トラフグ連鎖地図の作製と比較ゲノム解析
Contents
1. 81 2007b 10 En zx 2 3 S mon and Wol2. BE 86 4 Figure and Table 87 2 109 17 3 4 8 13 6 SKUIT REAR 16 21 5 1 7 14 18 19 11 12 15 20 1
3. 70 Ensembl 1 1 KZ FUGU 4 0 Ense
4. Co OM 22 RF 21 18 fH 1 1
5. COR 2 1 Jaillon et al 2004 Woods et al 2005 Kasahara et al 2007 71 Jaillon et al 2004 P 3 A B
6. E 109 Yu 1 2
7. cM Mb 11 Figure 8 2000b 12
8. Oryza sativa International Rice Genome Sequencing Project 2005 Fadiel et al 2005 DNA DNA marker assisted selection MAS MAS 1
9. 21 200 scaffold 30 kb scaffold 5 similarity score gt 2000 scaffold 3 1scaffold 3 10 kb BLAT Kent 2002 a minimum 3 3 2
10. 4 hun 65 Ensembl fiL 3 MMA C1 1 triple 3
11. Afi 2000a 525 425 Lee et al 2005 Moen et al 2008 ASAE CU 6K NORE T ZTE KAR l ASLO LTA EER Table 1 201 368 Table 1 f5 f200
12. Hedges and Kumar 2002 Hinegardner 1968 300 DNA DNA Tetraodon nigroviridis 380 Mb Brenner et al 1993 iX 400 Mb SS NN et Homo sapiens 118
13. 1 v 2 2
14. 2 H Dal EC X Gs 18 400 19 900 104 f EOD
15. Edwards and Page 1994 2 MAS N NS
16. Dy MAS amp ZR IRA HE EI ED EL SREL 1 1 I A fij WCF Ai HI 1 2006 E CHEE EE gt EA 772AB E Jw C 5 pei 8 TE lt
17. LAL RB 1
18. Navarro amd Barton 2003 HFL 1 50 V JE AES IT BV C HX E COS Yu 1 84 LEE LA HE
19. 1 Hi 2 RAE S COPS ICIS dg RATHER CoRR C AREE IL UY C6 SPS EPIS EX On 7 A DS ve cum ZOI EFLA Ee fi C
20. scaffold L TOR Oxford grid 60 D 22 421 28 653 1 1 15 068 Ensembl 10 482 Figure 9A Supplemental Table 12 2 15 1 1 18 1 1
21. 3 RICE SX SEU ae l ETT HE SH Aon W L COME LEA AR LF u ftti D f amp fi
22. 0 78X10 0 81 x10 3 72X10 DC 3 38X10 Table 10 Supplemental Table 23
23. Un 2 29 N 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 1 e E 1 o vo am AWD 10 1 B Gi 11 4 12 5 13 3 14 2 15 1 16 2 vm 1 1 18 2 19 2 20 1 21 22 E 5 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 X 1 o Am bm 10 11 E E 12 1 1 3 1 DI 13 14 15 1 1 2 E 17 5 18 1 19 Ee 1 al 2 21 1 1 22 1 2 Figure 4 A
24. FUGU 4 0 Ensembl version 48 4h TETRAODON 7 Ensembl version 48 1j Ensembl 1 1 FUGU 4 0 Ensembl version 48 4h HdrR Ensembl version 48 1d Woods et al 2005
25. pg 2 Figure 17C 75 3 200 299 300 399 gt 400 13 9 4 6 76 4
26. Dok w uy 3 10 2005 scaffold
27. 4 6 ze AK 72
28. Rat Genome Sequencing Project Consortium 2004 Bourque et al 2005 100 3 62X10 4 93X10 0 68 X 104 1 8SX10 ESL 3 2 97 x 1077 FLAC 3 08X10 Comai 2005
29. l WOT LEO HA 33 1 v3 0 v4 0 scaffold scaffold 500 v4 0 BLAST E value gt e MU v4 0 144 scaffold 1 E 23 100 kb scaffold 516 scaffold
30. 66 2 67 22 421 28 65 3 Ensembl Supplemental Table 15 al 2005 1 496 mu 758 i 4 f amp fi 3 20 604 1 1 7 755 Woods et E Supplemental Table 16
31. 2 Comai 2005 Ma and Gustafson 2005 Chen and Ni 2006 S mon and Wolfe 2007b 1 150
32. 42 3 Figure and Table 43 6 6ZL 3 QqN L NPE IN201 4 CS Z it UE et El e dE et E EE IECH Ware T plojyeos7 E EE E EE E poese AR UK coL 2455 2 did 200 Ce prz EIpIoJJe s 2 732 sse YR CAFEP TI JOHS VAROR cso 380 3 p104Je582 71 8 3227 c A OF AHE EEN One Lt DT ERONEN MEX Wo yog DEO Ar c C RE RECO 2 4 2 EIER E E CO Int YOR d E EHE RET ae ECH VW OS SERE REREMERCUR eest Tac ngmamen ert geess 9 nb vU Le 6EL 0 9 L E V Oo o 6221 FT Lu qIN T E IN OT Lv m CELL 0 v 10L Wo 186 1 86 L16 H 36 ZS6 E TRE s NS z E 1 88 m 98 S18 a 7 88 E IR 8 Zeg a Lh Lye a zeg LJ zv8 B d oze Veg E 6 t8 a 018 Li L 8 d rei Vi ri rei ze Weier zsh B8 Lev gar J Z z es zvL n KA t Vit L ozy 0 4 H 0 05 99 E aie 769 a SL ug rop gea Em yep 69 HS et 29 I 9H 6 99 8 8 97 Lon B i oec KE Li 619 E sey Cac See d pe 0 09 T Lge U Ces D ory 95 E 91S v 8S LI eee Eh Less oer Li gees Li BEE SYS aj 67s U Fr LS o ses EZE 2 ger i U zs 0 s 98v zos a 097 ger i 602 ger DZ H mp d Zi Ken be
33. 1 v3 0 scaffold T 2002 1 AFR 2 2005 v4 0 scaffold 3 BAR
34. 1994 3 international System for Human Cytogenetic Nomenclature p al 21
35. VES scaffold 39 Mb 12 4 452 Figure 2 IW v3 0 10 i50 ZE L MEO E SC Dib
36. 18 1 3 a s 4 XE 1 2 3 4 im LAR OS CD ROM Supplemental Table 1 25 21 32 58 104 107 111 112 UL gt zi E
37. 7 300 9 600 D Yamanoue etal 2006 8 700 58 1 2 DL
38. N ol 106 kb EL mu D Beeler Oey i XC PRO SER T ly jj eR E OJE 1 MS AIS
39. 2005 2 OEY 1 CORR
40. 2 f C do
41. 110 ARE DNA Institute of Molecular and Cell Biology Byrappa Venkatesh T
42. Semon and Wolfe 2007a Brunet et al 2006 F 1 Wia
43. are ZO i u x ECLA jJE E RH EO FEM Ze EH Ge z E bk Ed ne i 105 dU DALI BIER OS Ups h Yamonoue et al
44. 1 600 Mb Venkatesh et al 2000 Griitzner etal 1999 NN 27 2 Figure 28 SKRYTY Rth 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Un 0 400 bk wn Figure 3
45. LTWS TERS LV 70 ET scaffold 288 Supplemental Table 9 1 scaffold 193 42 190 scaffold 124 Supplemental Table 10 11 74 HO scaffold Institute of Molecular and Cell Biology scaffold
46. B oes DNA 1 1 Brenner et al 1993 Elgar et al 1999 90 ACGAGAAAACGTCAAAAACGTCATAATGTGAGCGCAGCATGAGTTTTCAGGT GATCATGTTGAATTTACCTCTGTTTTGAGAAACTTGTATATCCTGACCAAAAGTG ATGGTTTCCCC in situ hybridization
47. 14 28 26 32 25 Figure3 1 EA AL TOF TruS Tru8 CE Tru5 Tru8 2 2 X D
48. Lm Jaillon etal 2004 Naruse etal 2004 87 69 Z
49. v3 0 DNA DNA DNA 4 8 kg 2 7kg Fujita 1967 Matsuyama et al 1997 DNA Asahida etal 1996 300 mg 400 uL D 8 M TNESUS 10 mM Tris HCl pH 7 5 125 mM NaCl 10 mM EDTA 1 SDS 8 M 20 mg mL Proteinase K Wako 20 uL 37 1 2 5M NaCl 50 uL 500 pL 1 1 Ex PEP LIEK 15 000 rpm 5 Ow DAHES ITV
50. 33 Supplemental Table 16 33 DRZ AZ 23 Figure 12 RIC at 168 2 Supplemental Table 16 17 Figure 12 2 X AncA AncX
51. GBfs 2000a 2003 DNA Danio rerio Oryzias latipes Woods et al 2005 Kasahara et al 2007 Ensembl http www ensembl org Ictalurus punctatus Oncorhynchus mykiss Salmo salar 7 EE Salmo trutta Oreochromis niloticus Dicentrarchus labrax Sparus aurata Seriola quinqueradiata Paralichthys olivaceus Scophthalmus maximus Hippoglossus hippoglossus MAS Waldbieser et al 2001 Sakamoto et al 2000 Moen et al
52. 41 Tru12 Olal1 AT 7 E Trul4 Olal0 Ek 23 WAAC 20 23 507 553 Ensembl 14204
53. i 234b 72 Edwards et al 1998 Elgar et al 1999 BA EE Gr tzner et al 1999 Clark et al 2001 2002 pP Aparicio et al 2002 S E x MAS HE D
54. Kasahara et al 2007 4 COW 3 1 3 7 55 96 3 Figure 12 Supplemental Table 15 18 10 3
55. i Ano ARV 99 1 220 1 233 1 220 179 9 cM WEHI 1 E VES 572 ON 337 Mb 195 scaffold EES 225 Mb 21 89960 HHE scaffold 749 scaffold Table 4A 22 37
56. LAL 25 14 8 500 E E Springer et al 15 030 12 518 IZ EE
57. 749 1 scaffold Figure 7 Z scaffold 696 1 scaffold Dr Venkatesh 696 scaffold OW 278 scaffold f 282 Mb Table 4B 696 338 Mb 86 72 4B 118 EO 93
58. n gt 2 n 1 1 2 6 1 2 2 10 8 1 7 3 9 5 1 1 4 17 5 0 4 6 4 11 3 6 7 8 13 2 8 9 13 7 0 6 10 6 6 0 3 11 16 8 0 5 12 21 6 0 4 13 5 4 0 3 15 7 7 0 6 16 14 7 0 4 17 18 5 0 4 18 19 11 1 5 19 11 8 0 4 21 12 6 1 3 22 15 1 0 0 nm 1 100 Table 8 _ n gt 2 n 1 2 22 23 7 17 3 7 12 4 9 4 15 26 4 19 5 8 21 8 16 6 12 33 13 23 7 16 34 13 27 9 6 34 4 27 10 20 16 3 13 11 13 31 1 25 12 11 45 7 41 13 3 21 7 15 14 10 11 1 7 15 14 35 4 30 16 24 35 2 29 17 1 45 9 40 18 23 29 6 19 19 5 34 7 25 20 4 37 12 27 21 9 31 3 25 22 17 31 14 27 nm 1 101 WGUL ECURSINKK Zz4 n4 nt Oll Le ets2t reo OO SL zu9 ert ge 7596 681 HS 0 0 ER l 0 0 285 l Got zz 0 0 819 z 0 0 928 L 5 668 008 Lz 0 0 s68 b LIZ l oe g 662 002 0z z66 8 6zL v2 ees ol 028 2 91 661 001 6l 057 8 6 OL e9s 9 ei
59. Un 97 1 2 3 4 5 6 7 8 9 1011 12 13 14 15 16 17 18 19 20 21 22 Un Figure 16 Un 98 D 300 mm mm 250 mm 25 200 m m 150 15 100 50 D gt To o o 1 2 3 4 5 6 7
60. scaffold scaffold Kasahara et al 2007 Hill et al 2008 v3 0 scaffold 319 Mb 20 379 scaffold 80 4 100 scaffold LAL 2005 yv3 0 26 v4 0 Joint Genome Institute Fugu rubripes v4 0 http genome jgi psf org Takru4 Takru4 home html 393 Mb 7 213 scaffold
61. Naruse et al 2004 Woods etal 2000 NCBI human genome resources Oxford grid Edwards 1991 Oxford grid 23
62. LA MAS DNA MAS Fuji etal CH
