Diagnostic Mutation Database User Manual
Contents
1. Approve 858 NGRL Test amp Awaiting Approval The approval status feature has been designed to mirror the approval process followed by many diagnostic laboratories where reports are checked and signed off by a second scientist before being sent to the clinician for reporting to the patient Once you have checked the referral approve it by clicking referral must be in the Active folder and confirm your approval Your referral will then be marked as Approved To withdraw approval for an approved referral click Withdrawh If a referral that you are approving Is not correct you can send it back to the Draft folder without editing it by clicking RORA 19 Diagnostic Mutation Database oMu DBO Section 6 De identifying your data Referrals must be effectively de identified before being submitted to the database To help you to do this we have developed a tool to pseudonymise your patient IDs Each laboratory has its own unique and permanent key which is used to encrypt submitted text specifically for that lab Access the pseudonymisation software at https ngrl manchester ac uk Anonymise logon htm Log on to the tool by selecting your laboratory from the drop down list and typing your laboratory s key into the Password box If you are submitting data for the first time please contact support dmudb net to request your laboratory key Logon to the DMuDB Anonymising Software To preserve patient confidentiality wit2. be forwarded to the appropriate person for response DMuDB does not provide a secure email service so do not exchange confidential information through the database email To respond to an enquiry you should reply to the sender s email address which is provided in the enquiry email You are not obliged to respond however if you are unable to help the sender with their enquiry we suggest that you let them know It is the responsibility of the laboratories involved in each enquiry to assess the request and decide on the appropriate response and the amount of information that should be shared Diagnostic Mutation D M U D B e Database Section 4 Referral visibility Viewing data Your lab is a member of one or more groups in the database Labs that have subscribed to the database will be a member of the DMuDB visibility group UK labs will be members of the UK Labs visibility group A subscribing UK lab will be a member of both groups Each lab is also a member of its own lab group Each group has specific visibility settings Own lab you will be able to see all data submitted by other members of your lab DMuDB members of this group can see all data submitted under DMuDB and UK Labs visibility group settings UK Labs members of this group can see all data submitted under the UK Labs visibility group setting Submitting data When submitting a referral or multiple referrals to the database you will need to choose the visibility
3. the variant in which you are interested click on to email all the laboratories that have submitted this variant An email form will pop up the variant details will be automatically included and the email will be sent trom the email address set for your account Write your message including your name laboratory and details of your variant query then click Send Message Diagnostic Mutation Database oMu DBO PENNEN ENEE NRIN eels Se ais Variant Enquiry Email Variant CABBYCEG Exon 11 Gene BATAZ 5 laboratories have submitted referrals for this variant To contact the laboratories that have submitted referrals associated with this variant fill outthe message below Please include your name laboratory and contact details and give brief details of any specific information that you need The variant details shown above will be included automatically From this email the laboratory can choose to correspond with WOU directly DMuDE does NWOT provide a secure email service so DO MOT include any patient or otherwise confidential information in this message Cancel Email Enter your enquiry here send Message Responding to variant enquiries Each lab has designated a laboratory enquiry email address All variant enquiries for that lab will be emailed to this address Individual laboratories can decide how they want to handle process enquiries a single person can be responsible or each enquiry can
4. use this field to record any clinical notes about the referral that were received with the sample Please do not enter any patient identifying information here Additional information that may be useful can also be entered here Report Date should be set to the date that the referral was reported Visibility should be set depending on who you would like to share the referral with see Section 4 Referral visibility for more details on this setting The options you see here will depend on what visibility groups your lab is a member of Standard options are Your own lab only members of your own lab will be able to see the referral DMuDB all labs that have subscribed to DMuDB will be able to see the referral UK labs all UK labs and all labs that have subscribed to DMuDB will be able to see the referral Enter details for this Referral pwede ee JUN Click Save to continue Once saved a referral ID will be created for your referral you can use this ID to tind your referral in the future Diagnostic Mutation D M u D B O Database Enter details for this Referral 05 07 2011 DMuDB EJ You can change the visibility of your referral at any point by changing the selection in the drop down list and then clicking Save To add a variant to the referral first add a disease to the record Add Disease Add Disease If the disease you need is not in the list contact a curator to request that the dis
