Gegenees V 1.0.1
Contents
1. It is possible to export an interesting subsequence from the genome or the whole genome if it is completed into a format that can be viewed in Artemis http www sanger ac uk resources software artemis The export will end up in a directory called export under the workspace directory It will be a gbk file that essentially is the same file as the original gbk file if there are problems or warnings when loading the original file in Artemis they will remain The gene and misc feature track is replaced by the biomarker scores Five files are exported Ore E a a file with Biomarker scores max min as a misc_feature track a file with Biomarker scores max avr as a misc_feature track a file with Bimarker scores avr avr as a misc_feature track the original annotated file with also the gene and misc feature track intact a file with Biomarker scores max min only complete genomes as a misc_feature track an example of how this kind of export will look like in artemis is shown below Artemis Entry Edit 3 anthi Ames ox File Entries Select View Goto Edit Create Run Graph Display Entry Selected feature bases 369 amino acids 122 GBAA 1672 locus_tag GBAA 1672 codon_start l transl table 1l product flagellar protein Flis p E AA SS N o oa s ATS ok GBAA 1672 JC fliH E E a E GBAA 1673 iE LIN m j m al 1iD fliI 1iG isc_feature mi misc feature feature e e misc_feature iture isc_2. Analysis Current remote site __Local database Current comparison Namnl st 2 vid 66 7 Lager 1 RGB 8 l z k m m Mov Filter Filter Filter Genome ShowAll Complete Draft Show All Complete Wf Genome Genome BOO Tota Visit Not connected lt m lt itt a e B m OB el Vee we Total 0 Visible 0 Selected 0 Total 0 Visible 0 Selected Workspace Gegenees_wsp Comparison Alignment Analysis Remote Sites It is possible to download genomes from a remote FTP server The FTP sites are definend by a file ending with site in the ftp directory in the workspace directory A few pre defined ftp sites are distributed with the Gegenees software These are NCBI complete genomes pointing at ftp ftp ncbi nih gov genomes Bacteria and NCBI genomes bacteria draft pointing at ftp ftp ncbi nih gov genomes Bacteria DRAFT and NCBI genbank bacteria draft pointing at ftp ftp ncbi nih gov genbank wegs NCBI genbank bacteria draft contains more genomes than NCBI genomes bacteria draft It is possible to make own site files Copy the content of the existing files and replace the HostName and the Directory fields with custom information The FTP site must be formatted as the NCBI site If you need to connect to other types of ftp sites contact the support at Gegenees Gegenees genome format Gegenees uses a folder for each genome T
3. File Help E Workbench Overview Genomes Alignment Analysis Active alignment Progress log Ready Name none New Active alignment Comment Nr Genomes Parameters Fragment size Sliding step size Load default accurate Load default fast Versions BLASTN Set primers Nr Primers Status Created A Status Run time E Estimated time left ae j This window shows detailed output from the comparison The same text is also logged in Alignment control Start Continue Send pause signal Delete Workspace Gegenees_wsp Comparison Alignment Analysis When an alignment is defined it can be started by pressing the start button The calculation progress will be shown and the log window in the right part will show messages on what is happening Typically first a lot of conversion and preparation messages appears Then the a BLAST list is created and executed in parallel threads Typically each thread should not take more than at the most a few minutes to complete The number of simultaneously calculating threads is indicated and also the thread number and the total number of threads that should be run It is possible to send a pause signal and then resume the calculation later After all the threads have been run some data analysis is made and then the alignment is completed Once a alignment is completed it is possible to analyze the data in the Analysis persp
