 32 SNP A 1 Fig 11 C c 840 5G gt C VHL LOH 4 V 7 1
59. 3 SNP G or A 28 11 LOH 5 45 5 LOH Fig 3 4 A 1 G 4cc I RFLP 5 LOH Fig 4 ERO VAL No 52 1 ITT 2 3p LOH VHL 8p 3p LOH LOH 3 397609 D381612 D8S1300 amp VHL 895737
60. Ee xx RS p2 p4 BILE ae ERIC BIT OAK 3p EE Re ES p6 NE RRC p7 uo RDNS 2 SR BR 2 p10 T Lr p11 von Hippel Lindau Y7 1 I ee ew we RR f e p15 2 p15 8 p16 4 p17 IV p20 V p21 e E e a e E E a a E S E e a a p38 PIE 1 3p V MORI VHL 1 VHL mRNA VHL VHL
61. H Okada K Characteristic loss of heterozygosity in chromosome 3P and low frequency of replication errors in sporadic renal cell carcinoma J Urol 1999 162 614 8 35 Hamano K Esumi M Igarashi H et al Biallelic inactivation of the von Hippel Lindau tumor suppressor gene in sporadic renal cell carcinoma J Urol 2002 167 2 Pt 1 713 7 36 Dietmaier W Wallinger S Bocker T Kullmann F Fishel R Ruschoff J Diagnostic microsatellite instability definition and correlation with mismatch repair protein expression Cancer Res 1997 57 21 4749 56 37 Boland CR Thibodeau SN Hamilton SR et al A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition development of international criteria for the determination of microsatellite instability in colorectal cancer Cancer Res 1998 58 22 5248 57 38 Igarashi H Esumi M Ishida H Okada K Vascular endothelial growth factor overexpression is correlated with von Hippel Lindau tumor suppressor gene inactivation in patients with sporadic renal cell carcinoma Cancer 2002 95 1 47 53 39 Yan DW Fan JW Yu ZH et al Downregulation of metallothionein 1F a putative oncosuppressor by loss of heterozygosity in colon cancer tissue Biochim Biophys Acta 2012 1822 6 918 26 40 Ishwad CS Ferrell RE Rossie KN et al Loss of heterozygosity of the short arm of chromosomes 3 and 9 in oral cancer Int J Cancer 1996 69 1 1 4 41 Wang
62. I 1 174 76 F M 3 176 79 F II 1 177 79 M 1 178 81 F II 2 22 Table 3 Primer sequences used in this chapter Forward 5 3 Gene Locus Dye PCR bp Reverse 5 3 VHL LOH Ex3 PCR ctgcccattagagaagtattt 50 C 35 cycles 110 aattcccactgaattaggtata SNap agtcaggacagcttgtatgtaaggaggttt 50 C 25 cycles D3S1317 3p25 FAM tacaagttcagtggagaacc 60 C 24 cycles 169 179 ee D8S1609 3p23 VIC tgctctacactgtggcttaatg 60 C 24 cycles 254 262 atatecgtgggcaaatgg LS D8S1612 3p22 NED tcttttagtcagcagttatgtc 60 C 24 cycles 211 217 Se LTA CICLA PN NR D3S1300 3p14 FAM agctcacattctagtcagcct 55C 27 cycles 206 244 RR sccaattccccagat uu lt AFM183yc3 3p24 NED ggcagtaccacctgtagaaatg 59 C 30 cycles 152 166 gt M gagtaacagaggcatcgtgtattC smn AFMO93xh3 2p16 VIC aaacaggatgcctgcctttta 59 C 30 cycles 210 232 s ggactttccacctatgggac MK BAT25 4012 FAM tcgcctccaagaatgtaagt 59 C 30 cycles 127 129 rr re 02 021 7 BAT26 2p VIC tgactacttttgacttcagcc 55C 24 cycles 122 125 E Oa Q CC APC 5q21 NED actcactctagtgataaatcg 55C 24 cycles 116 148 5 agcagataagacagtattactagtt CC Mfd15CA 17q11 FAM ggaagaatcaaatagacaat 52 C 24 cycles 150 166 3 gctggccatatatatatttaaace Ex1 PCR aagaagacggcggggaggag 60 C 38 cycles 320 ggcttcagaccgtgctatcg VHL Ex2 PCR ctcccaaagtgctgggatta 60 C 38 cycles 325 sequence gattggataccgtgcctgac Ex3 PCR agtctgtcactgaggatttg 60 C 38 cycles 250
