Home

User Manual pBC1 Milk Expression Vector Kit

1. essent entente enne enne enen enne 29 Colony Hybridization 5e ioa LR hU teet ai tenuti e ate e en pa eret net 30 Isolati n of Genomic DNA 28 teh ca coe ete n te iste tee ite ede D eu eret 31 Sample Recombinant Protein Purification Strategy eese eene enne trennen enne nnen ne 32 Technical SetviCe rn eR pepe dette ebbe OR een toic irent ped 33 Purchaser Notifications ss 3 ero obe te nO UA rA b DOE d epe RR EDU oap 34 Product Qualifications s 5 eod en comma ERA 35 References seen UU RV UN I WR iho 36 Important Information Shipping Storage Kit Contents Easy DNA Kit Additional Reagents lv Shipping The pBC1 Milk Expression Vector Kit is shipped at room temperature Storage Upon receipt e Store the pBCI vector at 20 C e Store the Easy DNA Kit at room temperature For long term storage gt 6 months remove the mussel glycogen RNase and Protein Degrader and store at 20 C The pBC1 Milk Expression Vector Kit contains the following reagents pBCI Vector 20 ug lyophilized in TE Vector that expresses your pH 8 0 gene of interest in the milk of transgenic mice Easy DNA Kit see below 150 reactions Preparation of genomic for details DNA from mouse tails The Easy DNA Kit included with the pBC1 Milk Expression Vector Kit contains the reagents listed below Sufficient reagents are provided to isolate genomic DNA from 150 mouse tails Store the Easy DNA Kit at room temperature
2. Goat B casein gene 3 7 kb genomic Structural sequences that enhance fragment includes exon 1 parts of exons 2 expression of your recombinant protein in and 7 exon 8 and exon 9 mammary epithelial cells Roberts ef al 1992 Young et al 1997 Xho I cloning site Allows insertion of your gene between exons 2 and 7 of the goat f casein gene 3 untranslated region UTR of goat Permits translation termination and B casein gene polyadenylation of mRNA Roberts et al 1992 pHC79 cosmid vector sequences Contains prokaryotic sequences that allow selection and propagation of the pBC1 vector in coli and includes cosmid packaging sites to allow packaging of constructs in lambda phage Hohn and Collins 1980 bla promoter Allows expression of the ampicillin bla resistance gene in E coli Ampicillin bla resistance gene Selection of transformants in E coli pBR322 derived origin Maintenance and low copy replication in E coli 11 Transformation and Screening Introduction E coli Transformation Note Screening Transformants PCR Primers 12 Once you have ligated your gene of interest into pBC1 follow the guidelines below to transform and screen your clones For detailed protocols please refer to Current Protocols in Molecular Biology Ausubel et al 1994 and Molecular Cloning A Laboratory Manual Sambrook et al 1989 Prepare competent recA endA E coli cells e g TOP10 using your method of
3. Kit contains enough reagents to isolate DNA from 150 samples Approximately 125 ug of genomic DNA can generally be isolated from 1 cm of mouse tail The Easy DNA Kit is also available separately from Invitrogen see page iv for ordering information continued on next page Identification of Transgenic Mice continued Using the Easy Use the following protocol to isolate DNA from mouse tails using the Easy DNA Kit DNA Kit to The procedure will take 2 days Isolate DNA from Day1 Mouse Tails Before starting equilibrate a shaking water bath to 60 C Thaw the Protein Degrader if stored at 20 C and keep on ice If the solution is cloudy warm at 37 C for 5 minutes until clear If tail samples are frozen warm at 37 C until thawed 1 Into a sterile 50 ml capped centrifuge tube mix the components in the volume listed below Multiply each component by the number of samples i e 100 TE 320 ul Solution A 20 pl Solution B 10 ul Protein Degrader 5 mg ml 5 ul Aliquot 355 ul of the mixture above into each mouse tail sample fresh or frozen and shake the microcentrifuge tubes at 60 C overnight 12 20 hours Be sure to cap the tube tightly Note After overnight incubation the mouse tail should be completely digested with only hair visible in the solution The solution will be cloudy and may be slightly colored depending on the color of the mouse tail Day 2 Before starting equilibrate a 37 C heat block or water bath Tha
4. Plainview New York Cold Spring Harbor Laboratory Press Strouboulis J Dillon N and Grosveld F 1992 Developmental Regulation of a Complete 70 kb Human Beta globin Locus in Transgenic Mice Genes Dev 6 1857 1864 Talbot D Collis P Antoniou M Vida M Grosveld F and Greaves D R 1989 A Dominant Control Region from the Human globin Locus Conferring Integration Site Independent Gene Expression Nature 338 352 355 Townes T M Lingrel J B Brinster R L and Palmiter R D 1985 Erythroid Specific Expression of Human Beta globin Genes in Transgenic Mice EMBO J 4 1715 1723 Young M W Okita W B Brown E M and Curling J M 1997 Production of Biopharmaceutical Proteins in the Milk of Transgenic Dairy Animals BioPharm 0 34 38 Ziomek C A 1998 Commercialization of Proteins Produced in the Mammary Gland Theriogenology 49 139 144 1999 2006 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 36 Notes 37 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
5. 5 mM Tris pH 7 4 0 1 mM EDTA or preferred recipe e 0 22 um Millex GV filter Millipore Catalog no SLGV R25 LS Protocol 1 Dilute your concentrated stock of purified DNA to a final concentration of 200 400 molecules picoliter with Microinjection Buffer 2 4 ug ml for a 10 kb DNA fragment 2 Filter the diluted DNA solution through a 0 2 um filter 3 Store at 4 C until needed for microinjection Generation of Transgenic Mice Introduction Time Line CD 1 Mouse Strain Important Care of Mice Once you have prepared your DNA for microinjection you are ready to generate transgenic mice containing your construct of interest As mentioned previously we recommend that you collaborate with an experienced transgenic facility either core or commercial to generate your transgenic mice General information about selection of a host strain and animal husbandry are provided below For more detailed information consult your transgenic facility Please consult your transgenic facility to determine a suitable schedule for injection and generation of the first litter s of transgenic mice In general allow at least 6 7 weeks from the time of injection before obtaining the first set of mice to screen We recommend using the CD 1 mouse as the host strain to generate transgenic mice The CD 1 mouse strain is an outbred strain derived from a non inbred stock of Swiss mice The mice have an albino coat color and are recommended fo
6. Milking Apparatus We recommend using a human breast pump to harvest milk from the transgenic mice We typically use the Medela Classic Electric Breastpump Catalog no 01501 For more information please contact Medela directly at Tel 1 800 435 8316 U S and Canada Tel 41 41 769 51 41 Europe Web site www medela com To assemble the milking apparatus follow the instructions listed below A diagram of the milking apparatus is provided below for your convenience 1 Attach the Tygon tubing to the breast pump 2 Connect the tubing from the pump to the hub of an 18 gauge needle inserted diagonally through the rubber stopper see A below 3 Place tissues into the bottom of the 15 ml conical centrifuge tube such that the bottom of the tube is cushioned 4 Remove the cap from the 1 5 ml microcentrifuge tube and insert the microcentrifuge tube into the 15 ml conical centrifuge tube such that it stands vertically and stably within the 15 ml tube see B below 5 Insert a second 18 gauge needle vertically through the rubber stopper The tip of the needle should lie within the microcentrifuge tube when the rubber stopper is placed on the 15 ml conical tube see C below Note The needle should be turned and positioned so that the beveled portion of the needle faces towards the center of the microcentrifuge tube see D below 6 Place the rubber stopper in the 15 ml conical centrifuge tube and check to see that suction i
7. or CsCl gradient centrifugation The S N A P MidiPrep Kit is a medium scale plasmid preparation kit that allows isolation of 10 200 ug of plasmid DNA from 10 100 ml see Note below of bacterial culture Plasmid DNA purified using the S N A P MidiPrep Kit can be used directly to prepare DNA for microinjection Note Since pBC1 is a low copy number plasmid you will need to increase the amount of bacterial culture that you use for plasmid purification We recommend that you increase the volume of your bacterial culture 3 to 5 fold to obtain enough purified plasmid for further manipulations Preparation of DNA for Microinjection Introduction Linear DNA vs Circular DNA V N MEN 7 Y NB DNA Concentration Purity of the DNA for Microinjection Once you have cloned your gene of interest into pBC1 and have prepared clean plasmid preparations of your construct you are ready to prepare DNA for microinjection into fertilized eggs A number of factors can affect the efficiency of gene transfer including e Using linear or circular DNA e DNA concentration e Purity of the DNA e Composition of the microinjection buffer Before preparing DNA for microinjection we recommend that you read through this section and discuss DNA preparation with your transgenic facility Transgenic mice have been obtained by microinjection of either linear DNA or supercoiled DNA into fertilized eggs However microinjection of linear DNA appears