4. An overview of all comparisons collected in this workspace se below Genomes An overview of the genomes available in the local database Remote genomes at the NCBI ftp server can also be explored and downloaded Genomes can also be copied into a the current comparison Alignment This is the perspective where the comparative calculations are started and controlled Analysis a perspective for phylogenomic and signature analysis of a completed alignment The workspace The workspace is where all your genomes and your comparison projects will be stored A wokspace must always be selected so when Gegenees starts the first time a workspace location is asked for Typically a user always use the same workspace Different users on the same computer might want to collect their genomes and comparison in an own separate workspace The workspace can be changed by pressing the Change workspace button Do not use space characters in the workspace path The full path of the workspace can be seen in the textbox Active workspace The name of the current workspace can always be seen at the bottom left side of the status line The comparisons that are present in the current workspace will be listed in the table in the Workbench overview perspective Bse 0 Es SSS Saas File Help E3 Workbench Overview Genomes Alignment Analysis Active workspace Gegenees_wsp Change workspace Name Type Genomes Created Modified New comp
5. info part to the right The number of fragments that each pixel column on the screen represent is also indicated It is also possible to see how many percent of the genome has a biomarker score over a certain threshold This gives a good overview of the how much genomic regions one can expect It is possible to zoom into the graph by selecting a region with the right mouse button down If the left mouse button is used the corresponding region is selected A selection can thereafter be loaded into the tabular view for further data mining There are possibilities to export the graph as seen on the screen as an image It is also possible to export the data to a file that can be explored in Artemis se section below File Help EI Workbench Overview Genomes Alignment Group settings i Heat plot Score overvie EEX score abe E Primer score table Reference organism Bacillus_anthracis_Ames 1 Bacillus anthracis str Ames chromosome complete genome Workspace gegenees Comparison Bacillus Alignment ttttest Analysis default Viewing a signature in Artemis Biomarker score max min v Downwards Biomarker score max average X Info Nr of fragments Fragments per pixel Fragment cursor Fragment selection Subsequence coordinates cursor M of ttagments wih scare aver threshold Score type Bm max min KA Threshold Export as image Epe
6. If Gegenees starts OK it is time to install BLAST BLAST can be downloaded from ftp ftp ncbi nih gov blast executables Gegenees can use both BLAST and BLAST In general The latest version of BLAST is recommended ftp ftp ncbi nlm nih gov blast executables blast LATEST Chose a version that corresponds to your OS and architecture 32 bit 64 bit and extract or in windows run the installation program In the current version the directory blast is installed should NOT CONTAIN SPACES This requirement will be removed in future versions Gegenees must then be configured to find BLAST Chose preferences from Gegenees main menu Select blastall for older version of NCBI blast 2 2 20 and older and BLAST for newer 2 2 21 and later If BLAST is added to your system path you may not need to specify the path If BLAST is not in the system path or if BLAST cannot be found by gegenees specify the full pathname to the directory containing the BLAST executables e g Windows C blast Linux usr local blast Preferences Path to BLAST directory Leave blank if in your system PATH C blastp blast bin Blastall BLAST SS A function for testing if Gegenees finds blast is under implementation and will come in the next version Perspectives Gegenees have five perspectives The active perspective can be changed in the perspective bar just under the main menu The perspectives are Workbench overview
