GE AH9539 User's Manual
Contents
1. Only deionized distilled water should be used for the sequencing reactions Specialized sequencing primers Some sequencing projects will require the use of primers which are specific to the project For most sequencing applications 0 5 2 5pmol of primer should be used for each set of sequencing reactions Always determine the concentration of the primer by reading the optical density at 260nm OD If the primer has N bases the approximate concentration pmol ul is given by the following formula Concentration pmol ul OD 0 01 x N where N is the number of bases Gel reagents Sequencing gels should be made from fresh solutions of acrylamide and bis acrylamide Other reagents should be electrophoresis grade materials For convenience RapidGel gel mixes are strongly recommended RapidGel XL formulations yield up to 40 more readable sequence per gel See Related Products section for range of USB Ultrapure gel products Necessary equipment Liquid handling supplies such as vials pipettes and a microcentrifuge All sequencing reactions are run in plastic microcentrifuge tubes typically 0 5ml suitable for thermal cycling Electrophoresis equipment While standard non gradient sequencing gel apparatus is sufficient for much sequencing work the use of field gradient wedge or salt gradient gels will allow much greater reading capacity on the gel 4 5 17 A power supply offering constant voltage operation at2. Patents pending Thermo Sequenase DNA Polymerase This reagent kit is covered by or suitable for use under one or more US Patent numbers 4 962 020 5 173 411 5 409 811 5 498 523 5 614 365 and 5 674 716 Patents pending in US and other countries Pyrophosphatase This product and or its method of use is covered by one or more of the following patent s US Patent number 5 498 523 and foreign equivalents 8Glycerol Tolerant Gel Buffer This product and or its method of use is covered by US Patent number 5 314 595 The Polymerase Chain Reaction PCR is covered by patents owned by Roche Molecular Systems and F Hoffmann La Roche Ltd Exonuclease I Shrimp Alkaline Phosphatase method of use covered by one or more of the following US patents 5 756 285 and 5 741 676 ExoSAP IT patent pending GE Healthcare is a trademark of General Electric Company Pharmacia is a trademark of Pharmacia amp Upjohn Inc Hyperfilm RapidGel Redivue Sequenase and Thermo Sequenase are trademarks of GE Healthcare Bio Sciences Ltd or its subsidiaries Taq DNA polymerase This product is sold under licensing arrangements with Roche Molecular Systems F Hoffmann La Roche Ltd and the Perkin Elmer Corporation Purchase of this product must be accompanied by a limited license to use it in the Polymerase Chain Reaction PCR process for research in conjunction with a thermal cycler whose use in the automated performance of the PCR process is covered by the up fron
3. interfering with annealing with the template Try a different primer 10 Wrong amounts of dNTP or a P ddNTP used Check volumes added 11 Large excess of primer and DNA used Check quantities added to reaction Bands faint near the primer 1 Too much dNTP or too little a 7P ddNTP used Check volumes added Bands smeared 1 2 gt Contaminated DNA preparation Try control DNA Thermo Sequenase DNA polymerase is sensitive to salt concentration especially above 75mM Gel may be bad Gels should be cast with fresh acrylamide solutions and should polymerize rapidly within 15 minutes of pouring Try running a second gel with the same samples Gel run too cold Sequencing gels should be run at 40 55 C Gel dried too hot or not flat enough to be evenly exposed to film Samples not denatured Make sure samples are always heated to 70 C for at least 2 minutes longer in an air filled heat block immediately prior to loading on gel When re loading a sample e g for a second gel or a double loaded gel the heating step should be repeated Bands appear across all 4 lanes 1 Gel compression artifacts Sometimes a band in all 4 lanes indicates a severe gel compression caused by secondary structures not completely denatured during electrophoresis If the gel has a region where the bands are very closely spaced followed by a region where the bands are widely 21 spaced a compression artifact is indicated Try using t
4. 320 GCTGCGCTCG 370 CGGTAATACG 180 CTCACATTAA 230 GTCGTGCCAG 280 TGCGTATTGG 330 GTCGTTCGGC 380 GTTATCCACA TA gt TAAAACGACG 40 GATCCCCGGG 90 GTGTGAAATT lt CTTTAA 140 CATAAAGTGT 190 TTGCGTTGCG 240 CTGCATTAAT 290 GCGCTCTTCC 340 TGCGGCGAGC 390 GAATCAGGGG GCCAGTGCCA 50 TACCGAGCTC 100 GTTATCCGCT CAATAGGCGA 150 AAAGCCTGGG 200 CTCACTGCCC 250 GAATCGGCCA 300 GCTTCCTCGC 350 GGTATCAGCT 400 ATAACGCAGC REFERENCES 1 SANGER F NIKLEN S and COULSON A R 1977 Proc Nat Acad Sci USA 74 pp 5463 5467 2 BIGGIN M D GIBSON T J and HONG G F 1983 Proc Nat Acad Sci USA 80 pp 3963 3965 3 ZAGURSKY R J CONWAY P S and KASHDAN M A 1991 BioTechniques 11 pp 36 38 4 ANSORGE W and LABEIT S 1984 J Biochem and Biophys Method 10 pp 237 243 5 SHEEN J and SEED B 1988 BioTechniques 6 6 TABOR S and RICHARDSON C C 1987 Proc Nat Acad Sci USA 84 pp 4767 4771 7 TABOR S and RICHARDSON C C 1989 J Biol Chem 264 pp 6447 6458 8 W M BARNES 1992 Gene 112 pp 29 35 9 TABOR S and RICHARDSON C C 1995 Proc Nat Acad Sci USA 92 pp 6339 6343 10 TABOR S and RICHARDSON C C 1989 Proc Nat Acad Sci USA 86 pp 4076 4080 11 HUIBREGTSE J M and ENGELKE D R 1988 DNA and Protein Engineering Techniques 1 pp 39 41 12 McMAHON G DAVIS E and WOGAN G N 1987 Proc Nat Acad Sci USA 84 14 pp 4974 8 1
5. at 4 C for up to 1 week after receipt or at a constant 20 C if longer storage is desired Care must be taken to prevent evaporation of these small volumes of material Tightly cap the vials after use Store at 20 C between uses if frequency of use is less than every 1 3 days If condensation is observed on the walls of the vial or in the cap return the liquid to the bottom of the vial and mix well before use QUALITY CONTROL All kit batches are functionally tested using P labeled terminators and pUC18 double stranded DNA template as described in this protocol Release specifications are based on sequence length band intensity and sequence quality The sequence must be visible up to 300 base pairs on a standardized gel with less than 24 hours exposure The sequence must also be free of background bands strong enough to interfere with sequence interpretation SAFETY WARNINGS AND PRECAUTIONS Warning For research use only Not recommended or intended for diagnosis of disease in humans or animals Do not use internally or externally in humans or animals Caution This product is to be used with radioactive material Please follow the manufacturer s instructions relating to the handling use storage and disposal of such materials Warning Contains formamide See Material Safety Data Sheet on page 26 All chemicals should be considered as potentially hazardous We therefore recommend that this product is handled only by those p