63. C 90 C3 21 9002 7e 18 enouewie Af MEOH eo 7 EE BE Elise Cl BVPI SORES ee S v d SE CY FIL OMS 9E Y P xy aste D ECO ZE CECR EG SCH EA E PPIFORBR WOE RIB E COE BEBIUSEG C GCCPBNO KLOT Sy ye COBRE ALL 3 71 Bl I Co EXIRET Sy E COE BEBUIEI A C Fe CIEE S C XISr V OT FEECa LAK oc ccc ITEM 18 AWB XC XE OB COS BEBUEUE ee GL EPR SB ROR Sa ZL amb ALEJ 6 SEZ Ll erly OLELLOZ99LIZL8LZ 8 ELZZSL Z ZL6LIZ ZLLLG6L8LHL Z Sl29EL8 v OZ 9101216 SIZ LZ6L8LZL9LSLOZ LELZLOL6G6 29 8 S IL EZZL IL ALI T ULL ABBE eX OL E 4CL 4 D dE gt Seeche LE bk SZ ZZZZ1Z0Z6L8LZL9LSL LELZLLLOL6 8 2 9 Se EC L Du CH edhW YZE suoisny Z uolsn PREAL TANE EUM ERAI ME HI TI XMANLSYDdJONWIJFIH943094V KREEK AL sjuauiebue ueai sofew ON uolsm gJA L6L 91 Un Tni2 Tru1 Un Un Tni12 Tru21 Un Figure 13 Tru
64. 14 730 SH Pagrus major Taniguchi 2007 BSLXEIC EET 1 p SAR CIS HEF A 1 Taniguchi 2007 PI ECH DEY Sebastes crameri N 9 157 Verasper moseri H Tv Gomez Uchida and Banks 2006 Taniguchi 2007 Xe
65. MEC 507 1 cM 1 100 8 cM 11 D 22 AX Miyaki et al 1995 1 ELT TWH DBA BAIT SNS 3 ZW
66. e 0 5 cm 3 KE KE 3 E DNA E 400 uL 8 M TNESUS S DNA Molecular and Cell Biology HU f 1 508 HOT 34 1 Quick Gene DNA Tissue Kit S FUJIFILM DNA fi KEDA 2 Dr Institute of 406 PCR 1 ng nhL DNA 3 uL Forward primer 10 pmol uL 0 025 uL Reverse primer 10 pmoluL 0 25 uL IRD M13 primer 10 pmol uL LI COR 0 25 uL 10xPCR Buffer Takara 1 uL dNTP Mixture 2 5 mM Takara 0 8 uL r Taq DNA Polymerase 5 U uL Takara
67. v3 0 200 scaffold scaffold 2 39 Mb 10 WE scaffold scaffold
68. Figure 5 A 2 B 18 4 Supplemental Table 5 Oxford grid 3 2 1 31 3 1 200
69. 18 400 19 900 8 700 Springer et al 2003 14 et al 1999 28 000 Kumazawa 3 28
70. lz Ey Fa AA 9 612 1 2002 4 IREL EKRE VELTA EC gt d E E g i UA 400 Mb HLA ll 75 DNA L 1 insilico
71. scaffold HL p PCR 50 kb 100 kb scaffold ON 147 RIC UT PCR 300 kb scaffold tailed primer PCR PCR Forward primer M13 CACGACGTTGTAAAACGAC 1 459 PERL 1 DNA 1 1 scaffold
72. 83 278 scaffold 86 338 Mb L 282 Mb 4 7300 9600 8700 6300
73. 1 AncB AncA B 2 Tni2 H J 3 2 E 5 ve 1 ED 24 ffi E 1 Ancl AncJ Trus E ly GT NOT H 24 A
74. Kikuchi etal 2008 w AFH F BH EL 7 DG MELEAEW DRADER T n E pe HE da 3 Bourque er al 2005 Gallus gallus Mus musculus Rattus norvegicus fn Postlethwait et
75. Figure 12 AncA 1 Tru1 E 7 5 3 68 Kasahara et al 2007
76. ORF BLU 77 3 Ensembl 1 1 KIT KL RK 3 ET 2
77. cM Mb GC Gallus gallus Myers et al 2005 Shifman et al 2006 Beye et al 2006 Groenen et al 2009 GC cM Mb 2 1 GC GC GC Aparicio et al 2002 Kasahara et al 2007 GC cM Mb 2000b
78. di 1 LAID Be f TAZ scaffold 30 kb scaffold Cm Ze 1 MEIZET scaffold 819 http getentry ddbj nig ac jp v3 0 BLAST lt 1 gt
79. 38 11 73 Table FE 2 4 REE Au A 11 Ro A E 30 x a nf mill 35 Jk scaffold 7 id ll 12 1 v4 0 BLAST scaffold Table 5
80. Tni Un 92 Un Tni10 Un Tni4 Un Tni6 Un Tni5 Un Tni9 Tru2 Un Tru3 Un Un Un Tni17 Un Tru4 Un ES c Tru6 Un c 5 co c H Tru10 Un c 5 Tni7 Tru13 Un Tru15 Figure 13 98 Tni13 Un Tni21 Un Tni14 Tru16 Un Un Tni18 Un Tni15 Figure 13 Tru22 Un Un Tni19 94 Tru18 Un Un Tni11 Tru19 Un Un Ola22 Un Ola8 Un Ola6 Ola7 Ola15 Tru2 Un Tru4 Un C um SS d c 7 1 e e 5 LO S o ES o EN LU Tru6 Un Un Un Ola20 Ola13 Tru10 Un Tru11 Un Figure 14 Tru
81. 3 1 5 6 43 MKERE DS TVA NEIER II 4 y vals 1 6 2 2 ED cM Mb Table 6 Naruse et al 2004 Woods et al 2005 Ensembl EHH 1 9 Lee et al 2005 Ensembl 2 0 3 6 E D Ss a 95 1 2 Table 6 Peichel et al 2001 cM Mb cM Mb Macaca mulatta Equus caballus T 1 1 0 7 0 4 0 9 Wilfert ez al 2007
82. scaffold f369 f375 f377 f386 scaffold scaffold f460 CA scaffold f496 f502 19 Table 2 scaffold EHE LG1 LG2 LG3 LG4 LG5 LG6 LG7 LG8 LG9 LG10 LG11 LG12 LG13 LG14 LG15 LG16 LG17 LG18 LG19 LG20 LG21 LG22 17 17 12 12 14 Co MO On Om 200 scaffold bp 3 284 077 3 003 930 2 521 477 2 344 834 1 844 110 1 543 293 1 743 445 1 005 816 1 526 000 2 414 664 1 695 911 3 690 823 1 403 550 582 240 2 018 465 645 346 906 885 992 949 1 286 233 1 409 226 2 031 407 1 302 580 39 197 261 394 481 231 233 279 190 197 110 146 299 135 451 65 40 186 76 139 92 136 111 254 207 4 452 LG1 16 LG2 16 LG3 10 LG4 11 LG5 M1 4 LG5 M2 6 LG6 7 LG7 M1 2 LG7 M2 6 LG8 7 LG9 7 LG10 9 LG11 7 LG12 10 LG13 5 LG14 5 LG15 5 LG16 4 LG17 7 LG18 2 LG19 5 LG20 6 LG21 5 LG22 7 169
83. BR HW x macer ZZ ABA Monodelphis domestica 4 1 E JE WW x DNA lt v 5
84. 0 18 X 15 Tru7 Tni8 H H Yu EUG Tru22 Tni15 F 73 decks 1 x 4 H 72 565 lt 134 Dick 7 84 Trul Tni2 Trul Tni2
85. Hillier et al 2007 N Em Small et al 2007 mg AX o i DeWoody and Avise 2000 X 78 f amp f amp Ss Cr Cm HED 83 Be FR NS 1 500 000 W Yu et al 2001 Wu 4 524 L Ne 250 25 000 dE 30 3 000 Z mp X Ne Hr 8 XH 23 IR
86. 0la SRB Un 95 Un Ola11 Un Ola14 Un Ola23 Un Ola9 Tru21 Figure 14 Ola3 Un Ola24 Ola5 Un Ola17 o 96 Un Ola10 Un Ola1 Ola4 my PT m 1 2 3 4 5 6 7 8 9 1011 12 13 14 15 16 17 18 19 20 21 22 Un Figure 15
87. FE Yamanoue et al 2006 Vm E pei mE E 3 S DI gt SAS ME HY Py gt MA FLA CL Naruse et al 2004 Jaillon et al 2004 Woods et al 2005 Steinke et al 2006 Brunet et al 2006 Semon and Wolfe 2007a Kasahara et al 2007 O Aiea i amp 5 T El LED 2 2 Fy F
88. zn ge be 35 GEREG v4 0 BLAST E value gt e ul Ze t scaffold scaffold 36 PCR 9 Table 6 1 021 1 2121 1 057 1 Figure 6 1 000 22
89. 3 1 2 4 3 4 Eg Kasahara etal 2007 2 BR 63
90. 29 0 cM 18 7 92 171 697 1 cM 4 1 cM 75 0 cM EE 2 TE 169 Figure 1 Table 2 Supplemental Table 2 3 169 184 ger XM 49 188 50 160 212 569
91. 869605 IZ 72 HAA u 2d 35 k OES Hh EH ZHE cM Mb g Em E 1 202 8 cM 2 189 8 cM UFI v4 0
92. 10 E 3 HH LOY 86 3 59 Ensembl 1 1
93. pi 1 b 2 B E CISA HN Semon and Wolfe E 1 H Kasahara et al 2007 Uke Ak E 10
94. lt 2 gt 3 f E value E value 3 lt 4 gt EST Naruse etal 2004 EP DDBJ E E value gt e E value E value lt 3 gt E KEMO E value E value 3 NCBI human genome resources http www ncbi nlm nih gov
95. 1 MAS FME f Kikuchi et al 2007 E L Z ZS H SS 2007 MAS
96. scaffold r Wi scaffold 1 E L ik EP BAT Sct ly X7 7 ono DS can
97. Conery 2000 Taylor et al 2001 Semon and Wolfe 2007a Scannell et al 0T EL 4 Ohno 1970 Nowak et al 1997 Dehal and Boore 2005 2 2 F E 1 16 1T Sov ELT amp ff
98. Tru1 Tni2 Tru2 Tni10 Tru3 Tni9 Tru4 Tnil7 Tru6 Tni4 Tru7 Tni8 Tru9 Tnil3 Trul0 Tni6 Trull Tnil6 Trul2 Tni21 Trul3 Tni5 Trul5 Tni7 Trul6 Tnil4 Trul7 Tnil8 Tru18 Tni19 Tru19 Tnil1 Tru21 Tni12 Tru22 Tnil5 Tru5 Tru8 Tni3 2 1 Trul4 Tru20 Tnil Tru8 Tul4 Tni20 Trus Tru8 Tru14 Tru20 Tnil Tni3 Tni20 22 421 20 604 1 1 13 557 Ensembl
99. EL multi point analysis HL CHL H 74 1 SE 8 M 9 Takara 95 TOE TR ENT VRE A f DNA PCR PCR Grattapaglia and Sederoff 1994 E 6 Kosambi Kosambi 1944 PCR DNA PCR 389 376 PCR 184 IRER Supplemental Table 1
100. 18 scaffold 6 aC HF TERE WAY BIC 11 lt Figure 6 1 4 9 10 13 14 15 17 18 20 21 ES Ex Figure 8 7x NI Ir 7 AS 3
101. 3i NN E bk K 3 S d ze ed fe 2c HH D Arle ix Co MS 6 MS DNA TER UR
102. ul 200 scaffold 152 Table 4 1 Trul 17 15 1 2 Tni2 m Tni2 1 1 Trul2 Tni21 Tru13 Tni Tru15 Tni7 14 15 Trul Tni2 Tru2 Tnil0 Tru3 Tni9 Tru6 Tni4 Tru7 Tni8 Tru9 Tnil3 Trul1 Tnil6 Figure 3 Supplemental scaffold 2 scaffold Tru21 Tni12 Tru22 Tnil5 Tru10 12 scaffold Tni17 Tnil8 6 Tni6 El lt 2 1 1 1 Tru4 Tru5 Tru8 Tru10 Tru14 Tru17 Tru20 6 Tnil
103. IN 20 604 1 0 079 4 26X10 Table 10 Supplemental Table 23E F 79 H Bod vuz E 21 WMA 100 100 4 50 X107 4 19X10 2 20X10 1 2
104. Dobzhansky Muller Lynch and Force 2000 Lynch and LOA 2006 RBS 0 1T s E xdv 36 000 Christoffels et al 2004 Vandepoele et al 2004 Hoegg et al 2004 Crow etal 2006 32 400 ENEE WEE GC 7 and Wolfe 2007a nE HAL Semon
105. Figure 5A COW 611 2 31 24 18 HL 88 E 69 22 ob 108 105 Figure 4B EK 88 86 Figure 5B
106. Oxford grid A Oxford grid 2 5 B Oxford grid 2 L C 89 9 12 17 23 13 3 10 16 25 18 24 15 19 7 14 2120 1 4 1122 6 5 8 2 BE 1 1 BE d 1 1 1 1 d 1 f a 1 1 1 1 1 gl 1 1 1 1 1 1 CON PWR
107. 1 mE JEE 18 400 19 900 3 Nelson 1994 K d inpr a F ly lt OF m L 25 000 20 600 21300 754 m L A FH 1 50 Arakietal 2007 eo ee
108. UA 4 EE Supplemental Table 21 22 Figure 17 Table 9 16 18 000 D 5 80 10 749 Figure 17A ACH jn 10 259 3 Figure 17C 2 097 20 Figure 17C 100 199 2 370 Figure 17B 10
109. 3 MAS E Af k iD OO RS SB E Lo DR Hi D LEAR A gt D fa FETA CARTE SET EE Fl E Erickson ez al 2004 Sarropoulou et al 2008 7