7. a range defined by the mouse in the graphical view e a user defined range expressed as fragment numbers e a subset of fragments with a specific biomarker score range e g 0 8 1 0 1 0 is the maximum biomarcer score e If none of the range boxes are checked all fragments will be shown Fragments from a certain subsequence can also be selected After setting the filtering range or a combination of them e g all fragments in the first 200 kb of subsequence 2 with biomarker sore over 0 8 press the show fragments button to load the fragments It is possible to sort the table based by clicking the header The type of biomarker score to be shown can be selected in the info region E ile Help E Workbench Overview Genomes Alignment Group settings P Heat plot 5 Score overview ore t Primer score table epii Fragment Coord from Coord to Biomarker max min Targetmax Targetmin Targetavg Backmax Backavg Annotations in fragment Ames 1_ i J Y Bacillus_anthracis_Ames 1_3453 345201 345400 J 0 0 BA_0336 15 569 hypothetical protein Bacillus_anthracis_Ames 1_3454 345301 345500 a 0 0 BA_0336 85 469 hypothetical protein Bacillus_anthracis_Ames 1_3455 345401 345600 i 0 0 BA_0336 185 369 hypothetical protein Bacillus_anthracis_Ames 1_3456 345501 345700 0 0 BA_0336 285 269 hypothetical protein Bacillus_anthracis_Ames 1_3457 345601 345800 f 0 0 BA_0336 385 169 hypothe
8. n Show as fragments Show as continuous sequences ee a The detailed scores shows how each fragment scores against each genome in the target and background group This may help to identify which particular strain is causing a cross reaction Bacillus_anthracis_Ames 1_3451 Bacilus_anthracis_Ames 1_3452 _Bacillus_anthracis_Ames 1_3453 _Bacillus_anthracis_Ames 1_3454 Bacillus_cereus_Q1 Bacillus_cereus_E33L Bacillus_cereus_AH820 Bacillus_anthracis_Stene Bacillus_anthracis_Ames Bacillus_anthracis_A0193 It is also possible to export the table as its shown or the full data table without filtering as a tab delimited text file for further analysis in e g a spreadsheet program Primer alignment Primer score table tab To make a primer probe analysis create or use an existing comparison with the genomes of interest Create a primer alignment and press set primers enter your primers and run the analysis Bane 0287 yal 48 SSP See File Help EI Workbench Overview Genomes Analysis Active alignment Progress log i Copied 3 files into G5 gbk Name PPP Z New Copying genome Bacillus_cereus_Q1_uid58529 Complete Bacillus_cereus_Q1_uid58529 C q Comme jed 6 files into G4 b Ly tices 8 CEES m gt P1 a Pamei CCATCTTAACTTCGGTCCACA Fi Fragment size 200 gt P2 a Sliding
9. step size 100 CATA l gt Load default accurate Load default fast TTCCCACCCTTCTTTTAACAC 3 gt P4 Versions 2 0 0 running BLASI CAGAGGTTCTITCTAGCGTTIT BLASTN gt P5 CACGTTCTTTATCTCCAACCAA Z Set primers Nr Primers 0 gt P6 TCCGCATTACTTAGCCGTAAA gt ATATGGCTGATGCGCCTAAA Status gt P8 Created AATAATTGCACCGCCAAGAG Status t TTATGCTTTGCGCCTACAGA Run time gt P10 al Estimated time left CATCTCGCGTTTCTTGATGA m gt P11 Alignment contol anrasan Gea Od Start Continue Send pause signal Delete 4 m r Workspace gegenees Comparison Bacillus Alignment ppp Analysis default The primer alignment can now be explored in the Primer score table tab The unalignment index represents missmatches in the alignment plus non aligned nucleotides It is marked green if it is a perfect match A target group background group setting can be loaded from a fragmented alignment in the same comparison and the genomes are color coded accordingly so that a the primer matching can easily be compared to the target group definition Eile Help E Workbench Overview Genomes Alignment Analysis Select primer All 7 Filter by Database Database Primer name Unalignment index ity Query length Alignment length Bacillus_cereus_E33L Pi 20 13 Bacillus_cereus_E33L P12 7 20 13 Bacillus_cereus_AH820 PI a a Bacillus_cereus_AH820 P2 22 22 Bacillus_cereus_AH820 P3 21 a Bacillus_cer
10. this time A comparison is represented by a folder with the prefix comparison_ and it contains copies of the genomes and a file comparison geg that contains the genome list Gegenees alignment When a comparison is defined one or several alignments can be made The alignment represents a comparative calculation thatn be made at different resolutions An alignment is created in the Alignment perspective with the New button Two type of alignments can be made fragmented alignment and primer alignment the primer alignment is a special case and is described below in a separate heading The resolution of the alignment is controlled by two parameters the fragment size and the sliding step size The fragment size represents the scanning window size and it should be smaller than the genomic region you anticipate to find in the analysis For bacteria we recommend 200 frag size 100 slide size more accurate and 500 500 much faster and usually sufficient settings Small fragment sizes and sliding step sizes gives more demanding calculations When working with viruses and small sequences shorter settings may be needed It is also possible to use tblastx compares sequences on translated level i e aminocids This is very much more demanding and the datasets should be smaller If the sequences are pylogenetically far apart this may be a useful operating mode An alignment is represented on the disc by a folder with the prefix alignment_
