Home
Skewer - The UK Mirror Service
Contents
1. 2 Tolerance r lt number gt Maximum allowed error rate The error rate is defined as the normalized number of errors refer to section 1 2 considering the phred quality scores divided by the length of aligned region The valid range of error rate is 0 0 5 The default value is 0 1 d lt number gt Maximum allowed indel error rate The indel error rate is defined as the number of indels multiplied by the maximum penalty of a mismatch refer to section 1 2 divided by the length of aligned region The valid range of indel error rate is 0 r where r is the maximum allowed error rate The default value is 0 03 k lt integer gt Minimum overlap length for adapter detection For single end reads trimming or single end trimming of paired end reads the default value is maz 1 int 4 10r For mate pair reads the default value is half of the length of corresponding junction adapter 3 2 3 Filtering q end quality lt integer gt 3 end quality trimming Trim 3 end until specified or higher quality reached The default value is 0 Q mean quality lt integer gt Reads filtering by average quality Specifies the lowest mean quality value allowed before trimming The default value is 0 l min lt integer gt Minimum read length allowed after trimming The default value is 18 L max lt integer gt Maximum read length allowed after trimming There s no limit by default 9 Using the Program n Wh
2. SES A fast and accurate adapter trimmer N for paired end reads N USER S MANUAL Hongshan Jiang Chinese Academy of Inspection and Quarantine May 12 2015 Permission is hereby granted free of charge to any person obtaining a copy of this software and associated documentation files the Software to deal in the Software without restriction including without limitation the rights to use copy modify merge publish distribute sublicense and or sell copies of the Software and to permit persons to whom the Software is furnished to do so subject to the following conditions The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software THE SOFTWARE IS PROVIDED AS IS WITHOUT WARRANTY OF ANY KIND EXPRESS OR IMPLIED INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM DAMAGES OR OTHER LIABILITY WHETHER IN AN ACTION OF CONTRACT TORT OR OTHERWISE ARISING FROM OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE Copyright 2013 2015 Chinese Academy of Inspection and Quarantine All rights reserved Release Date Description Rev 0 1 76 09 26 2013 First public release Rev 0 1 88 10 16 2013 Barcode demultiplexing Rev 0 1 104 01 14 2014 O kn worst time
3. T GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT NA NA NA NA NA NA NA NA NA NA NA NA Chapter 3 Using the Program 3 1 Usage skewer options lt reads pairl fastq gt lt reads pair2 fastq gt 3 2 Options 3 2 1 Adapter x lt string gt Adapter sequence file for the first reads If it s not specified the adapter sequence is AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC by default If there s a dot in the string then it s recognized as the filename of the FASTA file that contains adapter sequences y lt string gt Adapter sequence file for the second reads If it s not specified the adapter sequence is AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA by default If there s a dot in the string then it s recognized as the filename of the FASTA file that contains adapter sequences If x is the only one specified explicitly then y is implied by x M matrix lt string gt TAB delimited file indicates valid forward reverse adapter pairing For the specified forward and reverse adapter sequences the matrix contained in the 7 Using the Program specified file further denotes the valid combinations It is an all ones matrix by default The following matrix specifies that the forward reverse adapter combinations A2 A3 B2 B3 C1 D1 D2 D3 and D4 are valid where forward
4. adapters are numbered as A B C D while reverse adapters are numbered as 1 2 3 4 E or denote match of a single adapter h 1 2 3 4 H 0 0 U 0 U A 0 U 1 1 U B 0 U 1 1 U C 0 1 U 0 U D 0 1 1 1 1 j lt string gt Junction adapter sequence file for Nextera Mate Pair reads The junction adapter sequence is CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG by default If there s a dot in the string then it s recognized as the filename of the FASTA file that contains junction adapter sequences m mode lt string gt trimming mode For single end reads the valid modes are head for 5 end trimming tail for 3 end trimming any for anywhere adapter detection and trim ming For paired end reads the valid modes are pe for paired end trimming mp for mate pair trimming ap for amplicon trimming besides head taal and any which specifies separate single end trimming for paired reads In amplicon mode the forward reverse primers will not be trimmed off because they are informative for downstream analysis b barcode Whether to demultiplex reads according to adapters primers The default is no c cut lt integer gt lt integer gt To hard clip off the 5 leading bases of the forward primer and reverse primer respectively as the barcodes in amplicon mode The default is 0 0 Using the Program 3 2
5. cho export PATH INSTALL_DIR PATH gt gt bashrc 7 bashrc Getting Started 2 2 For Impatient Users Basically the usage format of skewer is skewer options lt reads pairl fastq gt lt reads pair2 fastq gt where the primary options are as follows e options x and y are required for most of the cases for specifying the forward adapter s primer s and the reverse adapter s primer s e option m is used for specifying trimming mode such as head mode tail mode anywhere mode paired end mode mate pair mode and amplicon mode e options r d and k are used for specifying trimming stringency e options q and Q are used for quality based trimming or filtering e options l and L are used for length based filtering e option t is used for multithreading Examples are as follows 1 To trim the sequences in adpaters fa from sample fastq filter out those reads that have an average phred score below 9 and output the trimmed reads to out trommed fastq skewer Q 9 t 2 x adapters fa sample fastq o out 2 To do adapter trimming for the compressed files data pair1 fq gz and data pair2 fq gz with the adapter sequence of AGATCGGAAGAGC and do 3 end quality trimming with a quality threshold of 3 skewer x AGATCGGAAGAGC q 3 data pairl fq gz data pair2 fq gz 3 To trim adapter sequence TCGTATGCCGTCTTCTGCTTGT from small RNA reads s
6. complexity Nextera Long Mate Pair LMP adapter trimming Be Hei RTE trimming modes HEAD ANY TAIL Rev 0 1 120 09 27 2014 Amplicon paired reads Bidirectional 5 trimming Rev 0 1 124 03 09 2015 First OS X version Rev 0 1 125 05 12 2015 Capability of producing QIIME compatible files for microbial analysis Table of Contents 1 General Information 3 Tl OveryieW ee ces ae Oe Hed Rea at Gnd ds ai ew Ee Rew Badin Beare aiea ii 3 1 2 Gitati ln gon aoi eee do ame dd ae y de a adea ee Oe g 3 2 Getting Started 4 2 1 Installation 2 e 60 a E ERE we ee a E eRe eR a 4 2 1 1 System Requirements aoa aa a 4 2 1 2 Install from Binary Package 4 2 2 For Impatient Users ss o R cea vacuae wae ous we prere 5 3 Using the Program T d Usage orreina t ger ee pok R Bee aise aa AH R Beate a 9 7 3 amp 2 OPUOUS ss eee ed 6S hed bok ee s Se we Oe Ee Ole ee oe e 7 321 Adapter e rs dle we Gwe Hae Ha ee a A T T 3 2 2 Tolerance 2 0 4 4 San eo 6 4 8 oe 6 eb ow Ee Aw Br 9 3 2 3 Filtering ssor gene por es Bow eine pea Badia Head hi Bee ee 9 3 2 4 Input Output oSa54 b 24 44 we e eS ek Cee os 10 3 2 5 Miscellaneous 4 22 4 lt lt 2 x ed 4 28 eda ae Se SE ae 11 4 Source Codes 12 Chapter 1 General Information 1 1 Overview The Skewer program implements a novel dynamic programming algorithm dedicated to the task of adapter trimming and it is specially designed for processsing Ilumina paired end sequ
7. ences Skewer got its name because the implemented algorithm utilizes the equality of diagonal adjacent elements in the dynamic programming matrix where these elements could be skewered together by such a tool Skewer has the following features Detection and removal of adapter sequences Insertion and deletion allowed in pattern matching Targeted at Single End Paired End PE and Long Mate Pair LMP reads Demultiplexing of barcoded sequencing runs Multi threading support Trimming based on phred quality scores IUPAC characters for barcodes and adapters Compressed input and output support The program is available at https sourceforge net projects skewer 1 2 Citation Jiang H Lei R Ding S W and Zhu S 2014 Skewer a fast and accurate adapter trimmer for next generation sequencing paired end reads BMC Bioinformatics 15 182 Chapter 2 Getting Started 2 1 Installation 2 1 1 System Requirements CPU 64 bit Intel or AMD CPU RAM 30M per CPU core Operating System x86_64 GNU Linux Pre requisites none 2 1 2 Install from Binary Package Instructions Move skewer x x x linux x86_64 to a directory INSTALL_DIR where the software is to be installed mv skewer x x x linx x86_64 INSTALL_DIR skewer For convenience you should add INSTALL_DIR into the environmental variable PATH by adding a line export PATH INSTALL_DIR PATH to bashre fol lowed by command bashrc e
8. ether to filter out highly degenerative reads where highly degenerative reads are defined as those reads that above 15 of the nucleotides are N The default is no u Whether to filter out undetermined mate pair reads where undetermined mate pair reads are defined as those mate pair reads that neither of the paired reads has the junction adapter sequence detected The default is no 3 2 4 Input Output f format lt string gt Format of FASTQ quality value The valid options are sanger solexa auto The default value is auto 0 output lt string gt Base name of output file This specifies the prefix of output files The default value is lt reads gt trimmed where lt reads gt is the base name of input file Z compress Whether to compress output in GZIP format The default is no 1 stdout Whether to redirect output to STDOUT This option suppresses the b o and z options The default is no qiime Whether to prepare files required by QIIME If specified the barcodes fastq and mapping_file txt will be prepared for downstream analysis with QIIME This option must be used with cut option and will suppress barcode option The default is no quiet Whether in quiet mode When specified there will be no progress update The default is no 10 Using the Program 3 2 5 Miscellaneous 1 intelligent Whethe
9. r to intelligently redistribute reads When specified mate pair reads will be redistributed based on detected junction information The default is no t threads lt integer gt Number of concurrent threads The valid number is an integer between 1 and 32 The default value is 1 11 Chapter 4 Source Codes Source codes are deposited at https github com relipmoc skewer 12
10. rna fastg not allowing insertion deletion in adapter detection and only output those reads that have a length between 16 and 30 after adapter trimming skewer x TCGTATGCCGTCTTCTGCTTGT 1 16 L 30 d 0 srna fastq 4 To do adapter trimming from lmp pair1 fastq and lmp pair2 fastq using Long Mate Pair mode and redistribute reads based on junction information Getting Started skewer m mp i lmp pair1 fastq lmp pair2 fastq 5 To trim barcodes which are the 6 leading nt at the 5 end of the reverse primer of the amplicon sequences in miz pairl fastq and miz pair2 fastq output those barcodes to barcodes fastq and mapping_file tat as well as the trimmed reads for downstream analysis such as those by QUME skewer m ap cut 0 6 qiime x forward primers fa y reverse primers fa mix pairl fastq mix pair2 fastq where an example of the mapping_file tat required by QIIME looks like this SampleID BarcodeSequence LinkerPrimerSequence ReversePrimer Description A01 TCGAAT A02 CATGGC A03 AGCTTA A04 GTACCG A05 CTATGA A06 ACGCTG AO7 GATACT A08 TGCGAC A09 GCTTAA A10 TACCGG A11 CGAATT A12 ATGGCC GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GTGCCAGCMGCCGCGGTAA GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAAT GGACTACHVGGGTWTCTAA
Download Pdf Manuals
Related Search
Related Contents
Huawei Ascend W1 Black Manual do utilizador da Cápsula Nokia Field Force NFC ASUS PU500CA User's Manual SUPER DIMONA Si50x-FPB1-EVB User Guide Garantía de producto y servicio de garantía Scosche HD6903 car speaker User`s Manual M-Series Sonar, VDSL Panasonic ET-PKF110H project mount Zebra MC7596 Handheld Computer Copyright © All rights reserved.
Failed to retrieve file