63. Kudo I Asakawa T Matsuzaki H Saito T TanakaY Hypopharyngeal Cancer Cancer Washington D C 2004 8 Concurrent 45 Chemoradiotherapy for Advanced 6 International Conference on Head and Neck 22 gt how ma Oem FEER AE CC BG 2004 9 H yb s B gi HE 7 Microarray 2004 9 23 H 24 LEE X KJKS JAZ 2004 9 25 3p 26 pathogenic 12 H 27 106 3 33 e MEALS HER E FEME YIN VA DW PD 28 chip p53 BRCIAR TE MIS UN ZI z 106 29 aneurysmal bone cyst 1 9 30
64. blood B of the SCC patient indicated that the cancerous tissue had lost the mutant C allele arrow and the SNP A allele arrow LOH loss of heterozygosity VHL von Hippel Lindau SCC squamous cell carcinoma 37 VI 1 Crossey PA Foster K Richards FM et al Molecular genetic investigations of the mechanism of tumourigenesis in von Hippel Lindau disease analysis of allele loss in VHL tumours Hum Genet 1994 93 1 53 8 2 Latif F Tory K Gnarra J et al Identification of the von Hippel Lindau disease tumor suppressor gene Science 1993 260 5112 1317 20 3 Maxwell PH Wiesener MS Chang GW et al The tumour suppressor protein VHL targets hypoxia inducible factors for oxygen dependent proteolysis Nature 1999 399 6733 271 5 4 Pause A Lee S Lonergan KM Klausner RD The von Hippel Lindau tumor suppressor gene is required for cell cycle exit upon serum withdrawal Proc Natl Acad Sci U S A 1998 95 3 993 8 5 Lonser RR Glenn GM Walther M et al von Hippel Lindau disease Lancet 2008 861 9374 2059 67 6 Harris H Miller OJ Klein G Worst P Tachibana T Suppression of malignancy by cell fusion Nature 1969 223 5204 363 8 Knudson AG Jr Mutation and cancer statistical study of retinoblastoma Proc Natl Acad Sci U S A 1971 68 4 820 3 8 Friend SH Bernards R Rogelj S et al A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma Nature 198
65. 6 323 6089 643 6 9 Vogelstein B Kinzler KW The multistep nature of cancer Trends Genet 1993 9 4 138 41 10 Goldberg AD Allis CD Bernstein E Epigenetics a landscape takes shape Cell 2007 128 4 635 8 11 Consortium IHGS Finishing the euchromatic sequence of the human genome Nature 2004 431 7011 931 45 12 Lander ES Initial impact of the sequencing of the human genome Nature 2011 470 7333 187 97 13 Stratton MR Exploring the genomes of cancer cells progress and promise Science 2011 331 6024 1553 8 14 Leary RJ Kinde I Diehl F et al Development of personalized tumor biomarkers using massively parallel sequencing Sci Transl Med 2010 2 20 20ra14 15 McDermott U Downing JR Stratton MR Genomics and the continuum of cancer care N Engl J Med 2011 364 4 340 50 16 Chin L Andersen JN Futreal PA Cancer genomics from discovery science to personalized medicine Nat Med 2011 17 3 297 303 17 Vargas H Pitman KT Johnson JT Galati LT More aggressive behavior 38 of squamous cell carcinoma of the anterior tongue in young women Laryngoscope 2000 110 10 Pt 1 1623 6 18 Scully C Field JK Tanzawa H Genetic aberrations in oral or head and neck squamous cell carcinoma 3 clinico pathological applications Oral Oncol 2000 36 5 404 13 19 El Naggar AK Lai S Clayman G et al Methylation a major mechanism of p16 CDKN2 gene inactivation in head and neck squamous carcinoma Am J Pathol 19