8. 10 cells per gram of tissue with a milk output of approximately 10 grams per cell per day Milk is a well characterized colloidal mixture of fats and proteins and is composed of the major proteins listed below Further information about milk proteins may be found in published reviews Maga and Murray 1995 Young et al 1997 Milk Protein Percentage of Total Protein Casein as asa B9 80 Enzymes plasma proteins Albumin 1 Recombinant proteins that are produced in transgenic animals are designed to be secreted into the milk along with these other milk proteins and components Large scale purification of the recombinant protein of interest from milk typically involves clarification as the first step to remove fats In the case of feasibility studies in mice the milk is simply diluted and loaded onto an SDS polyacrylamide gel for detection of the recombinant protein of interest by Coomassie blue staining or by Western blot continued on next page Overview continued Posttranslational Modification of Recombinant Proteins in Transgenic Animals Experimental Outline Transgenic animals are capable of producing complex human recombinant proteins that are glycosylated and phosphorylated Denman er al 1991 Specific glycosylation enzymes vary somewhat by species therefore transgenically produced protein may vary from purified human derived protein Within a single transgenic line however post translational modifi
9. 4 Using blunt ended forceps peel the Plaque Screen filter from the plate and place in the glass tray prepared with 1096 SDS Be sure to place the filter colony side up Incubate the filter in SDS for 3 minutes 5 Transfer the filter sequentially to the second tray for 5 minutes Transfer the filter to the third tray for 5 minutes Finally transfer the filter to the fourth tray for 5 minutes Make sure that the filters are always placed in each tray colony side up 6 Lay the filters labeled side up on a sheet of 3MM paper Allow them to dry fully at room temperature 7 Sandwich the filters between sheets of dry 3MM paper and fix by baking for 1 hour in an 80 C vacuum oven 8 The filters are now ready for hybridization with a labeled probe You may use a labeled oligonucleotide or a nick translated DNA fragment from your insert as a probe to detect those transformants containing your insert of interest For more information about labeling your oligonucleotide or DNA fragment please refer to Current Protocols in Molecular Biology Ausubel et al 1994 Isolation of Genomic DNA Introduction Isolating High Molecular Weight DNA from Mouse Tails A protocol for isolation of genomic DNA from mouse tails is provided below for your convenience Other protocols are suitable For more information and other protocols please refer to Hogan et al 1994 Please note that the Easy DNA Kit is supplied with the pBC1 Milk Expression System
10. Mice Nature 3 4 377 380 Choi T Huang M Gorman C and Jaenisch R 1991 A Generic Intron Increases Gene Expression in Transgenic Mice Mol Cell Biol 77 3070 3074 Chung J H Bell A C and Felsenfeld G 1997 Characterization of the Chicken globin Insulator Proc Natl Acad Sci USA 94 575 580 Chung J H Whiteley M and Felsenfeld G 1993 A 5 Element of the Chicken f Globin Domain Serves as an Insulator in Human Erythroid Cells and Protects against Position Effect in Drosophila Cell 74 505 514 Coligan J E Dunn B M Ploegh H L Speicher D W and Wingfield P T 1995 Current Protocols in Protein Science New York John Wiley Denman J Hayes M O Day C Edmunds T Bartlett C Hirani S Ebert K M Gordon K and McPherson J M 1991 Transgenic Expression of a Variant of Human Tissue type Plasminogen Activator in Goat Milk Purification and Characterization of the Recombinant Enzyme BioTechnology 9 839 843 Deutscher M P 1990 Guide to Protein Purification In Methods in Enzymology Vol 182 J N Abelson and M I Simon eds Academic Press San Diego CA Ebert K M DiTullio P Barry C A Schindler J E Ayres S L Smith T E Pellerin L J Meade H M Denman J and Roberts B 1994 Induction of Human Tissue Plasminogen Activator in the Mammary Gland of Transgenic Goats BioTechnology 2 699 702 Edmunds d Patten S M V
11. chemically competent cells 21x 50 ul C4040 03 continued on next page General Cloning Information continued E coli You may use any method of choice for transformation Electroporation is the most efficient and the method of choice for large plasmids such as pBC1 Chemical Transformation P transformation is the most convenient for many researchers and is also suitable Maintenance of To propagate and maintain the pBC1 vector resuspend the vector in 20 ul sterile water to pBC1 Vector prepare a 1 ug ul stock solution Store the stock solution at 20 C Use this stock solution to transform a recA endA E coli strain like TOP10 DH5a or equivalent Select transformants on LB agar plates containing 50 to 100 pg ml ampicillin Be sure to prepare a glycerol stock of each strain containing plasmid for long term storage To prepare a glycerol stock 1 Streak the original colony out on an LB agar plate containing 50 ug ml ampicillin Incubate the plate at 37 C overnight 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 pg ml ampicillin 3 Grow the culture to mid log phase OD 09 0 5 0 7 Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Designing Transgenes Introduction Size of the DNA Construct Structure of the Gene of Interest Inclusion of Introns Note This section contains guidelines for designing your transgene construct T
12. choice For efficient transformation of pBC1 we recommend using electroporation to transform your ligation mixtures Transform your ligation mixtures and select on LB agar plates containing 50 to 100 ug ml ampicillin For fast and easy microwaveable preparation of Low Salt LB plates containing ampicillin imMedia Amp Agar Catalog no Q601 20 is available from Invitrogen Please call Technical Service see page 33 for more information If the efficiency of your E coli transformation is low you may want to use lambda phage cosmid technology to package your pBC1 construct as a cosmid For more details and protocols please refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 Using a large vector such as pBC1 for cloning requires the screening of large numbers of E coli transformants for the presence of the insert of interest We recommend large scale screening of at least 100 200 transformants by colony PCR Alternatively performing filter lifts and colony hybridization are also an effective means of screening large numbers of transformants A sample protocol for screening transformants by colony PCR is provided on the next page for your convenience A sample protocol for colony hybridization is provided in the Appendix page 30 To screen coli transformants by colony PCR you will need to design PCR primers that will allow you to amplify your insert of interest as well as determine the orientation of your insert in the
13. construct We recommend that you use the secretion signal for the goat B casein gene Persuy et al 1995 Roberts et al 1992 to allow secretion of your protein into the milk The peptide sequence of the B casein secretion signal is provided below MKVLILACLVALAIA continued on next page Cloning into pBC1 continued Translation Termination and Polyadenylation Sequences Cloning Site Note Your insert must contain a stop codon to allow termination of translation The pBC1 vector contains a large 7 1 kb genomic fragment from the goat B casein gene following the Xho I cloning site see below This 3 genomic fragment contains B casein exons and introns as well as the polyadenylation sequences necessary for efficient termination of transcription and polyadenylation of mRNA If the insert for your gene of interest contains the polyadenylation signal or other regulatory sequences you may replace the B casein polyadenylation signal with the polyadenylation signal for your gene We recommend that your insert also include 3 genomic sequences i e exons and introns in addition to the polyadenylation signal To remove the 7 1 kb 3 B casein fragment from pBCI1 1 Digest the pBC1 vector with Xho I and Not I restriction enzymes 2 Separate the 3 B casein fragment from the pBC1 vector by agarose gel electrophoresis and isolate the DNA fragment containing the remainder of the pBC1 vector 3 Clone your gene of interest containing
14. for easy isolation of genomic DNA from mouse tails see page 22 for a protocol and page iv for ordering information Materials 1 cm of mouse tail 1 5 ml microcentrifuge tubes 50 mM Tris pH 8 0 100 mM EDTA 0 596 SDS Proteinase K 10 mg ml in water Phenol equilibrated with Tris HCl pH 8 0 Phenol Chloroform 1 1 v v 3 M Sodium acetate pH 6 0 70 and 100 ethanol at room temperature 1X TE buffer 10 mM Tris pH 8 0 1 mM EDTA 1 Place the mouse tail sample in a microcentrifuge tube and add 0 5 ml of 50 mM Tris pH 8 0 100 mM EDTA 0 596 SDS Add 25 ul of a 10 mg ml stock of Proteinase K Incubate overnight at 55 C in a shaking water bath 2 Add 0 5 ml of equilibrated phenol to the digested tail and shake vigorously for 3 minutes Note Do not vortex Vortexing will shear the genomic DNA 3 Centrifuge the tube for 3 minutes at top speed to separate the organic and aqueous phases Transfer the aqueous top phase to a fresh tube 4 Re extract the aqueous phase with 0 5 ml of phenol choloroform Shake vigorously for 3 minutes and centrifuge at top speed for 3 minutes 5 Remove aqueous top phase to a fresh tube 6 Precipitate DNA by adding 50 ul of 3 M sodium acetate pH 6 0 and 0 5 ml of 10046 ethanol to the tube Invert the tube gently to mix DNA should immediately be visible as a stringy precipitate Please note that using sodium acetate with lower pH will cause EDTA to precipitate 7 To pellet the DNA cen
15. pBC1 vector Optimally the primers may also be used to sequence your insert after you have identified transformants We have successfully used the following primers to screen and sequence E coli transformants Location n 5 GATTGACAAGTAATACGCTGTTTCCTC 3 8554 8580 5 CATCAGAAGTTAAACAGCACAGTTAG 3 8653 8678 continued on next page Transformation and Screening continued Colony PCR A sample protocol for performing colony PCR is provided below Other protocols are suitable Please refer to Current Protocols in Molecular Biology Ausubel et al 1994 for additional information 1 Pick 100 200 colonies For each colony streak a small patch on a fresh LB agar plate containing 50 ug ml ampicillin Incubate the plate overnight at 37 C Prepare a PCR cocktail consisting of the components listed below Use a 20 ul volume for each sample Multiply by the number of colonies to be analyzed e g 100 200 Aliquot 20 ul of the PCR cocktail into each microcentrifuge tube 10X PCR Buffer 2 wl 50 mM dNTPs 0 5 ul Control PCR Primers 0 1 ug ul 1 pl Sterile Water 15 5 ul Tag Polymerase 1 unit ul lul Total Volume 20 ul Remove a small amount of each E coli transformant from the LB plate with a toothpick and resuspend the E coli in the microcentrifuge tube containing the 20 ul of PCR cocktail Remember to label your tubes Incubate the reaction for 10 minutes at 94 C to lyse the cells and inactivate nucleases Amplify