11. thresholds 0 Color profile1 4 0 decimals Tools Autosort Sorting Move selection to row E Drag and drop single sorting Workspace gegenees Comparison Bacillus Alignment ttttest Analysis default Score overview tab The score overview tab shows a graphic representation of the biomarker scores biomarker scores are score values that rank all genomic regions fragments in how discriminating they are for the target group in terms of conservation no false negatives and uniqueness no false positives in the background There are three types of scores with different stringencies Biomarker score max min Biomarker score max average represents the highest stringency The high scoring fragments must be present and conserved in ALL target group genomes and must be absent or very diverged in ALL background genomes The score goes from 0 or negative values representing bad regions up to 1 which represents a perfect region The score is based on the worst background genome max score and on the worst target group genome min score Similar to Biomarker score max average but uses average values of the background group relaxes the uniqueness criterion Biomarker score average average Similar to Biomarker score max average but uses average values of the background group and the target group relaxes the uniqueness and the conservation criterion T
12. User Manual Gegenees V 1 0 1 Wihatiis GEsenees 2 ccccsscnagsececi costae etaan eade a ae eade Aae ee Taen aee eea oeat aie aeaaaee eaa aeee Eae ee eaae Sees 1 Version SYStEMi resse ieac nestis eeraa eda deai ie Ea Eea aaa EE OaE Arae aAA Aeee dE aade era Eaa iE 2 What SMEW rarene a E E E E E EEE 2 Wstalati Neessen aea aeaa aa a ea a a eE a na aeaaaee 2 AEN LLAT E E N EE E EE E A E neck E EE E E E E E E E E eee eee ected 3 The WOrkS aCe seisine eena ea a d a e aE E Ea EAE EAR EE a EE E sia 3 Thih loCal database isian inean aae arane aereas eeraa EE iea sanie TUE ETETE PE Ea EETA 4 Remote Site S essersi ssdescabscdevetanseedunsgs teenie sapcevelasteeesssteesae sees venus EENE EE ENARE EE SA 5 Ge genees genome formateren ie ea Eaa d e EE a a EE a eaa aaeain i Teis 6 Gegen es compari SON iriseora a E A aE TEE a TEA Taa e i aE iaeia 6 Gegenees alignment is seccdeccecacesveskacdecc cetasvesscchencteatesveekcodscsbachedtnes tes ecasataecaaesecdecSaentaveseaacdases eoageseateeveeets 6 PRAM SF AS MIM SIM ae Ser E E e a e RES 7 E E E E E A E E E E 7 Group s ttings tabier ae aaea aaa e a a ae EREE EE a a eE E eare EAE E 8 Heatplottab detena e E a a ca cseeeerees 9 SCOPE Overview tabescere ieie ssn sLecesaizeod sensed ai a a i aa eao ei ae ia 10 Viewing a signature in ArtemiS esssssssesssssssssssssssssssssssssssrsrsrsrsrsrsrsrsrsrsrsrrrssssssssssssssssssssssessesreesreeernte 12 SCOPE tabletah oeesi x tiecseueccossateeran gsccueande Gees aea n
13. a Ea aa a a a aO S E E aE 13 Primer alignment Primer score table tab ccccccssccccssccsssceessecessececssecessecesseeecsececeeseecsaeeeesaeceeaeeceseens 15 What is Gegenees Gegenees is a software that compares genome sequences Draft and Completed It was primarily developed for bacterial genomes but it is also possible to use on viruses and smaller eukaryotes Gegenees fragments the genomes and compares all pieces against all genomes Based on this all against all comparison a phylogenetic data can be extracted It is also possible to define a target group and search for genomic regions that have high specificity for the target group This is referred to as a genomic signature The genomic signature regions can be used to find candidate regions for the design of primers and probes for ne highly specific diagnostic assays There is also a built in primer probe verification system that compares new candidate or existing primers and probes to the genomic database and to the defined target groups Future versions will include more aspects of comparing next generation sequencing NGS data Version system The first released version was 1 0 1 Based on user feedback new versions will be released that solves problems and makes the program easier to use These versions will be called 1 0 1 1 0 2 New functionality will lead to version 1 1 1 1 2 1 To see your version select About Gegenees in the Help main menu About Geg