66. 93xh3 Case 165 Mfd15CA Case 30 T N T i53 215 215 152 154 n7 217 j 234 kat ji m INI JL IR 1 I lf a A n fll U UI NU LHP Figure 5 LOH A and microsatellite instability MSD B analyses of microsatellites using PCR with fluorescent primers Numbers in the graphs indicate the number of base pairs of the amplified allelic fragments A D3S1317 172 174 D3S1612 211 215 D3S1609 258 270 D3S1300 224 234 Arrows indicate deletions in tumor tissues B AFM093xh3 215 217 Mfd15CA 152 154 N non tumor T tumor LOH loss of heterozygosity 31 Symbol VHL D3S1317 AFM183 D3S1609 D3S1612 381300 Mfd15CA APC BAT25 AFM093 BAT26 LOH Figure 6 Deletion map of 3p in tongue cancer Closed boxes LOH gray box retention of heterozygosity open box not informative Due to limitations in the sample specimens from cases 34 to 37 LOH analysis was restricted to the VHL gene in these patients LOH loss of heterozygosity 32 Case No rm N we A Un A N c 2 3 4 5 6 Informative locus No Figure 7 Frequency of simultaneous LOH at multiple microsatellite markers of 3p The 6 loci of 3p that were investigated were categorized by the number of informative loci and further by the number of loci with LOH in the 23 cases that were informative at more than one locus on 3p The number
67. 97 151 6 1767 74 20 Nagai MA Miracca EC Yamamoto L et al TP53 genetic alterations in head and neck carcinomas from Brazil Int J Cancer 1998 76 1 13 8 21 Loughran O Clark LJ Bond J et al Evidence for the inactivation of multiple replicative lifespan genes in immortal human squamous cell carcinoma keratinocytes Oncogene 1997 14 16 1955 64 22 Gonzalez MV Pello MF Ablanedo P Suarez C Alvarez V Coto E Chromosome 3p loss of heterozygosity and mutation analysis of the FHIT and beta cat genes in squamous cell carcinoma of the head and neck J Clin Pathol 1998 51 7 520 4 23 Pateromichelakis S Lee G Langdon JD Partridge M The FHIT gene in oral squamous cell carcinoma allelic imbalance is frequent but cDNA aberrations are uncommon Oral Oncol 2000 36 2 180 8 24 Piccinin S Gasparotto D Vukosavljevic T et al Microsatellite instability in squamous cell carcinomas of the head and neck related to field cancerization phenomena Br J Cancer 1998 78 9 1147 51 25 Nunn J Nagini S Risk JM et al Allelic imbalance at the DNA mismatch repair loci hMSH2 hMLH1 hPMS1 hPMS2 and hMSH3 in squamous cell carcinoma of the head and neck Oral Oncol 2003 39 2 115 29 26 Garrigue Antar L Munoz Antonia T Antonia SJ Gesmonde J Vellucci VF Reiss M Missense mutations of the transforming growth factor beta type II receptor in human head and neck squamous carcinoma cells Cancer Res 1995 55 18 3982 7 27 Eisma RJ Spir
68. AGTATACACTGGCAGTG 3 B Amplification plots of real time PCR We performed real time PCR for cDNA from the cancerous tongue tissue from the patient and cDNA from non cancerous tissue of the control GAPDH mRNA was quantified as an internal control C Agarose gel electrophoresis of real time PCR products The PCR product obtained from B was run on a 2 agarose gel for electrophoresis Lane I intron PCR 167 bp lane E exon PCR 144 bp lane G GAPDH PCR lane G GAPDH PCR using DNase treated RNA without reverse transcription as a template lane M HinclI digests of x174 phage DNA GAPDH glyceraldehyde 3 phosphate dehydrogenase 35 IVSI45 G to C conversion 1280 Un eRe ah ve eres OE DET UNT TUER SDN ENIM ROS aa CTGA RSV LLL intron 1 gt 1360 1440 1520 1600 Figure 10 Sequence profile of the intron transcript The sequence contained the mutated intron sequence 36 exon 1 exon 2 exon 3 VHL gene MAA AAA GCCGCATCCACAGCTACCGAG gtac c m we A AGTCAGGACAGCTTGTATGTAAGGAGGTTT G x SNaPshot primer intron 1 T B 0 56 exon 3 J T B 0 48 Figure 11 LOH of the VHL gene LOH was analyzed at the heterozygous point mutation G C of the intron 1 splice donor site and at the SNP A G of the exon 3 of the VHL gene using a quantitative genotyping method Comparison of cancerous tissue T and the peripheral
69. D Song H Evans JA Lang JC Schuller DE Weghorst CM Mutation and downregulation of the transforming growth factor beta type 40 II receptor gene in primary squamous cell carcinomas of the head and neck Carcinogenesis 1997 18 11 2285 90 42 Smith J Rattay T McConkey C Helliwell T Mehanna H Biomarkers in dysplasia of the oral cavity a systematic review Oral Oncol 2009 45 8 647 53 43 Gebhart E Comparative genomic hybridization CGH ten years of substantial progress in human solid tumor molecular cytogenetics Cytogenet Genome Res 2004 104 1 4 352 8 44 Garnis C Campbell J Zhang L Rosin MP Lam WL OCGR array an oral cancer genomic regional array for comparative genomic hybridization analysis Oral Oncol 2004 40 5 511 9 45 Maher ER Iselius L Yates JR et al Von Hippel Lindau disease a genetic study J Med Genet 1991 28 7 443 7 46 Yoshida M Ashida S Kondo K et al Germ line mutation analysis in patients with von Hippel Lindau disease in Japan an extended study of 77 families Jpn J Cancer Res 2000 91 2 204 12 47 Gallou C Joly D Mejean A et al Mutations of the VHL gene in sporadic renal cell carcinoma definition of a risk factor for VHL patients to develop an RCC Hum Mutat 1999 13 6 464 75 48 Maher ER Webster AR Richards FM et al Phenotypic expression in von Hippel Lindau disease correlations with germline VHL gene mutations J Med Genet 1996 33 4 328 32 49 Zbar B Kishida T Che
70. IVS ins GGT Type 1 Stolle C45 6 IVS1 1 del5 Type 1 Olshwang S44 7 IVS1 5 G gt C Type 1 Zbar B43 8 IVS1 5 G gt C Type 1 Stolle C45 9 IVS1 5 G gt C Type 1 Maher ER 10 IVS1 5 G gt C Type 1 Zhou J48 11 1VS1 5 G gt C Type 1 Erlic Z47 VHL von Hippel Lindau IVS intervening sequence 26 A CACACACA CACACACA CACACA LOH N T B CACACACA CACA MSI CACACA CACACA N T Figure 1 Schematic diagram of LOH A and MSI B N non tumor T tumor LOH loss of heterozygosity MSI microsatellite instability 27 number 25 20 15 o tongue larynx 10 80 84 WG age 85 89 40 44 45 49 50 54 55 59 60 64 65 69 70 74 75 79 35 39 Figure 2 The age structure at diagnosis for cancer of the tongue and the larynx in Nihon University Itabashi Hospital between 2010 and 2012 The total case number of tongue cancer and laryngeal cancer is 35 and 87 28 A see nn AGTCA GAGGTTT G eec nmn SNaPshot primer 4 ddNTPs Dye terminator Primer extension A li h 1 J 1 fh A 1 j J LA 35N 351 51N S11 S2N S21 f AA h 53N 53T 166N 166T Figure 3 Analysis of LOH of the VHL gene We performed quantitative primer extension analysis using dye terminators at the A to G SNP at position c 1008 in the VHL gene Arrows indicate reduced signals