110. 3 100 2 2
111. FAT SILC EE 7 7
112. Hillier et aL 2007 Drosophila 12 Genomes Consortium 2007 Hill et al 2008 1 L E E 23 D gt 7g MEY A FE UL AR AS H E AR W HELIO E o Carve AEA H E CHD A Hillier et al N 10 000 ve d 2007 Hill et al 2008
113. 107 1235 MS DNA FS 200 22 18 OO XESEURE Ze T Te v 72 ESSE X 94 3 scaffold scaffold 39 Mb U T 95 23
114. 1 COM 10 1 86 2 2 scaffold 10 3d 40 2
115. 10 482 10 441 99 2 LUBY 38 Figure 9A Figure 9B C 1 952 W 275 46 Figure 10B CO 11 930 12 026 99 1 627 W 259 mj
116. 1 934 14 74 720 599 945 1 23 1 243 1 11 79 677 1 11 Table 9 1 V 1 522 H L EE 19 100 18 400 19 900 7 300 9 600 755 Yamanoue et al 2006 88 700 74 2003 Mikkelsen et al 2007
117. 8 Ek 1 HICKS Fb
118. 2 B 4 Supplemental Table 5 amp Oxford grid Liz 3 2 1 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 GI P o A om 1 1 9 1 10 n 1 1 12 13 2 1 14 1 15 2 H 1 2 16 1 v 2 1 18 1 19 1 1 20 1 21 a 1 1 1 eem 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 X o 4 bk an 10 1 13 n IS 1 12 1 1 1 1 13 1 14 IER 15 1 1 16 1 17 1 Isi 19 1 1 20 3 21 1 22 1 NW
119. 2 2 McLysaght et al 2000 Semon and Wolfe 2007b 2 78 9 635 mr ee 169 0 018
120. Ensembl 14 204 8 Tni12 37 6 11 3 0 A 18 Tru Tni2 1 Figure 13 Supplemental Table 19 Toi
121. 1 1 NEN 18 20 LOL 38 46 QUO E 62 97 Figure 11B C 1 024 112518 91 1
122. 6 300 12 Drosophila 12 Genomes Consortium 2007 Tamura et al 2004 18 400 19 900 Yamanoue et al 2006 3
123. FUGU 4 0 Ensembl version 48 4h TETRAODON 7 Ensembl version 48 1j HdrR Ensembl version 48 1d C Woods et al 2005 1 496 4 D 1 1 3 1 3
124. 26 32 26 E A OD Jaillon et al 2004 64 Naruse et al 2004
125. Jaillon et 20041 1 BOL scaffold 118 Fischer et al 2000 Brenner et al 1993 Elgar et al 1999 57 Crollius etal 2000
126. scaffold scaffold 1 212 108 1021 1 220 22 749 scaffold scaffold 337 Mb VJ 195 scaffold scaffold 330
127. Tru22 Tni15 ERTO 8 E 4 EFI 88 92 1 Ensembl 13 743 1 20 Figure 14 Supplemental Table 20 2 54 Tru17 Ola1 12 Tru14 Ola10 Table 8 36
128. 23 0 ON o bk WwW MN o m ho77 RR gt a a bet IE N o m N N lt 1 E 2 3 1 2 3 4 5 6 7 8 9 19 10 11 12 13 14 15 16 17 18 19 20 21 22 ss EN EH EH ES mmm EDO Em EH EH DUDEN 12 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 E 5 9 hoa Bg 1 2 3 4 5 6 7 8 910111213141516 17 18 19 20 21 E su om EE NS NE EDO mmm Em mr NN S mm 12 34 56 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Figure 9 Oxford grid A Oxford grid 2 5 B Oxford
129. 3 2 24 171 Ties GH Hh 2 169 4 7 cM GER 2 MEMEK ESNY 200 1 212 1 94 2 7 1 cM a 1 213 5 cM 15 F2 117 4 cM QE F 91 HES ED 5 8 MEE 22
130. H KE 4 E UP DMG Ke d Aparicio etal 2002 Takagi etal 2003 23 Mb 3 He E 17 1 Md Cu d 0 105 10 0x 4 CH LAV TOZALA 3d al Lei DNA Al 44M E 2 6 iF LAL D gt D io A ra 4
131. J 200 scaffold D R 39 Mb scaffold 10 scaffold scaffold 4 452 Table 2 104 2 Figure 2 L
132. 1 508 1 88 1 828 57 692 1021 70 EE RH 61 F Supplemental 22 Ov 1 HOSBSHER 5 7 BE OMSK 1 5 10 11 15 17 8 HEE SA HE XI 1 1 cM cM REESE 10 5 2 66 8 cM MEM B 12 BE 2 189 8 cM 1 000 1
133. 43 11 1 10 MARMOL 2 1 2 6
134. ICS Lv BITS al 2000 Woods et al 2000 Naruse et al 2004 Jaillon et al 2004 Woods et al 2005 2 LAL E be Z H KEO m ELHIESTAS2LIcC A D scaffold scaffold b scaffold
135. 23 22 2 1 KZ 2 200 94
136. Trull 0 049 10 206 Supplemental Table 23A REIL Tru14 0 005 424 426 3 0 018 DO 9 466 xt 98 2 Table 10 8 500 Yamanoue et al 2006 Table 10 pe 100
137. 2 Ola19 Ola21 Ola2 Ola18 2 3 15 068 Woods et al 2005 1 496 1 125 Oxford grid 31 400 3 300 Yamanoue et al 2006 Figure 11A Supplemental Table 14
138. 3 3 2 64 Kasahara et al 2007 X 45 000 Yamanoue et al 2006 13 26
139. CNN oO d d oe ed on nt o 0001 ONTOBDOND OW o oc Ss 2g355 oceposogi 8 oc A AN coc OO Geo one Agr sos erer 2 LI o e e une QNo N oO CN on no SCONDTO ot co Q jv cO xf co o9 Qi on orn ocowoo ZIRANA NaM 6 oe c eoo HO id oe MO e e 000 e y N OO KEE eo N e D O OO Gooocooo ele II Wooo mo Jp HRM BD MM eo eet IK NWO TONS e No ei e wo e 0110 00 0 NN e oOo t www 45 onitan m faf N Figure 6 ant Sve 0 8Z oon orm 000000000 mo Ct 10 C3 8 LERSE IN OT 6 s9 019 No re 00 E op 64 c8 tt v 89 5S 59 Ala CN CO OO FED 8 6 00 DI Jt 10 IC LUULLUN E HH0IH HHHHWln H 9 09 Loe Toz 0LZ 6 8 99 onog onto JODOI II Du Jt it OL Jnr L8 Lvl 789 0 s9 s
140. 1 000 uL PEE 7 500 rpm 1 DNA 70 100 uL TE 10 mM Tris HCl pH 8 0 1 mM EDTA DNA Joint Genome Institute Fugu rubripes v3 0 http genome jgi psf org fugu6 fugu6 home html CA Table 1 389 f 7238 f fugu Fisheries Laboratory University of Tokyo PCR PCR 1 ng UL DNA uL Forward primer 10 pmol uL Reverse primer 10 pmol uL 0 5 uL 10xPCR Bu
141. H ii 69 3 2 1 1 D 2 RFL Hillier et al 2007 Drosophila 12 Genomes Consortium 2007 Hillier et al 2007 Drosophila 12 Genomes Consortium 2007 Hill etal 20
142. cM Mb 1 1 10 8 cM Mb cM Mb cM Mb Jenen Seaman et al 2004 EES 1 Henderson 1963 amp iv Z4 1 1 H Mb Rodionov 1996 International Chicken Genome Sequencing Consortium 2004 22 cM Mb 1 1 Groenen et al 2009 41 En cM Mb
143. 15 HOU 1 1 1 1 Tous Tru8 Tni3 2 2 Tni3 1 2 1 1 M7 1 Tni3 Tyler and Sorbini 1996 Yamanoue et al 9 500 9 500 2006
144. 2 2 2 100 CORR 0 47 1 82 AIC 0 78 3 72 0 81 338 1 1 3 87 1 4 77 1 4 17 Table 10 100 4 50X10 449x10 64 0 2
145. 2 06x10 H 9 445 xt 98 0 X10 Table 10 Supplemental Table 23B 100 274 Table 10 Supplemental Table 23C D 0 085 4 47X10 28 653 1 DXA FUE f AX 100 Hed 9 636 0 020 2 33 E 0 086 4 52X10 9 530 1 Ensembl Supplemental Table 24 HEN 0 081 4 26X10 9 509 1
146. PCR PCR Long Ranger FB PCR BOTZA am FB LER 64 2 Jacobs et al 1995 Sewell et al 1999 DNA NA AB CHS Map Manager QTX Manly etal 2001 MAPMAKER LOD 3 0 gt EL SL C cM B ES Lander etal 1987 two point analysis
147. ve 691J 4 9 AI LOEs eec LOREEE E eh II Oe ast 621 pees SET 4 91 cers oes 9 LARREEI 17 Genetic distance in male cM 0 10 20 30 40 50 Genetic distance in female cM Figure 2 2 18 Table 1 f5 f168 v3 0 CA so BLAST scaffold CA v3 0 scaffold f169 f200 scaffold CA scaffold f201 f368 scaffold CA
148. 0 05 uL 10 pL iCycler Bio RAD OSC 2 94 30 59 C 2 35 59C 3 PCR 10 pL Bl 95 10 KECAALE 8 M 6 Long Ranger Takara 4300 DNA analyzer LI COR 1 102 PCR Institute of Molecular and Cell Biology EV DNA illustra GenomiPhi V2 Kit GE Healthcare DNA PCR IRD M13 primer FAM M13 primer ABI3730xl Applied Biosystems
149. Tni2 1 061 80 87 8 5894 84 Tc lA bye Tru21 674 xx REL BH i 2 8Mb 2 4 Mb TruX TniX 6 7 Table 7 EI AV Tru7 Tni8 7 FS
150. lt 1 23 5 9 hoa hel eet et il li iiz ENR LEN nl m 1234 1 2 3 4 5 6 7 8 9 101112 131415 16 17 18 19 20 21 22 m mm Bo mo SELL Leo LA BE 56789 10 1112 13 14 15 16 17 18 19 20 2122 23 24 25 sm m EH EN NS mmm mmm Em EH EH SU ONES NN S WD m s m mr mm Om E EH EH SU END NND S NW 1 2 3 4 5 6 7 8 9 1011121371415 16 17 18 19 20 21 22 23 24 25 1 2 3 4 5 6 7 8 9 10 1112131415 16 17 18 19 20 21 22 Figure 11 Oxford grid A Oxford grid 2 4 B Oxford grid 2
151. 29 Figure 6 99 v4 0 86 Figure APH 64 Jaillon etal 2004
152. MALES Ly 111 Amores A Force A Yan Y Joly L Amemiya C Fritz A Ho R K Langeland J Prince V Wang Y Westerfield M Ekker M and Postlethwait J H 1998 Zebrafish hox clusters and vertebrate genome evolution Science 282 1711 1714 Aparicio S Chapman J Stupka E Putnam N Chia J Dehal P Christoffels A Rash S Hoon S Smit A Gelpke M D S Roach J Oh T Ho I Y Wong M Detter C Verhoef F Predki P Tay A Lucas S Richardson P Smith S F Clark M S Edwards Y J K Doggett N Zharkikh A Tavtigian S V Pruss D Barnstead M Evans C Baden H Powell J Glusman G Rowen L Hood L Tan Y H Elgar G Hawkins T Venkatesh B Rokhsar D and Brenner S 2002 Whole genome shotgun assembly and analysis of the genome of Fugu rubripes Science 297 1301 1310 Araki H Berejikian B A Ford M J and Blouin M S 2007 Fitness of hatchery reared salmonids in the wild Evolutionary Applications 1 342 355 Asahida T Kobayashi T Saitoh K and Nakayama L 1996 Tissue preservation and total DNA extraction from fish stored at ambient temperature using buffers containing high concentration of urea F