16. recombinant protein the codon usage should be maximized for mammals e g human mouse goat If you are planning to express your protein of interest from a human cDNA or genomic fragment minimal optimization for codon usage is necessary as codon preferences are generally similar within most mammalian species If you are expressing a protein of interest from a prokaryotic or yeast gene we recommend that you translate the mRNA sequence of your gene to determine the codon usage If your gene of interest contains codons that are not preferred for mammals you may want to perform mutagenesis to optimize the codon usage for mammals For more information about codon usage please refer to the Codon Usage Database on the World Wide Web at www dna affrc go jp nakamura CUTG html Transgenic expression vectors generally contain prokaryotic sequences that allow selection and propagation of the vector in bacterial strains or in cosmids The presence of prokaryotic sequences does not appear to affect the frequency of integration of the micro injected transgene but can severely inhibit the expression of the transgene in the animal Chada et al 1985 Krumlauf et al 1985 Townes et al 1985 To circumvent this problem most protocols for generating transgenic mice recommend the removal of prokaryotic sequences from the construct prior to introduction of the transgene construct into mice The pBC1 vector contains prokaryotic sequences from nucleotides
17. the polyadenylation signal into pBC1 The pBC1 vector contains a unique Xho I restriction site to allow cloning of your gene of interest downstream of the goat B casein promoter Heterologous exons and introns from the D casein gene have been included such that your insert will be flanked by portions of exon 2 and 7 of the B casein gene see vector map on the next page If you plan to PCR amplify your insert you must design your primers such that the amplified fragment will contain ends compatible with Xho I We recommend that you sequence PCR products prior to generation of transgenic animals in order to avoid sequence errors Please note that your recombinant protein will not include any amino acids from the B casein exons if you include an ATG start codon and a stop codon within your insert continued on next page Cloning into pBC1 continued Map of pBC1 The figure below summarizes the features of the pBC1 vector Please note that although Vector 10 all B casein exons are transcribed they will be untranslated if you clone your insert into the Xho I site and include an ATG start codon and a stop codon within your insert The complete sequence for pBC1 is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 33 For more information about the goat B casein genomic sequences please refer to Roberts et al 1992 IVS1 IVS7 IVS8 Xho Comments for pBC1 21628 nucleoti
18. 15761 21628 see vector map on page 10 that may be removed from the transgene construct by restriction digestion of the vector with the Not I and Sal I enzymes and separation of DNA fragments by agarose gel electrophoresis Other restriction sites are available When designing your transgene construct you should take into consideration the structural features of the transgene that will allow you to distinguish your gene of interest from a possible wild type mouse homolog When screening mice to identify transgenic founders you will need to have a probe that can distinguish between the transgene and the native mouse gene Generally transgenes will integrate into the genome in head to tail arrays Typically mice are initially screened for the presence of the transgene by PCR Putative transgenic mice are then analyzed for transgene integration and copy number by restriction digestion and Southern blot analysis Optimally you should design a probe that will allow you to identify transgenic mice as well as estimate the number of copies of the transgene that have integrated into the genome A variety of recombinant proteins have been successfully expressed in transgenic milk systems including human serum albumin antithrombin IIL and human long acting tissue plasminogen activator Denman et al 1991 Edmunds et al 1998 Young et al 1997 While many types of proteins can be expressed in the pBC1 Milk Expression System proteins that are normally
19. 639 1648 Maga E A and Murray J D 1995 Mammary Gland Expression of Transgenes and the Potential for Altering the Properties of Milk Biotechnology 13 1452 1457 Meade H M Echelard Y Ziomek C A Young M W Harvey M Cole E S Groet S Smith T E and Curling J M 1999 Expression of Recombinant Proteins in the Milk of Transgenic Animals In Gene Expression Systems Using Nature for the Art of Expression J M Fernandez and J P Hoeffler eds San Diego CA Academic Press pp 399 427 Palmiter R D Sandgren E P Avarbock M R Allen D D and Brinster R L 1991 Heterologous Introns Can Enhance Expression of Transgenes in Mice Proc Natl Acad Sci USA 88 478 482 Persuy M A Legrain S Printz C Stinnakre M G Lepourry L Brignon G and Mercier J C 1995 High level Stage and Mammary tissue specific Expression of a Caprine k casein encoding Minigene Driven by a B casein Promoter in Transgenic Mice Gene 65 291 296 Persuy M A Stinnakre M G Printz C Mahe M F and Mercier J C 1992 High Expression of the Caprine B casein Gene in Transgenic Mice Eur J Biochem 205 887 893 Roberts B DiTullio P Vitale J Hehir K and Gordon K 1992 Cloning of the Goat B casein encoding Gene and Expression in Transgenic Mice Gene 121 255 262 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition
20. Colony Hybridization Introduction Colony Hybridization Protocol Probes to Use for Hybridization 30 A protocol for using colony hybridization to screen for E coli transformants containing your insert of interest is provided below Other protocols are suitable For additional details please refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 Remember to include a plate containing pBC1 vector alone as a negative control for hybridization A diluted sample of insert alone may be spotted onto a filter to serve as a positive control Replica plating Colonies to Filter 1 With a soft lead pencil label dry filters to be used DuPont Plaque Screen Filters Catalog no NEF978A Wet filter with water and sandwich between dry Whatman 3MM paper Wrap the stack of filters in aluminum foil and autoclave to sterilize 2 Plate the transformation on LB agar plates containing 50 ug ml ampicillin Lay a Plaque Screen filter on top of the agar and incubate the LB plate overnight at 37 C 3 Prepare 4 glass trays for cell lysis and binding Cut 4 pieces of Whatman 3MM paper to the size and shape of a glass tray Place each piece of Whatman paper in a separate glass tray and saturate each tray with one of the following solutions listed below Pour off excess liquid 10 SDS Reduce background 2 0 5 N NaOH Denaturing solution 1 5 M NaCI 3 1 5 M NaCl Neutralizing solution wma ea 4 0 3 M NaCl Wash solution EN NUN
21. DNA using the following general cycling parameters or parameters of your choice Please note that cycling parameters may vary depending on the size of your insert Visualize PCR products by agarose gel electrophoresis Note Bufferless precast agarose E Gels Catalog no G5000 01 are available from Invitrogen for fast and easy electrophoresis Please see our Web site www invitrogen com or call Technical Service see page 33 for more information continued on next page 13 Transformation and Screening continued N geno RECO Nos Plasmid Preparation 14 Once you have identified transformants containing pBC1 plasmid with inserts we recommend that you sequence your construct to confirm that your gene of interest is cloned in the proper orientation in pBC1 and that it includes a secretion signal an ATG initiation codon and a stop codon For sequencing you may use the primers that were used to screen your E coli transformants or any other appropriate primers For subcloning and analysis of transformants to identify those containing plasmids with inserts in the correct orientation mini prep quality plasmid DNA is sufficient for success For sequencing and preparative purposes plasmid DNA of high purity is required Plasmid DNA for sequencing and preparative purposes must be very clean and free from phenol and sodium chloride We recommend isolating plasmid DNA using the S N A P MidiPrep Kit Catalog no K1910 01
22. For long term storage gt 6 months remove the mussel glycogen RNase and Protein Degrader and store at 20 C Solution A Lysis Solution Proprietary 55 ml 10 mM Tris Cl pH 7 5 100 ml 1 mM EDTA pH 8 0 2 mg ml in sterile water 750 ul Protein Degrader 5 mg ml in sterile water 750 ul Concentration Amount Supplied Additional Easy DNA Kits are available separately from Invitrogen Ordering information is provided below Easy DNA Kit 150 reactions if isolating genomic DNA from K1800 01 mouse tails Overview Introduction SN geo O O E Non Important Advantages of Recombinant Protein Production in Transgenic Milk Introduction The pBC1 vector is a 21 6 kb vector designed to facilitate expression of recombinant proteins in the milk of transgenic animals The pBC1 Milk Expression Vector Kit is intended for use in performing feasibility studies in mice with the expectation that the user is interested in eventual large scale recombinant protein production using larger animals Successful expression of recombinant protein in transgenic mice has generally been indicative of successful expression in larger animals such as goats or cows Young et al 1997 For feasibility studies transgenic mice provide the added advantage of shorter generation times and faster evaluation than larger herd animals The pBC1 Milk Expression Vector Kit is specifically designed to e Provide instructions for
