Home

Tet-Off and Tet-On Gene Expression Systems User Manual

1. tTA VP16 minimal Neo activation domain ptTA2 3 4 7Akb 8 40 polyA Hindi 1987 Tolerated Relative Stable level of transient regulatior VP16 activation domain activator activation factor pTet Off F 1X 100 2 2 x 105 ptTA2 3X 98 nd Scal Bsal ptTA3 5 39 5 x 105 3686 3267 ptTA4 8 9 14 44 x 10 Figure 16 VP16 Minimal Domain Vectors The three vectors differ in the sequence of their VP16 activation domains The letters in the first column of Panel B indicate the amino acid at the key functional position of a 13 amino acid repeat that composes the minimal domains The rest of the vector is identical to pTet Off The activation domain from each vector is tolerated at different levels and causes activation at different levels relative to pTet Off Panel B nd not determined Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual Appendix A Vector Information continued The pTet tTS Vector The pTet tTS Vector Cat No 631011 is designed for use with the Tet On System It is not suitable for use with the Tet Off System pTet tTS prevents unregulated gene expression in the absence of Dox It expresses the tetracycline controlled transcriptional silencer tTS which is a fusion of TetR and the KRAB AB domain of the Kid 1 protein Freundlieb et al 1999 Witzgall et al 1994 In the absence of Dox tTS
2. VH 38 1d s awAzua Io ula 01d owen 59215 uonoujse1 e qej ejes pesse1dx3 ul owe onsouBeiq NOLLVINYOANI SINALSAS 13 L ll 318 VL Protocol No PT3001 1 www clontech com Clontech Laboratories Inc 36 Version No 100912 Tet Systems User Manual Appendix A Vector Information continued You can obtain the sequences of the Tet Off and Tet On vectors at www clontech com manuals Xho 2 Hind pTet On only 871 Mutations that convert TetR to rTetR and tTA to rtTA Scal i 3949 3546 Figure 9 pTet Off and pTet On composite vector map Unique sites are in bold Only pTet On contains the second Hind Ill site at Position No 871 This site can be used to distinguish pTet Off from pTet On pTet Off expresses the tTA tet transactivator regulator protein from the strong immediate early promoter of cytomegalovirus Poemy pTet On expresses the reverse tTA which contains four amino acid mutations as marked on the map In addition there are several silent mutations in pTet On In all other respects the vectors are identical Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual Appendix A Vector Information continued Xhol 2 470 537 470 480 490 500 510 G
3. is silent in the absence of binding of TetR or rTetR to the tetO sequences Genes inserted into the MCS will be responsive to the tTA and rtTA regulatory proteins in the Tet Off and Tet On systems respectively Note that the cloned insert must have an initiating ATG codon The addition of a Kozak sequence is not required but may improve expression levels pTRE Tight Gene X plasmids should be cotransfected with the Linear Hygromycin Marker Cat No 631625 not included or Linear Puromycin Marker Cat No 631626 not included to permit selection of stable transfectants Complete sequence information is provided in the pTRE Tight Vector Information Packet PT3720 5 ThepTRE Tight Luc ControlVector packaged with the pTRE TightVector contains an additional 1 649 bp encoding firefly luciferase inserted into the MCS This vector can be used as a reporter of induction efficiency It is not intended as a cloning vector pTRE Tight DsRed2 discontinued contains the gene encoding DsRed2 cloned into the BamH and Not sites in the pTRE Tight MCS DsRed2 is a variant of the red fluorescent protein isolated from the IndoPacific sea anemone relative Discosoma sp Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 39 Tet Systems User Manual Appendix A Vector Information continued MCS hCMV 1 pTRE Myc HA amp 6xHN 3 8 kb E com P ta B globin polyA 3
4. Luciferase activity arbitrary units log transformed 04 T T T 0 0 1 1 0 10 100 1000 10 T T T T T T 1 001 01 4 1 10 100 1000 1000 Doxycycline ng ml Doxveveline na ml Figure 6 Dose response curves for the Tet Control Cell Lines Panel A Dose response curves for the CHO AA8 Luc Control Cell Line Experiments with another control cell line CHO K1 EGFP Luc Tet Off have demonstrated that suppression can be maintained with Dox concentrations as low as 10 pg ml Cunningham et al 1997 Differences in background and induction levels can occur between multiple independent clonal lines when establishing double stable Tet Off Cell Lines see Section IX C Panel B Dose response curve for the U2 OS Luc Tet On Control Cell Line 2 Determine optimal plating density 3 Once you have determined the optimal drug concentration determine the optimal plating density by plating cells at several different densities in the presence of a constant amount of drug If cells are plated attoo high adensity they will reach confluency before the selection takes effect Optimal plating density is dependent on population doubling time and cell surface area For example large cells that double rapidly have a lower optimal plating density than small cells that double slowly a Plate cells at several different densities in each of six 10 cm tissue culture dishes containing 10 ml of the appropriate selective medium Suggeste
5. 1 Introduction continued Tet Off System Tet Off DO C binds TRE and activates transcription 237 Paw tetR VP16 H in the absence of Dox v REMOVE DOX Transcription 6 2 Gene of interest e TRE y Gene of interest jeu o DOX o Tet On Tet On System rtTA binds TRE and activates transcription ZE in the presence of Dox S aie T DOX Tran iption Transcription Gene of interest TRE Gene of interest ADD DOX Figure 2 Schematic of gene regulation in the Tet Off and Tet On Systems Tet Off The TRE is located upstream of the minimal immediate early promoter of cytomegalovirus which is silent in the absence of activation tTA binds the TRE and thereby activates transcription of Gene X in the absence of Tc Dox Tet On The reverse Tet repressor rTetR was created by four amino acid changes that reverse the protein s response to Dox As a result of these changes the rTetR domain of rtTA binds the TRE and activates transcription in the presence of Dox Please see Appendix A for maps and detailed vector information Clontech Laboratories Inc www clontech com Protocol No PT3001 1 6 Version No 100912 Tet Systems User Manual 1 Introduction continued response plasmids When cells contain both the regulatory p T
6. 4 9AW cBAuz3u1d GC OL II PUIH 9AIN 3H 1d peprAo4d 041u02 GG GG euou eseJegJlon 9A A on 1 9A IN 341d 10199A 8 0 0 094 8282 auou X 9A N 3u 1d 9UN QuBi1 38 1d 915894 8 cv ouou 111 14911 3 14 90 807 oux 97 auou X ula oid 1611 9919 23918 o41u02 LO LY OE 9094 9007S euou 1 10199A L 0 0 9094 9 euou X uie1o4d c3u1d VEL 19 041005 48 Y s oux 9 ulAwoind on undz3u d Lg 10199A GGL Go L s ula oid 1d BAUS 2010 o41u02 99 v G oux 0969 ulsAWoIBAY on BAuz3u 1d eG 10199A 48 9 76 oux eg X uod BAuz3u 1d 10199A ELO 79 4094 ev euou SL L 9 SHNd 6661 7239 S1139 d 6 0 GL 10129A CR 3 LEL UpAuoeu VLU oeu LQHAd _ 9661 72 19 c II 2661 peIng a 5505 10199A GK 9 OUX LEL 8 0 14 661 7219 Axzuuseg Io s awAzua d uio304d 92u849J9H 59215 uonoujso1 9218 9 5 onsouBeig YOL9JA
7. rTetR rtTA Tc Tet Clontech Laboratories Inc 46 Doxycycline a derivative ofTc that is the preferred effector substance for Tet experiments ATet Off orTet On cell line that has been stably transfected withpTRE2 GeneXconstruct GeneXisinducedbytheremoval for Tet Off or addition for Tet On of Dox from the media The gene of interest cloned into the Response Plasmid The complete immediate early promoter of cytomegalovirus This is a proven strong promoter in many mammalian cell types The minimalimmediate early CMV promoter This promoter lacks the strong CMV enhancer and is therefore silent in the absence of binding of tTA or rtTA to the TRE An altered minimal immediate early CMV promoter This promoter is used in the pTRE Tight vector series The compound promoter in pTRE and related vectors that consists of the TRE element located just upstream of P nincmv The compound promoter in the pTRE Tight vectors that consists of the TRE mog element located just upstream of P nincmva The plasmid that encodes the hybrid regulatory protein or in Tet Off or Tet On System i e pTet Off or pTet ApTRE derived plasmid thatexpressesa gene ofinterestfrom the Pi cyyx promoter A pTRE derived plasmid can be used in both Tet Off and Tet On systems The reverseTet repressor In E coli rTetR binds specifically to tetO and blocks transcription of the tet operon in the presence ofTc Rever
8. Regulatory Transfect with regulator plasmid plasmid pTet Off or pTet On Select G418 resistant clones MC Screen by transient transfections with pTRE2hyg Luc for clones with low background and high Tc or Dox dependent induction or pTet On Tet Off or Tet On cell line Premade cell lines are available from Clontech SECOND STABLE TRANSFECTION Section IX 2 months Transfect with response plasmid pTRE Hyg Pur cotransfect with Linear Marker pTRE2hyg OR pTRE Tight or pTK Hyg or pPUR if necessary Response Select hyg puro resistant clones plasmid Screen by a gene specific assay for clones with low background and high Tc or Dox dependent induction of Gene X Double stable Tet Off or Tet On cell line Figure 4 Overview of developing Tet Off and Tet On and double stable Tet Off and Tet On cell lines To use the Tet Gene Expression Systems you will need to make a double stable Tet cell line as outlined above If you are starting with your own cell line you will need to perform the entire procedure outlined above If you are starting with one of our premade Tet Off orTet On Cell Lines only perform the second stable transfection Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual List of Components Store all mammalian cell lines in liquid nitrogen 196 C Store all plasmids a
9. SINAL 35 Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual inued ion cont Vector Informati Appendix A 10199A Z EL OL vVO 19003 L09 euou BAH J Ld c ese19Jion 1484 pue 5 188 184 041402 GE LE BON 96 euou 1 6 9661 7212 19 194 J10199A vette BON 80 9 euou eseJeyon 194 9661 7212 uo1eg Tad 9 0 X uie104d 10123A Ge Le eqx 17 auou je6 d Igd 9661 72 1e uojeg 59 194 1016 eqx euou X v iad 9661 7212 lad 10199A DNK 110 ee euou cpeusa cpeusqaubiL 384d 9 9 Hweg NHX9 3u 1d 81 86 euou eseJeylon NHX9 9nT NHX9 384d 28 101 9179 9 II PUIH cS X ureyo4d NHX9 NHX9ndz3g 4 v s AY094 10129A 81896 I PUIH yg ulAwoiBAy 10 4 9 NHX9 cBAuz3u1d 8 0 0 9094 101989A 86 Hweg 86 euou X ute1o4d NHX9 NHX9 3H 1d 81 86 14 ui 9 9 euou eseJaylon VH onT vH 3u1d A uo 3 10199A 915896 ulsAwoind X vHundz3ud 101989A 8179 9 I PUIH umAuoJBAu X urejoJd yH VH cBAuz3u4d 100 PIA 101989A ge ese auou x
