Home

CrossLink User Manual - Algorithms in Bioinformatics

image

Contents

1. Steffi 2 SALK TAIR RFAM TIGR O AB O NCBI D dict O linux 2 MPI LO DNA manipulation e on Algorithms in Bioinformatics a gt Software CrossLink Online Version Welcome CrossLink visualization and exploration of sequence relationships between People E micro RNAs Research a Online Version Publications Student Projects Diploma Projects CrossLink is usable over the web in two different ways via Java Web Start and as a Java Applet In both cases your browser transparently downloads and Studienkommission starts a CrossLink client which provides the graphical user interface This client talks to a CrossLink server hosted in Tuebingen which performs all Software computational work We strongly recommend to take advantage of Java Web Start since this technology is far superior to that of applets In particular you a will have more control there are less sources for incompatibilities and download times on repeated use will be significantly faster Note that if applets run on sss your system then Java Web Start will too and there is a high chance that it s already installed Like applets Java Web Start applications are started by a CGViz click in your web browser To use any online version of CrossLink you will need to have a Java Runtime v1 4 2 or better installed on your system SplitsTree4 Otherwise you can download a Java Runtime free of charge for all major operating systems here or here gece If you have never
2. AAGCUTAAUUGCULCCAUGAUCUGACAAUGUGGUGCUACALCGUAAACAUTUGCUAATLACUGGAUUAAUUAGGUU 151 l37 AAGCCTAATTIGCTCCATGATCTGACAATGTGGTGCTACAGTAAACATTIGCTAATGACGGATTAATTAGGCT 208 lclL ORSgTEMTOOLOOS6O gqillaz l7786 ntlls589zZ l22351 putative MITE Tourist like sense Match Antisense Match _ xX Alignment z evalue 9 23e 2 osa MiR442 MIOUOLTO 165 UCGCAGUUUACAGACGGAUUCUGUAAUUUGUUUUGUUADUAGH 207 that the rice microRNA osa MIR442 seems quite similar to a Tourist like MITE http www ab informatik uni tuebingen de software crosslink User Interface CrossLink s user interface essentially consists of two windows the Control Panel and the Visualization Window The Control Panel guides the user through the first two steps as show in the usage overview section The final exploration phase involves both the Control Panel and the Visualization Panel Control Panel The Control Panel hosts 4 sub panels We describe each one in turn now B3 CrossLink Control Panel v1 2 4 sequence Input Similarity Search Visualization Colors Visualization Options Active configuration template Example 1 v Configuration templates comprise the set of parameters for the sequence similarity search plus visualization colors and an associated set of default input files Load input files Sequence Set A sslink E1_A_MIR440 446 fa sequence Set B 4 crosslink E1_B_repeats fa Insert configuration template defaults Please supply input fi
3. mouse button The graph looks a bit messy because too many edges are shown CrossLink Control Panel v1 2 4 Sequence Input Similenty Search Visualization Colors Visualizatinn Upin Ave A amp vs B Bus B Ident All values hara are identical Show metchas w Sense M Antisense show representative by E value Match isbels Mont xw rs Unh v les SMALLER LARGER than threshold ane shown Fie do network layout Reset node positions Beset Chul We mask most of the insignificant green edges by moving the E value slider in the A vs B tab of the visualization options panel This masks all matches above the new evalue threshold http www ab informatik uni tuebingen de software crosslink CrossLink Control Panel v1 2 4 Sequence Input Similarity Search Visualization Colors Visualization Options Avs A Avs B Bvs B 8 AND Mode O OR Mode d Sense Nn Antisense E ro J 2e 61 2e 34 0 002 Antisense All values here are identical 1 Show matches M Sense M Antisense Show representative by E value v Match labels None v Resetnode postions E crossLink Visualization Window v1 2 4 slim yEd Graph Editor Ele Yew Layout Hep AAAA mi lei RS TEMT a lellORSgTEHT lel IS TEMT lellORSg TEM lellRSqTEMT1 lellORSg TEM Icl ORSgTEMT lellORRSg TEHT Icl ORSgTEMT lell OE EgTEMT Icl ORSgTEMT lel ERE TEMT Icl ORSgT