6. electrophoresis 500ml 75863 500ml TBE Buffer 10X Gel electrophoresis 6 bottles 70454 1pk TEMED Gel electrophoresis 100g 76320 100g 500g 76320 500g Tris Gel electrophoresis 5kg 75825 5kg 1kg 75825 1kg Urea Gel electrophoresis 1kg 75826 1kg 500g 75826 5009 Water RNase free 500ml 70783 500ml 1 liter 70783 1L X Gal Cloning 250mg 10077 250mg Xylene cyanol Gel electrophoresis 25g 23513 25g USB CORPORATION USA Cleveland Ohio 800 321 9322 usbweb com USB Authorized Distributor GE Healthcare Asia Pacific Tel 852 2811 8693 Australia Tel 61 2 9894 5188 Austria Tel 43 1 57 606 1610 Belgium Tel 0800 73888 Canada Tel 1 800 463 5800 Central and East Europe Tel 43 1 982 3826 Denmark Tel 45 4516 2400 Finland Tel 358 9 512 3940 Former Soviet Union Tel 7 095 232 0250 France Tel 33 1 69 35 67 00 Germany Tel 49 761 49 03 0 Italy Tel 39 02 27322 1 Japan Tel 81 3 5331 9317 Latin America Tel 55 11 3667 5700 Middle East and Africa Tel 30 1 96 00 687 Netherlands Tel 31 165 580 410 Norway Tel 47 23 18 58 00 Portugal Tel 351 2 1 417 70 35 South East Asia Tel 60 3 724 2080 South East Europe Tel 43 1 982 3826 Spain Tel 34 935 944 950 Sweden Tel 46 18 612 19 00 Switzerland Tel 41 1 802 81 50 UK Tel 44 870 606 1921 USA Tel 1 800 526 3593 25 QDIAPe eOIp ui y s pue 1 eA jo Alu d ym l 1eIp uuuui asul
7. of compressions Gel conc Acrylamide Urea 20X Gly Tol OR 10X TBE bis acrylamide 7M Gel Buffer Buffer Formamide H O 6 5 79 0 3g 42g 5ml 40ml 10ml 8 7 6g 0 4g 42g 5ml 40ml 10ml 6 5 7g9 0 3g 42g 10ml 40ml 5ml 8 7 69 0 4g 42g 10ml 40ml 5ml Warming to 35 45 C may be required to dissolve urea completely Adjust volume to 100ml with H O filter and de gas When ready to pour add 1ml of 10 ammonium persulfate and 100 150ul TEMED The temperature of the mixture should be 25 35 C warmer mixtures will polymerize too fast while mixtures below 20 C may precipitate urea They will require higher running voltage and run slower than urea only gels Prior to drying these gels should be soaked in 5 acetic acid 20 methanol to prevent swelling For more detailed information refer to TechTip 200 available from USB Technical Support or the Technical Library at usoweb com General guidelines for electrophoresis 1 Ultrapure or electrophoresis grade reagents should be used 2 Sequencing gels should be made fresh Store solutions no longer than one week in the dark at 4 C Commercial preparations of acrylamide gel mixes in liquid or powder form RapidGel gel mixes see Related Products should be used according to manufacturers recommendations 3 Gels should be prepared 2 20 hours prior to use and pre run for 15 minutes 4 When reading longer sequences it is usually convenient to run gels overnight with
8. on ice and extension of these primers can occur as the thermal cycler heats up during the first cycle To minimize nonspecific extension products the cycler can be pre heated to 85 95 C or pre cooled to 4 C Start the cycling program Note The specific cycling parameters used will depend on the primer sequence and the amount and purity of the template DNA For the primers included in the kit and the suggested amount of purified DNA 25 250fmol cycle 30 60 times as follows dGTP dITP 95 C 30s 95 C 30s 55 C 30s 50 C 30s 72 C 60 120s 60 C 5 10min typically 30 cycles taking 2 3hr typically 30 cycles taking 3 5hr Fewer 1 10 cycles may produce better results when using 250 500fmol DNA Add 4ul of Stop Solution to each of the termination reactions mix thoroughly and centrifuge briefly to separate the oil from the aqueous phase Alternatively remove 6ul from each termination reaction and transfer to a fresh tube containing 3 4ul of Stop Solution Samples should be kept on ice for same day loading or may be stored frozen up to 3 days before loading onto gel When the gel is ready for loading heat the samples to 70 C for 2 10 minutes and load immediately on the gel 3 5ul in each gel lane Note Heating in open vials will promote evaporation of water from the formamide reaction mixture This is not normally necessary but will increase the signal by concentrating the isotope and will promote more complete den
9. pluupuuuod dIHO NOILVINYOSANI AdO LV 10938 NOILVINYOSNI NOILVLYOdSNVUL SNOILVYAGISNOD 1VSOdSIG NOILVWHYOSANI TVOIDO 10904 NOI1VINHOHdNI TVOISOTOOIXOL ALIALLOVSY ANY ALITIGVLS S3a3lld3dOtd IVOIIN3HO ANV TVOISAHd NOILOALOUd TVNOSHJd 3SVHO1S ANV SNITGNVH SAYNSVAW ASVATSY IWLINAGIOOV NOILVINYOSNI SNI LH9I4 3tld S3d nSV3N qIV 1StId NOILVOIJILN3qQI SddVZVH N N All goods and services are sold subject to the terms and conditions of sale of the company within the USB Corporation or the group which supplies them A copy of these terms and conditions is available on request fNotice to purchaser about limited license This product is sublicensed from GE Healthcare UK Ltd The purchase of this kit reagent includes a limited non exclusive sublicense under certain patents to use the kit reagent to perform one or more patented DNA sequencing methods in those patents solely for use with Thermo Sequenase DNA polymerase purchased from GE Healthcare Bio Sciences Ltd and or its subsidiaries for research activities No other license is granted expressly impliedly or by estoppel For information concerning availability of additional licenses to practice the patented methodologies contact GE Healthcare UK Ltd Director VP Corporate Development GE Healthcare Place Little Chalfont Buckinghamshire HP79NA England US Patent numbers 4 962 020 5 173 411 5 409 811 5 498 523 5 614 365 and 5 674 716