14. arget group maximum score Shows the best score in the target group self score This is usually 100 everywhere but if bad regions are present in the sequence e g nnnnnnnnnnnnnn they can be identified here Target group minimum score Shows the worst conservation within the target group Can be used to find highly conserved regions Target group average score Shows the average conservation within the target group Can be used to find highly conserved regions Background group maximum score Shows the best score in the background group This represent the worst cross reaction Background group minimum score Shows the minimum score in the background group Can be used to find regions that are not conserved in a group of very related genomes Background group average score Shows the average conservation within the background group The biomarker scores are drawn graphically There is possibilities to compare two types of scores by drawing one upwards from the coordinate axis and a second downwards The graphical view is spitted into two rows in order to use the computer screen optimal do not confuse the upper row with the upwards score there are upwards scores in both rows there is a possibility to exclude draft genomes in the calculations since they sometimes lack regions that in some cases may disturb the analysis When the mouse moves over the graph the subsequence fragment number and coordinate at the cursor position is shown in the
15. arison Delete Import comparison ry Workspace Gegenees_wsp Comparison Alignment Analysis The local database This is where you store your genomes A default database is always present but customized databases can also be made The default database represents a directory called database in the workspace Custom databases represent directories named database_NameOfCustomDatabase The local database content is shown in the middle part of the Genomes perspective If the database is large subsets can be shown by entering a case sensitive filter text e g Bacillus to show only the genus Bacillus There is also a filter for showing only sequences in draft or complete form Below is a toolbar with functions for e refreshing database content from disk if you make a manual import of genomes e Starting an import Wizard e Selecting all visible genomes with the current filter e Deleting selected genomes e Bring up an information box about the selected genomes size GC content nr contigs etc e Copy genomes i e put genomes in an Gegenees specific clipboard e Paste genomes from the Gegenees specific clipboard e Change name or type complete Draft for a genome e copy to the current comparison genomes can also be copied from a comparison into the local database if needed e g if you get a ready made comparison File Help EI Workbench Overview O Genome Alignment
16. ective There is an export button after the Nr of genomes field that can be used to export a list of accession numbers for the genomes Primer alignment Primer alignments is a special type of alignment where primers and or probes are used instead of fragments This is usually not as demanding calculation as fragmented alignments The primer alignment is analyzed in a special tab in the analysis perspective see below Analysis The analysis perspective contains different tools for analyzing the data from a completed alignment The tabs are Group Settings A tabular view of the genomes that allows definition of the target and background groups for the analysis Heat plot This tab represents an phylogenomic overview of the data based on average similarities Score overview This tab represents a graphical overview and exploration tool of the genomic regions that are unique or discriminatory for the target group Score table This tab represents a tabular exploration tool for the genomic regions that are unique or discriminatory for the target group Primer score table This tab allows analysis of primer alignments to compare specificity of primers and probes based on the genomic data and the target group settings Group settings tab The group settings tab allows the target group and the background group to be define e The target group represents the genomes that you are interested in You might want to find discriminatory genom
17. enees _ IB Gegenees Version 1 0 1 For more info visit http www gegenees org Installation Details K ee What s new This is the first official user manual Installation The software can be downloaded from http www gegenees org There are several variants uploaded depending on your operating system OS Windows Macintosh and linux are supported You must also chose the correct processor architecture 32 bit or 64 bit To see the architecture In Windows 7 select properties when right clicking computer In Macintosh select About this Mac from the Apple menu Mac OS X 10 5 or greater is a 64 bit In Linux ina terminal type uname a If x86_64 or ia64 is shown the system is 64 bit Java needs to be installed You may check your Java version at this link http java com en download installed jsp Download and extract the compressed Gegenees program Run the Gegenees program from in the Gegenes folder You will then be asked to specify a Workspace This is the place where all your genomes and comparisons will be stored In the current version the workspace directory name SHOULD NOT CONTAIN SPACES Neither should any of the directories above contain spaces This is because the BLAST program uses spaces to separate command arguments A version that is compatible with spaces is under development but at this stage spaces should be avoided
18. eus_AH820 P4 0 22 22 Bacillus_cereus_AH820 P5 22 22 Bacillus_cereus_AH820 PE 7 a a Bacillus_cereus_AH820 P7 86 20 14 Bacillus_cereus_AH820 P8 12 20 17 Bacillus_cereus_AH820 Pg 0 20 13 Bacillus_cereus_AH820 P10 20 17 Bacillus_cereus_AH820 PH 7 20 13 Bacillus_cereus_AH820 P12 i 20 Bacillus_anthracis_Steme P1 7 a Bacillus_anthracis_Steme P2 2 Bacillus_anthracis_Steme 7 a Bacillus_anthracis_Stemne 22 Bacillus_anthracis_Steme 0 22 Bacillus_anthracis_Steme 2 Bacillus_anthracis_Steme 7 20 Bacillus_anthracis_Steme 0 20 Bacillus_anthracis_Steme 0 20 Bacillus_anthracis_Steme 0 20 a Bacillus_anthracis_Steme Bacillus_anthracis_Steme Bacillus_anthracis_Ames Racillus anthracis Ames SX SSSSSS8RRRABA Workspace gegenees Comparison Bacillus Alignment ppp Analysis default If a primer row is double clicked with the mouse or the show alignment button is pressed the alignment of this primer against this genome is shown The table and the alignment views can also be exported as text files D BLAST result file Bacillus_anthracis_Sterne vs P 2 BLASTN 2 2 25 a Reference Zheng Zhang Scott Schwartz Lukas Wagner and Webb Miller 2000 A greedy algorithm for aligning DNA sequences J Comput Biol 2000 7 1 2 203 14 Database C gegenees comparison_Bacillus alignment_ppp G2 fna 1 sequences 5 228 663 total letters m Query P1 Length 21 Score E Sequences
19. feature ature ture e mi misc_feature mi misc_feature e misc_fet misc_fea 1 7400 1s79600 ise1s00 issacoo 1586200 HUY ONE OE E A UAE Ua E E A A E OE A GBAA lisss4o0 15906500 1592800 soso00 1597200 1s99400 aso1600 aso3e00 1606000 DOOYOO OLOUN ONO MMMA WOON A AO TOOU UOO 0U OOD OOMOO 0 D OOOO O OUNO UOUN 000I AUDA ON YOMI ITN r OT ARMY a0 i mi VU 00 1 000000 A O NL MR misc_feature 1608200 161040d I MONNINA IIN NI GBA flgD JE GBAA 1698 GBAA 1701 m T a R a a LOULO N m a N a m 3 GBAA 1683 GBAA 1687 GBAA 1692 GBAA 1695 j GBAA 1707 fli T A a E a A O a a GBAA GBAA 1697 1704 C GBAA 1 4 lt E tiin 1579866 1581218 flagellar capping protein misc_feature 1580401 1580700 I nisc_feature 1580601 1581100 pee 1581001 1581200 misc_feature 1581101 1581300 Wisc feature 1581201 1581400 _ misc_feature 1581301 1581600 misc_feature 1581501 1582100 E cBaa_1673 1581599 1581871 hypothetical protein misc_feature 1582001 1582600 198 1582241 1582648 flagellar basal body rod protein FlgB W nisc_feature 1582501 1583100 E tige 1582669 1583082 flagellar basal body rod protein FlgC misc_feature 1583001 1583500 fliE 1583099 1583398 flagellar hook basal body protein FliE s 1cezanr 1 200n a I Score table tab In the score table tab details about the fragments representing either e a selection e g