4. IcljORRSg TEM IcjORSqTEMI IO RRSQTEMT IcljOFRSg TEM IcjORSqTEMI IO RRERTEMT IcljOR Sg TEM IcjORSqTEMI IO RRSQTEMT IcljOR Sg TEM IcjORSqTEMI IO RREQTEMT IcjOR Sg TEMI IcJORSgTEMI IO RREQqTEMT IcljOR Sg TEM IcjORSqTEMI IO RREQTEMT IcljOR Sg TEM IcjORSqTEMT IO RREQTEMT IcjOR Sq TEM IcljOP Sg TEM IcjORSgTEMI IO RREQqTEMT IcljORRSg TEM IcjORSgTEMI IO RREQqTEMT IR SqTEM IcjORSqTEMI IO REQTEMT IcjORSgTEMI a MN e SaTe NM The visualization window opens up in addition Dive into the graph by zooming with the mouse wheel http www ab informatik uni tuebingen de software crosslink CrossLink Visualization Window v1 2 4 slim yEd Graph Editor File View Layout Help Id ORSgTEMI Id ORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Id ORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Ic lORSgTEMI Ic ORSgTEMI Id ORSgTEMI Id ORSgTEMI Ic ORSgTEMI Id ORSgTEMI IclORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Ic ORSgTEMI Ic lORSgTEMI Id ORSgTEMI Icl ORSgTEMI Id ORSgTEMI IclORSgTEMI Id ORSgTEMI IclORSgTEMI Ic ORSgTEMI Ic lORSgTEMI IclORSgTEMI Id ORSgTEMI IclORSgTEMI Ic ORSgTEMI e Id ORSGTEMI V Loss dell aS amTERTI lt gt Drag the gray square around the overview panel by pressing and holding the left
5. of repetitive rice sequences Initially displaying a multitude of links in a tangle this example demonstrates the http www ab informatik uni tuebingen de software crosslink power of the interactive histograms to focus on relevant relationships Example 2 Sequence set A consists of all Arabidopsis microRNA precursors available at miRBase Sequence set B contains all 2000 sequences contained in the Arabidopsis Small RNA Project Database to date Setting these two sets in relation to each other allows one to assess which microRNA families have been sequenced by the ASRP project This example also demonstrates CrossLink s ability to handle large sets of sequences and also shows the power of the spring embedding algorithm in clustering microRNAs into families Example 3 Sequence set A consists of the Drosophila microRNAs dme miR 3 dme miR 4 and dme miR 5 Sequence set B contains all corresponding targets which have been predicted with an E value smaller than one in a study by Rehmsmeier et al plus some randomly picked sequences from the same study that have not been predicted as potential targets of these microRNAs This example demonstrates the use of RNAhybrid for example revealing that one sequence accession CG15125 is simultaneously targeted by two different microRNAs Furthermore the capability of custom pattern color associations is shown as each predicted target set of the Rehmsmeier et al study is associated with its own
6. one to select a criterion to select one representative match from each match set This representative match is selected depending on one of the following selections e Show representative by E value The match with the smallest E value represents this match set e Show representative by Length The match with the largest length represents this match set e Show representative by Identity The match with the largest fraction of identical nucleotides within the alignment represents this match set In multiple match mode all matches between one pair of sequence nodes are represented by one link in the network The attibute shown when Match labels is selected is the attribute of the representative match of the pertaining match set http www ab informatik uni tuebingen de software crosslink Visualization Window Gb ssLink Visualization Window v1 2 4 slim yEd Graph Editor as e ew Layout Help Ca Icl ORSgTEMT 2 Id ORSgTEMT Icl ORSgTEMIT Icl ORSgTEMT e Id ORSgTEMT Icl ORSgTEMT Icl JORSgTEMIT Icl ORSgTEMIT Icl ORSgTEMT e Id ORSgTEMT Icl ORSgTEMT Icl JORSgTEMIT Icl ORSgTENMIT Icl ORSgTEMT e Id ORSgTEMT Icl ORSgTEMT Icl ORSgTEMT e Id ORSgTEMT Icl ORSgTEMT Icl ORSgTEMT e Id ORSgTEMT IclJORSgTEM Icl ORSgTEMIT Icl ORSgTENMIT Icl ORSgTEMT e Id ORSgTEMT Icl ORSgTEMT Icl JORSgTEMIT Icl ORSgTEMIT Icl ORSgTE
7. the default files associated with the template by pressing the Insert configuration template defaults button http www ab informatik uni tuebingen de software crosslink On the bottom of the Sequence Input panel you find the console which keeps a crude record of the actions performed during this exploration session In case of errors in the tools used e g when an undefined parameter has been passed to BLAST the error message returned by the tool will be found here B3 CrossLink Control Panel v1 2 4 Sequence Input Similarity Search Visualization Colors Visualization Options Avs A A vs B B vs B Complexity Filter Expect 0 0010 Ward Size 10 v Additional parameters Command line blastall d E1 B repeats fa i E1 B repeats fa m 8 e 0 0010 W 10 F F p bl lt gt For help visit http Awww nebi nim nih gov blast blastcgihelp shtml The Similarity Search panel allows selection of a tool for each of the three searches plus parametrization of each tool Note that you may pass any parameter to each tool which it would accept on the command line if invoked directly Consequently you can use the full range of features of each tool The actual command line which will be passed to each tool is displayed on the bottom of the parametrization panel Important remark BLAST calculates E values based on the size of the target database which is constructed from the second set of sequen
8. used Java Web Start before we suggest to read the 5 minute Java Web Start Guide we have compiled for CrossLink users PAT If you opt for the applet version be sure that your settings allow the Java Virtual Machine JVM to allocate at least 50 MB of memory microHARVESTER y Ls Finally note that the online version of CrossLink poses an upper limit on each input fasta file to keep server load and network traffic manageable The local a icis version of CrossLink allows arbitrary file sizes Screenshots But now Documentation 9 Click any of these CrossLink versions to start Download Have fun Se CrossLink v1 0 0 Applet version Public release December 2005 Gene Content 7 CrossLink v1 0 0 Java Web Start i t 2005 DUE Lersion Public release December 2005 Workshops in Address CrossLink v1 2 4 Applet version 1 ink v1 2 aW External Links lt a v1 2 4 Java Web Start a a WEN SN Internal Links Contents v Done Proxy None You have Java installed Click the online Java Web Start version to start Warnung Sicherheit A Soll das signierte Anwendung das von Universitaet Tuebingen Ubertragen wird akzeptiert werden Authentizitat des Herausgebers uberpruft durch Thawte Consulting cc 1 Das Sicherheitszertifikat stammt von einem Unternehmen das als vertrauensw rdig eingestuft ist 1 Das Sicherheitszertifikat ist nicht abgelaufen und immer noch g ltig Vorsicht Universitaet Tuebingen gibt an dass di
9. CrossLink Control Panel v1 2 4 Sequence Input Similarity Search Visualization Colors Visualization Options Avs A Avs B Bvs B 8 AND Mode CO OR Mode Sense r zia Antisense T SN 26 152 2e 106 3e 58 1e 9 EENE a I Seance I Q tisense v 08 i E ft zi 110 192 273 l AS UN Antisense 1 0 893 0 945 0 997 matches Sense Antisense viatch labels Length v lt gt Only values SMALLER LARGER than threshold are shown Re do network layout Reset node positions The Visualization Options panel allows interactive manipulation of the network shown in the Visualization Window Dragging the slider of histogram marks some edges in gray which are consequently suppressed from visualization Using the radio buttons to the left and right of each histogram allows the threshold to apply to matches which are smaller or larger respectively Using the AND mode only visualizes those matches which pass each of the three thresholds The OR mode visualizes those matches which pass at least one of the given thresholds Using the checkboxes labeled Show matches Sense Antisense one may suppress all sense and or antisense matches altogether A dropdown box marked in green above allows one to switch from Single match mode equivalent to Show all matches to Multiple match mode equivalent to Show representative and if the case of Show representative allows