10. s UUM 9B81uoo JO SVI U 9Z S ulys pue uolyesedajd aun x ww soho 0 Bunel 8 98 H 6V61LZ Hed 94 104 VL 9 6 L8E9 6v6 Z Hed Ul V 1q3 bl L 98 Z2 6r612 Hed Ul SHL uollgeuuojJu ajqeodde oN IV L G G8 4 L 20862 Hed U OH SHL s pue Ulys YM 198 U09 pioAV SZ bZ S pilyo ujoqun y 0 wey JO JSU lqissod 9 H Aumua p ureduui JO JSH lqissoq gg wddol 96 Z S veZOZ ul eplueWw04 S3SVuHd S td dIHO All IM ON SVO GuvVZVH SINSNOdNO09 SNOdAYZYH JNOILISOdINOD 000S S9Z 912 89uoUd L88 22S 02 epeueg pue ysn episino 8ZLtt HO puel A lo9 peoy S N LLL9Z 0086 rzr 008 993ui gu5 uoneiodiod gsn 1OV1NOO AON3SH3NW3 dalddns wy Buiou nb s ajoA9 ioleuluu L ANVdINOO ANY SuoN 09264 09462 pajeqejoipey seu nb S ouugul NOMVEVdSaud SONVLSENS 434WNN 9333009 19naotud 3WVN 19nqotud 3H1 dO NOILVOINsILNAGI SOH piepue S uol solunuluuoo piezeH SN ay pue suolle n6 ui dIHD 6uiBeyoey pue uoneguuoju PuezeH sjeoiwayg ptumtuo4 YN au uloq UM 9uel duuioo 10 D DIAO1d SI UOeWOJU piezeH 00 08 01 uosiA8H 1 us Leep Ajajes Jenae oO N suoegj n6 41 qeo dde ayelsdoidde UMA 9uEpio2o2e ul Bq 0 JaSN aU Aq p uluuj 8 p aq 1snu 1 us eyep SIU u p uleluo2 uoluuuojui BU JO sn uV uol e9lJu A pue uol eBns Aul uollei pisuoo INO 10 p 1 JJO SI YOIUM ulay PaUleJUOD UO TEWUOJU BU JO ss u duuo2 Jo Aop nooe au 0 se lUe UeA 10 1lu u
11. see Denaturing gel electrophoresis section 16 1min 4min 10min 20min 300 bases 200 bases lt e 150 bases W Figure 3 Use of dITP requires longer extension times at 60 C Shown are four sequences of plasmid pUC18 obtained using cycles with 1 4 10 and 20 minute extension steps in the cycles Extension steps of 4 5 minutes or longer are necessary for reading beyond 200 bases Reading farther from or closer to the primer The termination mixes described in the protocol will typically yield sequencing data from the first base to over 500 bases from the primer This is as much sequence as most users will be able to read using current standard electrophoresis technology If it is desired to obtain sequence gt 500 bases from the primer the dNTP ddNTP ratios can be easily altered to shift the distribution of sequencing reaction products by adding more dNTPs to the termination reaction Adding 3ul instead of 2ul dNTPs will increase the dNTP ddNTP ratio 17 by 50 thus increasing the average extension length of each primer before a ddNTP is incorporated Conversely adding 1ul of e 33P ddNTP will decrease the ratio by 50 thus decreasing the average extension length of each primer Running sequencing gels which resolve more than 600 nucleotides requires high quality apparatus chemicals and attention to many details While specific instructions are beyond the scope of this manual following are som
12. 2000V or greater is essential Gel handling For P sequencing a large tray for washing the gel to remove urea and a gel drying apparatus are highly recommended For best results gels containing P must be exposed dry in direct contract with the film at room temperature Autoradiography Any large format autoradiography film such as the BioMax MR and a large film cassette Thermal cycler Sequencing will require thermally cycled incubations between 50 C and 95 C 1 100 cycles PROTOCOL 1 Termination mixes Prepare the termination mixes on ice Mix 2ul of Nucleotide Master Mix either dGTP or dlITP see note below and 0 5ul of a P ddANTP G A T or C one of each per sequence to produce a termination mix for each ddNTP Label fill and cap four tubes G A T C with 2 5ul of each termination mix It is more accurate and convenient to prepare batches of termination mixes sufficient for all sequences to be performed then dispense 2 5ul from this batch to each vial for the termination reactions It is recommended that these batches of termination mixes be made up routinely To prepare termination mixes for n reactions mix G A T C Nucleotide Master Mix 2xn jul 2xnul 2xn ul 2xn ul e 33P ddNTP 0 5 xn ul 0 5 xn ul 0 5 x n ul 0 5 x n ul Total 2 5 x n ul 2 5 xn ul 2 5 xn ul 2 5 x n u Note The termination tubes can be left uncapped until all reagents have been added if the tubes a
13. 3 CAROTHERS A M URLAUB G MUCHA J GRUNBERGER D and CHASIN L A 1989 Biotechniques May 7 5 pp 494 6 498 9 14 MURRAY V 1989 Nucleic Acids Research Nov 11 17 21 pp 8889 15 LEVEDAKOU E N LANDEGREN U and HOOD L E 1989 Biotechniques May 7 5 pp 438 42 16 LEE J S 1991 DNA Cell Biol Jan Feb 10 1 pp 67 73 17 BRUMMET S 1991 Comments 17 No 4 pp 22 23 Unites States Biochemical Corp Cleveland OH 18 GOUGH J A and MURRAY N E 1983 J Mol Biol 166 pp 1 19 19 MIZUSAWA S NISHIMURA S and SEELA F 1986 Nucleic Acids Research 14 pp 1319 1324 20 PISA WILLIAMSON D and FULLER C W 1992 Comments 19 No 2 pp 1 7 United States Biochemical Corp Cleveland OH 21 DENTE L CESARENI G and CORTESE R 1983 Nucleic Acids Research 11 pp 1645 1655 22 CARLSON A and MESSING J 1984 J Biotechnology 1 pp 253 23 RELATED PRODUCTS Kits and Enzymes Product Application Pack size Product number Sequenase PCR Product For rapid sequencing 100 70170 Sequencing Kit of PCR products templates Sequenase Quick Denature For rapid denaturation 100 70140 Plasmid Sequencing Kit and sequencing of templates plasmid DNA Sequenase Version 2 0 For non cycle 200 units 70775Y DNA polymerase radioactive sequencing 1000 units 70775Z Sequenase Version 2 0 For non cycle 100 70770 DNA Sequencing Kit radioactive sequencing templates The
14. Sequencing PGR product is sect anasu quipus 15 Elimination Of compressi ns issii nenia 15 Reading farther from or closer to the primer 17 Denaturing gel electrophoresis uu 18 Tro bl shoti ng 1 l cet srenti tees casas det escent eudedndeacecsessinntadesdadsciendskderezseets 20 Control DNA Sequence 22 R efe ere C89S sroine u us hanpahamauysqpsnqasqaqasasaqsukauqasanhasqhassasascs A 23 Related Products 2 acna L nek eee eee 24 Contact Informatio 2 u u uuu as aqhusaaiwaqipapqakukaqsaqausqasha uayQashppassta 25 COMPONENTS OF THE KIT The solutions included in the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing Kit have been carefully prepared to yield the best possible sequencing results Each reagent has been tested extensively and its concentration adjusted to meet USB standards It is strongly recommended that the reagents supplied in the kit be used as directed The following solutions are included in the kit Thermo Sequenase DNA Polymerase 4U ul 0 0006U ul Thermoplasma acidophilum inorganic pyrophosphatase 50mM Tris HCl pH 8 0 1mM dithiothreitol DTT 0 1mM ethylenediamine tetraacetic acid EDTA 0 5 Tween 20 0 5 Nonidet P 40 50 glycerol Reaction Buffer concentrate 260mM Tris HCl pH 9 5 65mM MgCl dGTP Nucleotide Master Mix 7 5uM dATP dCTP dGTP d