153. Mikkelsen T S Wakefield M J Aken B Amemiya C T Chang J L Duke S Garber M Gentles A J Goodstadt L Heger A Jurka J Kamal M Mauceli E Searle S M J Sharpe T Baker M L Batzer M A Benos P V Belov K Clamp M Cook A Cuff J Das R Davidow L Deakin J E Fazzari M J Glass J L Grabherr M Greally J M Gu W Hore T A Huttley G A Kleber M Jirtle R L Koina E Lee J T Mahony S Marra M A Miller R D Nicholls R D Oda M Papenfuss A T Parra Z E Pollock D D Ray D A Schein J E Speed T P Thompson K VandeBerg J L Wade C M Walker J A Waters P D Webber C Weidman J R Xie X Zody M C Broad Institute Genome Sequencing Platform Broad Institute Whole Genome Assembly Team Graves J A M Ponting C P Breen M Samollow P B Lander E S and Lindblad Toh K 2007 Genome of the marsupial Monodelphis domestica reveals innovation in non coding sequences Nature 447 167 178 E ESE 2003 RAR 48 253 256 Ti Miyaki K Tabeta O and Kayano H 1995 Karyotypes in six species of pufferfishes genus Takifugu Tetraodontidae Tetraodontiformes Fish Sci 61 594 5
154. Nakatani et al 2007 2 23 3 2 2 Ric 2 3 1 2 3 EV 4
155. 10 H Golding and Dean 1998 Force et al 1999 Ek 1998 Hughes et al 2000 Steinke et al 2006 Eg Zhang etal ABH 2 466 220 85 66 2 2
156. 23 Figure 12 AncH Supplemental Table 18 27 Anc Tru8 Tni3 AncH Ola8 E oC AncH AncI 3 4 Figure 12
157. Yamanoue et al 2006 2 3 7 300 9 600 1 8 400 19 900 2 31 400 33 300 LAL
158. 13 743 13 006 13 409 COW 3 6 Figure 15 Figure 16 13 003 1 203 9 2 46 17 9 657 74 189 13 403
159. 393 Mb 90 1 118 scaffold E oC scaffold gt scaffold C SE Ec B 500kb scaffold 1 scaffold 2 SATA TW scaffold SUE E077 ml 32 E 1
160. 9 68S AEE 50 cM 180 160 140 4 120 100 80 20 1 2 0 2 4 6 8 10 12 14 16 18 20 22 24 Mb 3 4 5 6 Figure 8 51 7 8 120 140 100 120 80 100 80 60 60 40 40 20 20 0 0 0 2 4 6 8 10 12 14 16 18 10 0 2 4 6 8 10 12 14 16 18 0 2 4 6 8 10 12 14 Figure 8 52 15 16 100 80 60 40 20 80 60 40 20 120 100 80 60 40 20 120 100 0 2 4 6 8 10 12 14 16 0 2 4 6 8 10 12 14 Figure 8 58 Table 3 SSES ES mer ERE YO Lh GRDRGUERMECM CM 1 87 72 99 7 74 179 9 2 54 46 53 2 46 97 7 3 50 42 61 9 41 98 7 4 58 49 42 0 47 98 1 5 56 46 48 7 48 92 3 6
161. f231 15 53 f1217 4 155 f248 13 183 f1208 10 234 f1218 10 342 AY f1202 9 371 f1220 18 378 f1203 410 f1209 14 412 f1210 17 443 AY f1221 1 496 f1207 21 635 f1260 2229 f1261 2938 f1206 3307 3827 4196 4416 f1262 5092 S 5155 z 5230 f1263 6054 6748 7476 7679 8015 8676 9341 e 11945 x 11964 12319 12358 7 13650 scaffold v4 0 56 Table 6 Mb cM cM Mb 393 1 696 4 3 462 886 1 9 Peichel et al 2001 AGH 869 1 402 1 6 Naruse et al 2004 1 100 1 311 1 2 Lee et al 2005 1 440 3 192 2 2 Woods et al 2005 3 087 2 772 0 9 Wilfert et al 2007 VIR 3 179 1 361 0 4 Wilfert et al 2007 TATE IV 3 077 2 408 0 8 Wilfert et al 2007 Er 3 191 3 615 1 1 Wilfert et al 2007 3 Wilfe
162. 2 2 cM F16 45 98 X3 22 k EZME LEH KAT 99 7 cM HEEM 48 885 1 069 jm REI 1 1 KEB Ds 37 TEN E 99 NEN 1 Figure 6 Table 3 Supplemental Table 7 1 202 8 cM 2 40 4 TE 184 HE HEB Hb
163. 2008 Gharbi et al 2006 Lee et al 2005 Chistiakov et al 2005 Franch et al 2006 Ohara et al 2005 Coimbra et al 2003 Bouza et al 2007 Reid et al 2007 amp met wait at WPI CARD Palti et al 1999 Ozaki et al 2001 Cnaani et al 2003 Khoo et al 2004 Reid et al 2005 Fuji et al 2006 Wang et al 2006 Moghadam et al 2007 Moen et al 2007 Houston et al 2008 Nichols et al 2008 Haidle et al 2008 2007 MAS Fuji etal 2007 Fuji ez g7 2007 MAS 7akifugu rubripes
164. 350 1 323 755 10 6 488 902 1 825 718 9 4 728 736 2 576 479 16 9 384 657 1 893 182 12 5 1 749 687 1 350 383 10 9 673 952 2 976 705 19 7 936 330 1 569 602 15 8 313 248 1 334 228 8 1 949 420 1 647 142 10 5 701 416 1 164 932 6 9 710 807 2 671 212 18 0 538 016 39 495 911 11 7 15 652 078 16 3 20 6 15 4 33 6 24 0 25 9 32 6 17 6 20 8 31 8 34 6 18 1 13 8 17 2 21 5 20 1 16 3 12 3 25 2 6 3 9 1 30 1 20 7 5 3 6 1 4 0 1 6 2 0 7 1 4 7 3 4 1 4 12 4 10 1 3 9 3 7 2 5 11 5 5 5 6 2 3 2 5 8 4 5 4 2 3 6 4 6 bp 26 330 658 14 211 633 16 031 146 15 549 612 13 175 788 11 780 457 16 283 200 18 618 810 14 960 318 12 054 619 15 376 318 12 589 505 19 305 636 15 247 820 14 088 904 12 457 908 15 096 502 10 003 158 16 511 194 15 759 749 16 783 189 14 843 466 337 059 590 bp 26 302 275 14 135 489 16 026 996 15 557 878 13 170 292 11 739 006 16 234 404 18 618 810 14 914 903 12 022 846 15 376 318 12 473 556 19 506 067 15 288 442 15 159 000 12 333 995 15 096 502 9 935 622 16 468 050 15 759 749 16 776 071 14 818 145 337 714 416 Table 5 scaffold scaffold 13 f1213 20 29
165. 47 40 57 6 42 79 4 7 61 58 56 7 54 103 1 8 59 47 63 0 47 135 0 9 44 41 51 9 38 96 2 10 68 58 40 4 55 86 6 11 72 64 53 5 43 75 0 12 44 38 54 9 38 76 3 13 52 45 43 8 42 120 1 14 56 51 48 5 45 99 0 15 54 40 46 1 47 97 8 16 49 45 48 5 36 66 8 17 56 50 60 6 49 86 3 18 35 30 65 9 31 76 1 19 66 58 53 7 49 116 6 20 47 41 56 6 40 95 9 21 39 34 45 5 32 123 2 22 66 62 50 1 55 89 7 1 220 1 057 1 202 8 1 000 2 189 8 54 Table 4 scaffold A scaffold 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 bp 19 909 122 75 6 9 432 749 66 4 10 678 483 66 6 8 487 841 54 6 8 075 078 61 3 7 534 349 64 0 9 606 962 59 0 13 493 774 72 5 9 921 658 66 3 6 761 225 56 1 8 471 794 55 1 9 343 478 74 2 15 125 759 78 3 9 775 499 64 1 8 410 555 59 7 9 887 109 79 4 10 134 991 67 1 7 828 496 78 3 9 544 030 57 8 12 130 093 77 0 14 904 255 88 8 5 456 333 36 8 224 913 633 66 7 B scaffold DJ Om P Ob LO 10 11 12 13 14 15 16 17 18 19 20 21 22 bp 23 259 404 88 4 11 406 866 80 7 13 092 473 81 7 13 818 288 88 8 12 183 748 92 5 9 411 599 80 2 1
166. 6vcj oer ESZI O HERS mt e9 9 DS e dk Le Sot 9 I 9 6 E1441 9 Ic 6ZT bres CTL vLlJ abe L983 93 6 91 SSI 8973 Gi Lec DII LLU vs ta I9 J E L EMER EF Eat Ont HS re 6L 6 8T Fei 9613 091J Sit sory 687 65 e rer Te eet Ge se ONU SCHU ks rot 121 c Lit ket 6 an Ze ST oss 8 9T Seit LC 3 Z II m T e 6 983 E aer CH eet 9 T Set Ee Kees Lit hibet 9 I Lv cor LII Sg Lamp 91 IS ei 913 s 6 Shee 8913 s o s Aen 6 693 f et e 841 tt SII Toe Sols L LEKER ect 6 ez c Lr 9TS St Z9T ZIJ 6 sees SITs 9z Ly 6TS 9 9 60S RET 16 Ly 00 Ie KI 8 8 Ly 6 Ge 04 0 0T Aert 2 8tI 91 ORG FIE SI 483 DEU 193 Toes 8S3 Ei Eu 2 ZZ 3 ZT z 9 I vst LA art oT M oT 8403 EZ eles ES ES LBZ OU ves cese itat LI pels 0L ced Sot CTL ees rg HK Te 6 4 v8 6L1 6 4 S I 9T T g Lamp 9 6 LOTS SIZI 8 T HI
167. 88v iv CH vse DO S62 erg 865 v95 m 029 DCH esL cb6 243 L8L 6L 8LZ LI 99L Du 6 SSS 742 elt SOL LEL 8 6 88L 0S4 026 00 L t LLE ECO NE S PPS 423 26Z ver 96 voz 807 ZL9 oLz EZZ 092 ev 9ce Sp 9L 29L SL eet Lz 926 6vc 60S Ley 921v L t O LEE ST Rw 7 anb Ces DOC 090z 0S0L ZL L6L Lvl 86L 6LL SOL POL evt s8 0 S2z LIZ 694 862 919 L6S BE Eu 49 qn LT eel Ses 198 088 990Z NE op POL Si Cen Oly 89v 98v 90Z SLOL cec gez 962 62v 92 19 L t 994 cic vic ooz eZ 601 P 08 ose Lv9 ZC s8t 06 6402 ZOL 682 S82 LO CC HERS at 698 or oN 99 cry Llp LOL 09 os GS8 LL vtt SL v9c ees Les Ras et 692 tvs LSE Lve ss 62 802 Izz EF LEL 186 SEL S97 SZ EL 19 ZLE Oeste 969 926 889 199 4L9 bes BER ELO LE9 98S S Ek 999 869 68t Soy 19v OSL vec 64 691 8LE 9 tt 849 m oziz 9s 18 061 lv LOE ELZ LOL 844 628 6L ECH 6 L HERS Bt gl9 eub Eu GC 998 804 ELS 9 894 L t DC ZIL 9 H L HERS Bt RY 7 unb z60z 094 t9S Sel 09S 0LS ci eee 0S9 s81 Dsg ety 402 z9
168. 89v 6 ex CTS ELE ZA CH L20 0 10 0 S80 0 S160 608 6 S2 01 FEN EES LE L80 ZS Lei L20 0 S100 980 0 16 0 L08 6 424 01 x AlN ell 090 gg Sg SI00 S000 0200 0860 Svv 6 9 9 6 GLA Cx A 0 L AW 8 enurqgtIiligteur dg y 312 0 L 44W 9 194 dg FIRI SIS dg 30072 0 LAAW 8 8 PIB BERE Hh E GC 4002 72 18 uesje piw APS 002 72 19 1ebuuds 9002 7229 enoueuieA Ia IH CO I EHE i7 8g enurdgz EE 986800 EE E P enUt d8 3 71828 491Uur d8 2 S MAOZ 1 988 0 2 1 17 TIH E OH SE PIHe1ut d8 377128 5 8 FIM C0 eeh 37198 97 8l z O Te ELL ECO 90 2 S8 SL00 000 810 0 c86 0 99 6 S89 6 GCNAS GLA EEN osifitie1ut dg BROW Met v gae AW Alba pity EDU gi oS re1ut dg o XII o cx ED LAG Ee RE EE EI E BRS ix aa STEUER Ale PTB OL eL 103 Y FIS 1220 98 9
169. C P ABC P p 3 a b c p abc 2 T 1 1 2 B b B abc WME Ii P AC p Em f 2 b 1 P AC p abc L 2 P ABC p ac reciprocal Scannell et al 2006 Semon and Wolfe 2007a gene loss BLAST 1 1 2007b
170. Genet 6 836 846 Crollius H R Jaillon O Dasilva C Ozouf Costaz C Fizames C Fischer C Bouneau L Billault A Quetier F Saurin W Bernot A and Weissenbach J 2000 Characterization and repeat analysis of the compact genome of the freshwater pufferfish Tetraodon nigroviridis Genome Res 10 939 949 Crow K D Stadler P F Lynch V J Amemiya C and Wagner G P 2006 The fish specific Hox cluster duplication is coincident with the origin of teleosts Mol Biol Evol 23 121 136 Dehal P and Boore J L 2005 Two rounds of whole genome duplication in the ancestral vertebrate PLoS Biol 3 e314 DeWoody J A and Avise J C 2000 Microsatellite variation in marine freshwater and anadromous fishes compared with other animals J Fish Biol 56 461 473 Dib S Faure S Fizames C Samson D Drouot N Vignal A Millasseau P Marc S Kazan J Seboun E Lathrop M Gyapay G Morissette J and Weissenbach J 1996 A comprehensive genetic map of the human genome based on 5 264 microsatellites Nature 380 152 154 Dietrich W Miller J Steen R Merchant M A Damron Boles D Husain Z Dredge R Daly M J Ingalls K A Taraj O connorevans C A Deangelis M M David M Levinsonkruglyak L Goodman N Copeland N G Jenkins N A Hawkins T L Stein L Page D C and Lander E S 1996 A comprehensive genetic map of
171. Takifugu rubripes Genetics 175 2039 2042 Kikuchi K Kai W Suetake H and Suzuki Y 2008 The tiger pufferfish fugu genome mapping project and its application in aquaculture Fish genetics and breeding science 38 25 30 Kosambi D D 1944 The estimation of map distance from recombination value Ann Eugenics 12 172 175 Kumazawa Y Yamaguchi M and Nishida M 1999 Mitochondrial molecular clocks and the origin of euteleostean biodiversity familial radiation of perciforms may have predated the Cretaceous Tertiary boundary pp 35 52 in The Biology of Biodiversity edited by Kato M Springer Verlag Berlin Heidelberg Germany New York Lander E S Green P Abrahamson J Barlow A Daly M J Lincoln S E and Newbug L 1987 MapMaker An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations Genomics 1 174 181 Lee B Y Lee W J Streelman J T Carleton K L Howe A E Hulata G Slettan A Stern J E Terai Y and Kocher T D 2005 A second generation genetic linkage map of Tilapia Oreochromis spp Genetics 170 237 244 119 Lynch M and Conery J S 2000 The evolutionary fate and consequences of duplicate genes Science 290 1151 1155 Lynch M and Force A G 2000 The origin of interspecific genomic incompatibility via gene duplication 4m Nat 156 590 605 Ma X F and Gustafson J P
172. compared Science 297 1283 1285 Henderson S A 1963 Chiasma distribution at diplotene in a locust Heredity 18 173 190 Hill M M Broman K W Stupka E Smith W C Jiang D and Sidow A 2008 The C savignyi genetic map and its integration with the reference sequence facilitates insights into chordate genome evolution Genome Res 18 1369 79 Hillier L D Miller R D Baird S E Chinwalla A Fulton L A Koboldt D C and Waterston R H 2007 Comparison of C elegans and C briggasae genome sequences reveals extensive conservation of chromosome organization and synteny PLoS Biol 5 el67 Hinegardner R 1968 Evolution of cellular DNA content in teleost fishes Am Nat 102 517 563 Hoegg S Brinkmann H Taylor J S and Meyer A 2004 Phylogenetic timing of the fish specific genome duplication correlates with the diversification of teleost fish J Mol Evol 59 190 203 Houston R D Haley C S Hamilton A Guy D R Tinch A E Taggart J B McAndrew B J and Bishop S C 2008 Major quantitative trait loci affect resistance to infectious pancreatic necrosis in Atlantic salmon Salmon salar Genetics 178 1109 1115 Hughes A L Green J A Garbayo J M and Roberts R M 2000 Adaptive diversification within a large family of recently duplicated placentally expressed genes Proc Natl Acad Sci 97 3319 3323 117 International Chicken Genom
173. genome duplication in teleost fishes Mol Biol Evol 23 1808 1816 Chen Z J and Ni Z 2006 Mechanisms of genomic rearrangements and gene expression changes in plant polyploids Bioessays 28 240 252 Chistiakov D A Hellemans B Haley C S Law A S Tsigenopoulos B Kotoulas G Bertotto D Libertini A and Volckaert F A M 2005 A microsatellite linkage map of the European sea bass Dicentrarchus labrax L Genetcis 170 1821 1826 Christoffels A Koh E G L Chia J M Brenner S Aparicio S and Venkatesh B 2004 Fugu genome analysis provides evidence for a whole genome duplication early during the evolution of ray finned Mol Biol Evol 21 1146 1151 Clark M S Smith S F and Elgar G 2001 Use of the Japanese pufferfish Fugu rubripes in comparative genomics Mar Biotechnol 3 S130 S140 Cnaani A Hallerman E M Ron M Weller J I Indelman M Kashi Y Gall G A E and Hulata G 2003 Detection of a chromosomal region with two quantitative trait loci affecting cold tolerance and fish size in an F tilapia hybrid Aquaculture 223 117 128 Coimbra M R M Kobayashi K Koretsugu S Hasegawa O Ohara E Ozaki A Sakamoto T Naruse K and Okamoto N 2003 A genetic linkage map of the Japanese flounder Paralichthys olivaceus Aquaculture 220 203 218 113 Comai L 2005 The advantages and disadvantages of being polyploid Nat Rev
174. genome guide human 4 Woods et al 2000 22 g 792 EST Zebrafish Information Network http www zfin org BLAST E valune gt e NCBI human genome resources 4 Ay scaffold
175. grid 2 DEL C 88 19 21 22 7 15 8 12 16 2 18 6 20 13 11 3 10 14 24 1 23 5 4 9 17 1 1 111 1 1 1 2 1 ili 2 iala mE 3 1 4 1 5 6 7 8 E 9 1 W 10 Em R12 1 DEC 1 14 1 15 16 1 17 18 1 19 20 21 1 22 1 B C IO UN KM oo 1 9 304 SR 7 8 9011121314713 1617 18 19 2921 22 1 2 3 4 5 6 7 8 9 1011121314 15 16 17 18 19 20 21 22 23 24 SS EH Em UON E EH EH UD mm NN S NH E ss mm ER EE NS mmm Sm Em EH EH UD END NH SU Nm 1 2 3 4 5 6 7 8 9101112131415 16 17 18 19 20 21 22 23 24 1 2 3 4 5 6 7 8 9101112131415 16 17 18 19 20 21 22 4 Billet Figure 10
176. scaffold v3 0 20 cM 64 8 35 3 20 5 11 0 12 6 6 3 42 0 43 3 36 7 22 1 22 6 24 1 697 1 LG1 F1 LG1 F2 LG1 F3 LG2 LG3 LG4 LG5 F1 LG5 F2 LG6 LG7 LG8 LG9 LG10 F1 LG10 F2 LG11 F1 LG11 F2 LG12 LG13 LG14 LG15 F1 LG15 F2 LG16 LG17 F1 LG17 F2 LG18 LG19 LG20 LG21 LG22 3 11 2 13 11 11 ro Wn AN ON E Al o om bk o o bk ou oO bo S 1 cM 12 6 75 2 21 2 117 4 96 0 86 1 17 4 65 8 76 2 69 0 68 9 63 4 38 5 19 3 23 7 24 0 46 4 43 1 42 6 31 9 4 7 34 9 20 9 7 9 27 0 23 2 22 5 22 4 11 3 1213 5 2 THE OX C Hell A E 2004 Bourque et al 2005 Nakatani et al 2 EF
177. 0 Taylor J S Van de Peer Y and Meyer A 2001 Genome duplication divergent resolution and speciation Trends Genet 17 299 301 Tyler J and Sorbini L 1996 New superfamily and three new families of tetraodontiform fishes from the Upper Cretaceous the earliest and most morphologically primitive plectognath Smithsonian Contrib Paleobiol 82 1 59 20003 DNA pp 33 58 2000b pp 3 32 Vandepoele K De Vos W Taylor J S Meyer A and Van de Peer Y 2004 Major events in the genome evolution of vertebrates paranome age and size differ considerably between ray finned fishes and land vertebrates Proc Natl Acad Sci 101 1638 1643 Venkatesh B Gilligan P and Brenner S 2000 Fugu a compact vertebrate reference 125 genome FEBS Lett 476 3 7 Waldbieser G C Bosworth B G Nonneman D J and Wolters W R 2001 A microsatellite based genetic linkage map for channel catfish Ictalurus punctatus Genetics 158 727 734 Wang C M Lo L C Zhu Z Y and Yue G H 2006 A genome scan for quantitative trait loci affecting growth related traits in an Fl family of Asian seabass Lates calcarifer BMC Genomics 7 274 Wilfert L Gadau J and Schmid Hempel P 200
178. 08 Kasahara etal 2007
