User Manual - Biomol GmbH
Contents
1. PCR product Vector 50 ng ul Insert PCR product ul 2x Quick ligation reaction buffer NEB 10 ul H2O make up to 20 ul Mix and add 1 ul Quick T4 DNA ligase NEB and incubate at room temperature for 5 minutes and proceed with transformation based on the size of PCR product try to maintain the molar ratio from 3 1 to 6 1 insert vector Other DNA ligases can be substituted Technical Support 888 503 3187 US 15 301 682 9200 APEX System Transformation Transform high efficiency E coli competent cells 2 10 cfu ug DNA with 2 ul of the ligation reaction according to manufacture s protocol Plate the transformants on LB agar plates supplemented with 100 ug ml ampicillin Pick up 4 colonies for doing miniprep Confirm the correct colony by restriction enzyme digestion and sequencing 5 CMVDD sequencing primer 5 AAA CTG ACT ATA TCT CCA GA 3 3 CMVDD rev sequencing primer 5 TTC TAG TTG TGG TTT GTC CA 3 VI Troubleshooting and FAQs If you have questions please check our website www SABiosciences com for a more complete listing of Frequently Asked Questions FAQs or call our Technical Support Representatives at 1 888 503 3187 or 301 682 9200 Technical Support support SABiosciences com www SABiosciences com 16 Version 1 0 Appendix Vector Maps 1 Vector map of DYKDDDDK tagged ORF expression plasmid CMV promoter pUC ori MCS for O2. of transfection add 200 ng of DYKDDDDK expression vector or control expression vector into separate 25 ul aliquots of Opti MEM Reduced Serum Medium Mix gently and incubate mixture for 5 minutes at room temperature 3 For each well add 0 3 ul of SureFECT into 25 ul of Opti MEM separately Mix gently and incubate mixture for 5 minutes at room temperature 4 Add 25 ul of SureFECT mix to 25 ul DYKDDDDK expression vector mix Mix gently and incubate for 20 minutes at room temperature 5 Add 50 wl DYKDDDDK expression vector SureFECT complexes in medium to the appropriate well containing cells and 100 ul of normal growth medium This gives a final volume of 150 ul Mix gently by rocking the plate back and forth 6 Incubate cells at 37 C in a 5 CO2 incubator for 16 24 hours 7 After 16 24 hours of transfection change the medium to complete growth medium and carry out a desired study C Transfection protocol for DD tagged ORF adjustable expression plasmid The following protocol is designed to forward transfect adherent cell line HEK 293H using SureFECT Transfection Reagent Cat No SA 01 in a 6 well plate format The APEX expression vectors works well with transfection reagent from other vendors f you are using a transfection reagent other than SureFECT follow the manufacturer s protocol Moreover if you are using plates or wells of different size adjust the components in proportion to the surface area This is just a gener
3. the size of the PCR product by agarose gel electorphoresis and purify the reaction using a purification column such as PCR purification kit Elute the purified product in 30ul elution buffer 10mM Tris Cl pH 8 5 3 Cloning of ORF into the empty vector Technical Support support SABiosciences com www SABiosciences com 14 Digestion of purified PCR product with Sgfl and Mlul Version 1 0 Purified PCR product 28 ul 10x NEB restriction buffer 3 4 ul 100x BSA 0 4 ul Sgfl 80U ul 0 2 ul Mlul 10U ul 0 8 ul H20 make up to 40 ul Incubate at 37 C for 3 hours Then purify the digested PCR product using a DNA purification column such as PCR purification kit and elute in 30 ul elution buffer 10mM Tris Cl pH 8 5 and measure the concentration Digestion of Empty Vector with Sgfl and Mlul Vector DNA 0 5 ug ul 2 ul 10x NEB restriction buffer 3 20 Ul 100x BSA 2 ul Sgfl 80U ul 0 75 ul Mlul 10U ul 4 ul H20 make up to 200 ul Incubate at 37 C for 3 hours and then at 80 C for 20 minutes Dephosphorylation of empty vector Add 1 10 volume of 10x antarctic Phophatase Reaction Buffer and 1 ul of Antarctic phosphatase NEB and continue incubation at 37 C for 1 hour Heat inactivate for 5 minutes at 65 C following by purifying on a column and eluting in 30 ul of elution buffer 10 mM Tris Cl pH 8 5 Set up ligation reaction with purified vector and
4. with Centry Stable cell generation The lentivirus and plasmid APEX vectors have selection markers for generating stable cell lines DYKDDDDK tagged ORF expression plasmids and DD tagged ORF adjustable expression plasmids have Neomycin as a selection marker and lentiviral particles expressing DYKDDDDK tagged ORF have Puromycin as a selection marker whereas lentiviral particles expressing DD tagged ORF have turboGFP as a selection marker for generating stable cell lines Technical Support support SABiosciences com www SABiosciences com 8 Version 1 0 B Transfection protocol for DYKDDDDK tagged ORF expression plasmids The following protocol is designed to transfect the adherent cell line HEK 293H using SureFECT Transfection Reagent Cat No SA 01 in a 96 well plate format Transfection reagent from other vendors can be used with the APEX plasmids f you are using a transfection reagent other than SureFECT follow the manufacturer s protocol Moreover the use of plates or wells of different size require the user to adjust the components in proportion to the surface area of the new plate or well The protocol below is just a general guideline the optimal conditions amounts should be adjusted according to the cell type and the study requirements Read the protocol completely before starting the experiment 1 One day before transfection seed 1 1 5x10 cells in each well of 96 well plate with 100 ul of growth medium 2 On the day
5. A 1 mM Sodium Pyruvate 100 U ml Penicillin and 100 ug ml Streptomycin to each well and carry out the desired study Note a SureENTRY Transduction Reagent enhances transduction of most cells however some cells like primary neurons are sensitive to the SureENTRY Transduction Reagent Do not add SureENTRY Transduction Reagent to these types of cells If working with a cell type for the first time a SureENTRY Transduction Reagent control only well should be used to determine cell sensitivity b When transducing Cignal lentiviral particles into a cell type for the first time we suggest using either 10 or 50 MOI as a starting point to determine the optimal assay development conditions Always include Cignal Lenti positive control GFP for determining transduction efficiency Technical Support 888 503 3187 US 301 682 9200 11 APEX System E Transduction protocol for lentiviral particles expressing DD tagged ORF The following protocol is designed to transduce HEK 293 cells using lentiviral particles expressing DD tagged ORF in a 96 well plate format If you are using plates or wells of different size adjust the components in proportion to the surface area This is just a general guideline the optimal transduction conditions should be optimized according to the cell type and the study requirements Read the protocol completely before starting the experiment 1 One day before transduction seed 0 5 1x104 cells in each well of 96
6. RF FLAG SV40 polyA FLAG tagged expression vecto HSV TK poly A 4027 bp f1 ori Kan Neo r SV40 ori MCS Multiple cloning site ORF open reading frame 2 Vector map of DD tagged ORF expression plasmid CMV promoter DD MCS for ORF SV40 poly A DD tagged expression vector 4686 bp neor MCS Multiple cloning site ORF open reading frame Technical Support 888 503 3187 US 301 682 9200 17 APEX System 3 Vector map of lentiviral plasmid expressing DYKDDDDkK tagged ORF MCS for ORF CMV promoter FLAG puroR 3 LTR FLAG tagged lentiviral vector HIV RNA Pack 7545 bp 5 LTR f1 ori ampR MCS Multiple cloning site ORF open reading frame 4 Vector map of lentiviral plasmid expressing DD tagged ORF tGFP 3 LTR IRES MCS for ORF DD f1 ori oan one DD tagged lentiviral vector 8343 bp ampR HIV RNA Pack 5 LTR MCS Multiple cloning site ORF open reading frame Technical Support support SABiosciences com www SABiosciences com 18 Version 1 0 Notes Technical Support 888 503 3187 US 301 682 9200 19 APEX System User Manual Part 1050A Version 1 0 9 18 2009 fy SABiosciences Focus on Your Pathway BIOMOL GmbH Waidmannstr 35 22769 Hamburg b m info biomol de 10 Oo www biomol de Phone 49 40 8532600 or 0800 2466651 D Fax 49 40 85326022 or 0800 2466652 D 888 503 3187 301 682 9200 _ www SABiosciences com support SABios
7. add to each well Total TU needed per well reported on Certificate of Analysis SABiosciences has found that some commonly used cell lines like HT1080 HEK293 and HepG2 etc can be effectively transduced using an MOI between 10 and 25 however some cell types like primary cells are more resistant to transduction and efficient transduction of these cell types may require a higher MOI 50 Suspending Centry For DD tagged proteins 1 Dispense 100 ul of 100 Ethanol into the tube containing dried Centry Reagent 2 Close the cap on the Centry Reagent tube 3 Resuspend the Centry Reagent by tapping or flicking the tube several times Optimizing Centry concentration For DD tagged proteins Centry is the ligand responsible for stabilizing DD tagged protein The final concentration of Centry used in the experiment depends on the type of cells and DD tagged APEX vector used in the experiment The in vivo amount of DD tagged protein can be adjusted by varying the amount of Centry in a culture media SABiosciences recommends determining a suitable amount of Centry by initially testing using Centry in a range of 50 nM to 1 uM in a culture media Optimizing Centry incubation time For DD tagged proteins The specific level of DD protein accumulation in cells not only depends upon the concentration of Centry but also incubation times SABiosciences recommends performing a time course experiment in order to determine the optimal incubation time
8. al guideline the optimal conditions amounts should be adjusted according to the cell type and the study requirements Read the protocol completely before starting the experiment 1 One day before transfection seed 7 5x10 cells in each well of 6 well plate with 2 ml of growth medium Technical Support 888 503 3187 US 301 682 9200 9 APEX System 2 On the day of transfection add 250 ng 1 ug of APEX vector or control turboGFP expression vector SABiosciences Catalog No DB4 001A into separate 250 ul aliquots of Opti MEM Mix gently and incubate mixture for 5 minutes at room temperature Note Titration of DNA to achieve desired adjustable expression might be required for transient transfection Therefore stable cell line generation is recommended 3 For each well add 7 5 ul of SureFECT into 250 ul of Opti MEM separately Mix gently and incubate mixture for 5 minutes at room temperature 4 Add 250 ul of SureFECT mix to 250 ul APEX vector mix Mix gently and incubate for 20 minutes at room temperature 5 Add 500 ul APEX vector SureFECT complexes in medium to the appropriate well containing cells and 2 ml of normal growth medium This gives a final volume of 2 5 ml Mix gently by rocking the plate back and forth 6 Incubate cells at 37 C in a 5 CO2 incubator for 16 24 hours 7 After 16 24 hours of transfection split the cells into at least two parallel cultures in a complete growth medium Protein accumula
9. ce of Centry in one culture consistently having high level of protein of interest whereas culture other plate without Centry and carry out the desired study D Transduction protocol for lentiviral particles expressing DYKDDDDK tagged ORF The following protocol is designed to transduce HEK 293 cells using lentiviral particles expressing DYKDDDDk tagged ORF in a 96 well plate format If you are using plates or wells of different size adjust the components in proportion to the surface area This is just a general guideline the optimal transduction conditions should be optimized according to the cell type and the study requirements Read the protocol completely before starting the experiment 1 One day before transduction seed 0 5 1x10 cells in each well of 96 well plate 2 On the day of transduction remove medium from wells To each well add 20 ul of lentiviral particles and make up the total volume of 50 ul using growth medium without antibiotics DMEM with 10 FBS 0 1 mM NEAA 1 mM Sodium Pyruvate In this particular case add 30 ul of growth medium without antibiotics 3 Add SureENTRY Transduction Reagent to a final concentration of 8 ug ml in each well Gently swirl the plate to mix 4 Incubate for 18 20 hours at 37 C in a humidified incubator in an atmosphere of 5 CO2 5 24 hours post transduction remove the medium containing lentiviral particles from wells Add 100 ul of fresh growth medium DMEM with 10 FBS 0 1 mM NEA
10. chnology for adjusting expression levels of exogenous proteins The APEX System provides two levels of flexibility for the scientist First expression constructs are available as either constitutively expressed proteins or as Destabilization Domain DD containing proteins that have an adjustable expression The stability of the fusion protein is regulated in a dose dependent fashion by the presence of a small membrane permeable molecule Centry Finally expression constructs are available in either a ready to transfect plasmid or as ready to transduce lentiviral particles This expression system relies on a FKBP derived Destabilization Domain DD 107 residues that is engineered to be unstable and thus degrade in the absence of its ligand Genetic fusion of this Destabilization Domain to a protein of interest POI confers instability to the entire fusion resulting in degradation Binding of a ligand named Centry for the Destabilization Domain protects the fusion from degradation which allows the POI to accumulate in the cell and exert its normal biological function The ligand does not elicit any detectable off target effects when administered to cultured cells or animals including humans Therefore this system couples the specificity of a genetic fusion with responsiveness a small molecule ligand can provide Benefits e Precisely control of protein expression level with Centry Reagent e Ready to transduce lentiviral particles or ready to tran
11. ciences com
12. dded Centry will protect your DD tagged protein from proteasomal degradation resulting a rapid increase in its level in cell and carry out your desired study DD tagged protein depletion The presence of DD tag enables rapid accumulation as well as depletion of protein of interest The Centry molecule can bind to DD to stabilize the protein Likewise removal of Centry reagent can cause rapid destabilization and proteasomal degradation of protein 7 After incubating transfected cell with Centry for desired time which result in accumulation of protein of interest split the cells into at least two parallel cultures in a complete growth medium 8 Continue with the presence of Centry in one culture consistently having high level of protein of interest whereas culture other plate without Centry and carry out the desired study V Cloning Protocol Cloning Of Open Reading Frame of Your Choice into DD Tagged Expression Vector CMV promoter DD _7 MCS for ORF SV40 poly A DD tagged expression vector neo r oni Technical Support 888 503 3187 US 301 682 9200 13 APEX System MCS for ORF Agel Sgfl Ascl Rsrll EcoRI Mlul Pmel ACCGGTGCGATCGCCGGCGCGCCCGGACCGTCGAATTCACGCGTTAAGTTTAAAG T G A I A There are several rare cutting restriction enzymes in the Multiple Cloning Site MCS of DD tagged expression vector such as Sgfl Ascl Rsrll Mlul and Pmel Most of mammalian Open Reading Frame ORF lacks sites for thes
13. e rare cutting restriction enzymes We recommend scanning the ORF of your protein of interest for these restriction enzyme sites and select a pair for cloning ORF must be PCR amplified using primers appending rare cutting restriction enzyme cloning sites and then cloned into linearized vector Here is an example using Sgfl and Mlul pair for directional cloning 1 Primer design Forward primer with Sgfl 5 GAGGCGATCGCCNNNNNNNNN NN 3 Ns 20 35 bp represent the sequence of ORF of protein of interest beginning with the start codon ATG Sgfl site is underlined and an additional C base after it is designed to keep reading frame with N terminal DD tag Reverse primer with Mlul 5 GCGACGCGTNNNNNNNN2 NN 3 Ns 20 35 bp represent the reverse complement sequence of ORF of protein of interest beginning with the stop codon If Sgfl or Mlul are present in the Open Reading Frame other restriction enzymes like Ascl Rsrll and Pmel can be used Since DD is N terminal tag in the Forward primer additional base s after restriction enzyme site may be necessary to maintain reading frame Arbitrary bases 3 4 should be added at the 5 of both primers to ensure effiicient restriction enzyme cutting 2 PCR amplification of ORF To minimize the mutations during the PCR amplification a high fidelity DNA polymerase such as Pfu DNA polymerase is recommended Follow manufacture s protocols to generate PCR product Confirm
14. each cell type is important for successful lentivirus particle use Variables to consider when optimizing the transduction conditions include Multiplicity of Infection MOI concentration of SureeENTRY Transduction Reagent used time of assay development and the cell density The Cignal Lenti positive control GFP SABiosciences Cat CLS PCG can be used for determining the optimal transduction conditions Multiplicity of Infection MOI For Lentiviral Particles The transduction efficiency of APEX expression vectors varies significantly for different cell types Users should determine the Multiplicity of Infection MOI which is the number of transducing lentiviral particles per cell required for desired transduction efficiency of a new cell type The MOI is typically adjusted by increasing or decreasing the amount of virus added per well to a series of wells containing the same number of cells SABiosciences recommends testing Technical Support 888 503 3187 US 301 682 9200 7 APEX System the Cignal Lenti Positive Control CLS PCG at MOls of 5 10 and 50 each MOI in triplicate in order to establish the optimal MOI for each cell type to be studied To calculate Multiplicity of Infection MOI Number of transducing units TU deposited in a well Number of target cells present in that well Total transducing units needed per well TU Total number of cells per well x Desired MOI Total mL of lentiviral particles to
15. emark of Sigma Aldrich Co Technical Support support SABiosciences com www SABiosciences com 6 Version 1 0 lll Additional Materials Required e Mammalian cell line cultured in the appropriate growth medium e Cell culture medium and standard cell culture supplies e Tissue culture plates e SureFECT Transfection Reagent SABiosciences Catalog No SA 01 for ready to transfect expression vectors e SureENTRY Transduction Reagent SABiosciences Catalog No SA 02 for ready to transduce lentiviral expression vectors e APEX Centry DD Protein Stabilization Reagent SABiosciences Catalog No SA 03 for controlling the expression of DD tagged proteins e Opti MEM Reduced Serum Medium Invitrogen IV Protocol A Before the Experiment Optimization of transfection conditions For Plasmids Optimizing transfection conditions for each cell type is important for the success of an experiment Variables to consider when optimizing the transfection conditions include cell density cell viability amount of DNA ratio of DNA to transfection reagent transfection complex formation time and transfection incubation time see the detailed protocols for SABiosciences recommendations The constitutive expressing GFP vector SABiosciences Cat CCS PCG can be used to determine the optimal transfection conditions Optimization of transduction conditions For Lentiviral Particles Optimization of transduction conditions for
16. eriment B Protocol for DYKDDDDK tagged ORF plasmids C Protocol for DD tagged ORF adjustable expression plasmid D Protocol for lentivirus expressing DYKDDDDK tagged ORF E Protocol for lentivirus expressing DD tagged ORF V Cloning Protocol VI Troubleshooting and Frequently Asked Questions Appendix Vector Maps LIMITED PRODUCT WARRANTY This warranty limits our liability to replace this product in the event the product fails to perform due to any manufacturing defect SABiosciences Corporation makes no other warranties of any kind expressed or implied including without limitation warranties of 11 12 13 16 17 merchantability or fitness for a particular purpose SABiosciences Corporation shall not be liable for any direct indirect consequential or incidental damages arising out of the use the results of use or the inability to use this product NOTICE TO PURCHASER This product is intended for research purposes only and is not intended for drug or diagnostic purposes or for human use The purchase of and APEX product includes a limited nonexclusive license to use the kit components for research use only This license does not grant rights to use the kit components to manufacture commercial products without written approval of SABiosciences Corporation No other license expressed implied or by estoppels is granted APEX System Background and Introduction APEX System The APEX System is the most advanced te
17. f interest POI confers instability to the entire fusion Addition of a ligand for DD rescues the fusion protein from proteasomal degradation Technical Support 888 503 3187 US 301 682 9200 5 APEX System ll Materials Provided 1 DYKDDDDK tagged ORF expression plasmid Component Description Amount Concentration Volume Ready to transfect 10 ug 500 ng ul 20 ul expression vector 2 DD tagged ORF adjustable expression plasmid Component Description Amount Concentration Volume Ready to transfect 10 ug 500 ng ul 20 ul expression vector 3 Lentiviral particles expressing DYKDDDDkK tagged ORF Component Description Concentration Volume Ready to transduce gt 0 8x10 TU ml 250 ul Lentiviral particles 4 Lentiviral particles expressing DD tagged ORF Component Description Concentration Volume Ready to transduce gt 0 8x10 TU ml 250 ul Lentiviral particles Storage Conditions Ready to transfect expression vectors should be stored at 20 C and ready to transduce lentiviral expression vectors should be stored at 80 C upon receipt Description Available APEX vectors express human or mouse Nanog Oct4 Sox2 c Myc KIf4 or Lin28 under the control of cytomegalovirus CMV promoter For the map of parent vectors see Appendix The DYKDDDDK epitope tag is also referred to as the FLAG epitope tag FLAG is a registered trad
18. fy SABiosciences sau Waidmannstr 35 22769 Hamburg b m info biomol de 10 o www biomol de Phone 49 40 8532600 or 0800 2466651 D Fax 49 40 85326022 or 0800 2466652 D User Manual APEX System Adjustable Protein Expression Plasmids and Lentiviral Particles See Purchaser Notification for limited use license and warranty information page 3 Part 1050A Version 1 0 9 18 2009 SABiosciences Corporation 6951 Executive Way Frederick MD 21703 USA APEX System Adjustable Protein Expression Plasmids and Lentiviral Particles User Manual For Catalog Numbers DA A DB A DN A DO A Ordering and Technical Service Contact Information BIOMOL GmbH O Waidmannstr 35 b m 22769 Hamburg 10 o info biomol de ts biomol de www biomol de Phone 49 40 8532600 or 0800 2466651 D Fax 49 40 85326022 or 0800 2466652 D You may place orders by fax e mail or from our website Each order should include the following information Your contact information name phone email address Product name catalog number and quantity Purchase order number or credit card information MasterCard Shipping address Billing address For more information visit us at www SABiosciences com SABiosciences Corporation 6951 Executive Way Suite 100 Frederick MD 21703 USA CONTENTS l Background and Introduction Il Materials Provided Ill Additional Materials Required IV Protocol A Before the Exp
19. sfect DNA enable the use with virtually any mammalian cell e Flexibility constitutive protein expression or adjustable expression vectors available e ORFs have been sequenced and functional validated Application iPSC Generation The discovery that mouse fibroblasts can be reprogrammed and generate induced pluripotent stem cells iPSC with qualities remarkably similar to embryonic stem cells has created a valuable new source of pluripotent cells for drug discovery cell therapy and basic research SABiosciences has developed expression vectors for six iPSC related proteins Nanog Oct4 Sox2 c Myc Klf4 and Lin28 to create a resource for producing induced pluripotent stem cells Ectopic expression of these factors has been shown to create pluripotent cells which resemble embryonic stem cells The expression vectors for the six iPSC related proteins are available as either ready to transfect plasmids or ready to transduce lentiviral particles In addition all six iPSC related proteins are available as either constitutively expressed ORFs or as adjustable versions APEX system Technical Support support SABiosciences com www SABiosciences com 4 Version 1 0 How to Regulate Protein Expression Directly with the APEX System Expression of DD Protein e Destabilization Domain DD Protein of Interest Degradation of Stabilization of DD Protein DD Protein by Centry Figure 1 Fusion of a Destabilization Domain DD to a protein o
20. tion Protein depletion Use plasmid or lentivirus Use plasmid or lentivirus to express DD ORF of POI to express DD ORF of POI Culture cells l 24 hours post transfection or for 48 hours transduction add Centry No Centry Add Negative control Centry l Split cells to Grow new culture Vv Add Centry N a Experimental analysis o Centry Positive control cell based assay Western blot PCR assay v v Y Experimental analysis cell based assay Western blot PCR assay 8 DD tagged protein accumulation Twenty four hours post cell splitting treat one culture with the Centry 50 nM to 1 uM and use another as an untreated negative control The added Centry reagent will protect your DD tagged protein from proteasomal degradation resulting in a rapid accumulation within the cell and carry out your desired study DD tagged protein depletion The presence of DD tag enables rapid accumulation as well as depletion of protein of interest The Centry molecule can bind to the DD and stabilize the Technical Support support SABiosciences com www SABiosciences com 10 Version 1 0 protein Likewise removal of Centry reagent can cause rapid destabilization and proteasomal degradation of protein 9 After incubating transfected cell with Centry reagent for desired time which results in the accumulation of DD tagged protein split the cells into at least two parallel cultures in a complete growth medium 10 Continue with the presen
21. well plate 2 On the day of transduction remove medium from wells To each well add 20 ul of lentiviral particles and make up the total volume of 50 ul using growth medium without antibiotics DMEM with 10 FBS 0 1 mM NEAA 1 mM Sodium Pyruvate In this particular case add 30 ul of growth medium without antibiotics 3 Add SureENTRY Transduction Reagent to a final concentration of 8 ug ml in each well Gently swirl the plate to mix 4 Incubate for 18 20 hours at 37 C in a humidified incubator in an atmosphere of 5 CO2 5 Twenty four hours post transduction split the cells into at least two parallel cultures in a complete growth medium Protein accumulation Use plasmid or lentivirus to express DD ORF of POI Protein depletion Use plasmid or lentivirus to express DD ORF of POI 4 p 4 Culture cells l 24 hours post transfection or for 48 hours transduction add Centry No Centry Add Negative control Centry Split cells to Grow new culture A Y Add Centry No Centr k Experimental analysis y Positive control cell based assay Western blot PCR assay s y v Experimental analysis cell based assay Western blot PCR assay Technical Support support SABiosciences com www SABiosciences com 12 Version 1 0 6 DD taqged protein accumulation Twenty four hours post cell splitting treat one culture with the Centry 50 nM to 1 uM and use another as an untreated negative control The a
Download Pdf Manuals
Related Search