15. TTP dITP Nucleotide Master Mix 7 5uM dATP dCTP dTTP 37 5uM dITP Stop Solution 95 formamide 20mM EDTA 0 05 bromophenol blue 0 05 xylene cyanol FF Control DNA double stranded pUC18 0 02ug ul Control Primer 40 M13 forward 23 mer 2 0pmol ul 5 GTTTTCCCAGTCACGACGTTGTA 3 This kit and all the enclosed reagents should be stored at 15 C to 30 C NOT in a frost free freezer Keep all reagents on ice when removed from storage for use The kit can conveniently be stored at 2 C to 4 C for periods of up to 3 months with no loss of performance but this should be avoided if it is expected that the reagents will not be completely consumed within 3 months Note The formulation of Thermo Sequenase DNA polymerase in this kit necessitates the use of a glycerol tolerant DNA sequencing gel See Supplementary Information denaturing gel electrophoresis section 33P labeled Terminators A package of four P labeled terminators must be purchased for use with the kit They may be ordered separately from GE Healthcare using product number AH95339 In the US the terminators may be ordered together with the sequencing kit from USB using product number 188403 ddGTP 0 3uM a sP ddGTP 1500Ci mmol 450uCi ml Redivue ddATP 0 34M ce 33P ddATP 1500Ci mmol 450uCi ml Redivue dd TTP 0 34M o 33P ddTTP 1500Ci mmol 450uCi ml Redivue ddCTP 0 3uM a P ddCTP 1500Ci mmol 450uCi ml Redivue Redivue nucleotides can be stored
16. Thermo Sequenase Radiolabeled Terminator Cycle Sequencing Kit Product Number 79750 50 reactions 79760 100 reactions 79770 500 reactions Product Number 188403 includes 79750 50 reactions AH9539 P labeled terminators STORAGE Store at 15 C to 30 C Warning For research use only Not recommended or intended for diagnosis of disease in humans or animals Do not use internally or externally in humans or animals GE imagination at work usb CONTENTS Components of the Kit L 3 Quality COMTO lce cdi aioe as eae eaaa Eiane r 4 Safety Warnings and Precautions 4 26 Introductio k o u a a SU Rua Re aaa sss 5 Materials Not Supplied 8 Protocole u hid QS sS aaa A iu aaa s a a au sb 9 Supplementary Information 11 General Quideline ccceeeceeseeeeseeeeneeceaeeesaeeceaeeeseeeesaeeeaeeseseeseaeessaeeseaeeeaees 11 Preparation of template DNA c cccceseeeeeeseneeeneseeeeeeeseeeeesseeeneseeeeenenenees 12 Cycle conditions and template Quantity a 12 Cycling temperatures ceeeccseceeeseeceeeeeeeeeeeeneeseaeeeeaeeeeaeeteaeeeeaeeteaeeneaeenea 12 Number of cycles and quantity of template l a 13 Designing a NEW SEQUENCING primer 13
17. a timer controlled power supply Gel runs of 18 24 hours at 40 50 watts are often necessary for reading in the 400 600bp range 5 Loading 8 adjacent lanes in a pattern that abuts all pairs of lanes e g GATCGTAC aids reading closely spaced bands 6 Gels should be soaked in 5 acetic acid 15 methanol to remove the urea Soaking time depends on gel thickness Approximate minimum times are 5 minutes for 0 2mm gels 15 minutes for 0 4mm gels and 60 minutes for field gradient 0 4 1 2mm wedge or formamide gels Drying should be done at moderate temperature 80 C to preserve resolution 7 If RapidGel XL is used the gel does not need to be soaked In fact soaking RapidGel XL gels will cause swelling thereby affecting band resolution in the final result 8 For P gels autoradiography must be done with direct contact between the dried gel and the emulsion side of the film Gels dried without prior soaking leaving plastic wrap on helps to prevent the film from sticking to the incompletely dried gels will require longer drying and exposure times but give sufficient resolution for most purposes 9 Good autoradiography film can improve image contrast and resolution We recommend Kodak Biomax MR or Hyperfilm bmax autoradiography film 10 In general overnight to 36 hour exposures are sufficient when using fast film such as Hyperfilm MP 11 The use of tapered spacers wedge gels improves overall resolution and allows more nucleoti
18. aturation of the DNA This may improve results when using older P ddNTPs Avoid complete evaporation to dryness by prolonged heating SUPPLEMENTARY INFORMATION General guidelines Since the popular multiple cloning sites all derive from similar sequences one primer can serve for the sequencing of insert DNA in most of the common vectors Among the vectors compatible with the primer supplied in the Thermo Sequenase radiolabeled terminator cycle sequencing kit are M13mp8 M13mp9 M13mp12 M13mp13 M13mp18 M13mp19 mWB2348 mWB3295 MWB3225 pUC18 pUC19 and virtually any vector featuring blue white screening with B galactosidase activity Good sequences can be obtained using as little as 0 05ug of M13 DNA 0 1ug of plasmid DNA or 50fmol of PCR product Mix reagents by gently pumping the pipettor The total volume of the reaction mix should be 20ul the volumes of DNA and primer added will depend on their concentration Adjust the amount of distilled water so that the total volume of DNA primer and water is 16ul The specific cycling parameters used will depend on the primer sequence and the amount and purity of the template DNA See Supplementary Information cycle conditions and template quantity The dGTP Nucleotide Master Mix should be used if the sequence is already known to be free of compression artifacts and the benefits of uniform band intensities are desired The uniform band intensities can aid in finding heterozyg
19. by a DNA polymerase in vitro using a single stranded DNA template Synthesis is initiated at the site where a primer anneals to the template Elongation of the 3 end of the annealed primer is catalyzed by a DNA polymerase in the presence of 2 deoxynucleoside 5 triphosphates dNTPs and is terminated by the incorporation of a 2 3 dideoxynucleoside 5 triphosphate nucleotide analog ddNTP that will not support continued DNA elongation hence the name chain termination Four separate reactions each with a different ddNTP ddG ddA ddT or ddC give complete sequence information A radiolabeled dNTP 2 3 or primer is normally included in the synthesis so the labeled chains of various lengths can be visualized after separation by high resolution gel electrophoresis 4 5 In this kit a radioactive label is incorporated into the sequencing reaction products at the 3 end by the use of an a P ddNTP thus ensuring that only properly terminated DNA strands are labeled and are visible in the sequence This results in a cleaner more reliable and easier to read sequence with fewer background bands and virtually no BAFLs The accuracy and readability of the sequence obtained depends strongly on the properties of the polymerase used for chain termination Some polymerases such as Sequenase Version 2 0 DNA polymerase generate much more uniform readable bands than others like Klenow and Taq DNA polymerase 6 7 8 Thermostable polymerases su
