Pathway Profiling System User Manual
Contents
1. Sph I 4 3 amp 0 7 kb pE2F Luc 5 0 Bgl ll 5 0 kb Hind Ill Sph 4 3 amp 0 7 kb pE2F TA Luc 4 9 Nhe amp Xbal 3 0 amp 1 9 kb pERE TA SEAP 4 7 Bgl ll 4 7 kb Notl amp Nhel 4 5 amp 0 2 kb pGAS TA Luc 4 9 Bglll amp Xba 3 0 amp 1 9 kb pGRE SEAP 4 9 Bglll amp Xba 3 3 amp 1 6 kb pGRE Luc 5 0 Hind lll amp Sph I 4 3 amp 0 7 kb pHSE SEAP 4 9 Hind lll Sac ll Xba I 3 1 0 9 0 6 amp 0 3 kb pHSE Luc 5 0 Hind Ml amp Sph I 4 3 amp 0 7 kb plSRE Luc b 0 Bgl ll 5 0 kb Hind Ill Sph 4 3 amp 0 7 kb plSRE TA Luc 4 9 Bglll amp Xba 3 0 amp 1 9 kb pMYC SEAP 4 8 Hind Ml Sac ll Xba I 3 1 0 9 0 6 amp 0 2 kb pMYC TA Luc 4 8 Nhe amp Xbal 3 0 amp 1 8 kb pNFxB SEAP 4 9 Hind lll amp Xba I 3 3 amp 1 6 kb pNFxB TA Luc 4 9 Bgl ll 4 9 kb Nhe I Hind lll 4 8 amp 0 1 kb pNFxB Luc 5 0 Hind ll amp Xba I 3 3 amp 1 7 kb pNFAT SEAP 4 9 Hind Ill Sac ll Xba 3 3 1 0 amp 0 6 kb pNFAT TA Luc 4 9 Bgl ll 4 9 kb Nhe I Hind lll 4 7 amp 0 2 kb pp53 TA Luc 4 9 Kpn amp Xba 3 0 amp 1 9 kb Clontech Laboratories Inc 16 www clontech com Protocol No PT3286 1 Version No 032712 Pathway Profiling System User Manual Appendix Pathway Profiling System Vectors continued TABLE Ill PATHWAY PROFILING VECTOR INFORMATION CONTINUED Vectors Size Restriction Fragment kb sites size s pRARE TA SEAP 4 7 Bgl II 4 7 kb Not amp Mlu I 4 5 amp 0 2 kb pRb TA Luc 4 9 Xho amp Xbal 3 0 amp2. 1 8 kb pSRE SEAP 4 9 Hind lll 4 9 kb pSRE Luc 5 0 Hind Wl amp Sph I 4 3 amp 0 7 kb pSTAT3 TA Luc 4 9 Bgl Il amp Xba 3 0 amp 1 9 kb pTRE TA SEAP 4 7 Bgl ll 4 7 kb Kpn amp Notl 4 5 amp 0 2 kb The identity of each Pathway Profiling vector and enhancer element was confirmed by sequencing Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 17 Pathway Profiling System User Manual Appendix Pathway Profiling System Vectors continued s cis acting Enhancer Element Each vector has one of the following enhancer elements AP1 SEAP Luc AP PMA CRE E2F ERE GAS GRE HSE ISRE MYC e box NFAT NFkB TB Transcription Blocker RARE Rb Pathway Profiling Vector SRE STAT3 TRE Figure 3 Generalized map of the Pathway Profiling Vectors Pathway Profiling vectors contain one of two promoters the entire TATA like promoter Pra region from the thymidine kinase basal promoter of the herpes simplex virus HSV TK or just its TATA box Pra The promoter is located upstream of the SEAP or luciferase coding sequence The SEAP or luciferase cod ing sequence is followed by the SV40 late polyadenylation signal to ensure proper efficient processing of the SEAP or luciferase transcript in eukaryotic cells A synthetic transcription blocker TB is located upstream of the response element for reducing background transcrip tion Eggermont J amp Proudfoot N 1993 Table lll shows a l
3. components in 1 8 L of deionized H O Adjust to pH 7 4 with 0 1 N NaOH Add deionized H O to final volume of 2 L Store at room temperature e 1XTrypsin EDTA Life Technologies 25300 054 e 0 5 ml microcentrifuge tubes or 96 well flat bottom microtiter plate Chemiluminescence assays are generally performed in 0 5 ml micro centrifuge tubes Alternatively reactions can be performed in a white opaque 96 well flat bottom microtiter plate such as those from Xeno pore or Costar e Luminometer tube or plate or x ray film Chemiluminescence detection of SEAP or luciferase activity can be performed either with a luminometer tube or plate or via exposure of x ray film to reactions performed in a white opague 96 well flat bottom microtiter plate such as those from Xenopore or Costar e Kits for plasmid DNA isolation For rapid high yield isolation of transfection grade plasmid DNA we recommend using NucleoBond Xtra Kits NucleoBond Xtra Midi Plus Kits Cat Nos 740412 10 amp 740412 50 NucleoBond Xtra Maxi Plus Kits Cat Nos 740416 10 amp 740416 50 Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 Pathway Profiling System User Manual VI General Considerations PLEASE READTHROUGH ENTIRE PROTOCOL BEFORE BEGINNING A Use of Controls Always perform control experiments with the appropriate vectors to determine the basal level of SEAP or luciferase activity and to ensure that the assay is opt