5. DB accession number ascribed to each referral automatically on submission HGVS name the name of the variant in HGVS nomenclature e g c 10234A gt G Gene name the unique gene symbol HGNC approved for the gene e g BRCA1 Disease name the name of the disease Sequence the name of the reference sequence e g NM_000059 1 Alternative name an alternative name for a variant for example if there is an alternative reference sequence that results in an alternative numbering of bases Interpretation value search by interpretation e g pathogenic Protein the protein change of interest e g p Ala742Val If your search returns only one referral you will be taken directly to the referral record If your search returns more than one referral you will see these listed in a table of results This table lists all of the key information about each variant found Click on La to view the details of an individual entry or click on next to the variant name to see the relevant variant information in a pop up dialogue box The Universal Browser can also be accessed by clicking on in the right hand column of the DMuDB search results table Getting more information about a variant It is often useful to contact the laboratory or laboratories that have submitted a variant of interest you may have questions about the interpretation that they have recorded or may wish to get the most up to date information on the variant Once you have found
6. Diagnostic Mutation D M u D B O Database Diagnostic Mutation Database User Manual August 2011 DMubDB is a service provided by NGRL based at Central Manchester University Hospitals NHS Foundation Trust lt gt Ni Gs L Manchester M13 9WL United Kingdom www ngrl org uk Manchester Z ational Genetics Reference Laboratory Manchester Diagnostic Mutation Database oMu DBO Contents Section 1 About DMuDB Section 2 Accessing the database DMuDB account set up and login Overview of database menu areas Changing account details Logging off Section 3 Searching the database Using the Universal Browser Using the Browse function Getting more information about a variant Section 4 Referral visibility oO UO WDA unum A A W Viewing data Submitting data Referral display N Section 5 Submitting data NO Manual submission N Bulk data submission O Approval process N O Section 6 De identifying your data N Section 7 Help and support Diagnostic Mutation Database ED Section 1 About DMuDB The Diagnostic Mutation Database DMuDB was established in 2005 by NGRL as a repository of diagnostic variant data to support the diagnostic process in UK genetic testing laboratories NGRL developed DMuDB in response to a need amongst UK laboratories for an easy and secure way to share variant data in order to support the inte
7. Patient IDs should be de identitied using the NGRL s Pseudonymisation tool before they are uploaded to the database If you wish to do this before you send your data to the curator see Section 6 De identifying your data for instructions on using this tool At present it is not possible for users to de identity multiple patient IDs in a batch If your patient ID is a laboratory generated identifier and not related to patient information such as name address or date of birth then we suggest that this is sufficiently secure to allow transfer of the data to the secure DMuDB server From here a curator will format your data and patient IDs will be automatically de identitied as part of the XML process What data to send There are a number of essential fields that are required before a data set can be uploaded to the database This information can be provided all together or in separate parts e g variants for a gene provided in a spreadsheet and essential information about that gene provided in an accompanying email Essential information Optional desirable information Patient Identifier Gender Disease Ethnicity Your lab name Year of birth OMIM number of gene tested Contact name lab contact for this Variant name in HGVS gene nomenclature Report date Reference sequence Interpretation of variant Genotype heterozygous homozygous etc Exon number Predicted consequence missense nonsense frameshift etc Sending your da
8. arked with must be completed Gender select a gender or use Not Known when the information is not available Not Specified should be used when gender cannot be determined Patient location country from where the patient has been referred Year of birth we do not collect exact date of birth to avoid patient identification Ethnicity this can be left blank if it is not of relevance to the disease You do not need to enter a Patient Clinic ID this is only required for certain referrals that are part of a project that requires the collection of additional data from the referring clinic Click Continue to proceed with the referral submission Diagnostic Mutation D M u D B O Database Enter the details of the new patient record On clicking Continue you will be alerted if identical patient details already exist in the system In this case you will either have already entered this referral and should not proceed or you will be entering a new report for a patient that has already been reported in which case you can proceed and a new referral will be created Please note that multiple referrals for the same patient ID are not linked in the system and will be treated as separate and independent referrals Submit new Referrals to the repository Help Enter the referral details in the form provided Please note Referral Contact Referring Clinician and Referred Clinic are not required for standard referrals Notes