20. ch as Tag polymerase can be used for multiple rounds cycles of DNA synthesis generating stronger signals Tabor and Richardson 9 have discovered that DNA polymerases can be modified to accept dideoxynucleotides as readily as the normal deoxynucleotide substrates Using this technology a new DNA polymerase for DNA sequencing was developed This enzyme called Thermo Sequenase DNA polymerase is thermostable and possesses many of the excellent DNA sequencing qualities of Sequenase DNA polymerase The properties of this DNA polymerase include activity at high temperature and absence of associated exonuclease activity Like Sequenase DNA polymerase derived from T7 bacteriophage it readily uses dideoxynucleoside triphosphates generating uniform band intensities in sequencing experiments with dGTP These properties make the enzyme ideal for generating high quality DNA sequences using cycle sequencing methods It is stable at 90 C for at least 1 hour and retains 50 of its activity when incubated at 95 C for 60 minutes The Thermo Sequenase polymerase in this kit combines the advantages of both Sequenase DNA polymerase and Taq DNA polymerase It produces bands with Mg that are nearly as uniform as those produced with Sequenase DNA polymerase with Mn 10 yet is thermostable like Taq DNA polymerase Cycle sequencing is the name given to the process of using repeated cycles of thermal denaturation primer annealing and polymerization to prod
21. cle or non cycle sequencing methods This polymerase produces very uniform band intensities with GTP so mixed sequences such as those of heterozygotes can be easily identified Thus the kit offers e Clean background free sequences e Complete elimination of compressions e Efficient use of labeled nucleotides less than 1uCi per sequence e Convenient single step protocol e Uniform band intensities for identification of mixed sequences e g heterozygotes e Sensitive cycle sequencing protocols for sequencing 20fmol or less of template e Overnight exposures with ordinary autoradiography film same day results possible with fast films e Exceptionally easy to read sequences e 3P for sharp autoradiogram resolution e Sample storage for 1 2 days prior to running on gel Chain termination sequencing This kit is designed to eliminate sequencing artifacts such as stops or BAFLs bands across four lanes and background bands BAFLs can result from the enzyme pausing at regions of secondary structures in GC rich templates producing prematurely aborted primer extension products of the same length in all four termination reactions Background bands can be caused by primer extensions aborting prematurely at random positions such as when a template is rich in a certain base and the complementary nucleotide in the reaction becomes depleted Traditional chain termination sequencing methods 1 involve the synthesis of a DNA strand
22. des to be read from a single loading 4 TROUBLESHOOTING Problem Possible causes and solutions Extensions appear short read length limited to less than 200 bases 1 If using dITP increase time of extension step in cycles to 5 10 minutes and decrease temperature to 60 C See figure 2 2 Too much template DNA In some cases the use of too much DNA especially PCR product DNA can exhaust the supply of ddNTPs Use less 20 than 1pmol of template DNA for each sequence 0 25pmol per reaction See figure 1 G C rich template producing strong secondary structure Try less DNA longer extension times more cycles more enzyme 5 DMSO or a 96 C denaturation temperature Film blank or very faint 1 9 m N 8 9 If using single sided film the emulsion side must be placed facing the dried gel DNA preparation may be bad Try the control DNA supplied in the kit Labeled dideoxynucleotide too old Try longer exposure Some component missing Enzyme lost activity Insufficient template DNA or insufficient number of cycles Try more DNA more cycles or longer film exposure Incorrect temperatures for primers used Try a lower temperature for cycling e g 50 95 C especially when using dITP Incorrect termination time or temperature for dITP Termination should be 5 10 minutes at 55 60 C Too little primer used The recommended amount of primer is 0 5 2 5pmol Primer bad Some primers form dimers hairpins etc
23. e general guidelines The gel should be loaded with 8 adjacent lanes GATCGTAC or see Supplementary Information denaturing gel electrophoresis section with a sharkstooth comb and be run 4 to 10 times longer than usual For this kind of experiment gradient or wedge gels or very long gels 80 100cm are almost a necessity The highest resolution gels appear to be approximately 6 8 acrylamide and are run relatively cool 40 C Denaturing gel electrophoresis Under optimal gel electrophoresis conditions 250 300 bases can be read from the bottom of a standard size sequencing gel The length of time the gel is run will determine the region of sequence that is readable Many factors can limit the sequence information which can be determined in a single experiment Among these are the quality of reagents used the polymerization the temperature of the gel during electrophoresis and proper drying of the gel after running The greatest care should be given to the pouring and running of sequencing gels The specifics of running the electrophoresis will depend on the apparatus used The following suggestions for reagent compositions and procedures are intended as guidelines For specific instructions contact the manufacturer of the gel apparatus used Gel electrophoresis reagents This kit contains a prediluted enzyme mixture which contains a high glycerol concentration requiring the use of a glycerol tolerant gel buffer The use of oth
24. er buffers such as TBE can result in severe distortion of sequencing bands in the upper third of the gel The following recipe is for typical sequencing gel reagents Buffers 20X Glycerol Tolerant Gel Buffer 71949 or 75827 Tris base 216g Taurine 729 Na EDTA 2H O 4g H O to 1000ml filter may be autoclaved This buffer can be used with samples containing glycerol at any concentration 20 If gels seem to run a bit slower with this buffer at 1X strength use it more 18 dilute approximately 0 8X strength Be certain to run glycerol tolerant gels at the same power wattage as TBE buffered gels so the gel temperature is normal 10X TBE Buffer 70454 Tris base 108g Boric acid 55g Na EDTA 2H O 9 3g H O to 1000m filter may be autoclaved This is the traditional sequencing gel buffer It should NOT be used with the polymerase supplied in this kit Glycerol Tolerant Gel Buffer should be used Gel recipes for 100ml of gel solution Standard gel Gel conc Acrylamide Urea 20X Gly Tol OR 10X TBE bis acrylamide 7 8 3M Gel Buffer Buffer H O 6 5 7g 0 3g 42 50g 5ml 45ml 8 7 6g9 0 4g 42 50g 5ml 45ml 6 5 7g 0 3g 42 50g 10m 40ml 8 7 6g9 0 4g 42 50g 10m 40ml Dissolve adjust volume to 100ml with H O filter and de gas When ready to pour add 1ml of 10 ammonium persulfate and 25ul TEMED N N N N tetramethylethylenediamine Use 4ml for faster gel migration Formamide gel for resolution