20. he folder name corresponds to the Name of the genome as appearing in Gegenees and the type of the genome Draft Complete The last part of the folder name has the format Draft or Complete In future versions more types may be introduced The folder contains at least one Genbank formatted file with extension gbk or gbff If there are several subsequences contigs they may be in the same file or in separate files Genomes are stored in the database folder s but also in the comparison folders Thus the comparison keeps a copy of the part of the database it is using If the database is modified the genomes belonging to a comparison is still untouched in the comparison folder Gegenees comparison The Gegenees comparison is a package containing e alist of genomes that belongs to the comparison e acopy of all the genomes as they looked like when they were added to the comparison e typically at least one alignment which represents a comparative calculation at a certain resolution se below e Files coupled to the analysis of the alignment s Thus the first step when making an comparative analysis is to define the genomes This can be done by copying the from the local database part in the Genomes perspective into the current comparison in the right part of the Genomes perspective This is typically done with the green arrow The list of genomes and the genome copies are then produced No alignment is created at
21. ic regions that can be used to design specific molecular assays You might also be interested in finding and analyzing genomic regions that are associated with a specific phenotypic trait that the target group share The target group should ideally contain genomes that represents the genomic variability in the group as well as possible e The background group represents other genomes The background should contain the genomes that are most likely to give a cross reaction false positive in an assay For best result close neighbor strains isolates that do not contain the phenotypic trait should be included e Excluded genomes You may also chose to exclude genomes from the analysis e The reference genome is the genome where the nucleotide coordinate system and the annotations are collected from For a high stringency biomarker analysis se below the best annotated genome in the target group should be used For lower stringencies in the biomarker analysis the result may be slightly different depending on which target genome is selected as reference It is then good to look at the data with different reference genomes A reference genome must be chosen to be able to look at the score overview and score table tabs Several group settings can be created from the same dataset e g different subtypes with the New or Make a copy buttons ic tee OM DDL ee oes Eile Help E Workbench Overv
22. ically which often is sufficient There are sorting possibilities built in for the heat plots It is possible to move genomes or group of genomes with the Move selection to row field or by right clicking it and select move from the context menu The target and background group settings can also be modified from the right click context menu If Drag and drop single sorting is selected genomes can be draged with the mouse one by one The sort is saved and if several sorts are wanted new ones can be created with the new button There is also an autosort function that tries to minimize the distances between the rows There is also an export button that allows of the phylogenomic data e export of the table in tab format for work in spreadsheet programs e export as html Can be opened in a web browser or converted to publication grade figures This is sometimes a better overview if the table is very large e export nexus file Use this export to create dendrograms in e g SplitsTree ee eee File Help FY Workbench Overview Genomes Alignment Group settings leat plot LI Score overview Score table E ESH E Primer score table 2 Bacillus_anthracis_Ames 3 Bacillus_anthracis_Steme i i 4 Bacillus_cereus_AH820 5 Bacillus_cereus_ 6 Bacillus_cereus_O 1 Bacillus_anthracis_40193 wss eo Current Heatplot heatl New Bs Heat settings Show score Show core C Use
23. iew Genomes Alignment f Group settings E Heat plot Score overview BEL Score table BE Primer score table is Search Current analysis Organism Target Background Reference Exclude default Bacillus_anthracis_40193 YES New Make a copy Delete Bacillus_anthracis_Ames YES YES Bacillus_anthracis_Sterne YES Grouping modification Bacillus_cereus_AH820 YES Select an z Bacillus_cereus_E33L YES as target organem Bacillus_cereus_01 YES Select as background organism Select as reference organism Exclude organism lt m Workspace gegenees Comparison Bacillus Alignment ttttest Analysis default Heat plot tab The heat plot tab gives an phylogenomic overview of the data shown The average normalized BLAST score values of all fragments are shown It is also possible to define threshold values meaning that that fragments falling under the threshold is not used to calculate the average similarity value This gives a better phylogenetic signal since the similarity value is only based on conserved genetic material the core genome It is also possible to see how large the core genome is at the specified threshold select show core insted of show score It is possible to change the color profile of the heatplot so that differences are highlighted as well as possible for the particular dataset The number of decimals shown can be changed The genomes are sorted alphabet
24. producing significant alignments Bits Value NC 005945 39 9 3e 005 gt NC_005945 Length 5228663 Score 39 9 bits 21 Expect Identities 21 21 100 Gaps Strand Plus Plus 3e 005 0721 0 Query 1 CCATCTTAACTICGGICCACA 21 UA COT O Sbjct 5088581 CCATCTTAACTTCGGTCCACA 5088601 Lambda K H SE 0 621 tsiz Export T
25. thracis_Ames 1_4487 448601 448800 i 0 0 Bacillus_anthracis Ames 1 4488 448701 448900 H 0 0 Fragment filtering Info All subsequences Biomarker score max min X V Biomarker range 0 8 Fragment range 0 0 Showsequenee Workspace gegenees Comparison Bacillus Alignment ttttest Analysis default f Show sequence displays the actual sequences of the fragments and it is possible to fuse adjacent and overlapping fragments into continuous sequences The sequences can be exported to a Fasta file or sent to a web page ready for a blast comparison at NCBI aaa 2 w bBacillus_anthracis_Ames 1_3451 1_3452 1_3453 1_3454 1_3455 1 tgagatcttttagacaataactgaaaagggaatttcttaagaatgaataaagctatca p gtatctitttgttgtaacatatactttgtatatatggagtatttggtttgattaaattta gtttaasatgaggcaacttcctttqgagagtigtctttatgctttacagtaaatata taggcaagtaattagagtgaaatggggaaggttgaagtgaasaagaagaaaaagttatc gttatgaaatttttaatatatatgctaatagcaattgtagttattaattggatctataag aacacccgaagagaaaaaagcagacttagaagaaaaagttgcgagctatgaagagtt atcacactgtataacatatgaagattggaatottgataaagggtgggaacaaaaatttaa atacttigtataatgatcctcaagaatycttygaaasagaattattatatygcggaacg atggtacggagctaacaaggggaagtagccasattagtatttcataacacagattactat tlacagaagaagaattaaaagatyatattcasacggaggcqgaasatasatacaaatta ctigaagaaattcagcgcgagtgtasatctacattgcttgggggttttcatatgattat tatacagatggatatgattatatastagaggacacatcaggcga
26. tical protein Bacillus_anthracis_Ames 1_3458 345701 345900 i 0 0 BA_0336 485 69 hypothetical protein Bacillus_anthracis_Ames 1_3459 345801 346000 E 0 0 Bacillus_anthracis_Ames 1_4474 447301 447500 u 0 0 BA_0427 1354 25 RNA methyltransferase Bacillus_anthracis_Ames 1_4475 447401 447600 p oo BA_0428 14 1110 prophage LambdaB a4 si Bacillus_anthracis_Ames 1_4476 447501 447700 i 0 0 BA_0428 114 1010 prophage LambdaBa04 Bacillus_anthracis_Ames 1_4477 447601 447800 ii 0 0 BA_0428 214 910 prophage LambdaBa04 si Bacillus_anthracis_Ames 1_4478 447701 447900 B 0 0 BA_0428 314 810 prophage LambdaB a04 si Bacillus_anthracis_Ames 1_4479 447801 448000 j 0 0 BA_0428 414 710 prophage LambdaB a4 si Bacillus_anthracis_Ames 1_4480 447901 448100 ii 0 0 BA_0428 514 610 prophage LambdaBa04 si Bacillus_anthracis_Ames 1_4481 448001 448200 y 0 0 BA_0428 614 510 prophage LambdaBa04 si Bacillus_anthracis_Ames 1_4482 448101 448300 i I 0 0 BA_0428 714 410 prophage LambdaB a4 si Bacillus_anthracis_Ames 1_4483 448201 448400 i 0 0 BA_0428 814 310 prophage LambdaBa04 si Bacillus_anthracis_Ames 1_4484 448301 448500 yi 0 0 BA_0428 914 210 prophage LambdaBa04 si Bacillus_anthracis_Ames 1_4485 448401 448600 ii 0 0 BA_0428 1014 110 prophage LambdaBa04 Bacillus_anthracis_Ames 1_4486 448501 448700 i 0 0 BA_0428 1114 10 prophage LambdaB a04 si Bacillus_an
Download Pdf Manuals
Related Search