9. ative variant name here Protein you can record the protein change here Reference if there is published literature referencing the variant then you can enter the details here Once saved you will need to provide details of how the variant has affected the patient Set the sample ID genotype and interpretation values sample ID is the ID you entered earlier if you are entering multiple samples for this patient make sure that you set the Sample ID to the correct value Variants Found Edit AUER BRCA1 c4327Ce 1 e Heterozygous D C Pathogenic Remove 0 Add New Vanant Interpretation value options are as follows Non pathogenic Probably not pathogenic Probably pathogenic Pathogenic Unclassified i e variant of unknown clinical significance there is not enough evidence to make a decision on pathogenicity Not known i e information on interpretation has not been provided Add further tests and or variants to your patient referral by repeating these steps Diagnostic Mutation D M U D B e Database Associated clinical keywords Keyword data can be added to a referral to allow analysis of phenotypic data in the future The data entered here should be an abstraction of the clinical information presented in the referral notes using a controlled list of keywords for the disease in question Each keyword can be qualified to indicate presence absence of the phenotype severity laterality etc Some keywords
10. ccount at https secure dmudb net ngrl rep Home do Both username and password are case sensitive ee Please login to the DmuDB Forgotten your password If you have forgotten your password click on the Forgotten your password link and follow the instructions to reset your password Once logged in you will see buttons for the different control areas of the database in the top right hand corner D M T D B O Diagnostic Mutation E ome Logout Da ta ba se Logged in as NGRL Test Select an action from the menu above Diagnostic Mutation Database EMD Overview of database menu areas Modules This area contains a file upload tool that allows you to upload bulk data to be formatted and added to the database by a curator See Section 5 Submitting data for details about this Submissions In this area you will see all the submissions from your own laboratory both draft and active See Section 4 Referral visibility and Section 5 Submitting data for more information about this Browse This area provides a search tool for searching the database See Section 3 Searching the database for more information about this My Account In this area you can view and edit your own account information Changing account details You can change your display name email address and password through the My Account menu but you cannot change your username or the laboratory that you belong to To make changes to these items you
11. ceptable Use Policy 01 08 11 pdf Diagnostic Mutation Database Dmu DB o Section 2 Accessing the database Please make sure you are familiar with the DMuDB Acceptable Use Policy before you log on to the database See Section 1 for details DMuDB account set up and login Each laboratory that is registered with DMuDB has its own laboratory account Each laboratory can have multiple staff members who will each have their own unique usernames and passwords New staff accounts can be created at any time by sending a request to support dmudb net A DMuDB curator will usually call the designated laboratory contact to confirm that the request is legitimate before setting up the new account Your account comprises the following information Username this is a permanent identification used to uniquely identify each user You will use it to log on to the database Display name this is the name that other database users will see in areas where users are identified e g on data submission First name Surname this is a record of your name and can be different from your display name Laboratory this identifies which laboratory you belong to Database access rights and restrictions i e what data you can see in the database are set for laboratories rather than for individuals Email address this will be used to email password details if you ever need to reset your password and so must be an active email address Log in to your a
12. e please contact a curator support dmudb net to request that it is set up You will need to provide the following information Disease name Disease OMIM number Disease mode e g autosomal recessive X linked dominant Gene symbol Gene OMIM number Reference sequence Manual submission Data can be submitted to DMuDB one referral at a time To submit a new referral go to the Submissions button and select New Referral eee i Prowse My Account Submit new Referrals to the repository Help Referral Search Filter Enter values to search the list of Referrals by See the help for advice on performing more complicated queries New Referral You are asked to enter a patient identifier this must be de identified before you enter it here To de identify your patient ID follow the link to the NGRL s pseudonymisation tool see Section 6 De identifying your data for guidance on using this software Sample identifiers are usually used as they can identify the referral and patient in the laboratory s own database but do not contain any personal patient details Enter your pseudonymised patient ID and click on Submit Submit new Referrals to the repository Enter a patient identifier to check for an existing patient record Pseudonymising hlFuixkiZiqVNIWIRGMhCOFdg9zggulo 9 sv5YGz k JZt3zOqRODHSGyHT CMinHRIBSSHRWBGmMH26 Submi Fill in the patient details in the form that is presented Fields m