25. ersons who have been trained in laboratory techniques and that it is used in accordance with the principles of good laboratory practice Wear suitable protective clothing such as a lab coat safety glasses and gloves Care should be taken to avoid contact with skin or eyes In the case of contact with skin or eyes wash immediately with water see Material Safety Data Sheet for specific advice INTRODUCTION This sequencing kit combines two revolutionary innovations for sequencing DNA using radioactive labels First the label is incorporated into the DNA sequencing reaction products by the use of four a P dideoxynucleotide ddNTP terminators G A T C The labeled ddNTPs are more efficient for labeling sequencing experiments than other labeled nucleotides because they specifically label only the properly terminated DNA chains Also since prematurely terminated chains are not labeled stop artifacts and most background bands are eliminated As an additional benefit the absence of artifact bands allows the routine use of dITP which can eliminate even very strong compression artifacts The second innovation is the use of Thermo Sequenase DNA polymerase This enzyme has been engineered to efficiently incorporate dideoxynucleotides allowing the use of very low amounts of isotope a P JddNTP for the termination reactions Thermo Sequenase DNA polymerase is also thermostable and performs very well in convenient and sensitive cy
26. he dITP reaction mixture or a formamide gel Bands in 2 or 3 lanes 1 Heterogeneous template DNA 2 bands caused by spontaneous deletions arising during M13 phage growth Try control DNA and limit phage growth to less than 6 8 hours Insufficient mixing of reaction mixtures The sequence may be prone to compression artifacts in the gel Compressions occur when the DNA usually G C rich synthesized by the DNA polymerase does not remain fully denatured during electrophoresis Try using the dITP reaction mixture or a 30 40 formamide gel N If problems persist please contact USB Technical Support for assistance at 800 321 9322 or techsupport usbweb com in the United States For your authorized distributor and support staff outside the United States contact your local GE Healthcare office Contact information is listed in the back of this protocol booklet CONTROL DNA SEQUENCE The control DNA included in the kit is from pUC18 a double stranded circular DNA of 2 7kb A partial sequence of this DNA is given below 14 m G AACGCCAGGG 10 AGCTTGCATG 60 GAATTCGTAA 110 CACAATTCCA Universal cycle primer TTTTCCCAGT TTTTCCCAGT 20 CCTGCAGGTC 70 TCATGTCATA 120 CACAACATAC CACGACGTTG CACGACGTTG 30 GACTCTAGAG 80 GCTGTTTCCT 130 GAGCCGGAAG GIGTT 5 Reverse cycle primer 160 GTGCCTAATG 210 GCTTTCCAGT 260 ACGCGCGGGG 310 TCACTGACTC 360 CACTCAAAGG 22 170 AGTGAGCTAA 220 CGGGAAACCT 270 AGAGGCGGTT
27. istics of the sequencing primer the template and the length of the termination product desired The number of cycles required will depend on the quantity and quality of the template DNA used The following guidelines should assist in choosing cycling parameters Cycling temperatures The melting temperature of the primer should be kept in mind when choosing cycle temperatures The control primer included in the kit is moderately long 23 bases with 50 G C content The melting temperature of this primer is 73 C under sequencing reaction conditions and excellent results are achieved by cycling between 60 C and 95 C The duration of the steps does not seem to be critical and even brief pauses 1 10 seconds at these temperatures seem to be effective except with dITP as described above 12 As another example when using the universal 40 17 mer which has a melting temperature of about 50 C cycling between 45 C and 95 C is effective If in doubt choose a wide temperature range with pauses 15 30 seconds at the extremes of temperature The termination reaction cycles should always have a denaturation temperature of 95 98 C however avoid extended steps at 98 C since at this temperature the enzyme has a half life of less than one hour Since the optimum temperature for polymerization is about 70 75 C 72 C is a good choice for the termination step except when using dITP which requires a maximum temperature of 55 60 C An an
28. nealing step e g lt 60 C is required only with primers less than 24 bases Number of cycles and quantity of template The number of cycles required will primarily depend on the amount of template DNA in fmols used for sequencing It will also depend on the purity of the DNA and the sensitivity of autoradiographic detection The minimum quantities of highly purified DNA which we have been able to sequence using these methods are about 5fmol of M13mp18 DNA and about 15fmol of pUC18 DNA For routine sequencing we recommend 25fmol of M13 and 75fmol of plasmid DNA When sequencing very small amounts of template it has been observed that the number of cycles has a strong influence on sequence intensity Increasing the number of cycles from 30 to 60 will increase the signal significantly when using less than 50fmol of template DNA whereas increasing the number of cycles with more than 100fmol is of little benefit and may even produce background sequence So in general use more cycles when template amounts are limited Also a modest improvement can sometimes be achieved by increasing the amount of primer 2 5 fold It is undesirable to use too much template as the result will be a shortened sequence extension Figure 1 shows the result of increasing template quantities to an excess Designing a new sequencing primer The length of the primer and its sequence will determine the melting temperature and specificity For the cycling temperat