4. phosphate transfections Figure 1 illustrates the general scheme for performing the pathway profiling procedure Assay materials to detect SEAP or luciferase are not included see Additional Materials Required Section V for ordering information TABLE SIGNALING PATHWAYS REPRESENTED IN THE PATHWAY PROFILING SYSTEMS cis acting Transcription Signal transduction Enhancer Element Abbrv factor s pathway s Activator protein 1 AP1 c jun c fos JNK cAMP response element CRE ATF2 CREB JNK p38 amp PKA E box DNA binding element E box Myc Max cell proliferation E2F DNA binding element E2F E2F DP1 cell cycle progression Estrogen response element ERE estrogen receptor estrogen receptor Glucocorticoid response element GRE GR glucocorticoid HSP90 Heat shock response element HSE HSF heat shock response IFN y activation sequence GAS STAT1 STAT1 proliferation inflammation Interferon stimulated ISRE STAT1 STAT2 proliferation inflammation response element Nuclear factor of activated T cells NFAT NFAT PKC amp Ca calcineurin Nuclear factor of B cells NFkB NFkB NF B p53 response element p53 p53 cell growth apoptosis Retinoic acid response element RARE RAR retinoic acid receptor Rb response element Rb Rb cell cycle progression STAT3 response element STAT3 STAT3 STAT3 proliferation inflammation Serum response element SRE Elk 1 SRF MAPK JNK Thyroid response element TRE Thyroid receptor thyroid hormone receptor Clontech Laboratories Inc www clo
5. points The parameters of the time course must be determined empirically for each experiment Alternatively to study the effects of a gene of interest cotransfect each profiling vector with an expression vector containing your gene Typi cally in each well of a 6 well plate use 1 ug of profiling vector with your expression vector For optimal induction of the reporter by your gene of interest we recommend setting up transfections with different amounts of expression plasmid containing your gene These amounts must be determined empirically for each experiment To study the effects of a drug candidate s and your gene of interest add your stimulus to the transfected cells as described above and assay for reporter activity e Be sure to include controls as described in Section VI A Clontech Laboratories Inc www clontech com Protocol No PT3286 1 12 Version No 032712 Pathway Profiling System User Manual VII Pathway Profiling System Procedure continued The following protocol is designed for use with adherent cultures growing in 35 mm tissue culture plates using a standard calcium phosphate transfection protocol If you are using plates wells or flasks of a different size adjust the components in proportion to the surface area of your container Section VLC contains helpful information for optimizing transfection procedures and convenient information for culture plate conversions All steps of the following protocol shoul
6. 2 Control Vector 21 List of Tables Table I Signaling Pathways Represented in the Pathway Profiling Systems 5 Table Il Culture Plate Conversion 11 Table Ill Pathway Profiling Vector Information 16 Version No 032712 Pathway Profiling System User Manual I Introduction The Pathway Profiling Systems allow you to quickly profile the effects of a given stimulus drug candidate or gene of interest on key signal trans duction pathways in vivo The Pathway Profiling Systems cover a variety of signal transduction pathways in eukaryotic cells Pathway Profiling Sys tems are available for broad spectrum or targeted profiling of key signaling pathways e SEAP System broad coverage e Luciferase System 4 cell cycle Each kit is composed of several different reporter vectors that contain a specific cis acting DNA seguence enhancer element and a sensitive re porter gene Thus you can monitor the binding of transcription factors to enhancer elements and screen for the induction of key signaling pathways Table I shows the signaling pathways represented in the Pathway Profil ing Systems For a list of vector sets provided in each system see List of Components Section IV Pathway profiling allows you to obtain preliminary evidence regarding the role of your gene or drug candidate in the activation of key signaling pathways Along with a Profiling System vector set each system includes all the reagents for performing standard calcium
7. 86 1 Version No 032712
8. E S Z Si Ben o UU Pathway Profiling System User Manual ks Clontech United States Canada 800 662 2566 Asia Pacific 41 650 919 7300 Cat Nos Many EE PT3286 1 Japan 032712 81 0 77 543 6116 Clontech Laboratories Inc ATakara Bio Company 1290 Terra Bella Ave Mountain View CA 94043 Technical Support US E mail tech clontech com www clontech com Pathway Profiling System User Manual Table of Contents l ll IL IV V VI VII VIII IX X Introduction Pathway Profiling Vectors Products for Signal Transduction Research List of Components Additional Materials Required General Considerations A Use of Controls B Transfection Considerations C Optimization ofTransfection Pathway Profiling System Procedure Troubleshooting Guide References Related Products Appendix Pathway Profiling System Vectors Clontech Laboratories Inc www clontech com Protocol No PT3286 1 Version No 032712 Pathway Profiling System User Manual List of Figures Figure 1 General scheme for the Pathway Profiling procedure 5 Figure 2 An overview of the cis acting enhancer element vector con structs in the Pathway Profiling Systems Figure 3 Generalized map of the Pathway Profiling Vectors 18 Figure 4 Map and multiple cloning sites of pTAL SEAP Luc Vector 19 Figure 5 Map and multiple cloning sites of pTA SEAP Luc Vector 20 Figure 6 Map and multiple cloning sites of pSEAP
9. E CONVERSION Size of Plate Growth Area Relative Area Recommended cm Volume 96 well 0 32 0 04 X 200 ul 24 well 1 88 0 25 X 500 ul 12 well 3 83 0 50 X 1 0 ml 6 well 9 4 1 20 X 2 0 ml 35mm 8 0 1 00 X 2 0 ml 60 mm 21 2 60 X 5 0 ml 10 cm 55 700 X 10 0 ml Flasks 25 3 00 X 5 0 ml 75 9 00 X 12 0 ml Relative area is expressed as a factor of the growth area of a 35 mm culture plate Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 11 Pathway Profiling System User Manual VII Pathway Profiling System Procedure Before you Start IMPORTANT After transfection it is important to remove serum from the medium to ensure proper induction of the reporter Serum induces various signaling pathways causing high background Although you may use any protocol designed fortransfecting mammalian cultures the Pathway Profiling system contains the necessary reagents to perform a standard calcium phosphate transfection procedure Design a method for studying a drug candidate or gene of interest For example 16 24 hrs after transfection add a stimulus to the cul ture medium containing 0 0 5 serum To determine the maximum response given by your stimulus perform a time course study by col lecting samples at various time points For the SEAP Systems you can collect samples from a single cell culture for luciferase systems you must set up multiple cell cultures to collect at different time
10. Once you have identified the pathway affected by your stimulus use one of the TransFactor Kits to study the transcription factor stimulation in depth visit our website at www clontech com for ordering information cis acting Enhancer Element Reporter Gene SEAP or luciferase Pathway Profiling Transfect cell line with the Ee appropriate vector in side by side cell cultures Incubate 24 hrs Add stimulus Assay amp Detect Reporter Activity Figure 1 General scheme for the Pathway Profiling procedure Each system is composed of several different vector constructs for screening key signal transduction pathways Along with each vector set sufficient reagents are included for performing 50 calcium phosphate transfections Reagents to detect reporter gene activity are not included Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 5 Pathway Profiling System User Manual ll Pathway Profiling Vectors Ineach Pathway Profiling vector the specific cis acting DNA binding sequence is located upstream from one of two promoters the TATA like promoter Pra region from the herpes simplex virus thymidine kinase HSV TK promoter or just its TATA box Pra These promoters provide optimal induction of the reporter while providing very low background Figure 2 shows some ex amples of stimuli that target Pathway Profiling enhancer elements thereby activating signaling transducti
11. R 1996 Use of secreted alkaline phosphatase as a reporter of gene expression in mammalian cells Methods in Molecular Biology vol 63 Humana Press Totowa NJ Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 15 Pathway Profiling System User Manual Appendix Pathway Profiling System Vectors The complete sequence information for the Pathway Profiling System Vectors can be downloaded from our web site at vectors clontech com Table lll shows the vector size diagnostic restriction sites and fragment sizes for all these vectors TABLE III PATHWAY PROFILING VECTOR INFORMATION Vectors Size Restriction Fragment kb sites size s Negative Controls pTAL SEAP 4 8 Xhol 4 8 kb pTAL Luc 5 0 Hind Ml Sph Xba I 3 3 1 0 amp 0 7 kb pTA SEAP 4 7 Bgl ll 4 7 kb Bglll amp Notl 4 5 amp 0 2 kb pTA Luc 4 9 Bgl ll 4 9 kb Nhe I Hind lll 4 8 amp 0 1 kb Positive Control pSEAP2 Control 5 1 Hind lll Xba 3 6 amp 1 5 kb Ase amp BamH 2 0 1 8 amp 1 3 kb Profiling Vectors pAP1 SEAP 4 9 Nhe Hind lll Xba 3 1 1 6 amp 0 2 kb pAP1 Luc 5 0 Hind IIl amp Sph I 4 3 amp 0 7 kb pAP1 PMA TA Luc 4 9 Bgl ll 4 9 kb Xba 3 2 amp 1 7 kb pCRE SEAP 4 9 Hind Ml Sac ll Xba 3 1 0 9 0 6 amp 0 3 kb pCRE Luc 5 0 Hind IIl amp
12. a Ready To Glow Secreted Luciferase pMetLuc Vector Kit which also includes a control vector The systems use secreted Metridia luciferase as a reporter molecule to monitor the activity of promoters and enhancers without the need for cell lysis by sampling media su pernatant Each Ready To Glow system includes a pMetLuc2 Reporter Vector which contains either a specific promoter such as NFKB or CRE or a multiple cloning site where you can clone in the promoter seguence you are interested in upstream of the seguence optimized Metridia secreted luciferase reporter gene Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 7 Pathway Profiling System User Manual IV List of Components All vectors and HEPES Buffered Saline HBS should be stored at 20 C All other components should be stored at 4 C after thawing The Pathway Profiling Systems contain sufficient reagents for approximately 50 calcium phosphate transfections in 35 mm tissue culture plates For broad coverage spectrum profiling Pathway Profiling SEAP System Cat No 631910 e 20 ug pTALSEAP Vector 500 ng ul negative control e 20 ug pSEAP2 Control Vector 500 ng ul positive control e 20 ug pAP1 SEAP Vector 500 ng ul e 20 ug pCRE SEAP Vector 500 ng ul e 20 ug pGRE SEAP Vector 500 ng ul e 20 ug pHSE SEAP Vector 500 ng ul e 20 ug pNFAT SEAP Vector 500 ng ul e 20 ug pNFKB SEAP Vector 500 ng ul e 20 ug pMyc SEAP V
13. ctors continued MCS SEAP luciferase pTA SEAP Luc Amp 4 9 kb TB Transcription blocker 1 10 20 30 40 GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCT Kpn Mlul Mel Xhol Seil Figure 5 Map and multiple cloning sites of pTA SEAP Luc Vector pTA SEAP Luc Vector can be used to determine the background signals associated with the culture medium Additionally these vectors can be used for studying putative enhancer elements which can be cloned into the MCS pTA SEAP Luc contains just a TATA box Pl that ensures optimal induction of the reporter while providing very low background The SEAP and luciferase coding sequences are followed by the SV40 late polyadenylation signal to ensure proper efficient processing of the transcript in eukaryotic cells A synthetic transcription blocker TB is located upstream of the MCS for reducing background transcription Eggermont J amp Proudfoot N 1993 Clontech Laboratories Inc www clontech com Protocol No PT3286 1 Version No 032712 Pathway Profiling System User Manual Appendix Pathway Profiling System Vectors continued MCSA 1 41 MCS B 245 264 BamH 481 TB SV40 ori SVa0 SEAP pSEAP2 Control Amp 5 1 kb Ase 3623 SV40 SV40 poly A pUC enhancer ori Xbal 1794 TB Transcription blocker BamH 2302 MCSA 10 20 30 40 GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCT Asp718 Miul Nhel geg Xhol Bgl il K
14. cytosolic and nuclear extracts the TransFactor Kits use an enzyme linked immunosorbent assay ELISA based format This method is easier safer and more sensitive than traditional EMSA Kits come in two formats the pathway targeted format allows you to investigate one transcription factor response in depth and the Pathway Profiling format allows you to investigate the factor s induced in repose to an inflammation reaction Kinase ExpressionVector Set This vector set consists of three vectors each constitutively expressing one of the following kinases MEK1 MEKK1 and PKA These protein kinases are ideal positive controls for the In Vivo Kinase Assay Kits or for any experiment that requires expression of these kinases Dominant Negative Vector Sets For studying a variety of path ways we offer the Dominant Negative Vector Sets which con stitutively express high levels of a wild type signal transduction molecule or its dominant negative mutant These vectors allow you to link your target gene to a particular pathway or biological process Currently vector sets are available for IkBo CREB p53 Raf and Ras For additional experimental options Raf and Ras sets also include vectors that express constitutively active variants Ready To Glow Secreted Luciferase Reporter Systems Our Ready To Glow Secreted Luciferase Reporter Systems each consist of two separate kits the Ready To Glow Secreted Luciferase Reporter Assay and