71. ctgagatgaaacagtgtaag 23 Table 4 Comparison of clinical features of tumors with and without LOH at 3p or VHL alone LOH of 3p VHD Feature P lt 40 1 0 4 4 0 180 Age EN UU 1000 9 0 060 Male 5 2 5 3 Sex 2 Female SO 93 oo 5 2 3 1 Smoking i MEME 40 100 5 2 3 0 Alcohol ee a 42 1 es I 1 0 4 2 I 9 4 6 3 Stage IE 0 0 2 0 a VD 20 1 9 4 9 6 Grade 2 2 1 4 0 3 0 0 1 0 LOH loss of heterozygosity VHL von Hippel Lindau gene UICC International Union Against Cancer The numbers in parentheses indicate those with LOH of the VHL gene alone 24 Table 5 Primer sequences used in this chapter Region Forward 5 3 Primer bp Comment Reverse 5 3 VHL E1 I1F CACAGCTACCGAGGTACCG 167 Exl dni1 IIR GAATGCTCTGACGCTTACGA VAL 1 2F AGCTACCGAGGTCACCTTTG 144 Ex1 Ex2 2 3R CAGAGTATACACTGGCAGTG GAPDH GGTCGGAGTCAACGGATTTG 231 GCATCTCGCTCCTGGAAGAT VHL AAGAAGACGGCGGGGAGGAG 320 Inl GGCTTCAGACCGTGCTATCG LOH SNaP GCCGCATCCACAGCTACCGAGGTAC VHL CTGCCCATTAGAGAAGTATTT 110 Ex8 AATTCCCACTGAATTAGGTATA LOH SNaP AGTCAGGACAGCTTGTATGTAAGGAGGTTT Ex exon In intron 25 Table 6 VHL diseases with mutations at the splice site of VHL gene Site Mutation VHL disease Reference No 1 IVS1 1 G gt A Type 1 Glasker S46 2 IVS1 1 G gt A Type 2B Olshwang S44 3 IVS1 1 C gt T Type 1 Olshwang S44 4 IVS1 1 C gt G Type 1 Olshwang S44 5
72. in the primer extension analysis due to LOH at this particular locus Case No 35 did not show LOH at VHL and is shown as a control N non tumor T tumor The left peak indicates the G allele and the right peak corresponds to the A allele LOH loss of heterozygosity VHL von Hippel Lindau 29 Control SNP N T A TATAC 110bp cfrarac Ne No wp 90bp Accl 20bp Case 51 Case 52 Case 53 Case 166 Case 171 N T N T N T N T N T Figure 4 RFLP analysis of LOH in the VHL gene in samples of tongue squamous cell carcinoma DNA sequences around the A to G SNP at position c 1008 in the VHL were amplified by PCR and the PCR products were digested with the restriction enzyme Accl and subjected to electrophoresis through a 2 NuSieve 1 agarose gel Arrows indicate PCR fragments whose abundance was decreased in DNA isolated from tumor tissues compared to DNA isolated from normal tissue N non tumor T tumor RFLP Restriction Fragment Length Polymorphism LOH loss of heterozygosity VHL von Hippel Lindau 30 D3S1609 Case 52 D3S1612 Case 52 N T N T 258 270 258 270 211 215 D aie g IS ETON et T a M J 8 Al N f f JI N NA AN Aj N KE A 3S7300 Case 177 D3S1317 Case 171 N T N 224 234 224 234 T E e 174 al al n as A ME Al ATU ae Paes A NA NE NE AFM0
73. n F et al Germline mutations in the Von Hippel Lindau disease VHL gene in families from North America Europe and Japan Hum Mutat 1996 8 4 348 57 50 Olschwang S Richard S Boisson C et al Germline mutation profile of the VHL gene in von Hippel Lindau disease and in sporadic hemangioblastoma Hum Mutat 1998 12 6 424 30 51 Stolle C Glenn G Zbar B et al Improved detection of germline mutations in the von Hippel Lindau disease tumor suppressor gene Hum Mutat 1998 12 6 417 23 52 Glasker S Bender BU Apel TW et al The impact of molecular genetic analysis of the VHL gene in patients with haemangioblastomas of the central nervous system J Neurol Neurosurg Psychiatry 1999 67 6 758 62 53 Erlic Z Hoffmann MM Sullivan M et al Pathogenicity of DNA variants and double mutations in multiple endocrine neoplasia type 2 and von Hippel Lindau syndrome