10. are firefly luciferase or B galactosidase Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual Appendix A Vector Information continued VP16 Minimal Domain Vectors The VP16 Minimal Domain Vector Set Cat No 631019 now discontinued ptTA2 ptTA3 and ptTA4 expresses tetracycline controlled transactivators containing modified VP16 activation domains Figure 17 Baron et al 1997 Overexpression of unmodified VP16 can have negative pleiotropic effects due to interactions with essential components of the transcriptional machinery This generally does not interfere with in vitro expression but can pose problems in vivo when transcription is driven by a strong tissue specific promoter The modified VP16 moieties contained in these transactivators allows their expression at higher intracellular levels potentially allowing increased stability for cell culture and transgenic applications Baron et al 1997 Furthermore each vector allows protein expression over a different induction range Panel B Applications such as knock in knock out experiments rely on site specific integration and thus are dependent on the transcriptional activity ofthe particular locus In these situations theVP16 Minimal Domain Vectors may enable you to obtain optimal expression levels by adapting the activation potential of the transactivator to the expression level of the locus
11. plasmid which also contains a neomycin resistance gene The secondcritical componentis the response plasmid which expresses a gene of interest Gene X under control of the tetracycline response element or TRE We provide two response vector series for the Tet Systems Our original vector series pTRE or its variants contain the TRE which consists of seven direct repeats of a 42 bp sequence containing the tetO located just upstream of the minimal CMV promoter Pmincmv Pmincmy lacks the strong enhancer elements normally associated with the CMV immediate early promoter Because these enhancer elements are missing there is extremely low background expression of Gene X from the TRE in the absence of binding by the TetR domain of tTA or the rTetR domain of rtTA Our second response vector series pTRE Tight contain a modifiedTRE TRE moa upstream of an altered minimal CMV promoter resulting in further reduced basal expression of Gene X pTRE Tight can fully minimize background expression in certain cell lines and is especially useful in cases where background expression is unacceptable such as the expression of proteins that are extremely potent or toxic to the host cell The ultimate goal in setting up a functional Tet System is creating a double stable Tet cell line which contains both the regulatory and Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual
12. the site of integration we recommend that you isolate and analyze as many clones as possible at Step 6 In general test at least 30 clones We have screened as many as 100 clones to obtain one that exhibits suitably high induction and low background 1 Grow cells to 80 confluency in complete medium orto a density appropriate for your transfection method 2 Transfect the pTet On or pTet Off Vector by the desired method Note If desired the regulator plasmid can be linearized by digestion with a restriction enzyme Sca for pTet On Off 3 Plate transfected cells in ten 10 cm culture dishes each containing 10 ml of the appropriate complete medium at the optimal density determined in Section VII 4 Allowcellsto divide twice 24 48 hr then add G418to 400 500 ug ml Note The exact concentration of G418 for selection and the optimal plating density may vary from cell type to cell type and with different lots of G418 See Section VII B 5 Replace medium with fresh complete medium plus G418 every four days or more often if necessary After about five days cells that have not taken up the plasmid should start to die Split the cells if they reach confluency before massive cell death begins After 2 4 weeks isolated colonies should begin to appear 6 Isolate large healthy colonies and transfer them to individual plates or wells Suspension cultures must be cloned using the limiting dilution technique When working with adherent
13. 00912 15 Tet Systems User Manual IV Additional Materials Required continued For regulation of gene expression Doxycycline Cat No 631311 Dilute to 1 2 mg ml in H5O Filter sterilize aliquot and store at 20 C in the dark Use within one year Tetracycline hydrochloride Sigma Cat No T3383 Dilute to 1 mg ml in 70 ethanol Filter sterilize aliquot and store at 20 C in the dark Use within two months For luciferase assays e Use any standard luciferase assay system For PCR confirmation of integrated plasmids optional If you wish to confirm the presence of integrated plasmids in clonal hygromycin puromycin or neomycin resistant cell lines you will need to design PCR primers that amplify a portion of the appropriate regulator or response plasmid Clontech Laboratories Inc www clontech com Protocol No PT3001 1 16 Version No 100912 Tet Systems User Manual V Plasmid Manipulations A Propagation of Vector Plasmids 1 Transform each of the plasmids provided in this kit into a suitable coli host strain e g DH5a to ensure that you have a renewable source of DNA Tet vectors are low copy number so use chloramphenicol amplification to increase plasmid yields 2 You will need to perform large scale plasmid preparations of any plasmid that will be introduced into mammalian cells To ensure the purity of the DNA prepare transfection grade plasmid by purification on a NucleoBond colu
14. 2 Gossen M amp Bujard H 1995 Efficacy of tetracycline controlled gene expression is influenced by cell type BioTechniques 89 213 215 Gossen M Freundlieb S Bender G Muller G Hillen W amp Bujard 1995 Transcriptional activation by tetracycline in mammalian cells Science 268 1766 1769 Harkin D P Bean J M Miklos D Song Y H Truong V B Englert C Christians F C Ellisen L W Maheswaran S Oliner J D Haber D A 1999 Induction of GADD45 and JNK SAPK dependent apoptosis following inducible expression of BRCA1 Cell 97 575 586 Hillen W amp Berens C 1994 Mechanisms underlying expression ofTn10 encoded tetracycline resistance Annual Rev Microbiol 48 345 369 Kozak M 1987 An analysis of 5 noncoding regions from 699 vertebrate messenger RNAs Nucleic Acids Res 15 8125 8148 Li X Zhao X Fang Y Jiang X Duong T Huang C C amp Kain S R 1998 Generation of destabilized enhanced green fluorescent protein as a transcription reporter J Biol Chem 273 34970 34975 Rennel amp Gerwins P 2002 How to make tetracycline regulated transgene expression go on and off Anal Biochem 309 79 84 Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual X References continued Resnitzky D Gossen M Bujard H amp Reed 5 1994 Acceleration of the G1 S phase transition by expression of cy
15. 23 GAATTCGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACGCGT EcoRI Pvul 368 Smal GCTAGCGCGGCCGCATCGATAAGCTTGTCGACGATATCTCTAGA Nhel Eagl Cal Sall EcoRV Xbal Acc Figure 12 pTRE Myc HA and 6xHN composite vector map and multiple clone site MCS These tagged pTRE vectors contain an MCS immediately downstream of the Tet responsive Pacmv 1 Promoter 1 contains the Tet response element TRE which consists of seven copies of a sequence containing the 19 bp tet operator sequence tetO and the minimal CMV promoter which lacks the enhancer that is part of the complete CMV promoter in the regulatory plasmids Consequently P cyy 4 is silent in the absence of binding of TetR or rTetR to the tetO sequences Genes inserted into one ofthe sites in the MCS will be responsive to the tTA and rtTA regulatory proteins in the Tet Off and Tet On systems respectively Note that the cloned insert must be in frame with the tag and need not have an ATG or Kozak sequence as these are provided at the start of the tag The tagged fusion protein can be efficiently detected and purified using antibodies and resins optimized against the different markers Complete sequence information is provided in the pTRE Myc HA and 6xHN Vector Information Packets pTRE Myc PT3398 5 pTRE HA PT3462 5 pTRE 6xHN PT3463 5 Please note that these vectors have been discontinued Clontech Laboratories In
16. E E N Tet Off9 and Tet On Gene Expression Systems User Manual Clontech United States Canada 800 662 2566 Asia Pacific 1 650 919 7300 Europe 33 0 1 3904 6880 er oasen PT3001 1 100912 Clontech Laboratories Inc Published October 201 2 Technical Support US E mail tech clontech com www clontech com Tet Systems User Manual Table of Contents l Introduction 4 A Summary 4 B TheTet Off and Tet On Systems 5 C Advantages of the Tet Systems 7 D Tet Off vs Tet On Systems 9 E Tetracycline vs Doxycycline 9 Additional Tet Response Vectors 10 G Beyond the Basics VP16 and pTet tTS Vectors 10 H ViralTet Expression 10 Il Protocol Overview 11 Ill List of Components 13 IV Additional Materials Required 14 V Plasmid Manipulations 17 A Propagation of Vector Plasmids 17 B Generating your Gene Specific Expression Vector 17 VI Cell Culture Guidelines 18 A General Information 18 B Characteristics of Tet Off and Tet On Cell Lines 18 C StartingTet Cell Cultures from Frozen Stocks 18 D Preparing Frozen Stocks ofTet Cell Lines 19 VII Pilot Experiments 20 A Pilot Experiment with the CHO AA8 Luc Tet Off or U2 OS Luc Tet On Control Cell Line 20 B Titrating G418 Hygromycin and Puromycin Kill Curves 21 C Test Potential Host Cells by TransientTransfection with pTRE2hyg Luc and pTet Off or pTet On 23 VIII Development of Stable Cell Lines 24 A Transfection and Selecti
17. Fold induction levels are almost always lower in transient assays than in properly screened stable and double stable cell lines For example the Saos 2 Tet Off Cell Line exhibits 40 fold induction in transient expression assays but stable clones can be isolated that exhibit 6 000 fold induction and background expression levels that are indistinguishable from control background expression Therefore an apparent lack of induction response in the transient assay should not be the sole reason for aborting your experiments in a particular cell line Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 23 Tet Systems User Manual VIII Development of Stable Tet Cell Lines A SKIP SECTION IF YOU HAVE PURCHASED A PREMADE TET OFF OR TET ON CELL LINE Transfection and Selection of Stable Cell Lines Figure 7 The following protocol describes the development ofTet Off or Tet On cell lines You must optimize the protocol for each cell type Some of the parameters most likely to need adjustment are plating densities transfection method 6418 concentrations for selection and incubation and growing times Regardless of the cell type and transfection method the goal is to generate a cell line that gives low background and high induction of luciferase activity when tested by transienttransfection with pT RE2hyg Luc in Section B Because the level of expression of tTA or rtTA is profoundly affected by
18. GATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCGCATCGAT BamH 1 Pvull Min Miel _ 514 520 530 AAGCTTGTCGACGATATCTCTAGA Sall EcoRV Accl ch TRE Pincay Tou pTRE2hyg 5 3kb P globin poly A Xhol 3759 Xhol pog D MCS 470 537 SV40 polyA TRE L nint hCMV 1 470 480 490 500 510 GGATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCGCATCGAT EcoR Pvull Mlul Nhel Noti Cla l 1175 514 520 530 AAGCTIGTCGACGATATCTCTAGA EcoR V 2 Xho l 51kb Agin 3759 Bu 3142 Figure 10 pTRE2hyg and pTRE2pur vector maps and MCSs Both response vectors contain an MCS immediately downstream oftheTet responsive 1 promoter P cmy 1 contains theTet response element TRE which consists of seven copies of a sequence containing the 19 bp tet operator sequence tetO and the minimal CMV promoter which lacks the enhancer that is part of the complete CMV promoter in the regulatory plasmids Consequently is silent in the absence of binding ofTetR or rTetR to the tetO sequences Genes inserted into one of the sites in the MCS will be responsive to the tTA and rtTA regulatory proteins in the Tet Off and Tet On systems respectively Note that the cloned insert must have an initiating ATG codon The addition of a Kozak sequence is not required but may improve expression levels The additio
19. II and Figure 8 Section IX If you have purchased a premade Tet Off orTet On Cell Line from Clontech you need only perform the second transfection with your pTRE Gene X construct Important note on simultaneous versus consecutive transfections Ingeneral werecommendthatyoudo notattemptto savetimeby cotransfecting theregulatorandresponseplasmids Cotransfectedplasmidstendtocointegrate into the chromosome and enhancer elements from the CMV promoter on the regulator plasmid pTet Off or pTet On can induce basal expression of Gene X Furthermore cotransfection prevents comparison of multiple clones since differences in induction or absolute expression could be due to clone to clone variation in tTA or rtTA expression In contrast consecutive transfections have several advantages Most importantly the response plasmid generally will not cointegrate with the regulator and you can select a double stable cell line that gives very low to no background expression of Gene X Furthermore once you have developed a suitable Tet Off or Tet On cell line it provides a proven genetic background into which you can introduce many different response plasmids Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual Protocol Overview continued Perform pilot experiments Section VII 3 weeks Host cell line FIRST STABLE TRANSFECTION Section VIII 2 months Neo
20. Takara Bio Company 2012 Clontech Laboratories Inc This document has been reviewed and approved by the Clontech Ouality Assurance Department Protocol No PT3001 1 Version No 100912 www clontech com Clontech Laboratories Inc
21. binds the tetO sequence in the TRE and actively silences transcription of Gene X Figure 18 As Dox is added to the culture medium the tTS dissociates from the TRE relieving transcriptional suppression At sufficient concentrations of Dox the rtTA transactivator binds the TRE and activates transcription of Gene X For additional information on pTet tTS including a vector map please refer to the pTet tTS Vector Information Packet PT3334 5 available at www clontech com manuals rtTA 12 10 Induced high transcriptio Arbitrary light units 0 1 10 100 1 000 10 00 Doxycycline ng ml Figure 17 Dose response curve demonstrating controlled expression in a cell line coexpressing tTS and rtTA HR5 cells which constitutively express rtTA were transiently transfected with a plasmid expressing tTS and a control vector expressing luciferase downstream of the TRE Cells were cultured in the indicated levels of Dox After 24 hr cells were harvested and assayed for luciferase activity SD silencing domain AD activation domain Data provided courtesy of S Freundlieb Zentrum f r Molekulare Biologie ZMBH Universit t Heidelberg Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 5 Tet Systems User Manual Appendix B Glossary Dox Double stable Tet Cell Line Gene X P nincmv P nincmva Paomv 1 Regulator Plasmid Response Plasmid
22. c HA and 6xHN composite vector map and MCS 41 Figure 14 pTK Hyg plasmid map 42 Figure 15 The pBl expression cassette 43 Figure 16 VP16 Minimal Domain vectors 44 Figure 17 Controlled expression in a cell line coexpressing tTS and rtTA 45 List of Tables Tablel _ Tet Off andTet On Vector Alignment 34 Tablell Tet Systems Vector Information 35 Protocol No PT3001 1 wuwwelontech can Clontech Laboratories Inc Version No 100912 3 Tet Systems User Manual 1 Introduction A Summary The Tet Off and Tet On Gene Expression Systems and the premade Tet Off and Tet On Cell Lines give researchers ready access to the regulated high level gene expression systems described by Gossen amp Bujard 1992 Tet Off and Gossen et al 1995 Tet On In the Tet Off system gene expression is turned on when tetracycline Tc or doxycycline Dox aTc derivative is removed from the culture medium In contrast expression is turned on in theTet On system by the addition of Dox Figure 1A The Tet On system is responsive only to Dox not to Tc Both systems permit gene expression to be tightly regulated in response to varying concentrations ofTc or Dox Figure 1B Maximal expression levels in Tet systems are very high and compare favorably with the maximal levels obtainable from strong constitutive mammalian promoters such as CMV Yin et al 1996 Unlike other inducible mammalian expression systems gene regulation in the Tet Systems
23. c www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual Appendix A Vector Information continued MCS SV40 TRE2 poly A P Pur Hyg hCMV 1 pTRE2Marker Myc HA amp 6xHN B globin polyA Psvao w tag sequence c Myc HA 6xHN epitope tag ATG XXX XXX XXX XXX XXX XXX XXX XXX XXX XXX XXX XXX XXX CTT ATG GCC ACT GAC GCG TTG CTA GCG CTG GAA GCT TAT TTG CGG CCG CGT CGA TAT C Mlul Nhel Clal Notl EcoR V Figure 13 pTRE2hyg2 Myc HA amp 6xHN and pTRE2pur Myc HA amp 6xHN composite vector map and multiple clone site MCS These tagged pTRE vectors contain a protein tag sequence followed by an MCS immediately downstream ofthe Tet responsive Pacmv 1 promoter containsthe Tetresponse element TRE which consists of seven copies of a sequence containing the 19 bp tet operator sequence tetO and the minimal CMV promoter which lacks the enhancer that is part of the complete CMV promoter in the regulatory plasmids Consequently is silent the absence of binding of tTA or rtTA to the tetO sequences Genes inserted into one of the sites in the MCS will be responsive to the tTA and rtTA regulatory proteins in the Tet Off and Tet On systems respectively The tagged fusion protein can be efficiently detected and purified using antibodies and resins optimized against the different mar
24. cells at Clontech we generally isolate clones using cloning cylinders orcloning discs Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual VIII Development of Cell Lines continued Neo NA Neo p OR Transfect host cell line with regulator plasmid pTet Off or pTet On cell line m Select in presence of G418 solate at least 30 G418 resistant clones e e gt Screen by transient transfections with pTRE2hyg Luc for clones with low background and high induction of luciferase in response to Tc or Dox Freeze stocks of Tet cell line Tet Off or Tet On cell line Figure 7 Flow chart for developing Tet cell lines Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual VIII Development of Cell Lines continued B Screening Stable Cell Lines The next step is to perform transient transfection assays with a reporter vector to identify G418 resistant clones that meet the criteria for stable Tet Off orTet On lines See AppendixA for maps and moreinformation on these reporter vectors Pick clones and expand as needed for your particular cell line Screen clones once they reach 50 80 confluency in a 6 well plate 2 Trypsinize the cells and split about 1 3 into a single well of a 6 well plate The cells in this stock plate will be propagated depending upo
25. clins D1 and E using an inducible system Mol Cell Biol 14 1669 1679 Sambrook J Fritsch E F amp Maniatis T 2001 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Triezenberg S J Kingsbury R C amp McKnight S L 1988 Functional dissection of VP16 the trans activator of herpes simplex virus immediate early gene expression Genes Devel 2 718 729 Witzgall R O Leary E Leaf A Onaldi D amp Bonventre J V 1994 The Kruppel associated box A KRAB A domain of zinc finger proteins mediates transcriptional repression Proc Natl Acad Sci USA 91 4514 4518 Yao F Svenjo T Winkler T Lu M Eriksson amp Eriksson E 1998 Tetracycline repressor tetR rather than the tetR mammalian cell transcription factor fusion derivatives regulates inducible gene expression in mammalian cells Hum Gene Ther 9 1939 1950 Yarronton G T 1992 Inducible vectors for expression in mammalian cells Curr Opin Biotechnol 3 506 511 Yin amp Schimke 1995 Bcl 2 expression delays drug induced apoptosis but does not increase clonogenic survival after drug treatment in HeLa cells Cancer Res 55 4922 4928 Yin D X Zhu L amp Schimke 1996 Tetracycline controlled gene expression system achieves high level and quantitative control of gene expression Anal Biochem 235 195 201 Protocol No PT3001 1 www clontech com Clontech Lab
26. contains the tetO Tetracycline controlled transactivator A 37 kDa fusion protein consisting of the TetR and the VP16 activation domain AD Binds specifically to the TRE and activates transcription in the absence ofTc or Dox Tetracycline controlled transcriptional silencer a fusion protein consisting of the TetR and the KRAB AB domain of Kid 1 Binds specifically to the TRE and suppresses transcription in the absence of Dox The activation domain of the VP16 protein from herpes simplex virus Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without prior written approval of Clontech Laboratories Inc Your use of this product is also subject to compliance with any applicable licensing require ments described on the product s web page at http www clontech com It is your responsi bility to review understand and adhere to any restrictions imposed by such statements Clontech the Clontech logo CalPhos Tet Off Tet On and Xfect are trademarks of Clontech Laboratories Inc All other marks are the property of their respective owners Certain trade marks may not be registered in all jurisdictions Clontech is a