10. CrossLink User Manual by Tobias Dezulian v1 2 4 31 03 2006 11 04 22 Or P d e ES ONES hS is ADSL o250 292552 922 300238515095293 30 90002999900908 900052029 0 9 2 9090090900 0800009090 90 999 0 900009099 08 9000 2 956 2 WSAGC OVCRVICW UII 3 Quick beginners TOU pcre citer ta ddr ta mita a peto ra a AB Edd ba Ee E Dude Mb tO 4 User aucem E 10 ro qiie E soin zd PE MT 10 Visualization Window csssseee IH m meme ememememeenenemese memes senes 14 MNOS VON O S aee 14 Terms and Conditions This manual adds detail information to the CrossLink article which is available from this website http www ab informatik uni tuebingen de software crosslink doc welcome html Please read the the CrossLink article first http www ab informatik uni tuebingen de software crosslink Abstract CrossLink is a versatile tool for the exploration of relationships between RNA sequences After a parametrization phase CrossLink delegates the determination of sequence relationships to established tools BLAST Vmatch and RNAhybrid and then constructs a network Each node in this network represents a sequence and each link represents a match or a set of matches Match attributes are reflected by graphical attributes of the links and corresponding alignments are displayed on a mouse click The distributions of match attributes such as E value match length and proportion of identi
11. ED INFORMATION OR DOCUMENTATION WILL NOT INFRINGE ANY THIRD PARTY PATENTS COPYRIGHTS TRADEMARKS OR OTHER RIGHTS OR THAT THE OPERATION OF THE SITE AT WHICH THIS INFORMATION IS FOUND WILL BE ERROR FREE IN NO EVENT SHALL THE LICENSOR HAVE ANY LIABILITY TO THE USER FOR CONSEQUENTIAL SPECIAL INCIDENTAL OR OTHER INDIRECI DAMAGES The copyright in this software and any associated documentation shall at all times remain with the LICENSOR or any other licensors which have granted a license to LICENSOR and the LICENSEE agrees to preserve the same http www ab informatik uni tuebingen de software crosslink
12. EMT lel ERE TEMT Icl ORSgTEHT lei ERE TEMT lel OF Eg TEHIT lel ERE TEMT IellORSg TEHT lel ERE TE MT lellORSgTEMT lel R amp qTEMT lellORSgTEHT Icl ORSgTEMT lellORSg TEHT Icl ORSgTEMT lell ORE TEMT Icl ORSgTEMT lel ERE TEMT Icl ORSgTEMT lel ERE TEM Iel ORSgTEMT lel ERE TEMT Icl ORSgTEHT IOS TEMT MIME c mTERKTI E amp 5 o amp 5 o 5 oBR oO B o5 Bo B CPC BoR o8 95 595 5 bo Bo RB RE o B SE And find a much better separation of the A set red and the B set blue http www ab informatik uni tuebingen de software crosslink 35 CrossLink Visualization Window v1 0 0 slim yEd Graph Editor Ele Edit View Layout Help amp amp amp Es e ORSgTEMT CA w ORSgTEMTOC Ssa ORSgTEMTOL ORSgTEMTOC ORSgTEMTOC ORSgTEMTOC ORSgTEMTOC ORSgTEMTOC ORSgTEMTOL ORSgTEMTOC ORSgTEMTOC ORSgTEMTOC ORSGTEMTOC ORSgTEMTOC ORSgTEMTOC ORSgTEMTOC ORSgTEMTUI ORSgTEMTUI ORSgTEMTIUI ORSgTEMTIUI ORSgTEMTUI ORSgTEMTUI ORSgTEMTUI ORSgTEMTU ORSgQTEMTU ORSgQTEMTO ORSgTEMTU ORSgTEMTIUI ORSgTEMTUI e ORSgTEMTO 9 kAT OT AMCnATO gt lt Double clicking on a green edge reveals ti osa MIR442 lt gt Icl ORSETEMT00100560 Alignment evalue 3 20e 36 asa MIR4dzZ MIOOOLTO B
13. MT e Id ORSgTEMT Icl ORSgTEMT Icl ORSgTEMT 2 Id ORSgTEMT Icl ORSgTEMIT v IclINRSaTFh1 gt Most menu things here should be self explanatory One remark however e PFile Save allows you to save the network in YGF format You can subsequently use the free yEd graph editor from yWorks www yworks com available at http www yworks com en products yed about htm web start version applet version standalone version to load and modify the saved network in a large variety of ways for printing Example templates CrossLink provides three example configuration templates along with the corresponding sequence files To try out CrossLink one merely has to select one of the examples and press the Run button When trying the examples in sequence be sure to load the default input files associated with each example as switching the configuration template does not change the current input files but provides new associated default input files that may be loaded by pushing the Insert configuration template defaults button The following example scenarios are provided e Example 1 Sequence set A consists of all rice microRNAs of families 440 446 available from miRBase Sequence set B contains a subset of repetitive rice sequences downloaded from the TIGR Rice Genome Annotation Database It is immediately visible that e g the rice microRNA family 445 exhibits very close sequence similarity to a family
14. cal nucleotides are displayed as histograms Sequence sets can be highlighted and visibility of designated matches can be suppressed by real time adjustable thresholds for attribute combinations Powerful network layout operations such as spring embedding algorithms and navigation capabilities complete the exploration features of this tool CrossLink can be especially useful in a microRNA context since Vmatch and RNAhybrid are suitable tools for determining the antisense and hybridisation relationships which are decisive for the interaction between microRNAs and their targets CrossLink is available both online and as a standalone version at http www ab informatik uni tuebingen de software Figure 1 A simple network with 5 sequences and 8 matches http www ab informatik uni tuebingen de software crosslink Usage overview This flow chart provides a schematic overview of the steps performed during a typical CrossLink session newer communication m eoma mmng 1d http www ab informatik uni tuebingen de software crosslink Quick beginner s tour T bingen University Algorithms in Bioinformatics Online Version Mozilla Firefox Bm x File Edit View Go Bookmarks Tools Help Q ii lt a M S gt v Ej x A L http www ab informatik uni tuebingen de software crosslink webstart welcome html v Q Go el gt EBI UCSC sourceforge ft WEB DE Mi 24 08 20
15. ces passed to BLAST This leads to different E values for a particular query target pair when sequences are added or removed to the second sequence set which some of our test users found quite confusing http www ab informatik uni tuebingen de software crosslink ES CrossLink Control Panel v1 2 4 Node colors for sequences of set ORSgTE 01488 for sequences of set B Below you may associate any color with a text pattern Each sequence who s header contains this pattern will be colored accordingly Optionally regular expression patterns may be used instead of literal text cf http java sun com j2se 1 5 0 docs api java util regex Pattern html transcription Change color l RNA binding Change color DNA binding Change color l Default colors _ Interpret all patterns as regular expressions Li LI LI Li Li LI Sense Match Avs A Antisense Match Avs A Sense Match Avs B Antisense Match Avs B Sense Match B vs B Antisense Match B vs B The Visualization Color panel allows the association of colors to patterns of text as described in the article Note that optionally all patterns stated may be interpreted as regular expressions in the format described here http java sun com 2se 1 5 0 docs api java util regex Pattern html Edge colors are not changeable An edge is colored according to the match set it belongs to http www ab informatik uni tuebingen de software crosslink B3
16. color yellow magenta and cyan for the targets of dme miR 3 dme miR 4 and dme miR 5 respectively and the non targets are shown in blue http www ab informatik uni tuebingen de software crosslink Terms and Conditions LICENSE AGREEMENT This software is being provided to you the LICENSEE by the LICENSOR Department for Algorithms in Bioinformatics Tuebingen University under the following license By obtaining and or copying this software you agree that you have read understood and will comply with the following terms and conditions Permission to use and modify for INTERNAL NONCOMMERCIAL RESEARCH PURPOSES ONLY this software and its documentation is hereby granted provided that you agree 1 to comply with the following copyright notice and Statements including the disclaimer and that the same appear on ALL copies of the software and documentation including duplications and modifications that you make for internal use Copyright 2005 by Department for Algorithms in Bioinformatics Tuebingen University All rights reserved 2 NOT TO REENGINEER DECOMPILE OR ATTEMPT TO REPRODUCE ANY COMPONENT NOT PROVIDED IN AS SOURCE CODE THIS SOFTWARE IS PROVIDED AS IS AND THE LICENSOR MAKES NO PRESENTATIONS OR WARRANTIES EXPRESS OR IMPLIED BY WAY OF EXAMPLE BUT NOT LIMITATION THE LICENSOR MAKES NO REPRESENTATIONS OR WARRANTIES OF MERCHANTABILITY OR FITNESS FOR ANY PARTICULAR PURPOSE OR THAT THE USE OF THE LICENS