J Clin Endocrinol Metab 2010 95 1 308 13 54 Zhou J Wang J Li N et al Molecularly genetic analysis of von Hippel Lindau associated central nervous system hemangioblastoma 41 Pathol Int 2010 60 6 452 8 55 Maher ER Yates JR Harries R et al Clinical features and natural history of von Hippel Lindau disease Q J Med 1990 77 283 1151 63 56 Davies DR Norman AM Whitehouse RW Evans DG Non expression of von Hippel Lindau phenotype in an obligate gene carrier Clin Genet 1994 45 2 104 6 42 Ur A WU
74. o JD von Biberstein SE Lindquist R Kreutzer DL Decreased expression of transforming growth factor beta receptors on head and neck squamous cell carcinoma tumor cells Am J Surg 1996 172 6 641 5 28 Waber PG Lee NK Nisen PD Frequent allelic loss at chromosome arm Sp is distinct from genetic alterations of the Von Hippel Lindau tumor suppressor gene in head and neck cancer Oncogene 1996 12 2 365 9 29 Partridge M Emilion G Pateromichelakis S Phillips E Langdon J Location of candidate tumour suppressor gene loci at chromosomes 3p 8p and 9p for oral squamous cell carcinomas Int J Cancer 1999 83 3 39 318 25 30 Huang Q Yu GP McCormick SA et al Genetic differences detected by comparative genomic hybridization in head and neck squamous cell carcinomas from different tumor sites construction of oncogenetic trees for tumor progression Genes Chromosomes Cancer 2002 34 2 224 33 31 Li X Lee NK Ye YW et al Allelic loss at chromosomes 3p 8p 13q and 17p associated with poor prognosis in head and neck cancer J Natl Cancer Inst 1994 86 20 1524 9 32 Mochida J Esumi M Kitajima A Okada K Allelic loss analysis of tumor suppressor genes regardless of heterozygosity von Hippel Lindau gene loss in renal cell carcinoma J Urol 2008 180 2 724 8 33 John SW Weitzner G Rozen R Scriver CR A rapid procedure for extracting genomic DNA from leukocytes Nucleic Acids Res 1991 19 2 408 34 Chino K Esumi M Ishida
75. s in the bar graph indicate the number of loci with LOH The 19 cases showing more than one LOH and more than two informative loci are shown in gray LOH loss of heterozygosity 33 VHL gene exon 1 inton 1 p F primer gt AG gtacgggc TC catgcccg R primer A B exon 1 intron 1 exon 1 intron 1 g c exon 1 intron 1 intron 1 exon 1 Figure 8 Sequence profiles of exon 1 to intron 1 of the VHL gene We compared DNA sequence from the cancerous tissue A and the peripheral blood B of the SCC patient to those of a control patient C The DNA from the peripheral blood of the patient was also sequenced in the reverse direction D VHL von Hippel Lindau 34 A exon 1 intron 1 exon 2 exon 3 Intron EI IIF gt IIR Exon 12F II PR B Fluorescence C I EG G M 10 PT Lt X n Patient ntron A 0 1 ili 167bp gt iil 144bp 001 7 19 15 20 25 30 35 40 P Cycle number Fluorescence MIEGG n GNPDH 1 M Exon 1 Control 01 au ntron AVIA 144bp gt 0 01 Mc TUTO 1 5 10 15 20 25 30 35 40 Cycle number Figure 9 RT PCR cripts A Primer positions of intron and exon PCR E1 11F 5 CACAGCTACCGAGGTACCG 3 11R 5 GAATGCTCTGACGCTTACGA 8 1 2F 5 AGCTACCGAGGTCACCTTTG 3 2 3R 5 CAG

Download Pdf Manuals

image

Related Search

Related Contents

Regulatory and Safety Guide:  Full Size User`s Manual  CRM USER GUIDE  

Copyright © All rights reserved.
Failed to retrieve file