23. Invitrogen pBC1 Milk Expression Vector Kit For the Expression of Recombinant Proteins in the Milk of Transgenic Mice Catalog no K270 01 Version E 08 September 2010 25 0264 ii Table of Contents Table of Contents udine nio sera HE En POE e e E EE E er p e EO poe eo eta iii Pipot n OAOD aer ass T pa rae RR P A D ere Pa D E rM Ri EIS iv IntroducliON c M 1 OVELVIEW 2 i eio Rn ehe tee eta e e eo deno ates De fecto Re itr even etd ortus 1 Lie Lm M 4 Greneral Cloring InforimatiOn iiiter ae RE e ER EID Gere 4 Designing Transgenes zi iue te eue endi ane 6 Cloning into PBC I itd aee Ri ei IRRE SS IRRE 8 Transformation and Screening 222222402022sensesneesennnenenennensensonnonnnenennennonsesnonsensnennnennensesnonnersersnnesnenenononn 12 Preparation of DNA for Microinjection uesersesseesersesensesnersernensennnenenesnenennnnnesnenesnonsennnennnesnennnenennnonon 15 Generation of Transgenic Mice sci eoa ato Io oe te ctl AR Aish eode eo pa tele sen 19 Identitication of Trams genic Mice one ebbe Rr mieten b desi re dedi ice eee sR kis 20 Harvesting Milk utet reto rie aa nein dedere e o e Ree ARE RE ERR Ere UO ERR eR NUR 24 Purification of Proteins from Milk niin a POCO ERU PERDE rre ip 27 ADDONGIX 29 Proteins Expressed in Transgenic Animal Milk
24. Pollock J Hanson E Bernasconi R Higgins E Manavalan P Ziomek C Meade H McPherson J M and Cole E S 1998 Transgenically Produced Human Antithrombin Structural and Functional Comparison to Human Plasma Derived Antithrombin Blood 91 4561 4571 Hansson L Edlund M Edlund A Johansson T Marklund S L Fromm S Str mqvist M and T rnell J 1994 Expression and Characterization of Biologically Active Human Extracellular Superoxide Dismutase in Milk of Transgenic Mice J Biol Chem 269 5358 5363 Hogan B Beddington R Constantini F and Lacy E 1994 Manipulating the Mouse Embryo Second Edition Cold Spring Harbor NY Cold Spring Harbor Laboratory Press Hohn B and Collins J 1980 A Small Cosmid for Efficient Cloning of Large DNA Fragments Gene 291 298 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nuc Acids Res 75 8125 8148 continued on next page 35 References continued Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biol 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Krumlauf R Hammer R E Tilghman S M and Brinster R L 1985 Developmental Regulation of Alpha fetoprotein in Transgenic Mice Mol Cell Biol 5 1
25. ant proteins have been purified using immunoabsorption with a monoclonal antibody Denman et al 1991 Hansson et al 1994 In other cases a strategy relying on conventional chromatography such as cation anion exchange have been used Edmunds et al 1998 As an example of a purification strategy the general steps used by Genzyme Transgenics Corporation to purify rhAntithrombin III to 99 999 purity from transgenic goat milk is shown in the Appendix see page 32 To develop a purification scheme for your recombinant protein we recommend collaboration with an experienced protein biochemist continued on next page 27 Purification of Proteins from Milk continued Removal of Fats Generally the first step to purify a protein from milk usually includes a clarification step that removes most of the fat and lipid from the milk Fats can be removed from the milk via microfiltration or by centrifugation of the diluted milk at 8000 x g for 5 minutes The resulting layer of fat is skimmed off the top Hansson et al 1994 Further purification steps may vary depending on the nature of your recombinant protein Scale Up into Once you have completed feasibility studies in transgenic mice you may use the pBC1 Larger Animals vector to express your recombinant protein in larger animals Scale up into larger animals requires that you enter into a commercial agreement with Genzyme Transgenics Corporation For more information please contact Commer
26. cation is consistent among animals and across generations In the case of transgenically produced human antithrombin III biological activity was similar to that of plasma derived antithrombin III although differences did exist in glycosylation patterns Edmunds er al 1998 The table below describes the basic steps needed to clone your gene of interest into the pBC1 vector and to express your recombinant protein in transgenic mouse milk For more details please refer to the pages indicated T Pa Develop a cloning strategy to ligate your gene of interest into the 6 11 pBC1 vector Ligate your gene into the desired vector and transform into a recA 12 endA E coli strain e g TOP10 Select transformants on LB agar plates containing 50 to 100 ug ml ampicillin 3 Use colony PCR or colony hybridization to screen for transformants 12 13 that contain the insert of interest 3 0 Isolate plasmid DNA and sequence your pBC1 construct to confirm 14 that your insert is cloned in the proper orientation and contains the appropriate features required for expression Perform restriction digestion agarose gel electrophoresis and 16 17 9 electroelution to remove the prokaryotic sequences and isolate the transgene construct Prepare transgene DNA for microinjection 15 18 Send DNA to transgenic core facility or other commercial 1 transgenic facility to generate transgenic mice Screen mice to identify transgenic founders 20 23 Bree
27. ced litters it is critical that pups be kept healthy so that the mothers continue to lactate Other recommendations pertaining to the care of female transgenic mice during lactation are provided in the Harvesting Milk section see pages 24 26 CD 1 is a registered trademark of Charles River Laboratories 19 Identification of Transgenic Mice Introduction Screening Mice Anesthetizing Mice Important 20 Once you have obtained the first litter s of mice from your transgenic core facility or commercial facility you are ready to screen the mice to identify transgenic founders Typically 10 of mice generated are transgenic although the frequency could vary depending on the nature of your insert Due to variability in recombinant protein expression levels we recommend that you obtain at least 8 confirmed transgenic female lines before proceeding to test for recombinant protein expression To obtain at least 8 transgenic founder mice expressing the recombinant protein we recommend the following e Inject approximately 300 500 eggs to obtain enough mice to screen for the transgene e Screen at least 100 mice to obtain a sufficient number of confirmed transgenic mice e Screen mice for the presence of the entire transgene to avoid obtaining mice which carry rearrangements or mutations within the transgene Please note that confirmed female transgenics can be bred and tested directly for protein production in the milk whereas mal
28. cial Development Genzyme Transgenics Corporation 5 Mountain Road Framingham MA 01701 9322 Tel 508 872 8400 Fax 508 370 3797 28 Appendix Proteins Expressed in Transgenic Animal Milk Proteins The pBC1 milk expression vector has been used to express a number of recombinant Expressed in Milk proteins and antibodies in transgenic animals The following table lists some of the proteins and antibodies which have been expressed from pBC1 in the milk of transgenic mice and goats as well as information about the expression levels achieved in each transgenic model For more information please refer to the Genzyme Transgenics Corporation Web site www genzyme com transgenics or contact Genzyme Transgenics Corporation see page 35 g L Recombinant Proteins Human long acting Mouse Ebert et al 1994 tissue plasminogen Goat Young et al 1997 activator tPA Ziomek 1998 Antithrombin III Mouse 10 Edmunds et al Goat 14 1998 Young etal 1997 Ziomek 1998 al Proteinase Inhibitor Mouse 35 Young et al 1997 Goat 20 Ziomek 1998 Human Serum Albumin Young et al 1997 Soluble CD4 HIV Mouse Young et al 1997 Receptor Antibodies Anti cancer Monoclonal Mouse 10 Young et al 1997 Antibody MAb Goat 10 Ziomek 1998 Anti Lewis Y BR96 Mouse 4 Young et al 1997 MAb Goat 14 Ziomek 1998 Human Transferrin Mouse 2 Young et al 1997 Receptor MAb Single chain Antibody Mouse Young et al 1997
29. cloning your gene of interest into the pBC1 expression vector e Allow easy screening and identification of transgenic mice using the Easy DNA Kit e Provide general guidelines on the milking of transgenic mice and initial evaluation of recombinant protein expression in the milk See below for information on generation of transgenic mice and scale up to larger animals This manual provides general guidelines for cloning your gene of interest into the pBC1 vector and instructions for identifying transgenic founder mice The manual is not intended to be an in depth resource for the generation of transgenic mice For detailed information and technical support on the generation and care of transgenic mice we recommend collaboration with an experienced transgenic facility Please note that once successful recombinant protein expression has been performed in mice scale up into larger animals will require the user to enter into a commercial agreement with Genzyme Transgenics Corporation GTC as described in the Purchaser Notification see page 35 For more information please contact GTC see page 35 Transgenic animals are capable of producing biologically active recombinant proteins at high levels In the pBC1 Milk Expression System recombinant proteins are secreted at high levels into the milk of transgenic animals Use of the pBC1 vector for recombinant protein production has resulted in yields as high as 35 g L of recombinant protein in the milk