17. eser Inhalt sicher ist Sie sollten diesen Inhalt nur akzeptieren wenn Universitaet Tuebingen vertrauenswurdig ist Mehr Details Do you trust a CrossLink application from Tuebingen University Yep http www ab informatik uni tuebingen de software crosslink CrossLink Control Panel v1 2 4 Sequence Input Similarity Search Visualization Colors Visualization Options Active configuration template Example 1 v Configuration templates comprise the set of parameters for the sequence similarity search plus visualization colors and an associated set of default input files Load input files Sequence Set A sslink E1_A_MIR440 446 fa Sequence Set B amp crosslinkVE1 B repeats fa Insert configuration template Please supply input files in multi FASTA format If no inputfiles are specified then the default input files of the currently active configuration template are used So now if you are a firsttime user 1 Push Run 2 Enjoy CrossLink vl 2 4 WELCOME Sat Mar 25 09 20 14 CET 2006 User japhy CrossLink dir C Dokumente und Einstellungen japhyM crosslink find temporar Working dir C Programme Mozilla Firefox Input file size limit in online mode 500 KB Please use the free standalone version of CrossLink to handle larger files loca _ Note that the use of CrossLink is subject to the terms and conditions found at CrosslLink was written hv Tohias Dezulian and Martin Schaefer in autumn 2fn
18. f amp 5 lt We are happy with Example 1 for now and click the Run button without further ado 4 er de Client lt gt Server communication D p enmy c mcue re Successfully uploaded job onto serve Now waiting for job completion Checking for finished job on the Checking for finished job on the Checking for finished job on the Checking for finished job on the Checking for finished job on the Checking for finished job on the Seconds running Cancel We wait for the server to perform all three relationship searches For Example 1 this should take less than a minute http www ab informatik uni tuebingen de software crosslink CrossLink Control Panel v1 2 4 Sequence Input Similarity Search Visualization Colors Visualization Options Avs A Avs B Bvs B AND Made m OR Mode T Antisense 1 3e 58 l I i Jiptisense I 110 192 PU Pen l 0 893 2e 152 2e 106 Ident 0 843 0 945 Show matches M Sense M Antisense Show representative by E value v Matchlabels None Re do network layout Reset node positions 1e 9 273 lt gt Only values SMALLER LARGER than threshold are shown Things seem to have gone well and we get a success screen CrossLink Visualization Window v1 2 4 slim yEd Graph Editor IcjORSgTEMI a IcjORSqTEMI IO RRSQqTEMT
19. les in multi FASTA format If no input files are specified then the default input files of the currently active configuration template are used So now if you are a firsttime user 1 Push Run 2 Enjoy CrossLink vl 2 4 WELCOME Sat Mar 25 09 20 14 CET 2006 User japhy CrossLink dir C Dokumente und Einstellungen japhy crosslink find temporar Working dir C XProgrammeVMozilla Firefox Input file size limit in online mode 500 kB Please use the free standalone version of CrossLink to handle larger files loca Note that the use of CrossLink is subject to the terms and conditions found at rnasLink was written hv Tnhias Deznulian and Martin Schaefer in autumn 2ffl amp 5 gt The Sequence Input panel allows one to select a configuration template It comprises the set of parameters for each of the relationship searches plus visualization colors and an associated set of default input files Configuration templates are useful to repeat an exploration task at a later time without having to re enter all parameters Also the whole parameter set of one exploration task can be easily be applied to a different pair of sequence sets When input files are chosen and Run is pushed the input files given are actually copied to the crosslink directory where they are handled Note that switching to a different configuration template does NOT change the stated input files You may however override the given input files with

Download Pdf Manuals

image

Related Search

Related Contents

яюю я S i t e D i a l e r E d i t  User`s Manual - Airlivecam.eu  BoomTone DJ LDS2  PHOBOS N BT PHOBOS NL BT  USER MANUAL - hik  Alto-Shaam Electronically Operated Ovens Oven User Manual  voir mode d`emploi - Festival du Film Court de Troyes    Uncle Milton Wall Friends: Mickey Mouse    

Copyright © All rights reserved.
Failed to retrieve file