13. ease and gene Is set up Click Save to continue Add sample details Associated Samples Add Sample Diagnostic Mutation D M u D B O Database Sample ID becomes important when multiple samples are tested for one patient Use 1 2 3 etc Tissue type select from the drop down list If you need a new term adding to the list contact a curator with your request The remaining fields are not relevant for a standard referral Click Save to continue Add a gene test select the gene and then the type of test Associated Genes Tested Add Gene Test Add Gene Test a Gene Test Type NF 162200 Click Save to continue Add your variant s Add New Vanant Diagnostic Mutation D M u D B O Database Select variant Use this form to select the reference sequence used then select or create the variant Select your reference sequence and then start to enter your variant in HGVS nomenclature If the variant has already been submitted to the database you will find it in the drop down list and the remaining details will be automatically filled in If any of these details differ from your report then you can amend them as necessary If your variant has not been submitted before then continue to Till in the required fields Notes on non essential fields Alternative name this can be used if a different naming system is used by your lab or other labs rather than HGVS Enter the altern
14. hin the Diagnostic Mutation Database lab identifiers such as lab sarnple ids cannot be used directly Therefore you must use an encrypted version of the lab identifier a pseudonym in DMuDB So that you can later reassociate the DMuDB entries with your lab database entries you must also be able to decrypt the patient identifier stored in DMuDB to the original lab identifier The DMuDB Anonymising Software provides the facility to do this reversible encryption To logon to the software select your lab from the list below and enter your lab password If you do not know your lab password or your lab is not listed please contact us Laboratory v Password PO Once logged on you will be presented with two fields one for your lab patient ID and one for the encrypted DMuDB ID To encrypt a patient ID insert the ID into the lab ID box Click Encrypt The encrypted ID will appear in the DMuDB ID box You should copy and paste this into DMuDB as the patient identifier when creating the new referral To reverse the process paste the DMuDB ID into the DMuDB ID box and click Decrypt The original patient ID should appear in the Lab ID box Encrypt Decrypt Lab Ids To convert a lab identifier to a patient identifier which can be used in DMuDB enter the lab identifier lab sample id is recommended into the box provided and press the Encrypt button To convert a patient identifier as stored in DMuDB to a lab identifier ente
15. ion about BRCA1 Gene name BRCA1 Description breast cancer 1 early onset Aliases RNF53 BRCC1 Created On 2003 01 01 00 00 00 0 Updated On 2008 01 09 13 19 08 0 Links HGNC OMA Ensembl Transcripts ENS TO0000357 654 an View Graphics accessibility privacy disclaimer 2009 NGRL Manchester Genetic Medicine 6th Floor St Mary s Tel 44 0161 276 8716 Hospital Oxford Road Manchester M13 Fax 44 0161 276 6606 To view variants listed in DMuDB you will need to log on to the database through the Browser Graphical Display for BRCA1 ENST00000357654 A graphical representation of the gene selected is displayed below If there is an error with any of the variants please email the site administrator here Graphics Information Genes BRCAI J Databases MBIC Logon DMU Logon DENIGMA cla MENIGMA ref M dbSNP Diagnostic Mutation Database oMu DBO The graphical display for the gene can be seen below the Graphics Information box The top view shows the entire gene Variants listed within different databases are shown on separate tracks Focus the view on a specific area of the gene to view variants in more detail This can be achieved in a number of ways 1 Using the Graphics Information panel Specify the area you are interested in by selecting the exon or by filling in the HGVS position or codon number in the Information box Click Refresh display to jump to that region Graphics Info
16. oval Referrals awaiting approval have been submitted but not approved whereas active and withdrawn referrals have been approved Withdrawn referrals are currently suspended 1 Found 1 Records BAGAGE G 18589 05 07 2011 10 08 2011 15 02 NGRL Test amp Awaiting Approval To make a change to an active referral it must be removed to the Draft folder Click on REMITA and then make your edits to the referral Once saved you will be able to tind the referral in the Draft folder To delete a referral you must first move it to the Draft folder From the Draft folder click FERS Bulk data submission Multiple referrals can be uploaded in bulk to the database by a curator Labs can send data sets to the curator who will then format and upload them using XML The most straightforward format in which to submit bulk data is in excel spreadsheets although the curator can handle data in other formats if necessary 17 Diagnostic Mutation Database oMu DBO We do not want the submission of data to be overly complicated or time consuming for DMuDB users We recommend that you spend time only ensuring that patient identifying fields are removed before sending your data to a curator and allow the curator to format the data into the required configuration The curator will work closely with you during this process to resolve any issues with your data and fill in any missing information before upload to the database De identifying your data
17. r the DMuDB patient identifier in the box provided and press the Decrypt button Lab ID testID12 34 Patient DMuDB ID G2RVW2vcY 7AWDVGYX2DC evmk pVBEYBBBwI 7 4 7y mz1lv Ww yCMvinnHAjcIZye 3UTyLYLeA 2G l4TEFROQ8kVal 8CnOsLxpk 3vr pk9SDLgso GMAMO 20 Diagnostic Mutation D M U D B e Database Section 7 Help and support This User Manual outlines most of the key features and processes for DMuDB Additional information can be found by clicking the Help and links on the database pages 1 performing more complicated queries ea aC The DMuDB team is always happy to provide technical support to individuals If you need help or have questions please contact us on Tel 44 0 161 276 8716 Email support dmudb net DMuDB team Kathryn Robertson Stephanie Farrell Project manager Project Assistant kathryn robertson cmft nhs uk stephanie tarrell cmft nhs uk Glen Dobson Jasmin Opitz Health Informatics Scientist Health Informatics Scientist glen dobson cmft nhs uk Andrew Devereau Mike Cornell Director Clinical Bioinformatician andrew devereau cmft nhs uk michael cornell cmft nhs uk Bharathi Kattamuri Health Informatics Scientist bkattamuri nhs net NGRL Genetic Medicine 6th Floor St Mary s Hospital Central Manchester University Hospitals NHS Foundation Trust Oxford Road Manchester M13 9WL UK 21
18. require a quantity e g age of onset which should b entered in the box provided include units too as appropriate See the image below for an example Associated Clinical Keywords 22 Edit Remove Affected Uterine cancer E Edit Remove Family history Breast cancer Edit Remove Age of onset 58 years PEC BEE Submitting editing and reworking referrals Once you have created your referral it will sit in your laboratory s Draft folder within the Submissions menu Referrals in the Draft folder are only visible to other members of your laboratory Referrals This page shows draft referrals new referrals and referrals being reworked Draft amp new referrals have not been submitted for approval yet new referrals being those that have newly created and draft referrals being those that have been edited Referrals being reworked have previously been approved but require updates 1 Found 2 Records Edit View Submit Remove 18589 O5 07 2011 10 08 2011 15 02 NGRL Test E Draft amp Edit View Submit Remove 18575 02 08 2011 02 08 2011 11 21 NGRL Test Draft amp med Built Hosted and Maintained by Certus Technology Copyright amp 2000 To share your data with other database users you must submit it to the active system click on SSE The referral will now be found in the Active folder Drat i Active Referrals This page shows approved referrals withdrawn referrals and referrals awaiting appr
19. rmation Genes BRCAT w Databases MIBIC Logon MIDMUDB MWEN GMAiclaj MEN GMAiref M dbSNP Features Clcoding sequence Display region HGVS positio Codon Go Search sequence Ee Refresh display 2 Using the gene overview graphic Click on an exon in the gene overview graphic and then select Centre Display On This Feature in the pop up box that appears 3 Using navigation buttons Use the navigation buttons at the top of the graphical view to change the display 4258002 lt gt to move 100bp up downstream lt lt gt gt to move 1kb up downstream lt lt lt gt gt gt to move 5kb up downstream Diagnostic Mutation Database oMu DBO Scroll down the screen to see your selected region at the sequence level Mouse over a variant to see the HGVS name or click on the variant to open an information box click on View All Database Entries to see a list of database entries for that variant 965 975 965 995 O05 015 025 035 TACAACCAAATGCCAGT CAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCCAAGAAGAG TyFRanGlnNetProvalarguiaserargqhanLeuGlnLeuNte tel lu lylLyaGcluProeslatTaArelyslabyabyace DMuDB ENIGM Aiclab Momenclature c 20020 gt T Nucleotide Change Type substitution ENIGMA ref at Alternative Hame In V1 dbSNP eee m pe Predicted Consequence a Pree TAACAAGCCAAATGOGAACAGACAAGTAAAAGACATGOGACAGC GATA e mIernGOeOTGAAGTTAACAAATGOCACLTSG amp SGTT FRanLyaAProasaanGl
20. rpretation of new variants and improve the quality and consistency of diagnoses The database also provides a way for diagnostic laboratories to share data that they do not want to or are not ready to publish publically NGRL has built up the content of DMuDB over time through an active programme of laboratory visits to provide training on the use of the database and to collect data to be submitted to the database Access to the database was originally restricted to UK diagnostic genetics laboratory professionals and use of the data is restricted to diagnostic use only Data within DMuDB remains the property of the submitting laboratory and any non diagnostic use of the data must be requested and agreed with the data owners in advance Access to DMuDB has now been extended to non UK laboratories through a partnership with EMQN We welcome this opportunity to extend the service to laboratories around the world believing that the database Is an important facility that should be open to all diagnostic laboratories By sharing variant information more widely the information stored within the database will become even more useful and the database will become an increasingly beneficial resource for the laboratories that use it Users of DMuDB do so within the terms and conditions stated in the DMuDB Acceptable Use Policy which can be accessed at www ngrl org uk Manchester page dmudb usepolicy or downloaded from www ngrl org uk Manchester downloads Ac