27. d densities cells 10 cm dish 5 x 106 1 x 108 5 x 105 2 105 1 x 105 and 5 104 b Incubate the cells for 5 14 days replacing the selective medium every four days c Examine the dishes for viable cells every two days For selecting stable transfectants use a plating density that allows the cells to reach 80 confluency before massive cell death begins at about day 5 Thisis the cell density at which cells should be plated for selection of stable transfectants For HeLa cells we have found 2 x 10 cells 10 cm dish to be a good plating density Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual VII Pilot Experiments continued optional Test Potential Host Cells by Transient Transfection with pTRE2hyg Luc and pTet Off pTet On Tet expression systems have been established in numerous cell lines including HeLa CHO MCF7 HEK 293 and HepG2 However the system may not be compatible with every cell type Performing a transient expression assay with pTet Off or pTet On and pTRE2hyg Luc may provide a quick indication of whether or not theTet systems will work in a particular cell line This test is not necessary if you have purchased a premade Tet Off orTet On Cell Line You shouldtransfectcells using varying ratios of pTet Off Onto pTRE2hyg Luc For example try pTet Off On pTRE2hyg Luc 1 ug 1 ug 1 ug 10 ug 10 ug 1 ug Important Note
28. ded even if you are using premade Tet Cell Lines 1 Titrate at fixed cell density a Plate 2 x 10 cells in each of six 10 cm tissue culture dishes containing 10 ml of the appropriate complete medium plus varying amounts 0 50 100 200 400 800 ug ml of hygromycin or G418 For puromycin add the drug at 0 1 2 5 5 75 and 10 ug ml Note 293 Tet On and Tet Off cells Cat No 630903 and Cat No 630908 respecitively are especially sensitive to hygromycin test a concentration range with a midpoint of 25 ug ml Saos 2Tet Off cells Cat No 630911 exhibit resistance to hygromycin test a concentration range with a midpoint of 800 ug ml b Incubate the cells for 10 14 days replacing the selective medium every four days or more often if necessary c Examine the dishes for viable cells every two days For selecting stable transformants use the lowest concentration that begins to give massive cell death in 5 days and kills all the cells within two weeks For HeLa and CHO cells we have found 400 ug ml G418 and 200 ug ml hygromycin to be optimal In mammalian cells the optimal level of puromycin is typically around 1 ug ml Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 21 Tet Systems User Manual VII Pilot Experiments continued D CHO AA8 Luc Tet off Control Celts EEJ 107 4 2500 105 2000 3 fi 1500 1000 Luciferase activity RLU 3 500 102 4
29. e 0 5 ug ml Selection acceptable range 0 5 5 ug ml Trypsin EDTA Trypsin Sigma Cat No T3924 Clontech Laboratories Inc www clontech com Protocol No PT3001 1 14 Version No 100912 Tet Systems User Manual IV Additional Materials Required continued Dulbecco s phosphate buffered saline DPBS Sigma Cat No D8662 Cell Freezing Medium with or without DMSO Sigma Cat No C6164 or Cat No C6039 Tissue culture plates and flasks available from BD Discovery Labware www bdbiosciences com discovery_labware Cloning cylinders discs PGC Scientific Cat No 62 6150 40 45 or Cat No 62 6151 12 16 For transient and stable transfections The transient and stable transfections inthis protocol can be performed by various methods Reagents will depend on which transfection method you use Although we generally use electroporation for both transient and stable transfections with the Tet Off and Tet On System other methods work well and may be preferable depending on cell type The CalPhos Mammalian Transfection Kit Cat No 631312 and Xfect Transfection Reagent Cat Nos 631317 amp 631318 are available for high efficiency calcium phosphate or nanoparticle mediated transfections The efficiency of transfection for different cell lines may vary greatly A method that works well for one host cell line may be inferior for another Therefore when working with a cell line for the fi
30. e dependent on the stability of the mRNA and protein It may take some time before stably expressed proteins accumulate to equilibrium levels Refer to the results seen in Figures 1B 3 and 6 Clontech Laboratories Inc www clontech com Protocol No PT3001 1 30 Version No 100912 Tet Systems User Manual IX Development of Double Stable Cell Lines continued Loss of regulation On occasion well characterized double stable cell lines can lose their responsiveness Tc or Dox This can occur after changing lots of calf or fetal bovine serum and appears to be due to contamination of some lots of serum withTc If you observe a sudden loss of responsiveness check your serum by performing a dose response curve as described in Section VII A You can also try replating and washing the cells 3 hr later to remove any residual antibiotic that may be interfering with induction control Rennel amp Gerwins 2002 Loss of regulation can also be due to switching off or methylation of the viral promoter It is recommended that you subclone and freeze stocks of your cells at various stages Toxicity of the VP16 activation domain Some researchers have inquired about the possible toxic effects of expressing the VP16 AD in mammalian cells In our experience and that of the Bujard laboratory and the many other labs that have successfully used the Tet system this has not been a problem in tissue culture Like other transcription factors the tTA regu
31. est forTc contamination in other sera as described in Section VII A Note The PC 12 Tet Off and Tet On Cell Lines require horse serum Sigma Cat No 0146 for growth which does not normally containTc 200 mM L Glutamine Sigma Cat No G7513 Solution of 10 000 units ml Penicillin G sodium and 10 000 ug ml Streptomycin sulfate Sigma Cat No P0781 Antibiotics for clonal selection Prior to use determine the optimal concentration of each antibiotic for selection as described in Section VII B G418 for selection of Tet Off and Tet On Cell Lines G418 is available in powdered form from Clontech Cat No 631307 Note that the effective weight is about 0 7 g per gram of powder Make a 10 mg ml stock solution by dissolving 1 g of powderin approximately 70 ml of DMEM or alpha MEM without supplements Filter sterilize and store at 4 C Recommended working concentration Maintenance 100 ug ml Selection HeLa or CHO cells 400 500 ug ml acceptable range 50 800 ug ml Hygromycin for selection of double stableTet Off andTet On Cell Lines Hygromycin B is available from Clontech Cat No 631309 Recommended working concentration Maintenance 100 pg ml Selection HeLaorCHOcells 200ug ml acceptable range 50 800 pg ml Puromycin for maintenance of the MDCK Tet Off Cell Line and for selection of double stableTet On andTet Off cells availablefrom Clontech Cat No 631305 amp 631306 Recommended working concentration Maintenanc
32. et Off or pTet On and the response e g pTRE Gene X Vectors Gene X is only expressed upon binding of the tTA or rtTA protein to the TRE Figure 2 In theTet Off System tTA binds the TRE and activates transcription in the absence ofTc or Dox In the Tet On System rtTA binds the TRE and activates transcription in the presence of Dox In both Tet On and Tet Off Systems transcription is turned on or off in response to Dox in a precise and dose dependent manner You can greatly reduce the time needed to establish a Tet cell line by purchasing one of our premade Tet Cell Lines which already stably express the appropriate regulatory protein A list of available Tet Off andTet On Cell Lines is available from ourTet Systems product page at www clontech com Note that addition of a nuclear localization sequence nls to tTA rtTA alters the protein s regulatory function M Gossen amp H Bujard pers comm Addition of an nls to tTA or rtTA increases maximum expression but also increases background expression due to altered binding affinity to tetO sequences unpublished observations Therefore we recommend that you do not add a nls to either tTA or rtTA for creating stable Tet cell lines C Advantages of the Tet Systems The Tet Off and Tet On systems have several advantages over other regulated gene expression systems that function in mammalian cells e Extremely tight on off regulation Background or leaky expression of Gene X i
33. expression regulated dose dependent induction with similar kinetics of induction and high absolute levels of gene expression Thus for most purposes there is no inherent advantage of using one system over the other With the Tet Off system it is necessary to keep Tc or Dox in the medium to maintain the native off state Because Tc and Dox have relatively short half lives see below you must add Tc or Dox to the medium atleast every 48 hours to suppress expression of Gene X Conversely in the Tet On system the native off state is maintained until induction Forthis reason Tet On may be more convenient in transgenic applications because you need only add Dox to the animals diet when induction is desired E Tetracycline vs Doxycycline TheTet On System is only responsive to Dox notTc Gossen amp Bujard 1995 In contrast Tet Off systems respond equally well to eitherTc or Dox We recommend that you use Dox for allTet System experiments in part because a significantly lower concentration of Dox is required for complete activation or inactivation 0 01 1 ug ml Dox vs 1 2 ug mlTc In both systems the antibiotics are used at concentrations far below cytotoxic levels for either cell culture or transgenic studies In addition Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual 1 Introduction continued Dox has a longer half life 24 hours than Tc 12 hours Thu
34. hest induction and lowest background we recommend that you grow and analyze as many clones as possible In general test at least 30 clones We have screened as many as 100 clones to obtain one that exhibits suitably high induction and low background IMPORTANT If you are not using pTRE2hyg pTRE2pur or another response vector bearing a mammalian selection marker skip the steps below and use the cotransfection protocol in Section IX C 1 Grow cells to 80 confluency in complete medium or to a density appropriate for your transfection method 2 Transfect cells with pTRE2hyg Gene X or pTRE2pur Gene X Note If desired the plasmids can be linearized by digestion with a restriction enzyme check the Vector Information Packets provided with each vector for appropriate restriction sites 3 Plate transfected cells in ten 10 cm culture dishes each containing 10 ml of the appropriate complete medium at the optimal density determined in Section VII 4 Allowcellstodividetwice 24 48hr then addtheappropriateselection agent hygromycin or puromycin to the optimal concentration determined in Section VII For hygromycin the range is generally Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual IX Development of Double Stable Tet Cell Lines continued Insert Gene X into pTRE2hyg pur another pTRE variant or a pBl vector pTRE2hyg pur Transfect Tet Off or Tet On ce