30. d female transgenic founder mice Proceed to step 11 Mate male transgenic founder mice and screen the resulting progeny 24 to identify female transgenic mice F1 generation Breed F1 female transgenic mice Harvest milk from female transgenic mice once they have produced 24 26 litters Assay the milk for recombinant protein expression Methods General Cloning Information Introduction General Molecular Biology Techniques Important E coli Host Strain The following section provides general information and guidelines for maintaining and propagating the pBC1 vector For help with DNA ligations E coli transformations restriction enzyme analysis DNA sequencing and DNA biochemistry please refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 The pBC1 vector is designed to help you express a gene of interest in the milk of transgenic mice as a means of evaluating the feasibility of proceeding towards large scale recombinant protein expression in larger transgenic animals Although the vector has been engineered to help you express your protein of interest in transgenic mice in the simplest most direct fashion use of the system is geared towards those users who possess a sophisticated knowledge of molecular biology techniques We highly recommend that users be familiar with the principles of transgenesis the care and handling of m
31. des Chicken globin insulator 2X bases 12 2412 Goat casein promoter bases 2427 6527 TATA box bases 6499 6506 B casein exon 1 untranslated bases 6528 7575 B casein intron 1 IVS1 bases 6576 8596 B casein exon 2 partial untranslated bases 8597 8602 Xho cloning site bases 8609 8614 B casein exon 7 partial untranslated bases 8620 8637 B casein intron 7 IVS7 bases 8638 9224 B casein exon 8 untranslated bases 9225 9266 B casein intron 8 IVS8 bases 9267 9993 B casein exon 9 untranslated bases 9994 10245 B casein 3 genomic fragment bases 10246 15760 pHC79 cosmid vector sequences bases 15761 21628 complementary strand bla promoter bases 15869 15967 Ampicillin bla resistance gene bases 15968 16828 pBR322 derived origin bases 16972 17645 continued on next page Cloning into pBC1 continued Features of the pBC1 Vector The table below summarizes the features of the pBC1 vector 21628 bp All features have been functionally tested and the vector fully sequenced Chicken B globin insulator 2X Shields the B casein promoter from the influence of nearby regulatory elements and allows position independent expression of the gene of interest in transgenic mice Chung et al 1997 Chung et al 1993 Goat casein promoter Permits inducible expression of your recombinant protein in the mammary epithelial cells of transgenic mice Persuy et al 1992 Roberts et al 1992 Young et al 1997
32. e detailed discussion about using Southern blot analysis to screen transgenic mice please see Hogan er al 1994 23 Harvesting Milk Introduction Choosing Mice for Lactation General Notes on Milking Schedules The Milking Apparatus 24 Once you have identified at least 8 transgenic founder mice you may proceed to breed the mice and harvest milk to test for expression of your recombinant protein Remember that if any of your transgenic founders are male you will need to mate the male founders The resulting progeny will need to be screened to identify the F1 female transgenic mice These F1 female transgenic mice may then be bred and tested for recombinant protein expression in the milk The following section discusses factors to consider prior to harvesting milk and provides a protocol for harvesting milk Once transgenic mice are confirmed by PCR and Southern blot the mice must be prepared for lactation and milk testing At four weeks of age female transgenic mice can be mated Once pups are born the transgenic mother will begin lactation and milk can be tested Once a transgenic female is producing milk she can be tested for expression of the recombinant protein of interest However in developing a milking schedule the health of the pups must be considered In some cases it may be advisable to have a foster mother on hand but in most cases this will not be necessary as long as a limited milk harvesting schedule is foll
33. e transgenics must first be mated to obtain female transgenic mice from the F1 generation The F1 progeny must then be screened to identify the female transgenic mice To screen mice for potential transgenic founders you will need to perform a tail biopsy on each mouse Genomic DNA will be prepared from each tail sample and subsequently screened by PCR analysis to detect the presence of the transgene Tail samples that test positive in the PCR analysis can then be confirmed by restriction digestion and Southern blot analysis Note Tail samples should also be taken from wild type mice to use as a negative control for the presence of the transgene To perform tail biopsies the mice will need to be anesthetized briefly Many types of anesthetics both inhalation and injectable are suitable for use with mice A protocol is provided on the next page to perform tail biopsies using an inhalation anesthetic isoflurane to anesthetize mice Isoflurane Aerrane may be obtained from Anaquest Inc Anaquest Inc 110 Allen Road Liberty Corner NJ 07938 Tel 908 647 9200 Fax 908 604 7652 For more information about other available anesthetics please consult your animal care facility Mice should be handled in strict compliance with animal care guidelines during the anesthetization and tail biopsy procedure Please consult your animal care facility for their recommended handling guidelines continued on next page Identification of Transge
34. ge scale recombinant protein purification collaboration with an experienced protein biochemist is advisable Initial testing for expression of recombinant protein in mouse milk generally involves dilution of the milk and analysis by SDS polyacrylamide gel electrophoresis General guidelines are provided below to prepare samples for analysis Either fresh or frozen milk may be tested If frozen milk is used thaw the milk before proceeding Remember to include a sample of milk from a wild type mouse as a negative control for expression Purified recombinant protein may be used as a positive control 1 Dilute the milk 20 fold in sterile water 2 Remove 10 ul of the diluted milk and dilute 1 1 in 2X SDS PAGE sample buffer 3 Incubate the sample at 65 C for 10 minutes 4 Load 4 ul of sample on an SDS polyacrylamide gel and electrophorese Use the appropriate percentage of acrylamide to resolve your recombinant protein 5 Proteins may be visualized by Coomassie blue staining or western blot analysis If you wish to perform western blot analysis to assay for your recombinant protein you will need to have an antibody to your recombinant protein We recommend that you use a monoclonal antibody to detect your recombinant protein as monoclonal antibodies are less likely to cross react with host proteins The exact strategy for further purification of your recombinant protein from milk will depend on the chemistry of your protein Several recombin
35. he 5 region of the chicken B globin gene Chung et al 1997 Chung et al 1993 When incorporated into transgene constructs the insulator sequences have been shown to reduce the influence of cis acting regulatory elements on the activity of the transgene Talbot er al 1989 The presence of the insulators eliminates position effects caused by the integration of transgenes into specific sites in the mouse genome and effectively reduces variability in the expression levels of transgenically produced recombinant proteins Talbot et al 1989 The goat B casein exon sequences included in the pBC1 vector do not contain an ATG start codon therefore your insert should contain a Kozak translation initiation sequence with an ATG start codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provided below Please note that other sequences are possible see references above but the G or A at position 3 and the G at position 4 are the most critical shown in bold The ATG initiation codon is shown underlined G A NNATGG In order for your protein of interest to be efficiently secreted into the milk of the transgenic mice your construct must contain a secretion signal If your gene of interest is a secreted protein you may use the native secretion signal for your gene If your protein does not have a secretion signal then you must add a heterologous secretion signal to your
36. he pBC1 vector is qualified by restriction enzyme digestion with specific restriction enzymes as listed below Restriction digests must demonstrate the correct banding pattern when electrophoresed on an agarose gel see below Restriction Enzyme Expected Results bp AfII 1207 3730 4215 12476 Hind III 1207 3319 4450 4503 8149 SapI 1202 1207 4717 5392 9110 SphI 720 4733 7266 8909 Easy DN A Kit Each kit component is sterile free of nuclease contamination and is lot qualified for optimum performance Greater than 10 ug of high molecular weight DNA must be isolated from 10 Sf9 insect cells 34 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Brinster H L Chen N Y Trumbauer M E Yagle M K and Palmiter R D 1985 Factors Affecting the Efficiency of Introducing Foreign DNA into Mice by Microinjecting Eggs Proc Natl Acad Sci USA 82 4438 4442 Brinster R L Allen J M Behringer R R Gelinas R E and Palmiter R D 1988 Introns Increase Transcriptional Efficiency in Transgenic Mice Proc Natl Acad Sci USA 85 836 840 Chada K Magram J Raphael K Radice G Lacy E and Constantini F 1985 Specific Expression of a Foreign Beta globin Gene in Erythroid Cells of Transgenic
37. here are many factors to consider when designing a transgene including the size of the DNA construct inclusion of introns and exons use of genomic sequences propagation and maintenance of the vector construct and detection of the transgene in mice A brief discussion of each of these factors is provided below For more details please refer to Hogan et al 1994 Transgenic mice have been successfully generated from microinjection of DNA fragments as large as 70 kb Strouboulis et al 1992 In general the size of the transgene does not appear to affect the frequency of obtaining transgenic mice but is limited more by cloning and handling considerations of the vector construct itself For pBCI derived DNA fragments ranging from 25 35 kb in size the success rate of obtaining transgenic mice is approximately 10 of the total mice obtained Genzyme Transgenics Corporation unpublished observations To facilitate propagation and maintenance of such large transgene constructs the pBC1 vector contains cosmid packaging sequences that allow packaging of the vector construct of interest into cosmids should the size be too large for efficient conventional bacterial transformation and propagation Transgenic mice have been successfully generated from constructs in which the gene of interest is expressed from either a cDNA or a genomic fragment However many studies have shown that the levels of gene expression obtained with genomic DNA based construc
38. ice and protein purification techniques For molecular biology protocols and information about manipulating and handling mice please refer to the following general reference sources Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Hogan B Beddington R Constantini F and Lacy E 1994 Manipulating the Mouse Embryo Second Edition Cold Spring Harbor NY Cold Spring Harbor Laboratory Press The pBC1 vector is over 21 kb in size Because of its large size extra care should be exercised when handling and propagating the vector to avoid shearing the DNA or losing vector sequences Pay particular attention when performing manipulation steps including cloning transformation and DNA preparation Many E coli strains are suitable for the propagation of the pBC1 vector including TOP10 Catalog no C610 00 or DH5a We recommend that you propagate and maintain the pBCI vector and your transgene construct in E coli strains that are recombination deficient recA and endonuclease A deficient endA To facilitate the uptake of large plasmids such as pBC1 we also recommend that you use an E coli strain that is For your convenience TOP10 is available as electrocompetent or chemically competent cells from Invitrogen Electrocomp TOP10 5x 80 ul C664 55 One Shot TOP10
39. its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 33 Product Qualification Introduction The following criteria are used to qualify the components of the pBC1 Milk Expression Vector Kit Vector T
40. lete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech_service invitrogen com jpinfo invitrogen com eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of
41. nic Mice continued Tail Biopsies A protocol is provided below to perform a tail biopsy on each mouse Other protocols are suitable For more details please refer to Manipulating the Mouse Embryo Hogan er al 1994 1 Pipet 0 5 ml of isoflurane see the previous page into a 1 L beaker and cover the liquid with several paper towels 2 Place the mouse inside the beaker and cover the beaker with foil The mouse should lose consciousness within a minute or so If the beaker is kept carefully covered tail biopsies can be performed on up to 5 mice in succession Do not keep mice under anesthetic for longer than 5 minutes 3 Remove the anesthetized mouse from the beaker Clip the mouse s ears for identification purposes Using a sterile razor blade cut 1 cm off the end of the tail Minimal bleeding will occur but no wound treatment is necessary as long as the razor blade is sterile Place the tail sample in a labeled microcentrifuge tube Place the tube on ice 5 Replace the mouse in the cage The mouse should recover consciousness within a few minutes 6 When you have finished collecting all of the tail samples proceed directly to isolate genomic DNA from the mouse tails see the next page or store the samples at 70 C or in liquid nitrogen for later use Isolation of Use the Easy DNA Kit supplied with the pBC1 Milk Expression Vector Kit to isolate Genomic DNA genomic DNA from mouse tails for subsequent analysis The Easy DNA
42. of transgenic mice and 20 g L in the milk of transgenic goats Young et al 1997 Ziomek 1998 Use of transgenic milk systems to express recombinant proteins offer a number of advantages over the use of cell culture systems e Milk provides a safe abundant and easily obtainable source of raw material for purification of expressed recombinant protein e Yields of recombinant protein can be 10 to 1000 fold higher than cell culture systems see the next page for more information e Transgenic lines maintain consistent protein expression across generations e Posttranslational modifications of recombinant protein remain consistent whereas posttranslational modifications in cell culture can vary depending on exact culture conditions see page 3 for more information For a detailed review refer to Gene Expression Systems Chapter 14 Meade et al 1999 continued on next page Overview continued Recombinant Proteins Produced Using the pBC1 Vector Casein Promoter The Mammary Gland and Characterization of Milk A broad range of recombinant peptides and proteins have been expressed in the pBC1 system including orally active drugs such as glutamic acid decarboxylase and parenteral drugs such as antithrombin III In functional studies of transgenically produced antithrombin III recombinantly produced protein was found to have a specific activity equal to that of plasma derived protein Edmunds er al 1998 A more detailed li
43. owed A number of recommendations to keep in mind when developing a milking schedule are provided below e Pups must remain healthy to maintain the mother s lactation cycle e In general milking is best performed beginning on day 7 after the birth of the pups e The mother should not be milked on consecutive days to provide enough milk for the pups Generally mice may be milked every other day e Milk may be collected from the mother for approximately 3 weeks until the pups are weaned Please note that approximately 50 500 ul of milk may be harvested from a mouse at each milking The mice do not need to be anesthetized during the milking process Before harvesting milk for the first time you will need to assemble a milking apparatus to collect milk from the mouse The milking apparatus uses a human breast pump that has been specially adapted to fit a mouse A graphic and instructions to set up the milking apparatus are provided on the next page To assemble the milking apparatus you will need to have the following items on hand e Human breast pump see the next page e 15 ml conical centrifuge tube e Rubber stopper to fit the 15 ml centrifuge tube e Two 18 gauge needles e 12 15 inches of Tygon tubing to fit the breast pump and the hub of the 18 gauge needle e 1 5 ml microcentrifuge tubes e Tissues Tygon is a trademark of Norton continued on next page Harvesting Milk continued Human Breast Pump Assembling the
44. r use in the generation of transgenic mice for this particular application because of the following reasons e fertilized eggs are relatively easy to microinject because pronuclei are large and easy to visualize e female mice generally exhibit non aggressive behavior during the milking process e female mice are good mothers and are good milkers CD 1 mice may be obtained from Charles River Laboratories For more detailed information about the CD 1 strain please contact Charles River Laboratories at Charles River Laboratories 251 Ballardvale St Wilmington MA 01887 Tel 1 800 LAB RATS 1 800 522 7287 Web Site www criver com It is important that all mice be handled and housed in compliance with established Institutional Animal Guidelines Please consult your transgenic and or animal care facility for specific guidelines and recommendations to handle and care for your mice In addition to following established protocols and guidelines to handle and care for your mice see above a number of other recommendations relating to the care of your mice for this particular application are listed below e Mice should be maintained on high calorie high fat Purina mouse chow This is particularly important for female mice during breeding as the high calorie high fat diet will keep milk production high Please consult your animal care facility for a supplier of the high calorie high fat mouse chow e Once transgenic female mice have produ
45. rom 1 10 ug ml The number of transgenic mice obtained decreases when the DNA concentration is less than 1 ug ml while embryo survival decreases dramatically when the DNA concentration is greater than 10 ug ml DNA for microinjection into fertilized eggs must be extremely clean and free of all contaminants e g traces of phenol ethanol enzymes or agarose that might harm the egg and any particulate matter that could clog the injection needles All solutions used to prepare DNA for microinjection should be filtered through a 0 22 um filter Millex GV Millipore Catalog no SLGV R25 LS We recommend purifying your linearized DNA by agarose gel electrophoresis followed by electroelution CsCl centrifugation and extensive dialysis Other standard methods for DNA preparation are suitable A protocol for preparation of DNA for microinjection is provided for your convenience see next page For details please refer to Manipulating the Mouse Embryo Hogan et al 1994 continued on next page 15 Preparation of DNA for Microinjection continued Microinjection Buffer N RECO Nous Important DNA Digestion and Gel Purification 16 The recipe for microinjection buffer used to resuspend your DNA construct can vary but typically contains the following components e 5 10 mM Tris pH 7 4 e 0 1 0 25 mM EDTA Please note that the concentration of EDTA in the microinjection buffer can dramatically affect the viability of the emb
46. ryos and thus the frequency of obtaining transgenic mice Use of microinjection buffers that lack EDTA result in reduced embryo survival and decreased integration efficiency Brinster et al 1985 while use of microinjection buffers containing over 1 mM EDTA result in reduced embryo survival and severe toxicity We recommend using a microinjection buffer composed of 5 mM Tris pH 7 4 and 0 1 mM EDTA Please see the next page for a recipe to prepare the microinjection buffer Most transgenic facilities develop their own guidelines and protocols to instruct users on how to prepare their transgene constructs for microinjection We recommend that you consult your transgenic facility to obtain a protocol for preparing your DNA for microinjection and for a recipe for their preferred microinjection buffer Multiple steps must be performed to prepare your DNA fragment for microinjection e g restriction digestion agarose gel electrophoresis electroelution dialysis CsCl gradient centrifugation and dilution You will lose a substantial amount of DNA from removal of the prokaryotic sequences and you will likely lose some DNA at each purification step Therefore be sure that you start out with a sufficiently large amount of DNA when setting up your initial digestion The higher the DNA concentration at the end of the purification process the cleaner and easier it will be to inject after dilution We recommend that you start with at least 100 300 ug of vec
47. s generated through the hub of the needle when the breast pump is turned on Proceed to milk the mouse see the next page 7 After the mouse has been milked the microcentrifuge tube see B below containing the expressed milk should be removed from the 15 ml conical tube and replaced with a fresh microcentrifuge tube continued on next page 25 Harvesting Milk continued Protocol for Milking 26 Beginning on day 7 after the delivery of the pups transgenic mothers can be milked to begin expression analysis experiments Milk may be harvested every other day from the mice We recommend that milking take place in a quiet room as nervous or stressed mice are harder to milk Note Remember to harvest milk from a wild type female mouse to use as a negative control for recombinant protein expression 1 The mother should be isolated from pups 1 hour prior to the planned milking time to allow milk to accumulate 2 Just prior to milking approximately 1 minute the mother should be injected intra peritoneally with 5 i u of oxytocin Sigma Catalog no O2882 using a 25 gauge needle Oxytocin induces expression of the milk The total volume of oxytocin injected should be approximately 0 2 cc The hormone should take effect within 1 to 5 minutes after injection 3 Turnon the breast pump for the assembled milking apparatus 4 To milk the mouse hold it by the base of the tail so that the mouse is facing away from you Let the mouse gra
48. secreted tend to express at the highest levels in milk In addition it is important to note that certain proteins that are particularly toxic to mammalian tissues may also have dramatic effects on transgenic animal development Please note that the pBC1 vector does not include an epitope tag for detection of recombinant protein You will need to have an antibody to your recombinant protein of interest in order to detect expression by Western blot Cloning into pBC1 Introduction Prokaryotic Sequences Insulator Sequences Kozak Consensus Sequence Secretion Signal General considerations for cloning your gene of interest into the pBC1 vector are described below For a map and a description of the features of pBC1 please refer to pages 10 11 The prokaryotic sequences in the pBC1 vector are derived from the pHC79 plasmid Hohn and Collins 1980 and include e the ampicillin resistance gene for selection in E coli e pBR322origin of replication for maintenance and low copy replication in E coli e cosmid packaging sequences that provide the user with the option of packaging larger constructs using lambda phage cosmid technology see Sambrook et al 1989 for protocols The pBC1 vector contains two tandem copies of a sequence located immediately upstream of the B casein promoter that has been shown to function as a chromatin insulator Chung et al 1997 Chung et al 1993 The insulator sequences were originally derived from t
49. sp the edge of the cage with its front paws The mouse need not be otherwise restricted or confined Gently lift the mouse s hindquarters to reveal the teats Lift the 15 ml conical tube to the mouse and allow the suction to draw the mouse teat into the needle hub see diagram on the previous page Milk each teat until the milk supply is exhausted Generally approximately 50 500 ul of milk can be obtained from the mouse in a single milking 5 Store the milk on ice for immediate analysis or at 80 C for later analysis Purification of Proteins from Milk Introduction Initial Expression Testing Western Blot Analysis Strategies for Purification The purpose of the pBC1 Milk Expression Kit is to facilitate recombinant protein production in the milk of mice for feasibility studies For initial testing of expression it is generally not necessary to purify the protein away from milk however a greater degree of purification may be required depending on the nature of your recombinant protein of interest and the nature of your analysis Several approaches for protein purification from milk are discussed in the following section For a general reference on biochemical purifications we recommend that you refer to Methods in Enzymology volume 182 Deutscher 1990 or Current Protocols in Protein Science Coligan et al 1995 Some general strategies for purifying proteins from milk are reviewed in Young et al 1997 and Ziomek 1998 For lar
50. st of some of the recombinant proteins that have been expressed using the pBC1 vector is provided in the Appendix see page 29 For more information and references on recombinant protein production and yields in larger herd animals please refer to the Genzyme Transgenics Corporation Web site at www genzyme com transgenics The pBC1 vector uses the goat f casein promoter to drive high level expression of the recombinant protein of interest The goat B casein promoter is a tissue specific promoter that targets expression of the gene of interest almost exclusively to the lactating mammary gland see below with some minor expression in skeletal muscle and skin Roberts et al 1992 Although the pBC1 vector is primarily intended for high level recombinant protein production in the milk of transgenic mice the specificity of the promoter also allows study of the effects of a protein of interest on a specific target tissue e g the mammary tissue The synthesis of milk is carried out by mammary epithelial cells in the mammary gland These cells are also responsible for all posttranslational modifications including glycosylation and phosphorylation Typically a mammary gland can synthesize and secrete approximately 2 grams of milk per gram of tissue per day Young et al 1997 The mammary gland is a natural bioreactor with cell densities up to 100 to 1000 fold greater than most cell culture systems This cell density translates to approximately 2 x
51. tinued Other DNA Isolation Protocols PCR Analysis of Potential Founder Mice Southern Blot Analysis Other protocols to isolate genomic DNA from mouse tails are suitable An alternative protocol is included in the Appendix see page 31 For more information please refer to Manipulating the Mouse Embryo Hogan et al 1994 Once you have isolated genomic DNA from the mouse tails potential founder mice can easily be tested for the presence of the transgene using PCR analysis Although PCR analysis is quick and easy it is also subject to artifacts Therefore we recommend that all PCR analyses be performed with positive and negative controls in parallel In addition founder transgenic mice that test positive by PCR should be retested by Southern blot analysis Southern blot analysis has the advantage of being less prone to false positives while also providing information about the structure integrity and copy number of the integrated transgene For PCR analysis it will be necessary to design and synthesize two primers that will amplify a transgene specific band of the appropriate size corresponding to your gene of interest The PCR primers can be tested for specificity and sensitivity by performing test PCR on dilutions of transgene DNA that have been mixed with a standard amount of normal mouse genomic DNA Alternatively you may use the Forward and Reverse primers previously described see page 12 for your PCR analysis Use the c
52. to 10 fold higher than the concentration used for microinjection Typically the DNA concentration for microinjection is diluted to 200 400 molecules picoliter or 2 4 ug ml for a 10 kb DNA fragment We recommend that the concentration of your DNA fragment in your stock solution be at least 10 ug ml 5 mM Tris pH 7 4 0 1 mM EDTA 1 3 This solution can be prepared from the following common stock solutions To prepare 1 liter combine 1 M Tris pH 7 4 5ml 0 5 M EDTA 0 2 ml Bring the volume up to 1000 ml with deionized water Filter sterilize through a 0 45 um filter Store tightly sealed at room temperature continued on next page 17 Preparation of DNA for Microinjection continued Dilution of DNA into Microinjection Buffer 18 If you are sending your DNA for microinjection to a transgenic core facility or to a commercial facility to generate transgenic mice you will often be asked to send concentrated DNA see the previous page Upon receipt of the DNA the transgenic facility will dilute the DNA with microinjection buffer to the appropriate concentration immediately prior to microinjection If you are asked to provide DNA at a concentration suitable for microinjection follow the protocol below to dilute your DNA to the appropriate concentration Other protocols are suitable Consult your transgenic facility to obtain a recipe for their preferred microinjection buffer Materials Needed e Microinjection Buffer
53. to increase the integration frequency of the injected transgene Brinster er al 1985 have found that injection of linear DNA can increase the integration frequency five fold when compared to injection of supercoiled DNA Most of the linear DNA molecules will integrate into the chromosome in a head to tail array To increase your chances of obtaining transgenic mice we recommend that you linearize your DNA prior to microinjection When designing a strategy to linearize your DNA for microinjection remember to linearize your pBC1 construct in such a way that most or all of the prokaryotic sequences are removed from the DNA fragment to be microinjected We recommend digesting the pBC1 vector with Not I and Sal I to remove the prokaryotic sequences see vector map on page 10 Please note that these restriction sites may not be available if they are found in your gene of interest Other restriction sites are possible In most cases DNA for microinjection is prepared as a concentrated stock solution and then diluted prior to microinjection On average approximately 1 2 picoliters of DNA solution is injected into each fertilized egg Although the total amount of DNA that is microinjected varies with each injection and is difficult to quantify the concentration of the DNA solution can effect the integration frequency and the chances of obtaining transgenic mice Generally the optimal concentration of the diluted DNA solution for microinjection ranges f
54. tor DNA for the initial digestion General guidelines are provided below to isolate your DNA fragment for microinjection Please see Hogan et al 1994 for details 1 Use the appropriate restriction enzymes to digest your pBC1 construct such that the prokaryotic sequences are separated from the transgene construct e g Not I and Sal I Do not use Not I and Sal I if these restriction sites occur in your gene of interest 2 Extract the DNA with phenol then chloroform 3 Separate the DNA fragments by electrophoresis on a TAE agarose gel containing 0 5 ug ml ethidium bromide 3 Usealongwave ultraviolet UV lamp to locate the band corresponding to the DNA fragment of interest and excise the band from the agarose gel 4 Use any standard protocol of your choice to electroelute the DNA from the gel slice into a dialysis bag Protocols may be found in most general references Ausubel et al 1994 Sambrook et al 1989 You may use an electroeluter if available Follow the manufacturer s instructions to electroelute the DNA 5 Concentrate the eluted DNA using standard methods i e S N A P MiniPrep Kit Catalog no K1900 25 or CsCI gradient centrifugation 6 Determine the concentration and purity of your isolated DNA fragment by reading the optical density at OD260 280 You should have at least 50 ug of DNA at a concentration greater than 10 ug ml before proceeding further Proceed to purify your DNA fragment by CsCl gradient cen
55. trifugation see the next page continued on next page Preparation of DNA for Microinjection continued CsCl Gradient Centrifugation Recipe for Microinjection Buffer Materials Needed 1X TE buffer 10 mM Tris pH 7 5 1 mM EDTA Cesium Chloride Ultracentrifuge tubes Protocol 1 In a 50 ml conical centrifuge tube bring your electroeluted DNA fragment from the previous page up in 10 ml of 1X TE buffer Add 10 g CsCl to the DNA solution and mix gently to dissolve Load the DNA CsCI solution into an ultracentrifuge tube Seal the tube tightly with a heat sealer Centrifuge at 65 000 rpm for 6 hours or overnight in a vertical or near vertical rotor at room temperature Collect 0 5 ml fractions using a butterfly needle inserted approximately 1 cm from the bottom of the tube Run 3 ul of each fraction on an agarose gel containing 0 5 ug ml ethidium bromide to identify the fractions containing your DNA fragment Generally fractions 7 12 contain the DNA but this may vary depending on the size of the DNA fragment Combine the peak fractions into one tube Dialyze the DNA at 4 C against a 50 100X volume of microinjection buffer see recipe below for 24 hours Change the microinjection buffer at least 3 times during dialysis After dialysis run different dilutions of the DNA on an agarose gel with the proper standards to determine the concentration of your purified DNA The concentration of DNA should be at least 5
56. trifuge at top speed for 30 seconds Remove ethanol with a pipette 8 Wash the pellet with 1 ml of 70 ethanol 9 Centrifuge at top speed in the microcentrifuge for 1 minute Remove the ethanol 10 Resuspend the DNA pellet in 1X TE buffer 3l Sample Recombinant Protein Purification Strategy Purification of The strategy used to purify recombinant Antithrombin III from transgenic goat milk is rhAntithrombin Ill provided below as an example of schemes available for purifying proteins from milk Such purification schemes may be modified according to the nature of your recombinant protein of interest In this case the overall yield of recombinant Antithrombin III obtained was 53 and the purity achieved was 99 999 Edmunds er al 1998 For more information please contact Genzyme Transgenics Corporation see page 35 Goat Milk rhAntithrombin Ill 1 5 3 mg ml Clarification by microfiltration Casein Fat Immobilized heparin absorbent Lactose Mineral Salts Endogenous protein Anion exchange chromatography Hydrophobic interaction chromatography Contaminants Ultrafiltration and formulation Purified rhAntithrombin Ill 32 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Comp
57. ts are generally higher than those obtained with cDNA based constructs Brinster et al 1988 Inclusion of introns in the transgene construct has been shown to increase the levels of transgene expression dramatically Brinster er al 1988 The mechanism for the increased expression of certain transgenes is not entirely known In some cases the increased expression associated with a particular transgene can be attributed to the presence of regulatory sequences within the intron sequences The introns and exons that are included in the transgene construct need not necessarily be derived from the gene of interest as expression from transgenes can be substantially enhanced by the inclusion of heterologous introns and exons in the construct Choi et al 1991 Palmiter et al 1991 In the pBC1 vector genomic sequences from the goat B casein gene flank the cloning site for your gene of interest The presence of B casein genomic sequences introns and exons allows you to clone your gene of interest into pBC1 as either a cDNA or a genomic fragment Your gene of interest will be inserted in such a way that it lies between exons 2 and 7 of the goat B casein gene see page 10 for a map of the vector continued on next page Designing Transgenes continued Codon Usage Removal of Prokaryotic Sequences Screening for Potential Transgenic Mice Types of Protein to Express Detection of Recombinant Protein For optimal expression of your
58. w RNase if stored at 20 C and keep on ice and chill 100 and 80 ethanol in a 20 C freezer 1 Add 300 ul Solution A and 120 ul Solution B to sample and vortex vigorously until solution is uniformly viscous 10 sec to 1 min 2 Add 750 ul chloroform and vortex until the viscosity decreases and the mixture is homogeneous 10 sec to 1 min 3 Centrifuge at maximum speed for 10 minutes at 4 C and transfer the upper aqueous phase to a fresh microcentrifuge tube 4 If the upper phase is not clear a second chloroform extraction is needed Repeat steps 2 and 3 When upper phase is clear proceed to the next step 5 Add 1 0 ml of 100 ethanol 20 C to the clear upper phase Vortex and incubate on ice for 30 minutes 6 Centrifuge at maximum speed for 10 to 15 minutes at 4 C Remove ethanol with a drawn out pasteur pipette Add 500 ul 8096 ethanol 20 C and mix by inverting the tube 3 5 times Centrifuge at maximum speed for 3 to 5 minutes at 4 C Remove 80 ethanol with a drawn out pasteur pipette 9 Centrifuge the tube at maximum speed for 1 3 minutes at 4 C Remove residual ethanol Let air dry 5 minutes 10 Resuspend the pellet in 49 ul TE and add 1 ul of 2 mg ml RNase to a final concen tration of 40 ug ml Incubate at 37 C for 30 minutes DNA is ready for use Store at 4 C The typical yield is approximately 125 ug DNA for 1 cm of tail continued on next page 22 Identification of Transgenic Mice con
59. ycling parameters listed on page 13 or those optimized for your gene of interest to amplify DNA from the mouse tail genomic DNA samples Amplified DNA may then be analyzed by agarose gel electrophoresis to identify potential transgenic mice Southern blot analysis of potential founder mice should be planned carefully with regard to both the restriction digest and probe Generally a fragment of the transgene 100 500 bp can easily be labeled using a standard random priming kit and used as the probe in the Southern blot When choosing a restriction enzyme to digest the genomic DNA we recommend choosing a restriction enzyme that cuts at known sites in the transgene and will yield a band of predictable size Depending on your choice of probe and enzyme you may also identify novel sized junction fragments in addition to the predicted band These junction fragment bands represent the ends of the integrated transgene array An estimate of transgene copy number can be obtained by including a range of standard amounts of the transgene mixed with normal mouse genomic DNA in parallel lanes on your Southern blot For optimal results it is necessary to quantitate this DNA as accurately as possible As a general rule one copy of a typical 5 10 kb mouse gene is present in the mouse genome 6 x 10 bp at approximately one part per million Therefore the amount of transgene construct used for the standards should cover the range from 1 to 100 pg For a mor

User Manual pBC1 Milk Expression Vector Kit

Contents

Download Pdf Manuals

Related Search

Related Contents