Sanger Sequencing: Troubleshooting Guide
Contents
1. Page 1 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 Sanger Sequencing Troubleshooting Guide Research Facility Ltd 1 Introduction This document highlights some common problems associated with DNA sequencing as well as the possible causes and solutions for these problems Pictures of sequence traces are provided where possible along with the information describing the problem how to identify the problem the cause and the potential solution for the problem Other problems can occur with sequence data but the following are those seen most commonly Use this guide as the AGRF recommended data review troubleshooting process 2 Sequence Data Evaluation For each sample processed the following are provided Filename ab1 The raw chromatogram trace file Filename seq A text file of the sequence as generated by the sequencing instruments Filename fa A quality trimmed FASTA formatted text file Filename bn A BLAST file GenBank of the quality trimmed FASTA file The filename ab1 file contains annotation of the sample the raw data trace and the analysed electropherogram Basecalling and analysis algorithms are applied to the raw data to create the analysed data trace When evaluating or trouble shooting sequence data it is important to look at the raw and analysed data traces The raw data trace should show an even distribution of peaks across the read and no2. Smaller ratios may indicate the presence of protein or organic contaminants Ratios less than 1 8 may still produce high quality results Quantitation by agarose gel electrophoresis may not be accurate because ethidium bromide incorporation is not consistent and the method of comparing the standard and sample brightness is subjective A260 values below 0 05 or above 1 00 are not accurate because Beer s law generally applies only within a certain concentration range Outside of this concentration range the relationship between absorbance and concentration is nonlinear A260 and A280 are the optical spectrometer measurement of absorbance at the wavelengths of 260 nm and 280 nm respectively A260 is frequently used to measure DNA RNA concentration and A280 is used to measure protein concentration A ratio of A260 A280 gt 1 8 suggests little protein contamination in a DNA RNA sample Page 10 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 Sanger Sequencing Troubleshooting Guide Research Facility Ltd 5 2 Primer Design Review Recommendation Comment Ensure that the primer has Tm gt 45 C If the Tm is too low it may result in poor priming and low or no signal Ensure that primers are at least 18 bases Primers that are too short may have Tms that are too long low Ensure that there are no known Secondary hybridization sites on the target DNA can se
3. Trace Name Stdvi 1 Trace Comments N A Well ID Al Cape 1 Data Analysis Run Configuration Basecaller KB bep Basecaller Version KB 1 2 Mobility File KB_3130_POP7_BDTv1 mob Basecall Date Time 2006 07 25 12 53 23 010 00 Total of Scans Collected 16776 Basecall Start Scan 532 oth Peak 1 Scand 532 Base Spacing 15 06 Average Raw Signal Intensity A421 0235 6337 T386 Average Moise AGI Cf3 G TEH E AA Trace Score 55 Contiguous Read Length 1088 OWZO Bases w QY gt 20 1054 t Consumables Figure 3 Annotation file which shows values for signal strength and start end points Page 3 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 Sanger Sequencing Troubleshooting Guide Research Facility Ltd 3 Troubleshooting When troubleshooting sequencing data follow the workflow below to try to identify the cause of your problem The following steps in this section use Sequencing Analysis Software or Sequence Scanner Software 3 1 Reviewing the Sequence 3 1 1 Electropherogram Select the Electropherogram tab and review the sequence for data quality Check the following e Well defined peak resolution minimal fluorescence overlap from one peak to the next with a sharp peak top e Uniform peak spacing peak spacing is consistent throughout the trace e Signal to noise ratios and variation in peak heights High signal to noise ratio and even
4. only one primer has been used Re synthesize primer with PAGE purification Sequence the complementary strand Page 8 of 11 Sanger Sequencing Troubleshooting Guide Research Facility Ltd 3 2 5 Artifacts Peaks of excess dye present in the raw data trace eee e a e a Misuli a Sue AI eee TATAATCGATCCRAAC IGCT TTG GATCA TERAGAGAC TC GC TAGCC TC PRT ITEICG TICATGGECCATCE tric ret Large broadened peaks that obscure the sequence T vgl h j a A t aa aA ada an e N A RUI NIN W AN MN M L N _ Problem Probable Cause Solution Large peaks obscuring Dye blobs caused by For CS submissions review clean the real sequence unincorporated BigDye up method used and or add more Terminator BDT and are DNA template and less BDT typically seen at 70bp and 120bp For PD submissions please notify Usually seen in failed k i Sau coe mn eS AGRF staff and a free re run will be provided Real sequence can still be read underneath these blobs Sample peaks become If related to individual samples Clean up template DNA lumpy and increasingly this is due to a contaminant in unreadable early in the the sample sequence before 500bp Page 9 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 d Sanger Sequencing Research Facility Ltd Ea Troubleshooting Guide 4 Review AGRF submission Take some
5. peak height characterize good quality sequence Please note the analysed view is re scaled the peak heights are not representative of raw fluorescence detected by the AB 3730xI 3 1 2 Raw Sequence Select the Raw tab and review the unprocessed fluorescence data to assess the signal quality Check the following e Artifacts Are there any artifacts such as four color spikes e Peak heights Are peaks well resolved with acceptable heights e Data start points Do any data start points deviate from others in the same submission e Length of read Was the expected length of read obtained Does the signal stop suddenly e Baseline Is there background noise for all the peaks Zoom in horizontally and vertically to verify the baseline noise Page 4 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 d Sanger Sequencing aa Troubleshooting Guide Research Facility Ltd 3 2 Result Evaluation Use the following examples as a guide to try to identify an explanation of your results Please note that this list is not exhaustive but include the most common results seen at the AGRF 3 2 1 Failed sequence Cacia ingel UHF E SS Pe RPE RPE ERS RPE RP RR ee ee ee oe a No noticeable fluorescence peaks in raw data Only background noise seen in electropherogram ARADAAAA ARAL AAA eee whe bee kee a Problem Probable Cause Solution No No primin
6. ate 11 12 2014 sequencing reaction to help relax the structure Design primers close to the hairpin Run product out on an agarose gel to check Page 7 of 11 aT Sanger Sequencing ET Troubleshooting Guide 3 2 4 Multiple sequences Base G102 CGGCCGCGAATTCAC TAG TEATTICCGGATTAGGAQC TGATC TGACTCAMCAGGGC TGAMPAARTCCATG TCCRCAATGHAQG Overlapping peaks in all or part of the electrooherogram that maintain correct base spacing at idl ab TAAAAG TCG TATAAATTTITITITITITTGGCGAAGGAAATTQATMRITIGG TTTTTTGGGAAGGGAAATGGA Overlapping peaks after a homopolymer region Problem Probable Cause Overlapping peaks in Mixed plasmid preparation all or part of the ce l oe Multiple PCR products Frame shift mutation Primer dimer contamination Multiple priming sites Multiple primers in reaction Primer with N 1 contamination Overlapping peaks Enzyme slippage occurs giving varying following stretch of lengths of the same sequence after this mononucleotide region n 1 n 2 and n 3 populations sequence Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 sig PAAIRTI Solution Re isolate the the DNA from a pure colony and re sequence Check PCR template on gel for single band Use a different primer after the mutation or sequence the complementary strand Optimise PCR amplification or redesign primer Make sure primer only has one priming site Ensure
7. condary hybridization sites on the resultin double peaks throughout the sequence target DNA Choose primers that do not have runs of Runs of identical nucleotides in primers can cause n 1 identical nucleotides especially 4 or more or n 1 effects Also these primers may be more difficult Gs to synthesize Choose primers with G C content in the If the G C content is too low the Tm may be too low If range of 30 to 80 preferably 50 to 55 so increase the primer length beyond 18 bases to obtain a Tm gt 45 C Design primers to minimize the potential Primer dimer formation from hybridization can result in for secondary structure and or mixed sequence at the beginning of the sequence hybridization Secondary structure in the primer particularly at the 3 end can result in poor priming and low or no signal Purify primers by HPLC to reduce the Primers containing contaminants or synthesized primers quantity of n 1 primers of the wrong length can cause problems in sequencing reactions such as failed reactions noisy data or poor sequencing results If the primer is a short oligo that contains n 1 primers HPLC cannot always remove the n 1 contaminants 6 Contact AGRF Sequencing If you have not resolved your problem please contact AGRF Sequencing for further support Contact Details e Email sequencing agrf org au e Phone 07 3365 8815 Page 11 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGra
8. d Sanger Sequencing Australian Genome Troubleshooting Guide Research Facility Ltd If you need help analysing your Sanger sequencing output this guide can help CONTENTS 1 O Opa O A E A T 2 2 Sequence Data Evaluation ccccssscsssssessesseeceseesesseesenseeeesseesenseseenseseeneeses 2 T FOES UN ames ene een Sonor en te one ne eee een Sone ener ome Se om emeee 4 3 1 Reviewing the SEQUENCE ccccccceececeeeeceeeeeceeessueeeseeeessueesseueeseeesseeeseeeetseeeees 4 Cele SOO Oa eeunenn EEES 4 oO PN 21 0 E16 ae ee ee ene ee eee en ne es ee eee ere nes ee eevee re eee er eer 4 g2 Bes OL AIA OM sartautacirasdracaeantacienudtasanantaslienidtasantentadhesedtauantantadhesediauantantaainsaans 9 aat Palea See erreien EEEE 5 Jaa WEIK SEGU NOD EE Pe ee ee TREE ener EEN 6 3 2 3 Short sequence or shorter than expected ccceccceccsecceeeeeeeeeeeeeeeeeeeeaeeeaees 7 3 2 4 Multiple sequences erect ateerercninincntinannncninendsatbecnereraninineieinemasindeniienaees 8 OES A E E A EA AE E A 9 Review AGRF submission ssssnnunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnmnnn 10 5 Reviewing Experimental Setup of SEQ Reaction cccssseceesseeeenseneenees 10 5 1 DNA lempl ate REVIEW es reesneesraiaaiernansaesnaeiaatnanriesausatataanaesausdersarnnaenaaniaesied 10 92 Pumar DESION ROVIO W crece 11 6 Contact AGRF Sequencing ssssssnnusnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnm nnna 11
9. g site present Confirm the primer site is present in the sequence template Redesign or use a different detected primer Primers have degraded through freeze thaw Make up new primer stocks cycles Inefficient primer binding Redesign primer Insufficient amount of DNA template Re quantify DNA and increase the amount of DNA if required DNA template has degraded or Inhibitory Re extract DNA template or clean up contaminant in your samples e g salts phenol template EDTA ethanol Page 5 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 d Sanger Sequencing er Troubleshooting Guide Research Facility Ltd 3 2 2 Weak sequence Se ee re ee n l Le aa ee O theese he ef e ee eo ee me me me ee me ee ee ee ome ce me Ge oe oe Very low peak height in the raw data trace D i 1 4 i tr u W d ry OPT PPT a eng hay OeT i pv HoT nnana a i k L k bem ie sende suas wym I AChOG TEGCE RTC CTE TC COAG ACHOGG A SEG TAC TO OCEOE NGECED ICE RNG OCETEG THERESE TTCTace rE CeacE AAAARRARALAEEAARTA ere ohebene Base calls fade before the end of the read and the signal to noise ratios are very low Ay Why ira nls d Al danaa Problem Probable Cause Solution Low peaks Insufficient amount of DNA template Quantitate the DNA throughout trace Inhibitory contaminant in your samples e g Increase the amount of DNA salts phenol EDTA et
10. hanol template clean up DNA template Insufficient amount of primer or inefficient Check primer dilution and or re primer binding design primer Page 6 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 aT Sanger Sequencing husran erone Troubleshooting Guide 3 2 3 Short sequence or shorter than expected Very high peaks in the raw data trace that fade off abruptly ture l ee te ete e mF i epas cage Beco T7ECcIe GOS EL CS SS CCS ATOSCCGSCE AT TTOTTE TE Taaa Te Tepe cese i MARIA i Ti jii j i PLAUTA TA Poor quality sequence at start leading to shorter than expected sequence length stops abruptly Problem Probable Cause Solution Sequence starts Primer or Template ratio is incorrect or Re examine template and well but signal contaminant is present in template primer concentration ae y Re extract or clean up template Repetitive region Repeat regions especially GC Add 1u DMSO to the and GT repeats can cause the signal to fade sequencing reaction either due to depletion or slippage or secondary Sequence the structure complementary strand Secondary structure GC and AT rich templates Add 1ul DMSO to the can cause the DNA to loop and form hairpins Linearized DNA restriction enzymes may have cut the template Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release D
11. residual dyes Figure 1 The analysed data trace should show sharp evenly spaced peaks across the read and a clear baseline Figure 2 AGRF recommends the use of Applied Biosystem s free Sequence Scanner software available for download at www appliedbiosystems com sequencescanner Coordinates xy 1275 378 500 100 500 2000 2500 3000 3500 4000 4500 5000 5500 6000 6500 7000 7500 8000 8500 9000 9500 10000 10500 NOO M500 12000 12500 13000 13500 14000 14500 15000 15500 16000 16500 Wh i 1 Re i b i n a ett ee Uwe NN N n l I 4 Ja m a a a i oA Wl I l PEP ee ee ee Figure 1 Raw Data Page 2 of 11 Sanger Sequencing Troubleshooting Guide GNGFM00346 v1 1 Approved By Ken McGrath Release Date 11 12 2014 C rf Sanger Sequencing porphin Troubleshooting Guide Research Facility Ltd It is equally important to look at data values displayed in the annotation file Figure 3 Itis useful to check the following e Average signal to noise ratio indicates labelling efficiency and should fall between be 100 and 750 e The base call start indicates the scan point at which the read commences at and should be 600 to 800 e The end point should be 13 000 to 14 000 or at the end of the read e The number of QV bases gt 20 should be 950 to 1000 less for shorter PCR fragments Trace Identification b Instrument and Data Collection Software Trace File Name Stdvi 1_A401 abl
12. th Release Date 11 12 2014
13. time to review the samples in each submission batch e For example does the problem occur in o Specific samples o Specific submissions o Samples extracted during the same process or different processes o Samples stored under similar conditions or under different conditions etc e Is the symptom present in other samples of the same submission Are there any differences in how the templates of other samples in the same submission were prepared e Was the same primer used in all samples of the submission e How was the template stored after preparation for this submission 5 Reviewing Experimental Setup of SEQ Reaction Based on the results from Sequence Data Evaluation use the tables below to review your experimental setup 5 1 DNA Template Review Recommendation Run an agarose gel to detect any contaminating DNA or RNA Measure the A260 A280 ratio of your samples Quantitate the DNA template using the absorbance at 260 nm A260 Dilute or concentrate the DNA as needed to obtain an A260 reading between 0 05 and 1 00 Comment Purified DNA should run as a single band on an agarose gel Note Uncut plasmid DNA can run as three bands supercoiled nicked and linear Note RNA contamination up to 1 ug can be tolerated in the sequencing reaction but it affects DNA quantitation greatly For pure preparations of DNA in TE the A260 A280 ratio is 1 8 Very clean samples in pure water can give a ratio of 1 5 to 1 6
Download Pdf Manuals
Related Search