179. 151 321 330 Shifman S Bell J T Copley R R Taylor M S Williams R W Mott R and Flint J 2006 A high resolution single nucleotide polymorphism genetic map of the mouse genome PLoS Biol 4 e395 Singer A Perlman H Yan Y Walker C Corley Smith G Brandhorst B and Postlethwait J 2002 Sex specific recombination rates in zebrafish Danio rerio Genetics 160 649 657 Small K S Brudno M Hill M M and Sidow A 2007 Extreme genomic variation in a natural population Proc Natl Acad Sci 104 5698 5703 124 Springer M S Murphy W J Eizirik E and O Brien S J 2003 Placental mammal diversification and the Cretaceous Tertiary boundary Proc Natl Acad Sci 100 1056 1061 Steinke D Salzburger W Braasch I and Meyer A 2006 Many genes in fish have species specific asymmetric rates of molecular evolution BMC Genomics 7 20 Takagi M Sato J Monbayashi C Aoki K Tsuji T Hatanaka H Takahashi H and Sakai H 2003 Evaluation of microsatellites identified in the tiger puffer Takifugu rubripes DNA database Fish Sci 69 1085 1095 Tamura K Subramanian S and Kumar S 2004 Temporal patterns of fruit fly Drosophila evolution revealed by mutation clocks Mol Biol Evol 21 36 44 Taniguchi N 2007 Studies on conservation and utilization of genetic divergence in fish and shellfish population Nippon Suisan Gakkaishi 73 408 42
180. 2005 Genome evolution of allopolyploids a process of cytological and genetic diploidization Cytogenet Genome Res 109 236 249 Manly K F Cudmore Jr R H and Meer J M 2001 Map Manager QTX cross platform software for genetic mapping Mammalian Genome 12 930 932 Marklund L Johansson M M Hoyheim B Davies W Fredholm M Juneja R K Marani P Coppieters W Ellegren H and Andersson L 1996 A comprehensive linkage map of the pig based on wild pig Large White intercross Anim Genet 27 255 269 1994 FISH 1 pp 22 32 Matsuyama M Chida H Ikeda Y Tanaka H and Matsuura S 1997 Induction of ovarian maturation and ovulation in cultured tigger puffer Takifugu rubripes by differential hormonal treatments Suisanzousyoku 45 67 73 McLysaght A Enright A J Skrabanek L and Wolfe K H 2000 Estimation of synteny conservation and genome compaction between pufferfish Fugu and human Yeast 17 22 36 Meyer A and Schartl M 1999 Gene and genome duplications in vertebrates the one to four to eight in fish rule and the evolution of novel gene functions Curr Opin Cell Biol 11 699 704 120
181. 4 303 172 88 1 14 689 462 78 9 13 921 860 93 3 9 125 214 75 9 11 238 226 73 1 10 660 899 85 5 16 951 613 86 9 12 327 306 80 6 11 516 131 76 0 10 309 660 83 6 11 183 467 74 1 8 052 772 81 0 14 184 402 86 1 13 411 191 85 1 14 900 332 88 8 11 608 917 78 3 281 557 002 83 4 scaffold 55 scaffold bp bp 2 140 755 8 1 4 280 781 1 855 804 13 1 2 923 080 2 886 226 18 0 2 466 437 1 839 519 11 8 5 222 252 1 933 348 14 7 3 167 362 1 198 524 10 2 3 047 584 1 376 025 8 5 5 300 213 1 855 867 10 0 3 269 169 1 924 886 12 9 3 113 774 1 460 284 12 1 3 833 110 1 590 666 10 3 5 313 858 966 888 7 7 2 279 139 1 518 385 7 9 2 661 492 2 852 028 18 7 2 620 293 2 653 161 18 8 3 025 188 70 921 0 6 2 499 878 2 494 231 16 5 2 467 280 948 111 9 5 1 226 551 2 807 427 17 0 4 159 737 2 636 379 16 7 993 277 354 134 2 1 1 524 800 4 918 575 33 1 4 468 558 42 282 144 12 5 69 863 813 scaffold bp bp 1 644 389 6 3 1 398 482 1 872 887 13 2 855 736 2 298 442 14 3 636 081 1 491 415 9 6 248 175 724 627 5 5 261 917 1 499 553 12 8 827 854 1 170 188 7 2 761 044 3 287 233 17 7 642 115 777 669 5 2 215 374 1 412 065 11 7 1 485 567 2 578 742 16 8 1 559
182. 7 Variation in genomic recombination rates among animal taxa and the case of social insects Heredity 98 189 197 Woods I G Kelly P D Chu F Ngo Hazelett P Yan Y Huang H Postlethwait J H and Talbot W S 2000 A comparative map of the zebrafish genome Genome Res 10 1903 1914 Woods I G Wilson C Friedlander B Chang P Reyes D K Nix R Kelly P D Chu F Postlethwait J H and Talbot W S 2005 The zebrafish gene map defines ancestral vertebrate chromosome Genome Res 15 1307 1314 Yamanoue Y Miya M Inoue J G Matsuura K and Nishida M 2006 The mitochondrial genome of spotted green pufferfish Tetraodon nigroviridis Teleostei Tetraodontiformes and divergence time estimation among model organisms in fishes Genes Genet Syst 81 29 39 Yu N Zhao Z Fu Y X Sambuughin N Ramsay M Jenkins T Leskinen E Patthy L Jorde L B Kuromori T and Li W H 2001 Global patterns of human DNA sequence variation in a 10 kb region on chromosome 1 Mol Biol Evol 18 214 222 Zhang J Rosenberg H and Nei M 1998 Positive Darwinian selection after gene duplication in primate ribonuclease genes Proc Natl Acad Sci 95 3708 3713 126
183. 8 9 gt 400 D D 1 o o 200 299 300 399 O gt 400 T y e hi m amp 3 3 ei EZ K 80 89 90 99 100 199 200 299 300 399 Figure 17 A B 1 C 99 Table 7
184. 9 1 HEDE 1 338 Mb 22 1 7 Table 4B H Gasterosteus aculeatus 90 Kasahara et al 2007 X D 22 HE 24
185. 98 Moen T Sonesson A K Hayes B Lien S Munck H and Meuwissen T H 2007 Mapping of a quantitative trait locus for resistance against infectious salmon anaemia in Atlantic salmon Salmo salar comparing survival analysis with analysis on affected resistant data BMC Genet 8 53 Moen T Hayes B Baranski M Berg P R Kjeglum S Koop B F Davidson S W and Lien S 2008 A linkage map of the Atlantic salmon Salmo salar based on EST derived SNP markers BMC Genomics 9 223 Moghadam H K Poissant J Fotherby H Haidle L Ferguson M M and Danzmann R G 2007 Quantitative trait loci for body weight condition factor and age at sexual maturation in Arctic charr Salvelinus alpinus comparative analysis with rainbow trout Oncorhynchus mykiss and Atlantic salmon Salmo salar Mol Genet Genomics 277 647 661 121 Myers S Bottolo L Freeman C McVean G and Donnelly P 2005 A fine scale map of recombination rates and hotspots across the human genome Science 310 321 324 Nakatani Y Takeda H Kohara Y and Morishita S 2007 Reconstruction of the vertebrate ancestral genome reveals dynamic genome reorganization in early vertebrates Genome Res 17 1254 1265 Naruse K Tanaka M Mita K Shima A Postlethwait J H and Mitani H 2004 A medaka gene map the trace of ancestral vertebrate proto chromosomes revealed by comparative gene mapping Genome
186. Bourque et al 007 Hox L Amores et al 1998 Meyer and Schartl 1999 Robinson Rechavi et al 2001 Postlethwait et al 2000 Woods et al 2000 Naruse et al 2004 Jaillon et al 2004 Woods etal 2005 4 5 3 2
187. COW MAET 12 026 Figure 10A Supplemental Table 13 20 1 1 Tru2 22 Ola22 Tru3 Ola7 Tru4 Ola15 Tru5 Ola8 Tru6 Ola12 Tru7 Ola16 Tru9 Ola6 Trul0 Ola20 Trull Olal3 Trul2 Olall Trul3 Ola3 Tru14 Ola10 Trul5 Olal4 Trul6 Tni24 Trul7 Olal Trul8 Ola23 Trul9 Ola5 Tru20 Ola4 Tru21 Ola9 Tru22 01a17 20 18 400 19 900 Trul Olal9 Ola21 BE U Tru8 Ola2 Olal8 1 2 Ola19 Ola21 Ola2 Olal8 2 61 Tul Tru Trul Tni8
188. ELEN OC HERS mt ESL ES 47 qn LI Ove LING NE zp N ver ess zis Oder at LEES O det Fas dt SHER veers PERN LEI GE CECI LAOL RFPS OR BS AIP L BP TORO FAM VERE COA PE OD E LO EE pI0JJE2S L S EI CES HED so 12 72 GSH PPS LENA BRR YR UIP amp x p910 J85sCo 3X El s Fh el C6 Co T FES et LRPO oyy SD s Fl LOT FERS ee LIL DFG BB RPIOSCISO T HERR OG LLY x ae V e ALEN A anb 109 0012 M Z88 SS 618Z 10S NE 0v9 18 aly 168 96 N_ Spe NS 6602 NS Sip N LLS 962 oos M 88 Sc DS azz See rr 09 LEZ Zsz eor 08L DH Les 9 L SL 62v 1902 6 0z 1901 or vS T 6 S Ivy Sa Sei eve Cer D 9v LLE Aer ve 01S SLZ Lz 0ZZ 00v See 992 OPES Et CHES Bt Ei 48 an LT gees 6802 56 bel v69 s09 pls 662 s 289 sg ESS Lvc c6t 009 LZ v6 182 84 ZL 94 Sov S8L DI DL 892 CFL 622 9 LRE ovs 944 26 L9 vov S Lit Et i TAS EN DL 14012 089 9 9 LES gee 844 cS 04 tci 08Z 16 68 9ZL 02 D r 091 6 18V c 91 be coe 9v PL V Lid Et 69S SLS S802 06v 99 088 cel 99 0co A vit 60 v 18v Lie EEN Cer ser D ses 7 Eet azv sei Z6Z 69 Iz L6Z 2802 plz EES ZS L9 ZL SSL LLEL rA BCL Sv ZOLZ Ove 622 98 c Leen t c8 LOL 618 v6v 8zt
189. G L 12 447 Supplemental Table 25 100 4 64X10 4 84 x 107 3 32X10 80 100 EL 100
190. Res 14 820 828 Navarro A and Barton N H 2003 Chromosomal speciation and molecular divergence accelerated evolution in rearranged chromosomes Science 300 321 324 Neff M K Broman K W Mellersh C S Ray K Acland G M Aguirre G D Ziegle J S Ostrander E A and Rine J 1999 A second generation genetic linkage map of the domestic dog Canis familiaris Genetics 151 803 820 Nelson J S 1994 Fishes of the world New York John Wiley and sons Nichols K M Edo A F Wheeler P A and Thorgaard G H 2008 The genetic basis of smoltification related traits in Oncorhynchus mykiss Genetics 179 1559 1575 Nowak M A Boerlijst M C Cooke J and Smith J M 1997 Evolution of genetic redundancy Nature 388 167 171 Ohara E Nishimura T Nagakura Y Sakamoto T Mushiake K and Okamoto N 2005 Genetic linkage map of two yellowtails Aquaculture 244 41 48 Ohno S 1970 Evolution by Gene Duplication New York Springer Verlag Ozaki A Sakamoto T Khoo S Nakamura K Coimbra M R M Akutsu T and Okamoto N 2001 Quantitative trait loci QTLs associated with resistance susceptibility to infectious pancreatic necrosis virus IPNV in rainbow trout 122 Oncorhynchus mykiss Mol Genet Genomics 265 23 31 Palti Y Parsons J E and Thorgaard G H 1999 Identification of candidate DNA markers associated with IHN virus resistance in backc
191. Tni3 Tni6 Tni17 Tni18 Tni20 Naruse et al 2004 L 108 87 21 22 3 3 HO scaffold Trul 1 1 2 1 1 Trul6 Tnil4 Trul8 Tnil9 Trul9 Tnill 7 Figure 4A 94 EA Woods etal 20000
192. andem repeats in the pufferfish Tetraodon nigroviridis Cytogenet Cell Genet 88 50 55 Force A Lynch M Pickett F B Amores A Yan Y L Postlethwait J 1999 Preservation of duplicate genes by complementary degenerative mutations Genetics 151 1531 1545 Franch R Louro B Tsalavouta M Chatziplis D Tsigenopoulos C S Sarropoulou E Antonello J Magoulas A Mylonas C C Babbucci M Patarnello T Power D M Kotoulas G and Bargelloni L 2006 A genetic linkage map of the hermaphrodite teleost fish Sparus aurata L Genetics 174 851 861 Fuji K Kobayashi K Hasegawa O Coimbra M R M Sakamoto T and Okamoto N 115 2006 Identification of a single major genetic locus controlling the resistance to lymphocystis disease in Japanese flounder Paralichthys olivaceus Aquaculture 254 203 210 Fuji K Hasegawa O Honda K Kumasaka K Sakamoto T and Okamoto N 2007 Marker assisted breeding of a lymphocystis disease resistant Japanese flounder Paralichthys olivaceus Aquaculture 272 291 295 Fujita S 1967 Artifical interspecific and intergeneric hybridization among the Tetraodontid puffers preliminary report Jpn J Michurin Biol 3 5 11 Gharbi K Gautier A Danzmann R G Gharbi S Sakamoto T Heyheim B Taggart J B Cairney M Powell R Krieg F Okamoto N Ferguson M M Holm L E and Guyomard R 2006 A linkage map
193. e Sequencing Consortium 2004 Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution Nature 432 695 716 International Rice Genome Sequencing Project 2005 The map based sequence of the rice genome Nature 436 793 800 Jacobs H J van Eck Arens P Verkerk Bakker B te Lintel Hekkert B Bastiaanssen H J M El Kharbotly A Pereira A Jacobsen E and Stiekema W J 1995 A genetic map of potato Solanum tuberosum integrating molecular markers including transposons and classical markers Theor Appl Genet 91 289 300 Jaillon O Aury J Brunet F Petit J Stange Thomann N Mauceli E Bouneau L Fischer C Ozouf Costaz C Bernot A Nicaud S Jaffe D Fisher S Lutfalla G Dossat C Segurens B Dasilva C Salanoubat M Levy M Boudet N Castellano S Anthouard V Jubin C Castelli V Katinka M Vacherie B Bi mont C Skalli Z Cattolico L Poulain J Berardinis V Cruaud C Duprat S Brottier P Coutanceau J Gouzy J Parra G Lardier G Chapple C McKernan K J McEwan P Bosak S Kellis M Volff J Guigo R Zody M C Mesirov J Lindblad Toh K Birren B Nusbaum C Kahn D Robinson Rechavi M Laudet V Schachter V Qu tier F Saurin W Scarpelli C Wincker P Lander E S Weissenbach J and Crollius H R 2004 Genome duplication in the teleost f
194. es 9 ts vos i KSS ON ez Cd NNO or orto 0000 onr mi n 5 D B ES A orton N geg Zr 76 Le DK 9 62 8L 99 009 KC 6LS Oly sey ER vt SSC KAS 4Z S vc 9 6L Lv ev 00 nHIE an v ES ECO vov ale LOL SOLL 8 804 0 66 Ss c6 68 Lag 6 44 Llz eu 9 ooo ort z4 9 anp HHII JI IDIL Jom 1 il ID tnit E Lit RE 46 gU o am m AT 5 8LL gon i SLL xis 6 90L Cent E S001 5 6S6 G S6 5 LI 016 E S o m i S ol 3 p ES Mss 8 ezg vos 8 978 6tv 608 LU DR Sei a o 9 82 t9 La a 6v nv E oss 3 Sv 1 0 68 Uu LOS r i Tee e S 69 F ple Vel a 69v ET a i 6 89 Cer 89 Leg n ES Leg zr vz Se9 Spp vig 5S Z9 Le ES dd n L 9 SE eze ez zs Los EIS E Kb ger ELL DO DR E E Ser g t opt Ze 9 ZZ gu T ozz 9v 0 1Z Ja ze 6L n er Sg Lat ege 00 o SI ze zt lt vt 1 Z 9 DF EN SEL ese i 4 CE 00 62i s 97 m U he vos 8 Ve z x gr se Es B 00 d Liz T i 8 d 0 8L i su g 8 6 d v9 gv Sr a ct 1 ze 00 00 00 CC HERS Bt FE
195. etal 1996 Dietrich et al 1996 Marklund et al 1996 Neff et al 1999 Sakamoto et al 2000 Singer et al 2002 Sakamoto Singer et al 2002 MEO MB ED 13 et al 2000 Singer et al 2002 TI JU cep ls Figure and Table 14 SEO Ty sR INO S YEON 2 e CIEPT IW 27 SHAPE ROM El gg 4 5 8 Hz LAP ERSR AIG OM ORES HMM L7 8i
196. fe 82 4 AAA S n F f Ce RE wc 3 N JS IL OER E OO fr E TS SR Ze H V Oc E pei 18 400 19 900 3 OS
197. ffer Takara 2 uL dNTP Mixture 2 5 mM Takara 1 6 uL rTaq DNA Polymerase 5 U uL Takara 0 1 uL 20uL iCycler Bio RAD 995C 2 94C 30 59 C C2 35 59C 3 DNA 6 PCR KIGU 10 UL E 0 1 10 mM EDTA pH 8 0 0 1 FEMA 95 10 2 000 V 2 L SYBR Gold Molecular Probes 1xTBE 89 mM 89 mM 2 mM 30 FLA 3000GF FUJIFILM KS 3 ze D Ei EL 3 8 4T TA pH 8 0 10 000 Der k EN 1 TU
198. for brown trout Salmo trutta chromosome homeologies and comparative genome organization with other salmonid fish Genetics 172 2405 2419 Gomez Uchida D and Banks M A 2006 Estimation of effective population size for the long lived darkblotched rockfish Sebastes crameri J Hered 97 603 606 Golding G B and Dean A M 1998 The structural basis of molecular adaptation Mol Biol Evol 15 355 369 Grattapaglia D and Sederoff R 1994 Genetic linkage map of Eucalyptus grandis and Eucalyptus urophylla using a pseudo testcross Mapping strategy and RAPD markers Genetics 137 1121 1137 Groenen M A M Wahlberg P Foglio M Cheng H H Megens H J Crooijmans R P M A Besnier F Lathrop M Muir W M Wong G K S Gut I and Andersson L 2009 A high density SNP based linkage map of the chicken genome reveals sequence features correlated with recombination rate Genome Res 19 510 519 Gr tzner F L tjens G Rovira C Barnes D W Ropers H and Haaf T 1999 Classical and molecular cytogenetics of the pufferfish Tetraodon nigroviridis 116 Chromosome Res 7 655 662 Haidle L Janssen J E Gharbi K Moghadam H K Ferguson M M and Danzmann R G 2008 Determination of quantitative trait loci QTL for early maturation in rainbow trout Oncorhynchus mykiss Mar Biotechnol 10 579 592 Hedges S B and Kumar S 2002 Genomics vertebrate genomes
199. ish Sci 62 727 730 Beye M Gattermeier L Hasselmann M Gempe T Schioett M Baines J F Schlipalius D Mougel F Emore C Rueppell O Sirvi A Guzm n Novoa E Hunt G Solignac M and Page Jr R E 2006 Exceptionally high levels of recombination across the honey bee genome Genome Res 16 1339 1344 Bourque G Pevzner P A and Tesler G 2004 Reconstructing the genomic architecture of ancestral mammals Lessons from human mouse and rat genomes Genome Res 14 507 516 Bourque G Zdobnov E M Bork P Pevzner P A and Tesler G 2005 Comparative architectures of mammalian and chicken genomes reveal highly variable rates of genomic rearrangements across different lineages Genome Res 15 98 110 112 Bouza C Hermida M Pardo B G Fern ndez C Fortes G G Castro J S nchez L Presa P P rez M Sanju n A Carlos A Alvarez Dios J A Ezcurra S Cal R M Piferrer F and Mart nez P 2007 A microsatellite genetic map of the Turbot Scophthalmus maximus Genetics 177 2457 2467 Brenner S Elgar G Sanford R Macrae A Venkatesh B and Aparicio S 1993 Characterization of the pufferfish Fugu genome as a compact model vertebrate genome Nature 366 265 268 Brunet F G Crollius H R Paris M Aury J M Gibert P Jaillon O Laudet V and Robinson Rechavi M 2006 Gene loss and evolutionary rate following whole