35. ia a bidirectional promoter Nucleic Acids Res 23 3605 3606 Baron U Gossen M amp Bujard H 1997 Tetracycline controlled transcription in eukaryotes novel transactivators with graded transactivation potentials Nucleic Acids Res 25 2723 2729 Cunningham S M Cunningham M D Zhu L amp Kain S 1997 Determination and correlation of expression levels of luciferase and EGFP using the tetracycline controlled gene expression system and fluorescence imaging Neuroscience Abs 23 647 Freshney R 2000 Culture of Animal Cells Fourth Edition Wiley Liss NY Freundlieb S Schirra M ller C amp Bujard H 1999 A tetracycline controlled activation repression system with increased potential for gene transfer into mammalian cells J Gene Med 1 4 12 Gossen M Bonin A amp Bujard H 1993 Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements Trends Biochem Sci 18 471 475 Gossen M Bonin A L Freundlieb S amp Bujard H 1994 Inducible gene expression systems for higher eukaryotic cells Curr Opin Biotechnol 5 516 520 Gossen M amp Bujard H 1992 Tight control of gene expression in mammalian cells by tetracycline responsive promoters Proc Natl Acad Sci USA 89 5547 5551 Gossen M amp Bujard H 1993 Anhydrotetracycline a novel effector for tetracycline controlled gene expression systems in higher eukaryotic cells Nucleic Acids Res 21 4411 441
36. ies Inc www clontech com Protocol No PT3001 1 8 Version No 100912 Tet Systems User Manual 1 Introduction continued In contrast to the heterologous Tet Systems homologous systems based on eukaryotic regulatory elements are subject to one or more of the following problems e Inducing stimulus is pleiotropic i e the gene of interest is not the only gene affected by the inducing stimulus t can be very difficult to distinguish specific from nonspecific events in an expression system based on homologous regulatory elements This is largely due to the modular nature of eukaryotic promoters which interact with a variety oftranscription factors that are in turn involved in the regulation of many promoters and or enhancers e Most of the commonly used eukaryotic promoters are too leaky to maintain the gene of interest in the fully repressed off state limiting their usefulness for expressing toxic proteins Maximal level of induction is usually not very high Thus of the systems described to date only the Tet Systems exhibit tight on off regulation absence of pleiotropic effects high induction levels high absolute expression and rapid induction times Gossen et al 1993 1994 D Tet Off vs Tet On Systems Although the Tet Off system has been studied more extensively than the Tet On system the two systems are truly complementary When properly optimized both systems give tight on off control of gene
37. insing is desired perform steps 1 and 2in a 15 ml conical centrifuge tube Centrifuge at 125 x g for 10 min and resuspend in complete medium for culturing This step removes the cryopreservative and can be beneficial when resuspending in small volumes However this step can damage fragile cell membranes 6 The next day examine the cells under a microscope Ifthe cells were not rinsed upon thawing step 5 centrifuge cells if suspension cultures aspirate the medium and replace with fresh prewarmed complete medium without antibiotics 7 Expand the culture as needed Note The appropriate selective antibiotic s may be added to the medium after 48 72 hr in culture D Preparing Frozen Stocks of Tet Cell Lines Once you have started growing a Tet Off or Tet On Cell Line from Clontech prepare frozen aliquots to ensure a renewable source ofcells Similarly prepare frozen aliquots of any double stableTet Off orTet On cell line or of any Tet Off orTet On cell line that you make Trypsinize the desired number of flasks 2 Pool cell suspensions together count cells and calculate total viable cell number 3 Centrifuge cells at 125 x g for 10 min Aspirate the supernatant 4 Resuspend the pellet at a density of at least 1 2 109 cells ml in freezing medium Freezing medium can be purchased from Sigma Cat No C6164 or freeze cells in 70 90 FBS 0 20 medium no additives and 10 DMSO 5 Dispense 1 ml aliquots into
38. is highly specific so interpretation of results is not complicated by pleiotropic effects or nonspecific induction Tc 00 2000 6 4 2 1 05 025 0 OX 4 4 Cyclin io 2 e we eege Bcl 2 coo Figure 1 Inducible on off control of gene expression in the Tet Systems Panel A Double stable cell lines were developed by stably transfecting HeLa Tet Off or HeLa Tet On cells with a plasmid containing E coli lacZ under control of the Tet response element TRE Cells were cultured 1 ug ml Dox For Northern analysis 10 of total RNA was loaded per lane and the blot was hybridized simultaneously with probes to lacZ and the GAPDH housekeeping gene Gossen et al 1995 reprinted with permission of the author Panel B HeLa 53 Tet Off cells were stably transfected with a plasmid expressing Bcl 2 under control of the TRE and grown in the presence of the indicated amounts of Tc A Western blot containing 100 ug of total protein from each condition was probed with human Bcl 2 specific and human cyclin B1 specific mouse monoclonal antibodies Based on scanning densitometry removal ofTc gave 100 fold induction of Bcl 2 For details see Yin amp Schimke 1995 Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual 1 Introduction continued See Appendix A or the Vector Information Packets provided f
39. kers Complete sequence information is provided in the Vector Information Packets pTRE2hyg2 Myc PT3685 5 pTRE2hyg2 HA PT3684 5 pTRE2hyg2 6xHN PT3686 5 pTRE2pur Myc PT3688 5 pTRE2pur HA PT3687 5 pTRE2pur 6xHN PT3689 5 Please note that these vectors have been discontinued Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual Appendix A Vector Information continued EcoR 5040 EcoR 1017 ECOR 2330 Figure 14 pTK Hyg plasmid map pTK Hyg is cotransfected with pTRE derived plasmids but not with pTRE2hyg and pTRE2pur vectors to allow selection of stably transformed cell lines inthe presence of hygromycin The absence of an enhancer element on pTK Hyg prevents the unwanted activation of pTRE derived plasmids upon cointegration into the genome The sequence of pTK Hyg has been deposited in GenBank Accession No U40398 Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual Appendix A Vector Information continued Bidirectional Tet Vectors The Bidirectional Tet Vectors are used to simultaneously express two genes under control of a single TRE Baron et al 1995 for more information see Clontechniques October 1996 p 8 After a Tet Off or Tet On cell line is established a pBl vector is cotransfected with pTK Hyg to permit selection of a double stable tet res
40. l No PT3001 1 26 Version No 100912 Tet Systems User Manual IX Development of Double Stable Tet Cell Lines A Test pTRE Gene X by Transient Transfection into a Tet Off Tet On Cell Line Prior to establishing your double stable Tet Off or Tet On cell lines you should test your pTRE Gene X or Tet Vector construct for functionality Transiently transfect pTRE Gene X into the cell line created in Section VIII or the premade Clontech Tet Cell Line If you are not using a pBI Vector you will need to design a gene specific assay to test for the induction of Gene X Examples of gene specific assays that can be used include e Western blot with an antibody to Protein X e RT PCR using Gene X primers Be sure you can discriminate PCR products generated from genomic DNA from true RT PCR products Northern blot with Gene X probe e Functional assay for Protein X B Stably Transfect and Select Double Stable Cell Lines Figure 8 The next step is to stably transfect the stable or premade Tet cell line with your pTRE Gene X construct The goal is to generate a cell line that gives low background and high expression of Gene X when tested in Section IX D Both expression levels and induction of Gene X can be profoundly affected by the site of integration Insertion near an enhancer may result high basal expression of Gene X whereas other insertion sites may result in suboptimal induction To find the clone with the hig
41. lator does not have to be expressed at high levels in order to give very high level expression of the genes it regulates i e genes encoded on the response plasmid For example Gossen and Bujard have characterized HeLa Tet Off cell lines that contain 6 000 10 000 molecules oftTA percell and give 105 fold induction ofthe Tet regulated genes pers comm For in vivo applications however it may be preferable to use the VP16 Minimal Domain Vectors which aretolerated athigherintracellular concentrations and allow activation over different ranges See Appendix A for more information Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual X References Clontech s Tet Systems were developed in cooperation with Dr Bujard and his colleagues at the Center for Molecular Biology in Heidelberg ZMBH Additional background information onTet regulated gene expressionsystems is available at the site maintained by Dr Bujard s laboratory http www zmbh uni heidelberg de bujard homepage html Please note that Clontech is not responsible for the information on or the maintenance of this site Ausubel F M Brent R Kingdom R E Moore D M Seidman J G Smith J A amp Struhl K eds 1995 Current Protocols in Molecular Biology John Wiley amp Sons NY Baron U Freundlieb S Gossen M amp Bujard H 1995 Co regulation of two gene activities by tetracycline v
42. ll line d with pTRE2hyg pur Gene X response Tet Off or Tet On N plasmid or cotransfect pTRE Gene X or pBl Gene X with a Linear Marker cell line or puromycin SS a Tc or Dox should be included in the medium when establishing Y double stable Tet Off cell lines Select in presence of hygromycin 9 e Isolate at least 30 9 hygromycin puromycin resistant Em clones e dm e OPTIONAL Confirm presence of integrated pTRE Gene X in clones by PCR Screen by a gene specific assay for clones with Low background of Gene X High induction of Gene X Possible assays Western blot using an antibody to Protein X RT PCR using Gene X primers Northern blot with Gene X probe Functional assay for Protein X Y Reporter activity 8 galactosidase or luciferase on 1 vector Double stable Tet Off or Tet On cell line Freeze stocks of double stable cell lines Figure 8 Flow chart for developing double stable Tet cell lines Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual IX Development of Double Stable Cell Lines continued 200 400 ug ml and for puromycin it is 1 5 ug ml ForTet Off cells only When establishing a double stableTet Off cell line we recommend that you culture the cells in the presence of 2 ug mITc or 1 ug ml Dox in order to keep transcription of Gene X turned off This is essen