15. d be performed in a sterile tissue culture hood 1 Plate the cells the day before the transfection experiment The cells should be 50 80 confluent the day of transfection Generally we plate 4 x 10 cells 35 mm plate 0 5 3 hrs prior to transfection replace culture medium on plates to be transfected with 2 ml of fresh culture medium per 35 mm plate Foreachtransfection prepare SolutionA and Solution B in separate sterile tubes To reduce variability when transfecting multiple plates with the same plasmid DNA prepare a master mix with enough of Solu tions A and B for each transfection Solution A add components in the following order 1Mg Plasmid DNA Sterile H O 12 4 ul 2 M Calcium Solution 100 ul Total volume Solution B 100 pl 2X HBS Carefully and slowly vortex Solution B while adding Solution A dropwise Alternatively blow bubbles into Solution B with a 1 ml sterile pipette and an autopipettor while adding Solution A drop wise Incubate the transfection solution at room temperature for 20 mins Gently vortex the transfection solution and then add the solution dropwise to culture plate medium Add 200 ul of transfection solu tion per 35 mm plate 7 Gently move plates back and forth to distribute transfection solution evenly Do not rotate plates as this will concentrate transfection precipitate in the center of the well or plate 8 Incubate plates at 37 C for 2 12 hrs in a CO incubato
16. ector 500 ng ul e 20 ug pSRE SEAP Vector 500 ng ul 1 ml 2M Calcium Solution e 7 ml 2X HEPES Buffered Saline HBS 7 ml Sterile H O To profile cell cycle signaling pathways Pathway Profiling Luciferase System 4 Cat No 631914 20 ug pTA Luc Vector 500 ng ul negative control e 20 ug pE2F TA Luc Vector 500 ng ul e 20 ug pMyc TA Luc Vector 500 ng ul e 20 ug pp53 TA Luc Vector 500 ng ul e 20 ug pRb TA Luc Vector 500 ng ul 1 ml 2M Calcium Solution 7 ml 2X HEPES Buffered Saline HBS 7 ml Sterile H O Clontech Laboratories Inc www clontech com Protocol No PT3286 1 Version No 032712 Pathway Profiling System User Manual V Additional Materials Required e SEAP reporter gene assay We recommend our Great EscAPe SEAP Detection Systems Cat Nos 631704 631736 631737 and 631738 Secreted luciferase reporter assay We recommend our Ready To Glow Secreted Luciferase Reporter Assay Kits Cat Nos 631726 631727 and 631728 or our Ready To Glow Automation Kits Cat Nos 631739 and 631740 Cell culture plates or flasks e Tubes 12 x 75 mm sterile tubes e Cell culture medium appropriate growth medium for mammalian cells in culture e Fetal bovine serum newborn calf serum or equivalent to supplement the growth medium e Phosphate buffered saline PBS pH 7 4 Final conc To prepare 2 L of solution Na HPO 58 mM 16 5 g NaH PO 17 mM 41g NaCl 68 mM 8 0 g Dissolve the above
17. ein Rb TA Luciferase serum SRE TAL SEAP or luciferase thyroid hormone TRE TA SEAP Figure 2 An overview of the cis acting enhancer element vector constructs in the Pathway Profiling Systems An example of a stimulus that will activate the binding of transcription factors to its response element is shown to the left of the figure The Pra and Pra promoters provide optimal induction of the reporter while providing very low background In the case of Rb binding of the protein to the response element represses expression of the reporter gene Clontech Laboratories Inc www clontech com Protocol No PT3286 1 6 Version No 032712 Pathway Profiling System User Manual lll Products for Signal Transduction Research Clontech offers a full line of products to facilitate your signal transduction research In addition to the Pathway Profiling Systems several cis acting Pathway Profiling Vectors are available separately some are available with secreted Metridia luciferase as the reporter the pCRE MetLuc2 Reporter Vector included in the Ready To Glow CRE Secreted Luciferase Reporter System Cat No 631743 or the pNFKB MetLuc2 Reporter Vector included in the Ready To Glow NF B Secreted Luciferase Reporter System Cat No 631745 The following is an overview of our current product line For the latest product information visit our web site at www clontech com e TransFactor Kits For rapid detection of transcription factor activities in
18. ents the host cell line can be transfected with a reporter expression vector such as pSEAP2 Control Vector The success of the transfection can then be estimated by assaying for secreted alkaline phosphatase Once the transfection parameters have been optimized they should be kept consistent from one experiment to the next to obtain reproducible results The following is a general guideline for optimizing the transfection parameters It is best to perform a series of small scale transfections This can be done conveniently in 12 well or 6 well plates To optimize cell density keeping all other parameters constant plate host cells in individual wells of a 6 well plate at varying densities e g 5 x 104 1 x 10 2 x 10 4 x 10 and 8 x 10 24 72 hrs post transfection assay for reporter gene activity Record results Repeat the experiment once or twice to account for day to day variation Choose the density with the highest reporter gene activity Other parameters can be optimized in much the same way Hold all other variables constant while varying the parameter you are testing Transfection incubations should be maximal at 2 16 hrs using a cal cium phosphate transfection protocol You may want to try incubation times from 1 18 hrs for optimization After transfections have been optimized scaleup or scaledown as necessary for the size of culture plate you are using see Table II for culture plate conversions TABLE Il CULTURE PLAT
19. ering Technical Support Telephone 800 662 2566 toll free Telephone 800 662 2566 toll free Fax 800 424 1350 toll free Fax 650 424 1064 Web www clontech com Web www clontech com E mail orders clontech com E mail tech clontech com Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without prior written approval of Clontech Laboratories Inc Your use of this productis also subject to compliance with any applicable licensing requirements described on the product s web page at http Awww clontech com It is your responsibility to review understand and adhere to any restrictions imposed by such statements Clontech the Clontech logo CalPhos CLONfectin Great EscAPe Living Colors and Ready To Glow are trademarks of Clontech Laboratories Inc All other marks are the property of their respective owners Certain trademarks may not be registered in all jurisdictions Clontech is aTakara Bio Company 2012 Clontech Laboratories Inc This document has been reviewed and approved by the Clontech Quality Assurance Department Clontech Laboratories Inc www clontech com Protocol No PT32
20. imized The Pathway Profiling vectors may be transfected into mammalian cells by a variety of techniques However a method that works well for one type of cultured cell may be inferior for another When working with acell line for the first time compare the transfection efficiencies of several transfection protocols using a con trol vector expressing a reporter gene e g DSEAP2 Control pCMV B pAcGFP1 C1 or N1 or pMetLuc2 Control Vector We recommend the following experimental procedures when using this system 1 Negative controls Performing a negative controlis necessary to determine background signals associated with the culture medium and reporter activity This can be determined by transfecting cells with the appropriate control pTAL SEAP Luc or pTA SEAP Luc The values obtained from such controls should be subtracted from experimental results 2 Positive control for transfection SEAP system Cat No 631910 only Performing a positive control is useful to confirm transfection and to verify the presence of active SEAP in the culture medium Expression and secretion of functional SEAP in transfected cells can be confirmed by assaying 25 ul of culture medium from cells transfected with pSEAP2 Control Cells transfected with this plas mid should exhibit high SEAP activity within 24 72 hours after transfection B Transfection Considerations 1 Perform all transfections in triplicate Each construct should be transfected and s
21. ion efficiencies We rec ommend performing transfections in triplicate to minimize the variability e Variable cell density Solution Keep cell density constant after optimizing transfection procedures Generally we use cultures that are 50 80 confluent at the time of transfection e Suboptimal cell growth Solution Keep cells healthy in culture Cells should be in mid log phase growth when plated for transfection Transfection efficien cies may decrease for cell lines that have been passaged for too many generations Clontech Laboratories Inc www clontech com Protocol No PT3286 1 14 Version No 032712 Pathway Profiling System User Manual IX References Chen C amp Okayama H 1988 Calcium phosphate mediated gene transfer A highly efficient transfection system for stably transforming cells with plasmid DNA Bio Techniques 6 632 638 Cullen B R amp Malim M H 1992 Secreted placental alkaline phosphatase as a eukaryotic reporter gene Meth Enzymol 216 362 368 Eggermont J amp Proudfoot N 1993 Poly A signals and transcriptional pause sites combine to prevent interference between RNA polymerase ll promoters EMBO J 12 2539 2548 Freshney I R 1993 Culture of Animal Cells Third Edition Wiley Liss New York NY Kain S R amp Ganguly S 1995 Overview of Genetic Reporter Systems In Current Protocols in Molecular Biology Ed Ausubel F M et al Wiley amp Sons NY Unit 9 6 Kain S
22. ist of the response elements and the consensus sequences in the Pathway Profiling System Clontech Laboratories Inc www clontech com Protocol No PT3286 1 18 Version No 032712 Pathway Profiling System User Manual Appendix Pathway Profiling System Vectors continued MCS SEAP or Luc pTAL SEAP Luc TB Transcription blocker 1 10 20 30 40 GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCT Kpn I Mlul Nhel Abol Bgll Figure 4 Map and multiple cloning sites of pTAL SEAP Luc Vectors pTAL SEAP Luc Vectors can be used to determine the background signals associated with the culture medium Ad ditionally these vectors can be used for studying putative enhancer elements which can be cloned into the MCS pTAL SEAP Luc contains the entire TATA like promoter Pra region from the basal promoter of the herpes simplex virus thymidine kinase HSV TK promoter Pra ensures optimal induction of the reporter while providing very low background The SEAP or luciferase coding sequence is followed by the SV40 late polyadenylation signal to ensure proper efficient processing of the SEAP or luciferase transcript in eukaryotic cells A synthetic transcription blocker TB is located upstream of the MCS for reducing background transcrip tion Eggermont J amp Proudfoot N 1993 Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 19 Pathway Profiling System User Manual Appendix Pathway Profiling System Ve
23. ntech com Protocol No PT3286 1 4 Version No 032712 Pathway Profiling System User Manual l Introduction continued SEAP and Luciferase ideal reporters for studying signal transduction The Pathway Profiling Systems offer two reporters SEAP and luciferase so youcanselectthe detection method thatis best suited for your experiments Se creted alkaline phosphatase SEAP and luciferase provide several advantages foruseastranscriptional reporters Both reporter proteins are detectable over a wide linear range making them well suited for comparative analysis Standard luciferase assays require lysis of transfected cells whereas SEAP activity is detected in the culture medium no cell lysis is required Because SEAP is secreted into the medium you can collect samples from the same cell culture at various time points i e time course studies without disrupting the cells Additionally the same transfected cells can be used directly for further investigation using other methods such as RNA or Western blot ting Regardless of the reporter SEAP and luciferase assays are extremely sensitive and both reporters can be detected using a luminometer liquid scintillation counter or x ray film We recommend using the Great EscAPe Chemiluminescence Detection Kit 2 0 Cat Nos 631736 631737 and 631738 with the Pathway Profiling SEAP System Alternatively the Great EscAPe SEAP Fluorescence Detection Kit Cat No 631704 can also be used
24. on pathways Additional vector information such as complete sequence and vector maps can be downloaded from our web site at www clontech com manuals For recommended diagnostic di gests and generalized illustrations of the vector maps see the Appendix Control Vectors Each kit is supplied with a negative control vector to determine unin duced background levels of reporter gene activity The negative controls pTAL SEAP pTAL Luc pTA SEAP or pTA Luc lack the enhancer element but contain a promoter and reporter gene The values obtained with the control vectors can be subtracted from your experimental values Ad ditionally you can use these vectors to study your own putative cis act ing enhancer element by cloning it into the MCS The positive control vector pSEAP2 Control provided in the original SEAP System Cat No 631910 is necessary for optimizing the SEAP assay For more informa tion regarding the use of these controls see Section VI A or the Appendix Stimulus I Activation a Y serum AP1 TAL SEAP or luciferase PMA AP1 PMA TA Luciferase forskolin CRE TAL SEAP or luciferase estrogen ERE TA SEAP growth factors E2F TAL Luciferase glucocorticoids GRE TAL SEAP or luciferase 42C heat HSE TAL SEAP or luciferase growth factors ISRE TAL Luciferase serum growth factors E box Myc TAL SEAP TNF or IL 1 NFkB TAL TA SEAP or luciferase PMA Ca NFAT TAL TA SEAP or luciferase retinoic acid RARE TA SEAP Rb prot
25. pn MCSB 250 260 270 SEAP AAGCTTCGAATCGCGAATTCGCCCACCATGCTG Hind UL BStBl Nru EcoR I Figure 6 Map and multiple cloning sites of pSEAP2 Control Vector Unique restriction sites are in bold pSEAP2 Control contains the SV40 early promoter inserted upstream ofthe SEAP gene and the SV40 enhancer inserted downstream pSEAP2 Control constitutively expresses SEAP in most cell types which makes it ideal for establishing transfection efficiency and optimizing your SEAP assay detection method A synthetic transcription blocker TB is located upstream of the MCS for reducing background transcription Eggermont J amp Proudfoot N 1993 Note on effects of SV40 large T antigen COS cells The specific level of expression for the pSEAP2 Control Vector is likely to vary in different cell types This may be particularly true for cell lines containing the SV40 largeT antigen such as COS cells The largeT antigen promotes replication of the SV40 origin sequences of which are found in the promoter region of the pSEAP2 ControlVector The combination ofthe largeT antigen and SV40 origin leads to a higher copy number of these vectors in COS cells which in turn may result in increased expression of the SEAP reporter gene relative to vectors lacking the SV40 origin Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 21 Pathway Profiling System User Manual Notes Contact Us For Assistance Customer Service Ord
26. r 9 Remove calcium phosphate containing medium and wash cells with medium or 1X PBS Protocol No PT3286 1 www clontech com Clontech Laboratories Inc Version No 032712 13 Pathway Profiling System User Manual VII Pathway Profiling System Procedure continued 10 Feed plate with 2 ml of fresh medium containing low serum 0 0 5 and incubate at 37 C until needed for assay 16 24 hrs Note After transfection it is important to remove serum from the medium to ensure proper induction of the reporter Serum can induce various signaling pathways causing high background 11 Proceed with your experiment then assay for the appropriate reporter gene VIII Troubleshooting Guide A Low Transfection Efficiency e Poor precipitate formation Solution Addition of the calcium DNA Solution A to the 2X HBS Solution B should be performed dropwise and with continuous mixing Adding Solution A too guickly or with too little mixing can result in a poor precipitate Poor guality DNA Solution The A 5 A5go ratio of the plasmid DNA should be gt 1 7 pH not optimal Solution The pH of the HBS should be between 7 05 and 7 12 However during prolonged storage the pH of the solution may change therefore use the Pathway Profiling System within the shelf life indicated on the accompanying Certificate of Analysis CofA B Variable Transfection Efficiency in Experiments There will always be some variability in transfect
27. ubsequently assayed in triplicate to minimize variability among treatment groups Trans fection efficiency is the primary source of this variability 2 Normalizing transfection efficiencies It is critical to include an internal control that will distinguish differences in transcriptional induction from variability in the ef ficiency of transfection Sambrook et al 1989 This is easily done by cotransfecting a second plasmid that constitutively expresses a reporter gene which can be clearly differentiated from SEAP and luciferase The level of expression from this gene can then be used to normalize the levels of SEAP or luciferase activity among different treatment groups Reporter proteins frequently used for this purpose include B galactosidase and AcGFP1 or SEAP for luciferase and secreted luciferase for SEAP Clontech Laboratories Inc www clontech com Protocol No PT3286 1 Version No 032712 Pathway Profiling System User Manual VI General Considerations continued C Optimization of Transfection The efficiency of a mammalian cell transfection is primarily dependent on the host cell line used Optimization of the transfection parameters for each cell type is crucial to obtaining consistently successful transfec tions Therefore for each cell type you plan to use perform preliminary experiments to determine the optimal cell density amount and purity of DNA and transfection incubation time For the preliminary experi m
Download Pdf Manuals
Related Search