200. ish Tetraodon nigroviridis reveals the early vertebrate proto karyotype Nature 431 946 957 Jensen Seaman M I Furey T S Payseur B A Lu Y Roskin K M Chen C F Thomas M A Haussler D and Jacob H J 2004 Comparative recombination rates in the rat mouse and human genomes Genome Res 14 528 538 Kasahara M Naruse K Sasaki S Nakatani Y Qu W Ahsan B Yamada T Nagayasu Y Doi K Kasai Y Jindo T Kobayashi D Shimada A Toyoda A Kuroki Y Fujiyama A Sasaki T Shimizu A Asakawa S Shimizu N Hashimoto S Yang J Lee Y Matsushima K Sugano S Sakaizumi M Narita T Ohishi K Haga S Ohta H Nomoto H Nogata K Morishita T Endo T Shin I T Takeda H Morishita S and Kohara Y 2007 The medaka draft genome and insights into 118 vertebrate genome evolution Nature 447 714 719 Kent W J 2002 BLAT the BLAST like alignment tool Genome Res 12 656 664 Khoo S K Ozaki A Nakamura F Arakawa T Ishimoto S Nickolov R Sakamoto T Akutsu T Mochizuki M Denda I and Okamoto N 2004 Identification of a novel chromosomal region associated with infectious hematopoietic necrosis IHN resistance in rainbow trout Oncorhynchus mykiss Fish Pathology 39 95 101 Kikuchi K Kai W Hosokawa A Mizuno N Suetake H Asahina K and Suzuki Y 2007 The sex determining locus in the tiger pufferfish
201. mbl version 50 4 TETRAODON 8 0 Ensembl version 50 8 HdrR Ensembl version 50 1f NCBI Ensembl version 50 361 monDomS Ensembl version 50 5e Ensembl 1 GRIMM Pevzner and Tesler 2003
202. ou E eS a 37 ERE SUE DOCERE BUR ARALAN L anb SIE UIT 6983 vip Toss s s eet Su sor 8 61 zor 9813 SS KT 612 EK Sb m ee 09vJ re LOU St SII ert 107i bors SE for reen Ee 91 91 gt e 0013 9 I S613 9 8 T 6r 9 ron Ee sz 9 SS 8983 Soe 25 9 193 E 673 E i 1 9913 er LSE rel Ae Ce Eri ZSTI EC E 62 oer 6T 0671 TOI Ee ZZ Lr Lr VII DII eg TIIT Sou 6 TIT 04 3 Cvel uu os e Cosi 91 se Soen s9 TUH art Aert Tey m eet _greg un 61 ee 908 REEL 6S 3 esz KZ bes 6613 Te se geet 8 ST evel re 9 Seer sy 6L sec LITI Ee Lvl DN E 6023 IER art Aen gr TIT S 9 z SS oT 941 E oT 963 S 6 6v1I OT _ a 3 AA 2 6 Les gT s 6 30 98 3 rg 423 ees 92i 093 So een SS Sid Et Vita CHERS CHE RS LER eB 15 vec Teas Spry DEI Lv fe Sec oe 9T Let 8 07 t e g 9 F S LIERSE DU TOZI 6t 6 SE DI oP sels ZO Pla re Me 62T LL sg O TJ LL Ly ee sz OLENE re oT iS 6T Lej ests 6L3 eo Obl Z983 Oz Loc goes TS ee 9S3 8 Sat ce 9 vc 9 Lye ST gsc 9 TZ KL
203. ross of rainbow Oncorhynchus mykiss and cutthroat trout O clarki Aquaculture 173 81 94 Peichel C L Nereng K S Ohgi K A Cole B L E Colosimo P F Buerkle C A Schluter D and Kingsley D M 2001 The genetic architecture of divergence between threespine stickleback species Nature 414 901 905 Pevzner P and Tesler G 2003 Genome rearrangements in mammalian evolution lessons from human and mouse genomes Genome Res 13 37 45 Postlethwait J H Woods I G Ngo Hazelett P Yan Y Kelly P D Chu F Huang H Hill Force A and Talbot W S 2000 Zebrafish comparative genomics and the origins of vertebrate chromosomes Genome Res 10 1890 1902 Rat Genome Sequencing Project Consortium 2004 Genome sequence of the Brown Norway rat yields insights into mammalian evolution Nature 428 493 521 Reid D P Szanto A Glebe B Danzmann R G and Ferguson M M 2005 QTL for body weight and condition factor in Atlantic salmon Salmo salar comparative analysis with rainbow trout Oncorhynchus mykiss and Arctic charr Salvelinus alpinus Heredity 94 166 172 Reid D P Smith C A Rommens M Blanchard B Martin Robichaud D and Reith M 2007 A genetic linkage map of the Atlantic halibut Hippoglossus hippoglossus L Genetics 177 1193 1205 Robinson Rechavi M Marchand O Escriva H Bardet P L Zelus D Hughes S and Laudet V 2001 Euteleo
204. rt et al 2007 5 EnsembI http www ensembl org Golden Path Length Lee et al 2005 57 4 4 5 000 Jaillon et al 2004 Woods et al 2005 Bourque et al 2005 Nakatani et al 2007 Bourque etal 2004 X 8 700 Springer et al 2003 lt
205. st fish genomes are characterized by expansion of gene families Genome Res 11 781 788 Rodionov A V 1996 Micro vs macro structural functional organization of avian micro 123 and macrochromosomes Genetika 32 597 608 Sakamoto T Danzmann R G Gharbi K Howard P Ozaki A Khoo S K Woram R A Okamoto N Ferguson M M Holm L Guyomard R and Hoyheim B 2000 A microsatellite linkage map of rainbow trout Oncorhynchus mykiss characterization by large sex specific differences in recombination rates Genetics 155 1331 1345 Sarropoulou E Nousdili D Magoulas A and Kotoulas G 2008 Linking the genomes of nonmodel teleosts through comparative genomics Mar Biotechnol 10 227 233 Scannell D R Byrne K P Gordon J L Wong S and Wolfe K H 2006 Multiple rounds of speciation associated with reciprocal gene loss in polyploid yeasts Nature 440 341 345 S mon M and Wolfe K H 2007a Reciprocal gene loss between Tetraodon and zebrafish after whole genome duplication in their ancestor Trends Genet 23 108 112 S mon M and Wolfe K H 2007b Rearrangement rate following the whole genome duplication in teleost Mol Biol Evol 24 860 867 Sewell M M Sherman B K and Neale D B 1999 A consensus map for loblolly pine Pinus taeda L 1 Construction and integration of individual linkage maps from two outbred three generation pedigrees Genetics
206. the mouse genome Nature 380 149 152 Drosophila 12 Genomes Consortium 2007 Evolution of genes and genomes on the Drosophila phylogeny Nature 450 203 218 Edwards J H 1991 The Oxford Grid Ann Hum Genet 55 17 31 114 Edwards M D and Page N J 1994 Evaluation of marker assisted selection through computer simulation Theor Appl Genet 88 376 382 Edwards Y J K Elgar G Clark M S and Bishop M J 1998 The identification and chracterization of microsatellite in the compact genome of the Japanese pufferfish Fugu rubripes perspectives in functional and comparative genomic analyses J Mol Biol 278 843 854 Elgar G Clark M S Meek S Smith S Warner S Edwards Y J K Bouchireb N Cottage A Yeo G S H Umrania Y Williams G and Brenner S 1999 Generation and analysis of 25 Mb of genomic DNA from the pufferfish Fugu rubripes by sequence scanning Genome Res 9 960 971 Erickson D L Fenster C B Stenoien H K and Prices D 2004 Quantitative trait locus analysis and the study of evolutionary process Mol Ecol 13 2505 2522 Fadiel A Anidi I and Eichenbaum K D 2005 Farm animal genomics and informatics an update Nucleic Acids Res 33 6308 6318 Fischer C Ozouf Costaz C Crollius H R Dasilva C Jaillon O Bouneau L Bonillo C Weissenbach J and Bernot A 2000 Karyotype and chromosome location of characteristic t
207. y Hu Da a hid Sor n E 992 Cie 97k 99t oe e H kok Sis B ove LSE a zi g U YE ag Sie S tt vc A e 20 stt v9 zoe a m 6 0 DW 03 eue F i U KI z gy k L i ect oi 2 99 S er zzz ELL LZ 00 ozz U 9 z gr 6L t 6L L 6L d 5 9 cet Sv a D vc 00 n E oe m g v9 L d 9 Ei e U Si as Za E 9 00 00 00 00 00 00 Erud EE HRS St CHER Bt CHESS HERS eat 9 Geo lt co to oo OO 44 11 12 10 9 SON Oc d N e ON epe ot CQ sue CH nro Co N NNN M 6 HS o wo x bd QNOGQ NTS Zeg N oat 1 SSS 5 S EEEE IMMIHHIHHII JIC IL JOD UDI cont 6 ONT o gt ATR w e wan 5 5 on ow 999900 a Meu ON cnr 0 S Ga NoNo git NEES g OM OME KK KN e ODN oo ot N oot O wo KR Ki o SN eot co oo Do nro ooo gei e OD gt N Q own N Oo e or
208. z 66 06 gl 8yz e 265 2 zsz e 8 68 08 Ll 9 6 65 8 sog p Loe p 62 02 oi GZS 6 222 n LSZ p gie 5 69 09 sl 9r0 1 61 y60 1 oz Leg zl zzz p 65 08 vl LZO L c 226 1Z 099 GL LEL 6 0 l ise 68 vol ze 926 8z z9y gl 6 0 zl FE 29 LOE L 9S evs L G9 DNA CC 62 02 LL 880 z oe ege o zu 8zl OLE 92 61 01 ol 882 ze 66 LL 291 gl m e 6 6 262 62 88 7 002 ez ze b 8 8 Stz SE v8 rA 082 Ov L A H v92 bb 801 gi zsz 2 og e 9 9 osz 0s 091 ze ozz by og 9 5 e vec 9S 801 ZZ 972 69 F 9 v v toz 89 66 ee 912 z2 zy m e e 09 081 901 es oz val og sl z z LSZ LSZ SLL SLL EZ EZ L L gaer MOLa paek OE paek Joen gaene WT teren BROKE TA SE aada amp amp zr ect i OCS CE lt 1L 1hE lt 1L AE g e EXxxPSPREHA ca e 4 ncg ARIN AR 6 31921 102 8 lt C9 9 08 0s0 0 6v0 0 660 0 LOGO 02 LI 8 v 21 YOOX SSE EN cUS 08 v90 0 820 0 c600 806 0 EEN 22v 2l TAHOE Kat LEE CHL Ek 08l 090 0 6200 680 0 LL6 0 66E LL 60S ZL 43 HA vLe LO L Sly 08 290 0 810 0 S80 0 S160 22v ll S6r 2l lt 43 LLZ 86 Sly 28 v20 O 21070 0 0 6860 68 vl 600 SI 43 Y a2 DE SLC cS v 2 8 L20 O 61070 6 0 0 L96 0 9Lv vi 900 SI 6 43 GI 7 0 ely CH S90 0 L00 6200 LZ6 0 682 8 S8v 6 GCA LOK 88 8 890 92v L6L 90 0 A LO0 180 0 6160 912 8
Download Pdf Manuals
Related Search