21. setting you would like to apply to it The setting will default to your own lab to prevent any unintentional release of data Please note that unless you change the visibility setting only other members of your lab will be able to see your data As long as the referral you are submitting is not a special case we would expect you to apply the following visibility settings depending on the group s to which your lab belongs Non UK DMuDB subscribers should use the DMuDB visibility setting UK labs should use the UK Labs visibility setting UK labs subscribing should use the UK Labs visibility setting Referral display Not all of the information collected when you submit a referral will be displayed to other database users There are two levels of display full display and restricted display Full display is currently only available to other members of your lab They will be able to see all the information you have entered for a referral Restricted display other DMuDB users who aren t members of your own lab will not see all of the information included in each referral The image below highlights the fields that will not be shown in the restricted view fields are greyed out Admin Module View View Referral Details Submit for approval Remove referral Diagnostic Mutation Database oMu DBO Section 5 Submitting data If the disease and or gene for which you want to submit data is not present in the databas
22. ta to a curator The most secure way to send your data to a curator Is via the secure DMuDB server Files names should include your laboratory name and an indication of the disease gene data that it contains To upload a file go to the Modules menu and click New Report EE Te SJibmissions Browse My Account Re orts for module Repository Loader 1 Found 0 Records Browse for your file and then click Upload Diagnostic Mutation D M U D B e Database Upload data file s for report New Report Click Done to complete the upload Source Data Files File name 1 Reload Files Only DMuDB curators and other members of your laboratory will be able to see the files uploaded here You can leave all uploaded files as a record of the data you have submitted or you can delete them through the edit menu Please note that if you delete a file it will be permanently removed from the system so make sure that the curator has processed your data first Approval process Once a referral has been submitted to the active database it will be marked as Awaiting approval Active Referrals This page shows approved referrals withdrawn referrals and referrals awaiting approval Referrals awaiting approval have been submitted but not approved whereas active and withdrawn referrals have been approved Withdrawn referrals are currently suspended 1 Found 1 Records E View Rework Reject
23. ucilnThrserLysaarghHisasapsersaapThrPhePraclubeubyalbeuThraansalarPro lys DMuDB Clicking on the entry accession number will take you to the source of that variant entry We recommend that you follow a variant to its source to ensure that you have the original information as there is always a small possibility that errors can be introduced during automated data extraction processes DMuDB 1 entry entries found Entry Accession Number Submitter Interpretation Other ariants Associated With Entry Manchester Regional ioe are Laboratory ENIGMA cla 1 entryfentries found Entry Accession Number Submitter Interpretation Other ariants Associated With Entry ooo00s 1 not known ENIGMA ref S entryfentries found Entry Accession Number Submitter Interpretation Other ariants Associated With Entry nood4s7 not known 000d not known o00gdz4 not known 0000430 not known 0000431 not known dbSNP 1 entry entries found Entry Accession Number Submitter Interpretation Other ariants Associated With Entry rss 357250 not known not known Diagnostic Mutation Database EMD Using the Browse function You can of course browse for variants within DMuDB Click on the Browse button Modules Submissions CBrowse My Account Advanced Search D em In the resulting search form enter the search terms relevant to your enquiry Field definitions are as follows Click on Advanced search Referral ID the unique DMu
24. will need to contact a curator support dmudb net with your request If a staff member leaves a laboratory we ask that the DMuDB curators are notified so that the individual s account can be deactivated Logging off Your database session will time out after a certain length of time if there is no activity To re access the system you will need to return to the login screen Your last session will not be saved i e you will not be returned to the place where you timed out and any incomplete referral submission that you were working on will not be automatically saved To log out of the database click the Logout link in the top right hand corner of the screen Diagnostic Mutation ED Database E ee Diagnostic Mutation Database oMu DBO Section 3 Searching the database Using the Universal Browser When searching for a variant submitted by another laboratory as opposed to looking for a variant that you have previously submitted and maybe want to edit we recommend that you use the Universal Browser This provides a graphical display of the variants in DMuDB as well as a number of other databases against the relevant reference sequences The Universal Browser can be accessed at https ngrl manchester ac uk Browser To search for a variant 1 Select your gene of interest 2 Click on View Graphics Home gt Projects gt Informatics gt Universal Browser gt Genes gt BRCA1 Databases Genes BRCA1 Informat
Download Pdf Manuals
Related Search