29. o essentially the last base of a PCR product Artifacts caused by appearance of double stranded PCR product on denaturing gels are similarly eliminated since they are not labeled Following is information which should assist in producing high quality reliable sequence information even with PCR product templates which have been very difficult to sequence with standard methods It is essential that PCR products are of high quality and quantity in order to obtain high quality sequence information Problems with high background low signal intensity and ambiguities can often be traced to the PCR step Not every PCR will yield a product which can be sequenced Analysis of the PCR product on agarose gels and optimization of the PCR may be necessary to obtain quality sequences Enzymatic pre treatment of PCR products The key step in this method for sequencing PCR products consists of treating the PCR product with a combination of Exonuclease and Shrimp Alkaline Phosphatase to eliminate any primer or dNTPs which were not incorporated into the PCR product These enzymes are available from USB in a reagent pack 70995 or pre mixed ExoSAP IT 78200 with detailed protocols for their usage It is recommended that this enzymatic clean up of the PCR product be used with this sequencing method Elimination of compressions Some DNA sequences especially those with dyad symmetries containing dG and dC residues are not fully denatured during electroph
30. oresis When this occurs the regular pattern of migration of DNA fragments is interrupted bands are spaced closer than normal compressed together or sometimes farther apart than normal and sequence information is lost The substitution of a nucleotide analog dITP for dGTP which forms weaker secondary structure has been successful in eliminating most of these gel artifacts 18 19 Two examples are shown in figure 2 in the sequences run with dGTP 15 dGTP dITP dGTP dITP 1 oy La L i i A ia we C t s oft oe 35 Figure 2 Compression artifacts can be eliminated using dITP in place of dGTP without interference by stops or other artifact bands Shown are two severely compressed regions of secondary structure see arrows The sequences run using dITP in place of dGTP are accurate and unambiguous A suitable nucleotide mixture containing dITP is included in the kit for use with templates prone to gel compression artifacts To use dITP simply substitute the dITP Nucleotide Mix for the dGTP Nucleotide Mix All other aspects of the sequencing protocol remain unchanged except that when using dITP reduce the termination temperature from 72 C to 60 C and increase the time to approximately 5 minutes or longer see figure 3 The use of dITP will result in less uniform band intensities but will completely resolve even the strongest compressions A 40 formamide gel will also eliminate almost all compressions
31. otes or in other cases where mixed sequence may be present If compressions are a problem when using dGTP gels containing formamide can be used as described in the Supplementary Information denaturing gel electrophoresis section of this booklet For running sequences where compressions are a problem the dITP Nucleotide Master Mix included in this kit can be substituted for the dGTP Nucleotide Master Mix See Supplementary Information elimination of compressions section for details Note When using dITP use an extension temperature of 60 C with a duration of at least 4 minutes Whenever possible tubes should be kept capped and on ice to minimize evaporation of the small volumes employed Additions should be made with disposable tip micropipettes and care should be taken not to contaminate stock solutions The solutions must be thoroughly mixed after each addition typically by pumping the solution two or three times with a micropipette avoiding the creation of air bubbles At any stage where the possibility exists for some solution to cling to the walls of the tubes the tubes should be centrifuged With care and experience these reactions can be set up in 15 20 minutes 11 Preparation of template DNA Since cycle sequencing can be performed using very little template DNA only very small amounts of detrimental impurities are likely to be carried along with the DNA Therefore though still important template puri
32. re kept on ice and the reaction mixture is added within a few minutes For determination of new sequences or of sequences with high G C content the dITP Nucleotide Master Mix is recommended This will eliminate all compression artifacts but will result in somewhat uneven band intensities especially in the G lane When perfectly uniform band intensities are desired such as when examining sequences from potentially heterozygous individuals the dGTP Nucleotide Master Mix should be used 2 Reaction mixture For multiple n reactions with different primers and or templates prepare a n 1 batch of reaction buffer water polymerase and aliquot then add the unique primer and or template in the appropriate concentration and volume to the aliquots Reaction Buffer 2ul DNA _ul 50 500ng or 25 250fmol Primer _ul 0 5 2 5pmol H O _ul To adjust total volume to 20ul Thermo Sequenase polymerase 4U ul 2ul 8 units polymerase add LAST Total 20ul For the control reaction use 10ul of control DNA and 1ul of control primer 3 10 Cycling termination reactions Transfer 4 5ul of reaction mixture prepared in step 2 to each termination tube G A T and C from step 1 Mix well and overlay with 10 20ul of mineral oil if needed Cap and place the tube in the thermal cycling instrument Note When sequencing single stranded DNA the primer may anneal to the template with reduced specificity while the tubes are
33. rmo Sequenase For radioactive cycle 100 78500 Cycle Sequencing Kit sequencing templates PCR Clean up Product Application Pack size Product number ExoSAP IT Removes primers and dNTPs 100 rctns 78200 from PCR products 500 rctns 78201 2000 rctns 78202 USB Ultrapure reagents for DNA sequencing Product Application Pack size Product number Agarose high efficiency 25g 10132 25g separation gt 1000bp 100g 10132 100g Agarose high efficiency 25g 10133 25g separation gt 500bp 100g 10133 100g Ammonium Persulfate Gel electrophoresis 1kg 76322 1kg 100g 76322 100g Antibiotic G418 Cloning 1g 11379 1g 100mg 11379 100mg Glycerol Tolerant Gel Gel electrophoresis 6 bottles 71949 Buffer pre mixed powder Glycerol Tolerant Gel Gel electrophoresis 1 liter 75827 1L Buffer 20X solution IPTG Cloning 1g 10078 1g 1g 10078 5g LB Broth Cloning 250g 75852 250g 1kg 75852 1kg LB Agar Cloning 250g 75851 250g 1kg 75851 1kg Mineral Oil Sequencing PCR 10ml 71600 10ml 25ml 71600 25ml RapidGel 6 Gel electrophoresis 500ml 75843 500ml RapidGel 8 Gel electrophoresis 500ml 75844 500ml RapidGel GTG 6 Gel electrophoresis 500ml 75846 500ml 24 Product Application Pack size Product number RapidGel GTG 8 Gel electrophoresis 500ml 75847 500ml RapidGel 40 Gel electrophoresis 500ml 75848 500ml RapidGel XL 6 Gel electrophoresis 500ml 75861 500ml RapidGel XL 8 Gel electrophoresis 500ml 75862 500ml RapidGel XL 40 Gel
34. t license fee either by payment to Perkin Elmer or as purchased i e an authorized thermal cycler BioMax is a trademark of Eastman Kodak Company Tween is a trademark of ICI Americas Inc Nonidet is a trademark of Shell ExoSAP IT is a trademark of USB Corporation USB and logo design are registered trademarks of USB Corporation USB Corporation 2000 All rights reserved Printed in the United States USB Corporation 26111 Miles Road Cleveland Ohio 44128 USA usbweb com 96 9750A 00 11
35. ty may not be as crucial for cycle sequencing as it is for non cycle sequencing Preparation of single stranded template DNA Single stranded template DNA of good purity is essential for excellent sequencing results Several popular plasmid cloning vectors contain the same lac derived cloning region as the M13mp vectors and a single stranded phage replication origin Production of single stranded DNA from these vectors is similar to that of the M13 phage and the single stranded DNA produced can also be used as template for sequencing Preparation of double stranded plasmid DNA Sequencing double stranded templates with the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing Kit works effectively with no changes in the reaction protocol Alkaline denaturation is not required for plasmid DNA templates For best results purified plasmid DNA should be used CsCl gradients PEG precipitation adsorption to glass columns and other common DNA purification methods all produce suitable DNA However since such small quantities of DNA are added to the reactions even impure DNA samples can sometimes yield acceptable sequence data There are many popular protocols for purifying plasmid DNA from 2 10ml cultures We have had consistent success with boiling 21 and alkaline 22 mini prep methods Cycle conditions and template quantity The temperatures used for cycling the termination reactions should be determined from the character
36. u l e s ou SeyewW AUBdWOD aU aqe q 0 p A j q uonewoju uodn pase si 4994S gep SIU uollpuuijoju ajqeodde oN uollpuuijoju qe9 dde oN suoleinBau ej p le s eSo ajqeoijdde y m 52uepiuo52e ul jenayew Jo sodsiq l qe ieAe UO yEWJOJU ON s ueiqui ui snoonui pue s UMS 0 UOTE asneo Aew V LG3 pue sul s nnuenb abe u p s Buli J Injuueu aq Aew sauesquiaw snoonui pue ulys s o uo sne5 AEN OH SIH L ulys y uBnouu peqsosqe oq Aew sulajoid sainyeuap pue 1A 0 aBewep asned Aew saipnys jewue ul sjoajap yuq pue AyolxojoAuquia pasned sep aplwewsoy 9002 18 101S s O 9 MEU 9Z991 PIOAY q els sI JONPOd slu Be u JO suolnios pue speja ayesedas Buluieluoo Wy Hulouanbes Boloiq enoa OPILUEWJOJ 0 nsodx pue 9e UON zlullului pinoys abe Buue q pIIU9 JO U WOM JO UBWWOM JUeUBAasY uolpuuoju B6e1ols pue Huljpuey se saweg Do0G Ye 9101S s Ao B pue sassejb Ajayes yeoo qe Hulpnjou Hulyjojo AI1199101d ajqeyins 169M s sp 1 eWS ue o o s A0 B pue sasse b 1 les eoo qe Buipniou Bulujojo An98101d qel1ins 169M weoj 10 JapMod Alp pixolp uoqued asp luo Saul ews 104 QOIAPe JedIPIW YES payeyu JO p s Bul J JO JUSPIAS SI UOHEYU J YaTEM YIM S JO UlYS WO usnij ainsodxe w014 aAowaY JUL VLG pue sul OH SI L uaboyeso apiweWws04 SOH Jue S 1 g Aoba uononposda 0 91x0
37. uce greater amounts of product in a DNA sequencing reaction This amplification process employs a single primer so the amount of product DNA increases linearly with the number of cycles This distinguishes it from PCR which uses 2 primers so that the amount of product can increase exponentially with the number of cycles The earliest examples of cycle sequencing used P labeled primers and a non thermostable polymerase which was added after each denaturation cycle 11 12 Later improvements included the use of thermostable Taq polymerase 13 14 and the use of alpha labeled dNTPs in place of the labeled primer using mixtures of nucleotides similar to those used originally by Sanger 15 16 The labeled primer methods make efficient use of P giving a sequence with as little as 4uCi of y P ATP 14 The methods using internally labeled products were less efficient requiring either 10uCi of a P dATP or 20uCi of a SS dATP for a sequence This is a consequence of the relatively low specific radioactivity and the small number of labeled bases in short product molecules This kit makes very efficient use of a 7P ddNTP requiring less than 1uCi of 3P per sequence Cycle sequencing is necessary with this kit when using less than 0 2 0 5pmol of template DNA Non cycle or very few cycle protocols may be used with more than 0 5pmol of template See license information on back cover MATERIALS NOT SUPPLIED Necessary reagents Water
38. ures normally used the primer should be about 18 25 nucleotides long It is also a good idea to check the sequence of the primer for possible self annealing dimer formation could result and for potential hairpin formation especially those involving the 3 end of the primer Finally check for possible sites of false priming in the vector or other known sequence if possible again stressing matches which include the 3 end of the primer 13 0 5pmol 1pmol 2pmol 8pmol 300 bases 150 bases Figure 1 Excess template DNA can reduce sequence extension lengths In cases where 2pmol or more template DNA are sequenced the supply of nucleotides can be exhausted before extensions reach suitable length for optimal sequencing These sequences were run using up to 16g 8pmol of M13mp18 DNA template 14 Sequencing PCR Products The products of Polymerase Chain Reaction PCR can have structures which make them difficult to sequence One of the most common problems associated with sequencing of PCR products is the presence of stops or BAFLs where the sequence pauses or stops at artifactual ends in the template actually the ends of truncated PCR product This kit incorporates label by way of a radiolabeled dideoxy terminator so that only the fragments which were properly terminated are visible in the sequence No labeled bands are formed at ends in the template eliminating many of these artifacts and enabling sequences to extend t
Download Pdf Manuals
Related Search