43. maximum expression levels varied from 123 to 3 176 RLU Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual VII Pilot Experiments continued Procedure 1 Plate 6 aliquots of 0 5 x 10 CHO AA8 Luc Tet Off or U2 OS Luc Tet On cells each into 5 ml of complete culture medium in 6 well culture dishes 2 To titrate Tc add Tc to final concentrations of 0 1 x 107 1 x 103 1 x 102 0 1 1 0 and 10 0 ug ml To titrate Dox add Dox to final concentrations of 0 1 x 103 1 x 107 0 1 1 0 10 and 100 ng ml 3 Allow the cells to grow for 48 hr 4 Assay each sample for luciferase activity using any standard luciferase assay Plot your results logarithmically and compare to Figure 6 B Titrating G418 Hygromycin and Puromycin Kill Curves Prior to using G418 hygromycin or puromycin to establish stable and double stable cell lines it is important to titrate your selection agent stocks to determine the optimal concentration for selection with the particular host cell line being tested This is also important because of lot to lot variation in the potency of these drugs Therefore you should titrate each new lot of antibiotic to determine the optimal concentration We recommend that you perform two experiments for each drug 1 a titration to determine the optimal drug concentration and 2 an experiment to determine the optimal plating density This step is recommen
44. mn Visit www clontech com for complete product information B Generating Your Gene Specific Expression Vector Generate your pTRE Gene X construct using standard molecular biology techniques as described below For more detailed information see Sambrook et al 2001 1 Purify the Gene X fragment by any standard method such as the NucleoTrap Gel Extraction Kit Cat No 740584 or NucleoTrap PCR Purification Kit Cat No 740587 The cDNA or gene fragment must contain an initiation codon In some cases addition of a Kozak consensus ribosome binding site Kozak 1987 may improve expression levels however many genes have been efficiently expressed inTet systems without the addition of a Kozak sequence The fragment can be generated using compatible restriction sites that are present on either side of the gene and inthe cloning vector If no such sites are present the gene fragment can be generated by PCR with suitable restriction sites incorporated into the primers 2 Digestthe response vector pTRE orits variant with the appropriate restriction enzyme s treat with phosphatase and purify 3 Ligate the response vector and the Gene X fragment Transform ligation mixtures into E coli 5 Identify the desired recombinant plasmid by restriction analysis and confirm orientation and junctions by sequencing BR Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Man
45. n of an internal selection element Hyg or eliminates the need for cotransfection with pTK Hyg Complete sequence information is provided in the pTRE2hyg and pTRE2pur Vector Information Packets pTRE2hyg PT3521 5 pTRE2pur PT3520 5 pTRE2hyg Luc and pTRE2pur Luc contain the gene encoding firefly luciferase cloned into the and Nhe sites in the pTRE2hyg and pTRE2pur MCS The Nhe sites were destroyed during construction The luciferase construct adds 1 649 bp to the vectors Clontech Laboratories Inc www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual Appendix A Vector Information continued Xho 2 MCS 323 411 TRE mod Princ tight Pvul 1985 Amp pTRE Tight 26kb polyA Xho 607 323 GAATTCGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACGCGT EcoRI Sacl Mlul 368 Smal GCTAGCGCGGCCGCATCGATAAGCTTGTCGACGATATCTCTAGA Nhel Eag Clal Hind iil Sall EcoRV Xbal Noti Acc Figure 11 pTRE Tight vector map and MCS This response plasmid contains MCS immediately downstream of the Tet responsive promoter contains a modified Tet response element which consists of seven direct repeats of a 36 bp sequence that contains the 19 bp tet operator sequence tetO and the minimal CMV promoter which lacks the enhancer that is part of the complete CMV promoter Consequently
46. n the absence of induction is extremely low with pTRE or its variants Figure 1 For the lowest background expression use Tet On 3G vectors No pleiotropic effects When introduced into mammalian cells the prokaryotic regulatory proteins TetR or rTetR the prokaryotic precursors to tTA and rtTA act very specifically on their target sequences presumably because these regulatory DNA sequences are nonexistent in eukaryotic genomes Harkin et a 1999 e High inducibility and fast response times With the Tet Systems induction can be detected within 30 minutes Figure 3 using nontoxic levels of inducer Induction levels up to 10 000 fold have been observed results not shown In contrast other systems for mammalian expression exhibit slow induction up to several days incomplete induction compared to repressor free controls low overall induction often no more than 100 fold and high nearly cytotoxic levels of inducer reviewed by Gossen et al 1993 Yarronton 1992 Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 7 Tet Systems User Manual 1 Introduction continued e High absolute expression levels Maximal expression levels in the Tet systems can be higher than expression levels obtained from the CMV promoter or other constitutive promoters For example Yin et al 1996 reported that the maximal level of luciferase expression in HeLa Tet Off cells transiently transfected with
47. n the results of the screening assay 3 Transfect the remaining 2 3 of the cells with 1 2 ug of your reporter vector using the desired transfection method Decrease amount of DNA if performing liposome mediated transfection Split into two wells of a six well plate 4 Add Dox 1 2 ug ml to one of the two wells from step 3 Incubate the transfected cells for 48 hr 6 Assay for induction Luciferase Assay calculate fold induction For Tet Off Fold induction Dox RLU Dox RLU ForTet On Fold induction Dox RLU Dox RLU 7 Select clones with the highest fold induction highest expression with lowest background for propagation and further testing In general only select clones that exhibit gt 20 fold induction 8 Freeze stocks of each clone as soon as possible after expanding the culture Note Some researchers may desire to confirm the presence ofthe tTA and rtTA regulatory proteins in stableTet cell lines by Western analysis A Western blot only verifies the presence of tTA or rtTA it does not reveal the functional inducibility of these cell lines Furthermore tTA and rtTA expression in stable cell lines may be below levels detectable by Western blotting High levels of tTA or are not required for good induction and in fact overexpression of tTA can be toxic to cells Therefore Western analysis should NOT substitute for the functional screen Clontech Laboratories Inc www clontech com Protoco
48. nd Fetal Bovine Serum at 20 C Visit ourTet Systems product pages www clontech com for a current list of cell lines and products available for the Tet Systems Tet Off Cell Lines 1 0 ml 1 0 ml e 50 ml Tet On Cell Lines 1 0 ml 1 0 ml 50 ml Protocol PT3001 1 Version No 100912 Tet Off Cell Line 2 x 108 cells ml CHO AA8 LucTet Off Control Cell Line 2 x 108 cells Tet System Approved Fetal Bovine Serum Tet Cell Lines Protocol at a Glance PT3001 2 Tet On Cell Line 2 x 108 cells ml U2 OS Luc Tet On Control Cell Line 2 x 106 cells Tet System Approved Fetal Bovine Serum Tet Cell Lines Protocol at a Glance PT3001 2 www clontech com Clontech Laboratories Inc 13 Tet Systems User Manual IV Additional Materials Required For cell culture Dulbecco s Modified Eagle s Medium DMEM Sigma Cat No D5796 Alpha Minimal Essential Medium Eagle alpha MEM RPMI 1640 or other specified medium The appropriate medium for growing Clontech premadeTet Off andTet On cell lines is described onthe ProductAnalysis Certificate provided with each cell line Fetal bovine serum FBS It is critical that the FBS not inhibit Tet responsive expression You can eliminate Tc contamination problems by using Clontech Tet System Approved FBS This serum has been functionally tested in the Tet Systems to ensure against possible Tc contamination Alternatively use the CHO AA8 Luc Control Cell Line to t
49. of interest poly A Used for screening with antibodies or for purification pTRE 6xHN TRE Ten gene of interest poly A Bidirectional Tet Vectors pBI G gene of interest TRE PmincMV lacZ pBI L tg PmincMV TRE Pmincmv pBl Tet gene of interest 22 TRE Pmincmy Y gene of interest Response vectors for monitoring expression of a target gene via expression of a coregulated reporter RevTet Basic Vectors pRevTet Off w le VP16 Regulator vector for use in RevTet Off System pRevTet On 9UR 37 Wel LE ZUR Regulator vector for use in RevTet On System pRevTRE site w H TRE gene of interest 3 LTR Response vector for use in either RevTet Off or RevTet On Systems RevTet Accessory Vectors pRevTet Off IN S LTR H w H tetR VP16 IRES Neo 3 LTR Can ba usad for quickly establishing a Tet Off cell line Discontinued Clontech Laboratories Inc 34 www clontech com Protocol No PT3001 1 Version No 100912 Tet Systems User Manual inued ion cont Vector Informati Appendix A CG A H0 3 91896 I PUIH ZG ureyo4d 2A N oA N andz3u 1d vs A H0 3 815896 II yg ulsAwoiBAyX
50. on of Stable Cell Lines 24 B Screening Stable Cell Lines 26 IX Development of Double Stable Cell Lines 27 A Test pTRE Gene X by Transient Transfection into a Tet Off or Tet On Cell Line 27 B StablyTransfect and Select Double Stable Cell Lines 27 C StablyTransfect and Select Double Stable Cell Lines Cotransfection 29 D Screening Double Stable Cell Lines 30 E Working with Double Stable Cell Lines 30 Clontech Laboratories Inc www clontechcom Protocol No PT3001 1 Version No 100912 Tet Systems User Manual Table of Contents continued X References 32 Appendix A Vector Information 34 Appendix B Glossary 46 List of Figures Figure 1 Inducible on off control of gene expression in the Tet Systems 4 Figure 2 Schematic of gene regulation in the Tet Systems 6 Figure 3 Luciferase expression is rapidly induced in a Tet Off cell line in response to removal of Dox Figure 4 Developing Tet Off and Tet On Cell Lines 12 Figure 5 Fold induction of luciferase activity in different lots of FBS 20 Figure 6 Dose response curves for the Tet Control Cell Lines 22 Figure 7 Flow chart for developing Tet Cell Lines 25 Figure 8 Flow chart for developing double stable Tet Cell Lines 28 Figure 9 pTet Off and pTet On composite vector map 37 Figure 10 pTRE2hyg and pTRE2pur plasmid map and MCS 38 Figure 11 pTRE Tight vector map and MCS 39 Figure 12 pTRE Myc HA and 6xHN composite vector map and MCS 40 Figure 13 pTRE2Marker My
51. or maps and detailed information on the Tet System Vectors For a complete list of Tet Systems references visit our web site at www clontech com B The Tet Off and Tet On Systems In E coli theTet repressor protein TetR negatively regulates the genes ofthe tetracycline resistance operon on theTn 70transposon TetR blocks transcription of these genes by binding to the tet operator sequences tetO in the absence ofTc TetR and tetO provide the basis of regulation and induction for use in mammalian experimental systems The first critical component of theTet Systems is the regulatory protein based onTeiR In the Tet Off System this 37 kDa protein is a fusion of amino acids 1 207 of TetR and the C terminal 127 a a of the Herpes simplex virus VP16 activation domain AD Triezenberg et al 1988 Addition of the VP16 domain converts the TetR from a transcriptional repressor toa transcriptional activator and the resulting hybrid protein is known as the tetracycline controlled transactivator tTA tTA is encoded by the pTet Off regulator plasmid which also includes a neomycin resistance gene to permit selection of stably transfected cells The Tet On system is similar to the Tet Off system but the regulatory protein is based on a reverse Tet repressor rTetR which was created by four amino acid changes inTetR Hillen amp Berens 1994 Gossen et al 1995 The resulting protein rtTA reverse tTA is encoded by the pTet On regulator
52. oratories Inc Version No 100912 Tet Systems User Manual Appendix A Vector Information Table Tet Off and Tet On Vector alignment Applications Basic Vectors pTet Off tetR VP16 Regulator vector for use in Tet Off system pTet On Pew m VP16 Regulator vector for use in Tet On system pTRE2 TRE Pow gene of interest poly A Response plasmids encoding the Tet Responsive Element TRE pTRE2hyg pur mre gene of interest poly A H Hyg Pur for use in either Tet Off or Tet On pTRE Tight Amt Pa gene of interest poly Response plasmid encoding a modified Tet Responsive Element TRE noa for use in either Tet Off or Tet On Accessory Vectors m For tighter control of gene expression in J Pow 8 ert poly A pTet tTS ud Tet On Systems Paw y VP16 2 3 41 _ Minimal domain vectors used in ptTA 2 3 4 Tet Off System minimizes VP16 toxicity pTRE Tight DsRed2 me si poly AL Reporter vector containing a modified Tet Responsive Element TRE nog for use in either Tet Off or Tet On Tagged Vectors TRE Myc 4 e f interest poly Response plasmids for use in either a Dee Tet Off or Tet On System pTRE HA TRE uw HA gene
53. pTRE Luc is 35 fold higher than that obtained with HeLa cells transiently transfected with a plasmid expressing luciferase from the wild type CMV promoter e Well characterized inducer In contrast to the inducer used in other systems such as in the ecdysone system Tc and Dox are inexpensive well characterized and yield highly reproducible results e Activation of a promoter rather than repression to control expression To completely shut off transcription repression based systems require very high and difficult to attain levels of repressorto ensure 10096 occupancy ofthe regulatory sites Even if suitably high levels of repressor can be obtained the presence of high repressor levels makes it difficult to achieve rapid high level induction Yao et al 1998 For a more complete discussion of the advantages of activation versus repression see Gossen etal 1993 removal of 1 ug ml Dox addition of 1 ug ml Dox Time hr Figure 3 Luciferase expression is rapidly induced in a Tet Off cell line in response to removal of Dox The CHO K1 EGFP Luc Tet Off control cell line expresses the tTA and contains a stably integrated copy of the firefly luciferase gene under control of the TRE Luciferase activity was continuously monitored with a fluorescent imaging plate reader FLIPR Molecular Devices Corp after addition or removal of 1 ug ml Dox from the culture medium Cunningham et al 1997 Clontech Laborator
54. ponsive cell line that coexpresses two genes pBI G and pBI L can be used to indirectly monitor expression of a gene of interest for which there is no direct or convenient assay These vectors express p galactosidase or luciferase as the reporter gene located one side of the TRE Gene X can be expressed at the same time as the reporter when cloned into the MCS flanking the other side oftheTRE When screening double stable cell lines Section IX D you can monitor expression of the reporter from the vector that also simultaneously expresses the gene of interest Expression levels of the gene of interest can be inferred from reporter gene expression in response to or Dox The pBI Vector lacks reporter sequences and instead contains two separate MCSs in opposite orientation driven by two identical inducible promoters pBI allows for coexpression of two genes of interest in the same cell For instance the interaction of two proteins ortwo subunits of a complex protein can be investigated by simultaneous expression in pBl Visit www clontech com for complete vector information Please note that while these specific vectors have been discontinued we do offer other Bidirectional Tet Vectors E GeneX TRE ME EP Reporter 3 k cd Figure 15 The pBl expression cassette Two genes either two genes of interest a gene of interest and a reporter or two reporters can be expressed simultaneously from the Py promoter Reporters
55. r the concentration can be reduced typically to 100 pg ml for each drug from the levels used to select stably transfected clones You may wish to alternate between selecting and nonselecting conditions C Starting Tet Cell Cultures From Frozen Stocks Note Frozen cells should be cultured immediately upon receipt or as soon thereafter as possible Increased loss of viability may occur after shipping if culturing is delayed 1 Thaw vial of cells rapidly ina37 C water bath with constant agitation Immediately upon thawing wipe the outside of the vial with 70 EtOH Transfer the contents of the vial to a 10 cm dish or aT25 75 flask containing 1 ml of medium without antibiotics Mix gently 2 Add an additional 4 ml of medium to the flask dish and mix gently 3 Add additional medium to the culture as follows T25 flask 10 cm dish add5ml T75 flask add 10 ml Note For Jurkat and other suspension cultures suspend cells at a density of no less than 2x10 cells ml in the appropriate medium Clontech Laboratories Inc www clontech com Protocol No PT3001 1 18 Version No 100912 Tet Systems User Manual VI Cell Culture Guidelines continued 4 Mix the cell suspension thoroughly Gently rock or swirl the dish flaskto distributethe cells evenly overthe growth surface and place it in a 37 C humidified incubator 5 10 as appropriate 5 Alternative method Thecells can also berinsed prior to incubation If r
56. r additional information on these vectors G Beyond the Basics pBI VP16 and pTet tTS Vectors The Bidirectional pBl Tet Vectors are specially designed response vectors that allow coregulated expression of two genes under control of a single TRE They are ideal response vectors to use if you do not have a functional assay for your gene of interest because you can select for expression of the coregulated marker gene either p galactosidase or luciferase These vectors do not contain a selectable gene and should be cotransfected with one of the Linear Selection Markers pTK Hyg Cat No 631625 or pPUR Cat No 631626 The pTRE Tight response plasmid Cat No 631059 contains a modified TRE element that can minimize basal expression in certain cell lines See Appendix A for additional information on these vectors H ViralTet Expression Tet On 3G Systems come in adenoviral lentiviral and retroviral formats For more information visit the Tet On 3G Systems product pages at www clontech com Clontech Laboratories Inc www clontech com Protocol No PT3001 1 10 Version No 100912 Tet Systems User Manual ll Protocol Overview Figure 4 provides an overview for creating double stable Tet Off or Tet On cell lines which contain integrated copies of the regulatory and response vector the ultimate goal in establishing the Tet System For more detailed flow charts of each of the transfection procedures see Figure 7 Section VI
57. rst time you may want to compare the efficiencies of several transfection protocols You can transfect the host cell line with a noninducible reporter expression vector such as pCMV LacZ Cat No 631719 or pAcGFP1 N1 Cat Nos 632469 amp 632426 and assay for reporter gene activity After a method of transfection is chosen it may be necessary to optimize parameters such as cell density the amount and purity of the DNA media conditions and transfection time Once optimized these parameters should be kept constant to obtain reproducible results If cotransfection is required to create a stable cell line with your pTRE vector we recommend cotransfection with Linear Hygromycin Marker Cat No 631625 or Linear Puromycin Marker Cat No 631626 These markers are short purified linear DNA fragments comprised of the marker gene an SV40 promoter and the SV40 polyadenylation signal Because of their small size these markers are highly effective at generating stable transfectants Alternatively you can use pTK Hyg Vector Cat No 631750 or pPUR Vector Cat No 631601 Note If you are using a selection vector other than a Linear Selection Marker pTK Hyg or pPUR the promoter should not contain an enhancer element If it does cointegration of the response and selection plasmids may lead to high background expression of Gene X in the uninduced state Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 1
58. s for the Tet Off System you may prefer to use Dox for long term maintenance of antibiotic levels and switch to Tc in preparation for induction Other Tc derivatives have been used successfully as the inducer in Tet systems Gossen amp Bujard 1993 Affinity for TetR and antibiotic potency are apparently mediated by different chemical moieties some derivatives such as anhydrotetracycline have an increased affinity for TetR and decreased antibiotic activity Gossen et al 1993 F Additional Tet Response Vectors The complete Tet Off and Tet On Gene Expression Systems are provided with pTRE2hyg as the response vector In addition to the TRE regulatory element and a multiple cloning site this vector also expresses the hygromycin resistance gene permitting easy selection of stable transfectants We also offer pTRE2pur Cat No 631013 for an alternative selection scheme using puromycin Another response vector the pTRE Tight Vector Cat No 631059 is available separately pTRE Tight contains a modified TRE element TRE moa that can minimize basal expression in certain cell lines Additionally response vectors are available that express your protein with a tag to aid in detection and protein purification These vectors provide a way to screen colonies directly for protein expression by Western analysis using readily available antibodies These Vectors are available with or without a mammalian selection marker See Appendix A fo
59. se tetracycline controlled transactivator A 37 kDa fusion protein consisting of the rTetR and theVP16 activation domain AD Binds specifically to TRE and activates transcription in the presence of Dox The chemical compound tetracycline Tetracycline as in the tet operon or the Tet repressor The compound tetracycline is abbreviated Tc Protocol No PT3001 1 Version No 100912 www clontech com Tet Systems User Manual Appendix B Glossary continued Tet Off Cell Lines Tet On Cell Lines tetO TetR TRE TRE tTA tTS VP16 AD Notice to Purchaser Any cell line that stably expressestTA from integrated copies of pTet Off Tet Off cell lines can either be made by the researcher or purchased from Clontech celllinethatstably expresses rtTA from integrated copies of pTet On Tet On cell lines can either be made by the researcher or purchased from Clontech The tet operator a 19 bp cis acting regulatory DNA sequence from the bacterial tetoperon where it is the natural binding site forTetR See TRE The Tet repressor component of tTA and rtTA In E coli TetR binds specifically to tetO and blocks transcription of the tet operon in the absence ofTc Tet Response Element A regulatory sequence consisting of seven direct repeats of a 42 bp sequence that contains the tetO Modified Tet Response Element A regulatory sequence consisting of seven direct repeats of a 36 bp sequence that
60. sterile cryovials 6 Freeze slowly 1 C per min Nalgene makes cryo containers Nalgene Cat No 5100 for this purpose if a specialized freezer is not available freeze at 80 C overnight Alternatively place vials in a thick walled styrofoam container at 209 for 1 2 hr Transfer to 80 C overnight Remove vials from styrofoam container or cryo containers the following day and place in liquid nitrogen storage or ultra low temperature freezer 150 C 7 Two or more weeks later Plate a vial of frozen cells as described in Section C to confirm viability Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 19 Tet Systems User Manual VII Pilot Experiments A Pilot Experiment with the CHO AA8 Luc Tet Off or U2 OS Luc Tet On Control Cell Line Before you perform any other experiments we strongly recommend that you perform a dose response curve with the CHO AA8 LucTet Off Control Cell Line provided with Tet Off kits or the U2 OS Luc Tet On Cell Line provided with the Tet On kits These premade double stable Tet Cell Lines can exhibit over 10 fold induction of luciferase upon removal Tet Off or addition Tet On of Tc or Dox from the culture medium Figure 5 In addition to providing a hands on introduction to theTet Systems this experiment serves two critical functions Determination of effective concentrations of Tc Dox stocks The concentrations of Tc and Dox listed
61. throughout this protocol are approximate The optimal concentration may vary with different cell lines and with different lots of antibiotic In general full repression of gene expression inTet Off cell lines can be obtained with 1 2 ml Tc or 10 ng 1 ug ml Dox Full activation of gene expression in Tet On cell lines can be obtained with 100 ng 1 ug ml Dox Testing of serum for Tc contamination As shown in Figure 5 different lots of FBS exhibit significant variation in their effect on Tet System expression presumably due to the widespread use of tetracyclines in the diet of cattle The 10 000 fold induction of luciferase in CHO AA8 Luc Tet Off Control Cells in response toTc or Dox is highly reproducible If you see a significantly lower level of induction e g 100 1 000 fold or less this may suggest that your serum containsTc This test should be repeated with each different lot of serum Alternatively useTet System Approved FBS Cat No 631101 or Cat No 631106 which has been functionally tested and shown to allow the full range of induction possible with the Tet System cell lines 15x10 10 x 10 4 Fold induction 5x 10 4 Tet System Other commercially Approved FBS available FBS Figure 5 Fold induction of luciferase activity in different lots of FBS The CHO AA8 LucTet Off Control Cell Line was grown in media prepared with different lots of FBS Average uninduced expression level 0 21 RLU n 21 S D 0 07
62. tial if Protein X is toxic to the cell 5 Replace medium with fresh complete medium containing the selection antibiotic hyg or pur every four days Fresh Dox MUST be added every two days for Tet Off cells After about five days cells should start to die Split cells if they reach confluency before massive cell death begins After 2 4 weeks hyg resistant or pur resistant colonies will begin to appear 6 Isolate large healthy colonies and transfer them to individual plates or wells Isolate as many clones as possible 7 Proceed to Section IX D C StablyTransfect and Select Double Stable Cell Lines Cotransfection pTRE2hyg Gene X and pTRE2pur Gene X response plasmids contain a selection marker in the backbone Other pTRE response plasmids which do not contain a marker must be cotransfected with a selection vector such as a Linear Selection Marker pTK Hyg or pPUR using the following protocol Note If you are using a selection vector other than a Linear Selection Marker pTK Hyg or pPUR the promoter should not contain an enhancer element If it does cointegration of the response and selection plasmids may lead to high background expression of Gene X in the uninduced state 1 Grow cells to 80 confluency in complete medium or to a density appropriate for your transfection method 2 Transfect pTRE Gene X and a Linear Selection Marker pTK Hyg or pPUR in a ratio of between 10 1 and 20 1 by the desired method You may
63. ual VI Cell Culture Guidelines A General Information The protocols in this User Manual provide only general guidelines for mammailian cell culture techniques Perform all steps involving cell culture using sterile technique in a suitable hood For those requiring more information on mammalian cell culture we recommend the following general references Culture of Animal Cells Fourth Edition ed by R Freshney 2000 Wiley Liss NY Current Protocols in Molecular Biology ed by M Ausubel et al 1995 Wiley amp Sons B Characteristics of Tet Off and Tet On Cell Lines See the Certificate of Analysis for information on eachTet Off andTet On Cell Line Additional information for all the currently available Tet Off and Tet On Cell Lines including propagation information is provided in theTet Cell Lines Protocol At A Glance PT3001 2 which is available from our website at www clontech com manuals General cell culture conditions Premade Tet Off and Tet On Cell Lines should be grown at 37 C in a humidified chamber with 5 10 See the PAC for details particular to each cell line Relative growth rates The incubation times in this User Manual are for cells such as CHO or HeLa with relatively rapid doubling times Other cell types will differ in their growth rates Selection in G418 and hygromycin Maintain stable and double stable Tet Off and Tet On Cell Lines in the appropriate selective medium howeve
64. want to optimize ratios Note If desired the plasmids can be linearized by digestion with a restriction enzyme check the Vector Information Packets provided with each vector for appropriate restriction sites 3 Plate transfected cells in ten 10 cm culture dishes each containing 10 ml of the appropriate complete medium at the optimal density determined in Section VII 4 Allow cells to divide twice 24 48 hr time may vary with cell line then add hygromycin or puromycin to 200 400 ug ml the optimal concentration determined in Section VII ForTet Off cells only When establishing a double stableTet Off cell line you may wish to culture the cells in the presence of 2 ug ml Protocol No PT3001 1 www clontech com Clontech Laboratories Inc Version No 100912 Tet Systems User Manual IX Development of Double Stable Cell Lines continued Tc or 1 ug ml Dox in order to keep transcription of Gene X turned off This is essential if Protein X is toxic to the cell 5 Replace medium with fresh complete medium containing hygromycin or puromycin every four days Fresh Dox MUST be added every two days for Tet Off cells After about five days cells should start to die Split cells if they reach confluency before massive cell death begins After 2 4 weeks hyg or puro resistant colonies will begin to appear 6 Using cloning cylinders or discs isolate large healthy colonies and transfer them to individual plates or
65. wells Isolate as many clones as possible D Screening Double Stable Cell Lines 1 Test isolated resistant clones for Dox regulated gene expression by dividing a suitable number of cells in half and testing for Gene X expression or pBl reporter expression in the presence and absence of 1 ug ml Dox As with the development ofTet Off orTet On cell lines you should generally choose the cell line that gives you the highest overall induction and lowest background i e uninduced expression level of Gene X 2 Allow the cells to grow for at least 48 hr then assay each sample for GeneX expression using oneofthe methods described in SectionA 3 Optional Confirm the presence of integrated pTRE Gene X by performing PCR on chromosomal DNA using primers that will amplify an internal portion of the plasmid 4 Once you have developed a suitable double stableTet Off orTet On cell line prepare frozen aliquots to ensure a renewable source of the cells Section VI D E Working with Double Stable Tet Cell Lines The Tet System has been established successfully in many cell types as well as transgenic mice rats plants and yeast In general failure to obtain a cell line with a low background level of Gene X expression is a result of the integration site in the tested lines and can be overcome simply by screening more clones Perform a dose response curve similarto the experiments described in Section VII A The kinetics of induction ar

Tet-Off and Tet-On Gene Expression Systems User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents