Home

PathNet Transcriptional Reporter Lentivectors User Manual

1. Packaging Plasmid Kit Origin Catalog pPACKF 1 FIV based LV100A 1 pPACKH1 HIV based LV500A 1 For Annealing TRE Oligonucleotides e 2X DNA Annealing Buffer 20mM Tris pH 7 8 100mM NaCl 0 2mM EDTA 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual For Phosphorylation of Annealed Oligonucleotides e T4 Polynucleotide Kinase Recommended New England BioLabs T4 Polynucleotide Kinase Cat M0201S For Ligating and Transforming Reporter Vector Construct e T4 DNA Ligase and ligation reaction buffer Recommended New England BioLabs T4 DNA Ligase Cat M0202S Dilute to 5 U ul with the provided 1X reaction buffer just before use e Competent E coli cells RecA Recommended Invitrogen One Shot OmniMAX 2 T1 Phage Resistant competent cells Cat C8540 03 e Petri plates containing LB Agar media with 50 ug ml Ampicillin For Screening Inserts and sequencing e Taq DNA polymerase reaction buffer and dNTP mix Recommended Clontech Titanium Taq DNA polymerase Cat 639208 e PCR machine e Forward and reverse primers see Appendix for the sequences e 2 3 1X TAE Agarose gel For Purifying Reporter Vectors after Cloning e Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Maxi Kit Cat 12362 The following combination of kits can be used for Midi scale preparation of endotoxin free DNA gt QlAfilter Plasmid Midi Kit Cat 12243 and E
2. System Biosciences SBI User Manual HIV Based PathNet Transcriptional Reporter Vectors plasmid dscGFP Reporter Vector Catalog Luciferase Reporter Vector Catalog pTRH1 mCMV dscGFP TR500PA 1 pTRH2 CMV Luc TR601PB 1 pTRH1 CMV dscGFP TR501PA 1 pTRH2 p53 Luc TR602PB 1 pTRH1 p53 dscGFP TR502PA 1 pTRH2 NFkB Luc TR603PB 1 pTRH1 NFkB dscGFP TR503PA 1 pTRH2 AP1 Luc TR604PB 1 pTRH1 AP1 dscGFP TR504PA 1 pTRH2 cFos Luc TR605PB 1 pTRH1 cFos dscGFP TR505PA 1 pTRH2 cJun Luc TR606PB 1 pTRHI cJun dscGFP TR506PA 1 pTRH2 FosB Luc TR607PB 1 pTRH1 FosB dscGFP TR507PA 1 pTRH2 JunD Luc TR608PB 1 pTRH1 JunD dscGFP TR508PA 1 pTRH2 DP1 Luc TR609PB 1 pTRH1 DP1 dscGFP TR509PA 1 pTRH2 ErbA Luc TR610PB 1 pTRH1 ErbA dscGFP TR510PA 1 pTRH2 REVERB Luc TR611PB 1 pTRH1 REVERB dscGFP TR511PA 1 pTRH2 Sp1 Luc TR612PB 1 pTRH1 Sp1 dscGFP TR512PA 1 pTRH2 Sp3 Luc TR613PB 1 pTRH1 Sp3 dscGFP TR513PA 1 pTRH2 NMyc Luc TR614PB 1 pTRH1 NMyc dscGFP TR514PA 1 All plasmids are shipped at a concentration of 200 ng ul and an amount of 25 ug All kits are shipped in dry ice and should be stored at 20 C upon receipt Properly stored kits are stable for 12 months from the date received For the complete list of available transcriptional reporter vectors please visit our website at www systembio com Page 6 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 Transcript
3. Page 26 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 27 System Biosciences SBI User Manual VI Licensing and Warranty Statement Limited Use License Use of the PathNet Transcriptional Reporter Lentivector i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warra
4. 11668 027 Clontech s CLONfectin Cat 631301 For TRE activation studies using transfection it is important to optimize the selected transfection protocol and then keep the parameters constant to ensure reproducible results Once you identify a functional TRE construct you can package this construct into lenti pseudoviral particles and efficiently transduce it into any target cells of choice For this purpose you will need to purchase the pPACKF1 for FIV based pTRF constructs or pPACKH1 for HIV based pTRH constructs Lentivector Packaging Kit from SBI see Appendix Figure 3 schematically shows all steps which need to be performed in order to generate pseudoviral packaged Transcriptional reporter constructs A detailed protocol with descriptions of each step can be found in the Lentivector Packaging Kit manual also available on SBI s website www systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual lentiviral Ig pVSV G packaging pTR TRE N plasmid S P Packaging Plasmid zl Reporter Construct Step 1 Co transfect packaging plas 293T Packaging mid and TR construct into 293 Cells celis C 2 Collect pseudoviral particles Pseudoviral X a from supernatant Particles 3 E 6 containing TRE construct J Step 3 Transduction and stable inte gration of TRE construct into genomic DNA of target cells Stable Reporter E s Mec Cell Line Step 4 A
5. Conc Amount pTR mCMV dscGFP 200 ng ul 10 ug c Fos TRE Ligation Control 100 nM 10 ul Forward cPPT PCR Primer 10 uM 50 ul Reverse2 mCMV PCR Primer 10 uM 50 ul FIV Based PathNet Transcriptional Reporter Vectors plasmid dscGFP Reporter Vector Catalog Luciferase Reporter Vector Catalog pTRF1 mCMV dscGFP TR1OOPA 1 pTRF3 CMV Luc TR201PC 1 pTRF2 CMV dscGFP TR101PB 1 pTRF2 p53 Luc TR202PB 1 pTRF1 p53 dscGFP TR102PA 1 pTRF2 NFkB Luc TR203PB 1 pTRF1 NFkB dscGFP TR103PA 1 pTRF2 AP1 Luc TR204PB 1 pTRF1 AP1 dscGFP TR104PA 1 pTRF2 cFos Luc TR205PB 1 pTRF1 cFos dscGFP TR105PA 1 pTRF2 cJun Luc TR206PB 1 pTRF1 cJun dscGFP TR106PA 1 pTRF2 FosB Luc TR207PB 1 pTRF1 FosB dscGFP TR107PA 1 pTRF2 JunD Luc TR208PB 1 pTRF1 JunD dscGFP TR108PA 1 pTRF2 DP1 Luc TR209PB 1 pTRF1 DP1 dscGFP TR109PA 1 pTRF2 ErbA Luc TR210PB 1 pTRF1 ErbA dscGFP TR110PA 1 pTRF2 REVERB Luc TR211PB 1 pTRF1 REVERB dscGFP TR111PA 1 pTRF2 Sp1 Luc TR212PB 1 pTRF1 Sp1 dscGFP TR112PA 1 pTRF2 Sp3 Luc TR213PB 1 pTRF1 Sp3 dscGFP TR113PA 1 pTRF2 NMyc Luc TR214PB 1 pTRF 1 NMyc dscGFP TR114PA 1 All plasmids are shipped at a concentration of 200 ng ul and an amount of 25 ug All kits are shipped in dry ice and should be stored at 20 C upon receipt Properly stored kits are stable for 12 months from the date received For the complete list of available transcriptional reporter vectors please visit our website at www systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 5
6. Looney D J and Wong Staal F 2003 Lentiviral nucleic acids and uses thereof US Patent NO 6 555 107 B2 Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D 1998 J Virol 72 8463 8471 Miyoshi H Blomer U Takashi M Gage F N Verma I M 1998 J Virol 72 8150 8157 Zufferey R Donello J E Trono D Hope T J 1999 J Virol 73 2886 2892 Ramezani A Hawley T S Hawley R G 2000 Mol Ther 2 458 469 Leung T H Hoffmann A Baltimore D 2004 Cell v 118 453 464 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual V Appendix A Map of pTRF1 mCMV dscGFP Vector CMV s Tg Multiple Cloning Site BRE for TRE ais pTRF1 mCMV dscGFP Spe 5 983 bp NV pUC ORI Cat 4 TR100PA 1 add dscGFP SV40 Poly A 3 ALTR WPRE B Map of pTRH1 mCMV dscGFP Vector RSV s LTR gag Multiple RRE n pTRH1 mCMV dscGFP Cla 3 6 801 bp jw ba UCORI fat TDCANDA 1 E pe I p Cat TR500PA 1 RNN BamHI SV40 ORI SV40 Poly A 3 ALTR WPRE ATTTTATCGATGAATTCTAGAACT AGT TAGG TAAAATAGCTACTTAAGATCTTGATCAATCC Page 22 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 C Map of pTRF2 mCMV Luc Vector CMV S LTR R Amp gag RRE TRE cPPT Cloning a Site pTRF2 mCMV Luc MENN SV40 ORI Luciferase
7. Screen for TRE template inserts in lentiviral construct Clones with TRE insert can be identify using the Forward cPPT PCR Primer and Reverse2 mCMV PCR Primer provided in the kit see Appendix for the sequence of the primers a Prepare a PCR master as follows tmxn 10 rxn Composition 0 5 yl 5 ul Forward cPPT PCR primer 10 uM 0 5 ul 5 ul Reverse2 mCMV PCR primer 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 ul 25 ul 10X PCR Reaction Buffer 19 5 ul 195 ul Deionized water 0 5 ul 5 ul Taq DNA polymerase approx 5 U l 24 0 ul 240 ul Total volume b Mix the master mix very well and aliquot 24 ul into each well of 96 well PCR plate or individual tubes c Add 1 ul of each bacterial culture from C 1 into each well or tube d Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 30 sec 25 cycles 68 C 3 min 1 cycle e Take 5 ul of the PCR reaction and run it on a 2 3 agarose EtBr gel in 1X TAE buffer The expected size of the PCR product if there is no insert present is 277 bp for FIV based copGFP vectors 300 bp for FIV based Luciferase vectors 150 bp for HIV based copGFP vectors and 175 bp for HIV based Luciferase vectors With the positive control c Fos insert the size is an additional 74 bp For positive clones with your insert add the size of your insert to the appropriate size above Grow a positive clone with TRE insert in an appropriate amount of LB Amp Brot
8. WPRE D Map of pTRH2 mCMV Luc Vector RSV s LTR RRE TRE icai pTRH2 mCMV Luc cPPT Cloning y 7 7 kb mcmy Site SV40 ORI SV40 Poly A Luciferase 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual E pTRF1 mCMV dscGFP Features CMV 5 LTR 1 415 Hybrid CMV promoter R US long terminal repeat required for viral packaging and transcription gag 762 1011 Packaging signal 1012 1143 Rev response element binds gag and involved in packaging of viral transcripts Central polypurine tract includes DNA Flap cPPT 1150 1390 region involved in nuclear translocation and integration of transduced viral genome Human cytomegalovirus CMV constitutive 139171149 promoter for m of pisa Copepod green fluorescent protein similar to regular EGFP but with brighter color as a dscGFP 1766 2566 reporter for the transfected transduced cells a destabilizing ds peptide on the C end shortens the half life time of the mature protein to 1 hour enhances the stability of the viral transcripts Required for viral reverse transcription self 3 ALTR AU3 3283 3498 inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA SV40 Poly A 3499 3630 Transcription termination and polyadenylation SV40 Ori 3639 3785 Allows for episomal replication of plasmid in eukaryotic cells pUC Ori 4155 4828 C Allows for hi
9. cell can be tested by transforming with any circular plasmid 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual Check antibiotic selection The plates used for cloning should contain 50 100 ug ml ampicillin in the media 2 No product was amplified from selected clones Confirm activity of the Taq DNA polymerase Test the activity of the enzyme reaction by amplifying a known sequence from any plasmid DNA Replace the reagents if they demonstrate poor activity Page 18 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 IV References Buchschacher G L and Wong Staal F 2000 Development of lentiviral vectors for gene theraphy for human diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors concentration to a very high titer and efficient gene transfer into mammalian and non mammalian cells Proc Natl Acad Sci USA 90 8033 8034 Cann A J ed 2000 RNA Viruses A Practical Approach Oxford Univ Press Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A third generation lentivirus vector with a conditional packaging system J Virol 72 8463 8471 Gould D J and Favorov P 2003 Vectors for the
10. treatment of autoimmune diseases Gene Therapy 10 912 927 Lee N S Dohjima T Bauer G Li H Li M J Ehsani A Salvaterra P and Rossi J 2002 Expression of small interfering RNAs targeted against HIV 1 rev transcripts in human cells Nature Biotechnol 20 500 505 Morgan R A Cornetta K and Anderson W F 1990 Application of the polymerase chain reaction in retroviral mediated gene transfer and the analysis of gene marked human TIL cells Hum Gene Ther 1 135 149 Pfeifer A Kessler T Yang M Baranov E Kootstra N Cheresh D A Hoffman R M and Verma I M 2001 Transduction of liver cells by lentiviral vectors Analysis in living animals by fluorescence imaging Mol Ther 3 319 322 Qin X F An D S Chen I S and Baltimore D 2003 Inhibiting HIV 1 infection in human T cells by lentiviral mediated delivery of small interfering RNA against CCR5 Proc Natl Acad Sci USA 100 183 188 Quinn T P and Trevor K T 1997 Rapid quantitation of recombinant retrovirus produced by packaging cell clones Biotechniques 23 1038 1044 Sui G Soohoo C Affar E B Gay F Forrester W C and Shi Y 2002 A DNA vector based RNAi technology to suppress gene expression in mammalian cells Proc Natl Acad Sci U S A 99 5515 5520 Curran MA Nolan GP Nonprimate lentiviral vectors Curr Top Microbiol Immunol 2002 261 75 105 Curran MA Nolan GP Recombinant feline immunodeficiency virus vect
11. 266 5066 Toll Free 650 968 2200 outside US Page 29
12. 4 G Properties of dscGFP Fluorescent Protein sss 24 H Related Products sse 25 L TechnicalSupport ss sss 26 VI Licensing and Warranty Statement 27 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual I Introduction and Background A B Overview This manual provides details and information necessary to develop PathNet Transcriptional Reporter TR constructs in lentiviral vectors plTRH1 mCMV dscGFP and pTRF1 mCMV dscGFP Reporter Vectors Specifically it provides instructions on designing and synthesizing Transcriptional Response Element TRE inserts cloning TREs into the pTRH pTRF Vectors and confirming successful cloning This manual does not include information on packaging pTRH or pTRF Vector constructs into pseudoviral particles or transducing your target cells of your choice with these particles This information is available in the user manual provided with the Lentivector Packaging Kit from SBI Multiple Cat s which is available on the SBI web site www systembio com Before using the reagents and materials supplied with this system please read the entire manual Lentiviral Transcriptional Reporter System Advantages of lentivector technology include Ready to use pre packaged constructs with a wide range of Transcriptional Response Elements TREs for multiple transcriptional factors Lentiviral reporter constructs can efficiently transduce nea
13. 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Unfortunately TRE sequences for any transcriptional factor in different promoters are not conserved TRE sequences can be found in the TRANSFAC professional Data Base www biobase com or in the public version of this Data Base www gene regulation com Because each transcriptional factor has multiple TREs derived from different promoters we recommend to use a consensus sequence for each particular factor to make a reporter construct However this consensus sequence may not be the most efficient recognition element for all cell types SBI transcriptional reporter vectors are designed for simple rapid and convenient assessment of the in vivo activation of signal transduction pathways SBI has created a series of inducible reporter plasmids that contain three different reporter genes driven by a minimum CMV promoter plus a defined inducible response element see Appendix These plasmids are particularly suited for the in vivo readouts of signal transduction pathways since these TFs are convergent points of many signal transduction pathways Because the lentiviral sequences are integrated into the genome activation of reporter gene expression reflects changes in activity of the desired transcriptional factors in a natural chromatin environment in comparison to commonly used plasmid transfection most of which stay in the cytoplasm These lentiviral systems
14. NA reducing the number of genes from HIV 1 that are used in this system e Number of HIV 1 viral genes necessary for packaging replication and transduction is reduced to three gag rev and pol and these genes are expressed from different plasmids lacking packaging signals and significant homology to pSIH expression vectors VSV G expression vector or each other to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev will be present in the packaged viral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Pseudoviral particles will carry only the expression construct of your target gene 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual To avoid any possible contamination and maintain a clean laboratory environment we also recommend following these standard safety practices Page 10 Wear double gloves face protection and lab coat at all times Perform work in a limited access area in a Biological Safety Cabinet Class Il and post biohazard warning signs Minimize splashes or aerosols with careful pipetting Take precautions with needles blades etc Decontaminate work surfaces at least once a day and after any spill of viable material Decontaminate all cultures stocks and other biological wastes before disposal us
15. SSRI System Biosciences PathNet Transcriptional Reporter Lentivectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR500A 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 10 070201 contained in this user manual PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 Contents l Introduction and Background AY OVerVIeW ace arean ront honor fone Sones Ap he 2 B Lentiviral Transcriptional Reporter System ss i 2 C Transcriptional Response Elements 4 D List of Components and TRE Sequences 5 E Additional Required Materials sists 7 F Safety Guidelines sss sss 8 ll Protocol A Transcriptional Response Element Design and Synthesis 10 B Cloning of TRE into pTR Vector sss 11 C Identify Clones with TRE Inserts ss 12 D Testing of TRE Constructs sss 13 lll Troubleshooting sss 16 IV References osos 18 V Appendix A Map of pTRF1 mCMV dscGFP Vector 21 B Map of pTRH1 mCMV dscGFP Vector 21 C Map of pTRF2 mCMV Luc Vector ssi ica 22 D Map of pTRH2 mCMV Luc Vector nna 22 E pTRF1 mCMV dscGFP Features ss 23 F Sequences of the primers used for clone identification __ 2
16. are useful in studying the in vivo effects of a new gene growth factor or drug candidate on the signaling pathway Basic reporters may also be used for cloning novel sequences in order to identify possible response elements A T 8 z 8 4c A im C C anamanna LE amp amp o o jd E 10 10 o w 10 10 10 10 Q g z 2 sg x B D 8S 5s Jd m oO amp amp i 1 10 iP 10 i 10 10 ie 10 Figure 2 Analysis of p53 activity in HeLa cells transduced with different TR constructs A pTRH1 mCMV dscGFP negative control B pTRH1 CMV dscGFP positive control C pTRH1 p53 dscGFP basal level of p53 D pTRH1 p53 dscGFP p53 was activated by PRES 229 treatment For your convenience SBI provides control TR vectors and constructs for several TFs in ready to use form as pseudoviral particles If you prefer to do the packaging step yourself SBI supplies the packaging plasmids which can be purchased separately Additional TF specific constructs of your choice packaged in Page 4 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 pseudoviral particles or provided as a plasmid are available as a custom service D List of Components PathNet Transcriptional Reporter Vector Cloning Kits pTRF1 mCMV dscGFP TRE Cloning Kit Cat TR100A 1 pTRH1 mCMV dscGFP TRE Cloning Kit Cat TR500A 1 Component
17. ctivate transcriptional factor specific signaling path T wa EON Step 5 Measure reporter activity e g by FACS luminescence colo SS A rimetry Fig 3 Schematic presentation of the packaging procedure for pTR constructs and making of stable cell lines The Lentivector Packaging Kit User Manual includes the procedural information for packaging the viral vector This user manual is also available on the SBI web site www systembio com Although you can create stable transfectants with the lentiviral construct using standard transfection and selection protocols transduction of the lentiviral TRE construct using packaged pseudoviral particles is the most efficient way to deliver TRE constructs in a wide range of cells including dividing non dividing and hard to transfect cells Page 16 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 Ill Troubleshooting 1 Getting Few or No Clones Use positive ligation control If you did not use the positive control repeat all steps e annealing phosphorylation and ligation to check the quality of your reagents Check design of the TRE insert Check the sequence of the Transcriptional Response Element oligonucleotides to ensure that after top bottom strand annealing the ends present on both 5 ends overhang for proper annealing with the restricted ends of the linear
18. ditional transcription to 1 hour The copGFP protein has very bright fluorescence that exceeds at least 1 3 times the brightness of EGFP the widely used Aequorea victoria GFP mutant The copGFP protein emits green fluorescence with the following characteristics emission wavelength max 502 nm excitation wavelength max 482 nm quantum yield 0 6 extinction coefficient 70 000 M cm Due to its exceptional properties copGFP is an excellent fluorescent marker which can be used instead of EGFP for monitoring delivery of FIV constructs into cells 888 266 5066 Toll Free 650 968 2200 outside US Page 25 System Biosciences SBI User Manual H Related Products e PathNet Lentiviral Transcriptional Reporter Constructs in Pseudoviral Packaged form gt Many see Section I D or visit our website for a current list of available TR packaged constructs Provided in pre packaged ready to use pseudoviral particles these HIV and FlV based reporter constructs allow you to transduce and analyze a wide variety of TF specific constructs in a wide range of cells Based on the highly efficient lentiviral system the PathNet Transcriptional Reporter Vectors provide a convenient and cost effective system to deliver and stably integrate sequences of your choice into the host genome e PathNet Pooled TF Binding Site Library in Plasmid form Cat TR550PA 1 After packaging the plasmid library into pseudoviral pa
19. e Element oligonucleotides 1 A 50 nmol scale reaction for DNA oligonucleotide synthesis with regular desalting purification is sufficient for cloning into the TR lentivectors 2 For the best cloning efficiency we recommend using phosphorylated oligonucleotides which can typically be ordered from the supplier Alternatively you can phosphorylate the oligonucleotides after synthesis using T4 polynucleotide kinase The phosphorylation protocol is provided below in step B 2 3 In addition to the Transcriptional Response Element sequence the oligonucleotide needs to include a 2 or 4 base sequence at the 5 end of each oligonucleotide which will be complementary to the desired cloning sites in the pTR vector Typically we clone into the EcoR1 and Spe1 sites see diagram below These sequences form sticky ends that facilitate ligation with the linear vector The annealed sequences should have a double stranded Transcriptional Response Element structure as shown in the following diagram Top strand 5 AATTNNNNNNNNNNNNNNNNNNN 3 3 NNNNNNNNNNNNNNNNNNNGATC 5 Bottom strand 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual B Cloning of TRE into pTR Vector 1 Anneal TRE Oligonucleotides a Dissolve the TRE oligonucleotides in an appropriate amount of deionized water to a final concentration of 1 uM b Prepare the ds TRE oligonucleotide as follows 25 ul Top stra
20. er to mouse retina following intravitreal injection J Gene Med 2002 Sep Oct 4 5 463 9 Haskell RE Hughes SM Chiorini JA Alisky JM Davidson BL Viral mediated delivery of the late infantile neuronal ceroid lipofuscinosis gene TPP I to the mouse central nervous system Gene Ther 2003 Jan 10 1 34 42 Price MA Case SS Carbonaro DA Yu XJ Petersen D Sabo KM Curran MA Engel BC Margarian H Abkowitz JL Nolan GP Kohn DB Crooks GM Expression from second generation feline immunodeficiency virus vectors is impaired in human hematopoietic cells Mol Ther 2002 Nov 6 5 645 52 Stein CS Davidson BL Gene transfer to the brain using feline immunodeficiency virus based lentivirus vectors Methods Enzymol 2002 346 433 54 Browning MT Schmidt RD Lew KA Rizvi TA Primate and feline lentivirus vector RNA packaging and propagation by heterologous lentivirus virions J Virol 2001 Jun 75 11 5129 40 Curran MA Kaiser SM Achacoso PL Nolan GP Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors Mol Ther 2000 Jan 1 1 31 8 Poeschla EM Wong Staal F Looney DJ Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors Nat Med 1998 Mar 4 3 354 7 Page 20 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 Poeschla E M
21. fications and design features of the SBI system with which you are working The original FIV viral vector was developed by Eric M Poeschla David J Looney and Flossie Wong Staal in UCSD Poeschla 2003 Based on this original pFIV vector the FIV based pTRF Vectors for cloning and delivering TREs into cells were developed at SBI These lentivectors have been modified to remove sequences that overlap with the packaging plasmid to minimize the possibility of homologous recombination and generation of self replicating viral sequences when co transfecting these constructs into packaging cells SBI s lentivectors also have a deletion in the enhancer of the U3 region of 3 ALTR to ensure self inactivation of the lentiviral vector after transduction and integration of the sequences into the genomic DNA of the target cells SBI s pTRH lentivectors together with the pPACKH1 packaging plasmids comprises a third generation HIV 1 based cloning vector system These lentivectors are based on the vectors developed for gene therapy applications by Dr J G Sodroski US patent 5 665 577 and 5 981 276 This system is designed to maximize its biosafety features including e Deletion in the enhancer of U3 region of 3 LTR ensures self inactivation of lentiviral construct after transduction and integration into genomic DNA of the target cells e RSV promoter upstream of 5 LTR in pTRH expression vector allows efficient Tat independent production of viral R
22. gh copy replication in E coli 4973 5833 C Ampicillin resistant gene for selection of the plasmid in E coli The notation C refers to the complementary strand Page 24 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 F Sequences of the primers used for identification of the positive clones with TRE insert included only with PathNet TRE Cloning Kits For FIV based pTHF vectors Forward cPPT 5 AGAAGAGGTAGGATAGGAGGGATG 3 Reverse2 mCMV 5 CTGCTTATATAGACCTCCCACCGT 3 For HIV based pTRH vectors Forward cPPT 5 GGGGTACAGTGCAGGGGAAAGAAT 3 Reverse2 mCMV 5 CTGCTTATATAGACCTCCCACCGT 3 G Properties of the dscGFP Fluorescent Protein The pTR dscGFP Vectors contain the full length copGFP gene with optimized human codons for high level of expression of the fluorescent protein from the CMV promoter in mammalian cells The copGFP marker is a novel natural green monomeric GFP like protein from copepod Pontellina sp The copGFP protein is a non toxic non aggregating protein with fast protein maturation high stability at a wide range of pH pH 4 12 and does not require any additional cofactors or substrates A unique feature of the dscGFP protein is the presence of an additional destabilizing ds peptide on the C end of the protein which shortens the half life time of the mature protein without ad
23. h and purify the TR construct using an endotoxin free plasmid purification kit see Section l F Confirm identity of TRE insert by sequence analysis of the pTR construct using the Forward cPPT PCR primer for sequences see Appendix Section V F Testing of the TR constructs If you are planning to use SBI s pTR Lentiviral Vectors for viral delivery first screen the TRE constructs generated in section C to determine their effectiveness in the cells of interest TR constructs Page 14 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 can be tested as reporters in a cell based assay directly after transfection into an appropriate cell line in the same way as regular TR plasmids To rapidly screen the lentiviral TRE constructs in plasmid form you can deliver and express them in HeLa or HEK 293 cells using chemical transfection For example with these cells the Lipofectamine Reagent Invitrogen Cat 18324 111 with Plus Reagent Invitrogen Cat 11514 015 system works well Alternatively you can use your target cells for this analysis If you have already established a transfection method for your target cells use your established conditions If you do not have an established transfection protocol we recommend you compare efficiencies of several transfection procedures e g Invitrogen s Lipofectamine 2000 Cat
24. imum m CMV promoter mCMV is not active without a TRE specific to a transcriptional factor Figure 1 Vectors with mCMV can be used as negative controls in the experiment or as vectors for cloning any TRE of interest After the introduction of a specific TRE upstream of mCMV this construct becomes a fully active promoter and expression of the reporter gene depends on the activity of the specific TF Figure 1 GFP r Luciferase _ L or p Gal oe no TF TRE Fig 1 Activity of the vectors depends on promoter sequence and presence of a specific transcriptional factor TR vectors usually contain several repeats of specific transcriptional response elements for Cat s see table below to ensure efficient activation of the minimum promoter due to cooperative interaction between TF molecules The pTR dscGFP vectors contain a destabilized ds copGFP reporter gene under the CMV promoter and WPRE element dscGFP is a novel fluorescent protein derived from copepod plankton Panalina sp which is similar to EGFP but has a brighter color see Appendix A unique feature of this protein is the presence of an additional destabilizing peptide on the C end of the protein which shortens the half life time of the mature protein without additional transcription to 1 hour The two other reporters Luciferase and B Galactosidase have codon usage optimized for translation in Human cells C Transcriptional Response Elements 888 266
25. ing approved decontamination methods such as autoclaving Before decontamination the biological materials should be placed in a sealed durable leak proof container for transport from the laboratory ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 Protocol A Transcriptional Response Element Oligonucleotide Design and Synthesis Typically 4 or 5 repeats of TRE sequences of interest should be inserted upstream of the mCMV promoter for efficient activation of transcription Although there is no standard rule for selecting TRE sequences for particular factor we recommend using consensus sequences for example see http bio chip org mapper or http mars kribb re kr 8080 tfExplorer websites or a TRE from a promoter for genes which are highly expressed in most cell types or tissues You should also consider that the size of each recognition element may be different but it is preferable to have them one or two helix turns apart e 11 or 22 nucleotides in order to be located on the same side of the DNA helix If necessary add an extra spacer between TRE repeats to follow this rule For each selected sequence two complementary TRE oligonucleotides a top and a bottom strand need to be synthesized then annealed before the phosphorylation and ligation steps Below are guidelines for synthesis of the Transcriptional Respons
26. ional Response Elements TREs Transcriptional factor AP 1 TCAGTCAG 6 C EBPalpha TTACGTCA 6 c Fos GGTGTAA 6 c Jun GTGACGTCAC 6 c Myc CGTGGTCGACCACGT GGT CGACCACGT GGTCGACCACGT GACCA 2 c Rel GGGGAATCTCCCGGGGAATCT CCC 3 DP 1 ATTGGCGCGAAAt AAAAAT TGGCGCGAAA 2 E2F p107 TCGCGG 6 E2F 1 TTTCCCGC 6 E2F 4 DP 2 GGTTTTCCCGCCTTTT 4 Egr 1 CACCCCCAC 6 ErbA TCAGGTCA 6 FosB TGTAATA 4 HIF 1 TACGTG 4 HSF1 TCTAGAAG 6 INF TTTCt cTTTCAG 5 JunD GGTGTAATA 6 Max1 ACGTGGT CGACCACGT GGT CGACC 3 NF kB GGGACTTTCC 4 N Myc AACATCAGCCCCCCACGT GATACAACATCAGC 2 p53 ACATGTCCCAACATGTTGT CO 8 REVERB alpha AGGTCA 6 Spl 6GGGGCGGCGC 6 Sp3 GGCCCTGCCCTC 3 SRF CCATATATGG 3 YY1 CCAAATATGG 4 Recognition element E Additional Required Materials For vectors purchased in plasmid form you will also need to purchase the appropriate pPACK Lentivector Packaging Kit Cat LV100A 1 for FIV based vectors and Cat LV500A 1 for HIV based vectors and the 293TN Producer Cell Line Cat LV900A 1 or HEK 293T cells ATCC Cat CRL 11268 in order to package your reporter constructs into pseudoviral particles The protocol for packaging and transduction of packaged pseudoviral particles is provided in the SBI Lentivector Expression Systems User Manual and manual for HEK 293T cells ATCC Cat CRL 11268
27. itute Inc WPRE Technology System Biosciences SBI has a license to sell the Product containing WPRE under the terms described below Any use of the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If you do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies SBI grants you a non exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies Page 28 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 This license agreement is effective until terminated You may terminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Pr
28. ized pTR Vector Also confirm that the top and bottom strand sequences reverse complement each other Check top bottom strand annealing To ensure a high percentage 8096 of double stranded DNA after annealing check the concentration of TRE oligonucleotides using a spectrophotometer and mix equal molar amounts of each strand For optimal annealing turn off the thermocycler after denaturation and let the tubes cool down to room temperature Evaluate 5 ul of annealed insert from step II B 1 e using a 12 polyacrylamide gel and compare the band s location with that of the original single stranded oligonucleotides Confirm oligonucleotides were correctly synthesized Verify the size of the oligonucleotides using a 12 native polyacrylamide gel Check quality of T4 polynucleotide kinase and T4 DNA ligase Test the activity of your ligase and reaction buffer using a different vector and insert Test the activity of T4 polynucleotide kinase by labeling annealed oligonucleotides with 9 PYATP Replace the reagents if they show poor activity Ensure there are no ligation inhibitors present EDTA and high salt can inhibit ligation reactions Make sure that your double strand oligonucleotide concentration is only 100 nM and that you dilute it at least 10 fold before adding it to the ligation reaction Check the quality of the competent cells Handle the competent cells gently Many cells can not be refrozen once thawed The quality of the competent
29. nd TRE oligonucleotide 25 ul Bottom strand TRE oligonucleotide 25 0 ul 2X Annealing Buffer 20 0 ul Deionized water 50 0 ul Total volume c Heat the mixture to 95 C for 5 min in a thermocycler or heating block d Turn off the thermocycler or heating block and let it cool to room temperature e The annealed oligonucleotide 100 nM is ready for the phosphorylation and ligation steps Store the annealed oligonucleotides at 20 C until use 2 Phosphorylate the Transcriptional Response Element Duplex Note If your oligonucleotides are already phosphorylated dilute them to 10 nM in 1X Annealing Buffer skip this phosphorylation step and proceed to ligation in step 3 For the insert minus control you may either follow step 2 or use 1 ul Annealing Buffer in step 3 a Set up 10 ul phosphorylation reactions for each experimental TRE template as follows 4 ul Annealed ds TRE template oligos from step B 1 M 100nM 1 ul 10X T4 Polynucleotide Kinase Buffer 1 ul 10 mM ATP 6 ul Deionized water 1 ul T4 Polynucleotide Kinase 10 U ul 10 ul Total volume For the insert minus control use 1 ul 1X Annealing Buffer b Incubate the phosphorylation reaction at 37 C for 30 minutes c Use1 ul 10 nM for the ligation step Page 12 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 3 Ligate the TRE into pTR vec
30. ndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contained in the current user manual gt http www1 giagen com literature protocols pdf QP 15 pdf F Safety Guidelines Work with FIV based and HIV based lentiviral vectors falls within NIH Biosafety Level 2 criteria For a detailed description of laboratory biosafety level criteria consult the following pages on the Centers for Disease Control Office of Health and Safety Web site http www cdc gov od ohs biosfty bmbl4 bmbl4s3 htm http www cdc gov od ohs biosfty bmbl4 bmbl4toc htm Also you should consult the health and safety guidelines and officers at your institution regarding use and handling of the lentiviral system In addition although the system itself has been designed to minimize Page 8 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 possible risk specific recombinant lentivector constructs may be potentially hazardous depending on the nature of introduced insert such as oncogenes toxins Transcriptional Response Element to tumor suppressor genes etc For these reasons it is critical to exercise due caution while working with recombinant lentiviruses To ensure safe laboratory handling you should thoroughly understand the biology of the lentiviral vectors and the specific modi
31. nted for use in humans or for therapeutic or diagnostic use The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research FIV Vector System This Product is for non clinical research use only Use of this Product to produce products for sale or for any diagnostic therapeutic clinical including pre clinical veterinary or high throughput drug discovery purpose the screening of more than 10 000 compounds per day is prohibited In order to obtain a license to use this product for these commercial purposes contact The Regents of the University of California This Product or the use of this Product is covered by U S Patent No 6 555 107 owned by The Regents of the University of California HIV Vector System This product is for non clinical research use only Use of this Product to produce products for resale or for any diagnostic therapeutic clinical veterinary or food purpose is prohibited In order to obtain a license to use this Product for these commercial purposes contact the Office of Research and Technology Ventures at the Dana Farber Cancer Institute Inc in Boston Massachusetts USA This Product or the use of this Product is covered by U S Patents Nos 5 665 577 and 5 981 276 and foreign equivalents owned by the Dana Farber Cancer Inst
32. oducts containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation and enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Management Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center lowa City IA 52242 CopGFP Reporter This product contains a proprietary nucleic acid coding for a proprietary fluorescent protein s intended to be used for research purposes only Any use of the proprietary nucleic acids other than for research use is strictly prohibited USE IN ANY OTHER APPLICATION REQUIRES A LICENSE FROM EVROGEN To obtain such a license please contact Evrogen at license evrogen com SBI has pending patent applications on various features and components of the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patent
33. ors Preparation and use Methods Mol Med 2002 69 335 50 Loewen N Barraza R Whitwam T Saenz DT Kemler I Poeschla EM FIV Vectors Methods Mol Biol 2003 229 251 71 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Naldini L Lentiviruses as gene transfer agents for delivery to non dividing cells Curr Opin Biotechnol 1998 Oct 9 5 457 63 Sauter SL Gasmi M FIV vector systems Somat Cell Mol Genet 2001 Nov 26 1 6 99 129 Alisky JM Hughes SM Sauter SL Jolly D Dubensky TW Jr Staber PD Chiorini JA Davidson BL Transduction of murine cerebellar neurons with recombinant FIV and AAV5 vectors Neuroreport 2000 Aug 21 11 12 2669 73 Brooks Al Stein CS Hughes SM Heth J McCray PM Jr Sauter SL Johnston JC Cory Slechta DA Federoff HJ Davidson BL Functional correction of established central nervous system deficits in an animal model of lysosomal storage disease with feline immunodeficiency virus based vectors Proc Natl Acad Sci U S A 2002 Apr 30 99 9 6216 21 Crystal RG Bad for cats good for humans Modified feline immunodeficiency virus for gene therapy J Clin Invest 1999 Dec 104 11 1491 3 Curran MA Kaiser SM Achacoso PL Nolan GP Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors Mol Ther 2000 Jan 1 1 31 8 Derksen TA Sauter SL Davidson BL Feline immunodeficiency virus vectors Gene transf
34. rly all cell types even those that are difficult to transfect such as primary or non dividing mammalian cells Our lentiviral based reporter system is a novel approach to study transcriptional regulation and offers many advantages over current transcription reporter systems TR constructs will integrate into the genome and therefore be subject to chromatin regulation Leung T H et al 2004 Expression of the reporter gene indicates activation of a given transcriptional response element TRE by the cognate transcriptional factor in the natural chromosomal environment rather than in the episomal state in the nucleoplasm as is the case for conventional plasmid based TR vectors Tandem copies of integration can be avoided thus allowing for faithful promoter regulation Copy number of reporter constructs can be controlled by varying the multiplicity of infection MOI Construction of stable reporter cell lines is possible with TR lentivectors in just several days without the need for conventional low efficiency selection of stable transfectants Monitoring of signaling pathways by flow cytometry FACS is enabled by GFP reporters Page 2 ver 10 070201 www systembio com PathNet Plasmid Reporter Vectors Cat s TR100PA 1 TR799PA 1 PathNet TRE Cloning Kits Cat s TR100A 1 TR700A 1 SBl s basic PathNet TR lentivectors contain three different reporters dscopGFP Luciferase and f Galactosidase under the control of the min
35. rticles transduce the packaged PathNet library into target cells select target cells with a specific phenotype and identify TREs and corresponding transcription factors which induce the specific changes in expression levels of the reporter gene e pPACK Lentivector Packaging Kits gt FIV Based pPACKF1 Packaging Kit Cat LV100A 1 gt HIV Based pPACKH1 Packaging Kit Cat LV500A 1 Unique lentiviral vectors that produce all the necessary lentiviral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to package pTR lentiviral constructs into pseudoviral particles 293T cells ATCC Cat CRL 11268 transiently transfected with the Lentiviral Packaging Plasmid Mix and one of the pTR reporter vectors produce packaged pseudoviral particles containing a pTR TRE mCMV construct e 293TN Producer Cell Line Cat LV900A 1 The 293TN cell line is a highly transfectable derivative of the HEK293 cell line with constitutive expression of SV40 T antigen and neo gene Use with the pPACK Lentivector Packaging Kit to generate a high titer of pseudoviral particles containing your lentivector construct e Lentivector Rapid Titer PCR Kit Cat LV950A 1 for human cells LV951A 1 for mouse cells Measure copy number MOI of integrated lentiviral constructs in genomic DNA of target cells after transduction with SBI s PathNet vectors or with constructs made in any of SBs FIV or HIV based lentivectors
36. s or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2007 System Biosciences SBI 888
37. tor a Set up 10 ul ligation reactions for each phosphorylated TRE template as follows 2 5 ul Linearized Reporter Vector 20 ng ul 1 0 ul Phosphorylated ds TRE template step B2 10 nM 1 0 ul 10X T4 DNA Ligase Buffer 4 5 ul Deionized water 1 0 ul T4 DNA ligase 5 U l 10 0 ul Total volume For controls use insert minus from step B2 and positive ligation control TRE for c Fos provided in the kit Use 1 ul of positive ligation control TRE per reaction b Incubate the ligation reaction at 16 C for 2 4 hrs 4 Transform E coli with the ligation product a For each experimental TRE template use the whole volume of ligation reaction for transformation b Follow the manufacturers protocol for transforming the competent cells with each experimental and control TRE construct c Plate an appropriate amount of transfected cells on LB plates with 50 ug ml ampicillin and grow overnight at 37 C C Identify clones with Transcriptional Response Element inserts 1 Prepare colony cultures a Randomly pick up 10 well separated colonies from each plate and grow each clone in 100 ul of LB Broth with 100 ug ml ampicillin at 37 C for 2 hours with shaking b Take 1 ul of each bacteria culture for PCR screening see C 2 and continue to grow the cells for another 6 hours c Store the bacterial culture at 4 C 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual 2

PathNet Transcriptional Reporter Lentivectors User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents