Savant Genome Browser: User Manual
Contents
1. chr2 1000 2000 chr2 range 1000 2000 chr2 chr2 range 1 1000 1000 2000 in current chromosome range 1000 2000 1000 900 in current chromosome range 900 1000 equivalent to 900 1000 1000 2000 in current chromosome range 1000 3000 1000 in current chromosome start position at 1000 keeping current range length 1000 1000 bases to the right of the current start keeping same range length 1000 1000 bases to the left of the current range keeping same range length Table 4 1 Specifying Ranges Using the Location Field 4 1 2 Navigation Buttons Lovie 919 j Cl s M Figure 4 3 Navigation Buttons At the top right of the Navigation Toolbar are eight buttons which perform a variety of navigation related tasks From left to right these are Undo Redo Zoom In Zoom Out Beginning Pan Left Pan Right and End Undo lets you undo your previous navigation action It can be used repeatedly to undo multiple navigation actions Redo cancels the effect of the most recent Undo Zoom In and Zoom Out change the visible range by a factor of two keeping it centred on the same location Pan Left and Pan Right shift the visible location left or right by half the width of the screen Beginning and End allow you to navigate quickly to the beginning or end of the current chromosome 16 Figure 4 4 Genome Bar and Ruler 4 1 3 Genome Bar and Ruler Below the location field and the navigation buttons lies the genome bar2. 35 If you wish to disable this feature un check the Collect anonymous statistics about usage check box Information Example time 2012 02 16 14 18 58 language English time zone America Toronto Savant version 2 0 0 Savant build beta IP address 128 100 3 60 Java version 1 6 0_23 Java vendor Sun Microsystems Inc operating system Linux OS version 3 0 0 15 generic architecture amd64 region CA Table 12 1 Anonymous Usage Stats 12 3 Interface Settings This section allows you to set the default heights for various BAM and interval tracks In addition you can enable or disable the display of popup menus and legends on tracks 12 4 Remote Files The Remote Files section allows you to configure Savant s access and caching of remote files Any changes to settings on this panel will not take effect until the next time Savant is launched Un checking the Enable remote file caching button will disable the caching of remote files completely This 1s not recommended because without caching performance will be terrible By default cache files are kept in the cache subdirectory of your Savant home directory You can move it to another location 1f your home directory is located on a file system where space is at a premium Remote file caching uses a default block size of 64kB There probably is no good reason to change this The cache directory can grow to consume a considerable amount of disk space If you wish to
3. This bar highlights in blue the cur rent visible region in the context of the genome If the current genome has associated cytoband information 1t will be displayed in this bar You can select a new range by clicking and dragging within the bar Underneath the genome bar is the ruler which indicates the current viewable range in the coordinate space of the current chromosome 4 2 Mouse and Keyboard Shortcuts Navigation can be done very quickly using a number of mouse and keyboard shortcuts described in the tables below Keys Action SHIFT LEFT pan left SHIFT RIGHT pan right SHIFT HOME move to start of chromosome SHIFT END move to end of chromosome SHIFT UP zoom in SHIFT DOWN zoom out Table 4 2 Navigation Using the Keyboard In addition to these navigation shortcuts there are a number of other useful shortcuts described in Table 4 3 17 Keys Action Click and drag left right pan left right CTRL CMD scroll wheel up down pan left right CTRL CMD Click and drag SHIFT Click and drag zoom in on selected region select all records in region CTRL CMD Z CTRL CMD Y CTRL CMD I CTRL CMD B CTRL CMD J CTRL CMD K CTRL CMD L undo range change redo range change export track images see 10 1 bookmark current location see 87 crosshair see 85 4 plumbline see 85 4 spotlight see 85 4 Table 4 3 Other Shortcuts 18 Chapter 5 Visualisation Features I
4. ae a AR laa ae oe ah Rik a tad 34 11 2 2 Variation Map 34 11273 Allele Frequency Plot iio dada ta D drone sta as en 34 11 2 4 Linkage Disequilibrium Plot 34 12 Preferences 35 12 1 Colour Settings ss Es a Sued oe Soe del we die D BR Gee eld A 35 12 2 General Settings s tinte 4 2 aad A ad le whe A at ga Acta dan ea 35 123 Interface Settings fs ec GA Land ee Ao gh 4 dbo che Be Gee Bee ee hea 36 12 4 Remote Biles erosin e Aon Gunes AA oe aed WS ee BA ae eee Ae Bon eae Ra 36 12 5 Track Resolutions 5 4 4 ao 4 dio BA Go fae Ae rt ae eed Bae Go BA 37 A Savant Home Directory 38 List of Tables 2 1 Alignment Track Display Modes 11 3 1 Native File Formats 4 e e 4 4 44 Li dB LA Lun a ga deu date 12 3 2 Compatible File Formats 13 4 1 Specifying Ranges Using the Location Field 16 4 2 Navigation Using the Keyboard 17 4 3 Other Shortcuts o sue ABS Lin mb and od nh An ts a ah un es Gen ru ae dy dd 18 12 1 Anonymous Usage Stats mier a AU due du ed aura 36 A l Contents of savant Directory 38 List of Figures 3 1 The Format Dialog sarsa moe ack 2 finies SE he di Gee du Ga 14 4 1 Navigation Toolbar 15 4 2 Hocauon Field A A ee RE Seach Ta Me S
5. and Ruler Mouse and Keyboard Shortcuts Visualisation Features 5 1 5 2 5 3 5 4 Track Locking Selecting Records Popup Menus Highlighting Areas of Interest Docking Framework 6 1 Showing and Hiding Modules 6 2 Resizing Modules 6 3 Rearranging Modules 6 4 Maximising and Restoring Modules 6 5 Detaching and Attaching from and to the UI Bookmarks 7 1 Adding and Removing Bookmarks 7 2 Seeking to a Bookmark 7 3 Adding Annotations to Bookmarks 7 4 Saving and Loading Bookmarks Data Table 8 1 Changing Tracks 8 2 Sorting ROWS 8 3 Exporting Data 19 19 19 19 20 21 21 21 21 23 23 24 24 25 25 25 26 9 Plugins 28 9 1 Installing and Uninstalling Plugins 28 92 Using Plugins ia Bo de OR a de ee jar ne ee a eS 28 O22 Panel PlUSMS lt vs A Gr RA ea ee a wk hee SUR de da BA 29 922 Tool PIO Gis is eii ote ces a ados a Re ek ebay ete Pes as eek a tye 29 9 2 3 DataSource Plugins 30 10 Other Features 31 10 1 Exporting Images 4 44 ke a ee do 31 11 Variants 33 11 1 Variant Tracks 2 000 ee a A he a ee ee rate 33 11 2 Vanation Module z a e a Se a ee A Se ne Oe OR 33 1122 1 Variation Table is o ae Ba
6. at 0 or 1 In most cases this is deter mined by the choice of Format The output file to be produced which can subsequently be loaded into Savant 13 800 Format Input File Volumes Data Raw Data hg19 ensGene bed pes Format EE GFF VCF BAM Coverage WIG BedGraph Generic Interval Format Description BED format is an alternative to GFF format for describing co ordinates of localized features on genomes Output File Volumes Data Raw Data hg19 ensGene bed gz Figure 3 1 The Format Dialog 3 2 1 Generating Coverage Files In addition to formatting the file types described in Table 3 1 2 the Format dialog is also used for generating coverage files These are used to display alignment data when the viewable range is too large to make indi vidual reads discernible In such cases Savant uses the coverage file to draw a continuous track indicating the level of read coverage across the viewable range Simply choose a bam file as the input and Savant will generate the corresponding bam cov tdf file In order to serve as a coverage file the bam cov tdf file must be stored in the same location as the bam file which it summarises 14 Chapter 4 Navigation Navigation refers to changing the region of the genome which is being viewed by the browser You can navigate either by interacting with the navigation toolbar 84 1 located at the top of the Savant main window or by using the appropriate keyboard
7. be docked on top of each other in which case tabs will appear allowing one to switch between modules or beside each other 21 Close Floating Akorde Floating Maximize Dockable Auto Hide Maximize Dockable Figure 6 1 Left A track module Upper right Docking menu presented when the title bar of a module is right clicked Bottom right Docking controls embedded in the title bar of the module The latter controls are not available in the Mac version E i Annotation annaa z Bookmarks Bookmarks 3 tom Annotation From To Annotation Figure 6 2 Hiding and Showing Modules Left The Annotation module hidden on the right of the Savant UI Middle The Annotation module shown by clicking the Annotation tab Right The Annotation module pinned so that it will remain shown even when you are interacting with other components of the UI 22 Savant Genome Browser Savant Genome Browser File Edit View Help File Edit View Help ler IE GCG e Caen Ce ere E CCG C7 Figure 6 3 Rearranging Modules Left Demonstration of the rearrangement process Right The result of the rearrangement 6 4 Maximising and Restoring Modules A module can be maximised to occupy the entire screen or UI to make interaction or visualisation with it easier and then restored back to its original state among other modules to resume a concerted view To maximise press the emb
8. delimited text file with four columns chromosome start end and annotation Consequently if you create your own tab delimited file with this layout it can be loaded into a Savant project as a set of bookmarks You can opt to append the loaded bookmarks to the existing bookmarks or to replace the existing bookmarks entirely with the loaded ones Savant also gives you the option of adding padding to bookmarks to make them more prominent For instance if you have loaded bookmarks from a text file containing SNP coordinates you might want to add padding so that navigating to a SNP will display it centred in the display area without padding selecting one of these SNP bookmarks would set the range so that the selected SNP filled the entire display 25 Chapter 8 Data Table The Data Table is a plugin see Chapter 9 which is installed by default as part of Savant The Data Table module displays the data in the current range in a tabular format with the records being rows and the fields being columns The data is automatically updated when the range in the main track display changes unless the Auto Update checkbox is unchecked The Show Only Selected checkbox allows you to filter the table showing only records which are selected in the current track Double clicking on a row in the data table will select the corresponding record in the track display Log Batch Run Data View Track N412878 chrom1 SLX maq SRPOO0032 2009
9. free up some disk space you can use the Clear remote file cache button 36 12 5 Track Resolutions This selection allows you to set a range threshold for each track type above which the track will not attempt to render data When the display range is above a track s threshold the track will display either a Zoom in to see data message or a coverage track if available 37 Appendix A Savant Home Directory By default Savant stores settings plugins and temporary files in your home directory in a folder called savant on Mac and Linux or savant on Windows In most cases it should not be necessary to delve into this directory but it can be useful to know what is stored there Table A 1 summarises the contents of the savant directory cache Keeps a cache of files accessed from remote URLs Over time this directory may use up a considerable amount of disk space It can be cleared using the Clear remote file cache option in the Preferences dialog Chapter 12 index Stores index files for remote BAM Tabix and Fasta files plugins The Plugin Manager dialog 89 1 installs plugins in this directory projects Default location for Savant project svp files savant settings Stores values for Savant preferences Edit this file at your own risk Table A 1 Contents of savant Directory 38
10. Install Figure 9 2 Plugin Repository Dialog 9 2 3 Data Source Plugins Data source plugins are a special class of plugins which extend Savant allowing it to access data in non standard ways Data source plugins do not have a tab at the bottom left of the Savant window but instead are accessed through the Load Track from Other Datasource menu item The UCSC and SQL plugins are both examples of data source plugins Or in the case of genomes from the Other Datasource button on the genome dialog 30 Chapter 10 Other Features 10 1 Exporting Images Track images from Savant can be exported as PNG files using the File gt Export Images command This command brings up a dialog which allows you to select the tracks you want to appear in the output By default none of the tracks are selected and you use the arrow buttons to move them from the unselected left side to the selected right side of the dialog Checking the Always select all check box means that the next time the dialog is displayed all tracks will start on the selected side of the dialog Optionally you may enter a single base which will be highlighted in the output PNG file using a plumbline as described in 85 4 31 Select Tracks to Export All Tracks Selected Tracks http genomesavant com savant data hg19 hg19 fa savant Volumes Data ALL chr1 20 vcf gz gt Volumes Data vcf 142468 20110408234207 gatk1 0 5506 hg19 cut re Volumes Data vcf
11. MM02454 20110502133647 gatk1 0 5506 hg19 cut Volumes Data ALL chr1 43 vcf gz lt gt gt lt lt Filter By All C Always select all Optional Select Base ex 123 456 789 OK Cancel Figure 10 1 Export Image Dialog 32 Chapter 11 Variants Savant 2 provides improved support for viewing variant data in VCF files In addition to being able to open Tabix formatted VCF files as variant tracks Savant 2 also provides a Variation tab at the right of the user interface next to the Bookmarks tab This tab provides a variety of ways of exploring variation data as described in 811 2 11 1 Variant Tracks Variant data can be loaded into Savant using the Load Track from XXX commands Loading a VCF file in this fashion will create a new track in the main display area As with other data types the VCF file must first be formatted and indexed as a Tabix file in order to be usable see 83 2 SNPs are displayed with a vertical line in the colour of the alternate non reference base Participants drawn from the VCF file are arranged vertically A gap in the vertical line indicates that a particular participant lacks that variant If a variant is heterozygous for a participant that portion of the line will be drawn using a paler version of the associated colour Insertions and deletions are displayed in the same manner as SNPs with a single vertical line black for deletions magenta for insertions The var
12. R oe Us LAS R 15 43 Navigation Buttons To T o A A aan Baa ae nat is ae tad 16 4 4 Genome Bar and Ruler 17 Track Popup acide a Be Pt ER MO AU RE ada BO ant dela an gt due 20 6 1 Docking Controls se NE AE a ae le Se a op hea 22 6 2 Hiding and Showing Modules 22 6 3 Rearranging Modules ee 23 7 1 Bookmarks Module 24 8 L Data Table Module os 0 eee a A A doe ae it 26 9 1 Plugin Manager Dialog soea dun eee dee sardines he and A Reina 29 9 2 Plugin Repository Dialog 30 10 1 Export Image Dialog 2 5 8 ao e ti ee BAS Meh Sat ae ne 32 Chapter 1 Introduction 1 1 What is Savant Savant stands for Sequence Annotation Visualisation and Analysis Tool In other words Savant is a program for visualising and analysing genomics data It was designed to run quickly and efficiently on conventional desktop or laptop computers 1 2 Who Should Use Savant Savant makes visualisation and analysis of genomics data very efficient If you use genome browsers like UCSC or IGV or if you are a biologist or bioinformatician who works with genomics data you should try Savant 1 3 Getting Started Savant is designed to run on any operating system which supports Java Standard Edition 1 6 or 1 7 In practice it has been tested on Windows XP Vista and 7 32 bit and 64 bit Ma
13. Savant Genome Browser User Manual April 23 2012 Authors Marc Fiume amp Eric Smith Contact savant cs toronto edu Website http savantbrowser com This document applies to Savant version 2 0 0 Contents 1 Introduction 7 1 1 Whatis Savant cc 3 ee ee ee a a A tire 7 12 Who Should Use Savant es sn ne ke Sh ae Dee var hoes a at be WET a he dodo ees 7 1 3 Getting Started ian res Sh ule wola de pds dd dd ye eal des Teh ee 7 2 Projects and Tracks 8 Zils PYOJECts mo Farid wide aah ye Goat wo deals dn bo CE Band BA dee ub eld Sh 8 2 2 IGENOMES Patate ls Es AE oe hs ehh ea A SE Att a die oh a 8 2 37 TACKS 2 ory hb org ee Meh eels ne Boh ge te Mak tog lle Se Ge Meum thie tr ok 9 2 3 1 Display Modes 22 tec a hg ade RU A a tee oe Gene te A du eae di 9 2 32 Loading a Track s dion SA daw bao BA ea et es bao Gus Go BA 9 23 30 Track Types si x wot a oo ee ned Sort nd A ca de 10 3 Formatting and Loading Data 12 3 1 Supported File Formats sesi 4 aa e a asad eed ee amant Bae ha a ee ke et 12 3 1 1 Native File Formats 12 3 1 2 Compatible File Formats 12 3 2 Using the Format Dialog 13 3 2 1 Generating Coverage Files 14 4 Navigation 15 4 1 4 2 Navigation Toolbar 4 1 1 Location Field 4 1 2 Navigation Buttons 4 1 3 Genome Bar
14. _07 bam x Auto Update Read Name Sequence Length First of Pair Position Strand IL22_307 1 102 GTTGAATTTCACTGAGAGGCGT 49768931 v j Mapping Quality CIGAR 36M Mate Position Strand Inferred Insert Size A 49769028 ATATGCACCATCCTATTTGATA O 49768872 36M 49768668 s ATATTTGATAATATATGGGTTTA 49768884 49768926 CCTGGGTAACATTGGACTGCGC 49768926 49768884 s TTGCTAATATATGGGTTTATTTG 49768888 49768915 IL10_385 6 45 6 TATTACAGATACCTGGGTTGCA 49768915 49768888 AL10 ISRRO10942 283 TTAAAATCACATGGTATTTTGG 49768834 49768819 ISRRO06423 128 GATTGGGAAAATAATCATATGC 49768856 49768815 SRROD1139 936 TTAATCATATGCACCATCCTAT 49768866 49769022 IL17_297 1 218 AATCATATGCACCATCCTATTT 49768863 49768967 E 49768875 49768981 1L22_348 8 131 TGCACCATCCTATTTGATAATA 49768876 49769073 OORRODOROEO JAAR ERRO01300 593 GCACCATCCTATTTGATAATAT J_0001_FC20C CCACCCTATTTGATAATATATG 49768879 49768926 ERROO1300 139 TCAGCCTCTCTGATAATATATG 49768879 49768681 Figure 8 1 Data Table Module showing data from a read alignment tr
15. able The variation table provides a spreadsheet like summary of all variants in the variation module s current display range Double clicking on row will centre the main track display on the position of that variant 11 2 2 Variation Map The variation map provides a graphical overview of all variants in the variation module s display range Variant records are arranged vertically by position but the scale is non linear since the gaps between variants are squeezed down Participants are laid out horizontally using the same colour scheme as described for variant tracks 811 1 11 2 3 Allele Frequency Plot The allele frequency plot graphs frequencies of each allele for each variant location Like the variation map the allele frequency display is arranged vertically by position with a non linear scale If controls have been specified allele frequencies for controls will be displayed on the left of the central axis while case allele frequencies will be displayed to the right of the central axis 11 2 4 Linkage Disequilibrium Plot The linkage disequilibrium plot graphs LD values calculated using D or r Variant locations are used as the loci for the LD calculation i e there is no attempt to segregate ranges into groups 34 Chapter 12 Preferences The preferences dialog allows you to configure a number of Savant features The dialog is invoked by the Preferences menu item which is found under the Savant application menu o
16. ack 8 1 Changing Tracks The Data Table only displays data from a single track at a time To change the track whose data is being displayed a drop down list of tracks is provided from which to choose 26 8 2 Sorting Rows The entries in the Data Table can be sorted by clicking the field header by which the rows are to be sorted Subsequent clicks on the field header toggle between sorting in ascending order and descending order 8 3 Exporting Data The data being viewed in the Data Table can be exported to a text file by clicking the Export button The format of the resulting text file depends on the type of the track being exported Sequence tracks are exported as Fasta files BAM alignment tracks are exported as SAM files All other track types are simply exported as tab delimited text 27 Chapter 9 Plugins Savant is able to integrate plugins allowing for powerful extensions of the browser To learn how to develop a plugin see the Developer s Guide downloadable from the Savant web site 9 1 Installing and Uninstalling Plugins To install a plugin choose Plugin Manager from the Plugins menu Savant will present the dialog shown in Figure 9 1 This dialog lists all the plugins which are currently installed Selecting one of plugins from the list will display information about the plugin s version and status and provide a button to allow uninstalling the plugin Clicking Install from Repository will bring up a secon
17. alised data Tabix BedGraph continuous valued data TDF GFF genes and other features associated with DNA Tabix RNA and protein sequences GTF genes and other features associated with DNA Tabix Tab delimited any feature oriented data in tab delimited form Tabix RNA and protein sequences structural variations Tabix continuous valued data such as GC percent TDF probability scores and transcriptome data Table 3 2 Compatible File Formats Genomic annotations are also available from other databases Downloading and formatting data from these and other popular data sources is encouraged UCSC http genome ucsc edu 1000 Genomes Project http www 1000genomes org NCBI EBI Ensembl http www ncbi nlm nih gov http www ebi ac uk http ensembl org info data ftp 3 2 Using the Format Dialog The Format Dialog can be used to format text files e g ones downloaded from the various data sources listed above for use with Savant In most cases Savant is able to infer the file s format from its extension Given the size of data files associated with bioinformatics formatting a file may take a considerable amount of time The Format Dialog can be opened by choosing File gt Format File Components of the Format Dialog Input file Format Input is 1 based Output file The text file to be formatted The format of the input file Whether or not the input file s positional annotations start
18. and mouse shortcuts 84 2 In Savant a location consists of two parts the current reference and the current visible range The current reference is typically a chromosome so the term chromosome is used below even though the reference in question could actually be any contiguous range of bases and not necessarily a chromosome per se The current range specifies a range of bases in the coordinate space of the current reference 4 1 Navigation Toolbar Location chrl 173 828 566 173 837 333 Go Length 8 768 sie Laie lei ei E E l M Eee LE Md E Mi MN EN Es i M aA NE ER A 6 EE ET EE 7 Figure 4 1 Navigation Toolbar The top row of the navigation toolbar contains the location field 4 1 1 and the navigation buttons 4 1 2 Below that are the genome bar and the ruler 84 1 3 4 1 1 Location Field Location chri 173 828 566 173 837 333 al Figure 4 2 Location Field 15 The location field displays the current visible range within the genome It can also be used to specify a new range in a number of ways described in the table below Changes take effect by hitting RETURN or clicking the Go button 1 Clicking the downward pointing triangle to reveal a menu of chromosomes 2 Type a gene name into the text field Type a partial gene name and hit TAB to pop up a menu of matching genes 3 Type a range specification into the text field
19. c OSX 10 6 and 10 7 and Linux 32 bit and 64 bit For best performance run Savant on a computer with at least 2GB of RAM An internet connection is strongly recommended When you launch Savant you will be presented with the start screen which shows a list of recent projects and a feed of news stories from the Savant web site If this is the first time you have launched Savant there will be no recent projects so the first thing you should do is choose File gt Load Genome to tell Savant what reference genome you wish to work with Chapter 2 Projects and Tracks When working with Savant you will typically be working with a number of tracks which are organised together into a project In addition to the tracks a project file also maintains associated information such as the reference genome your browsing location and any saved bookmarks Each track normally corresponds to single data file although there are exceptions e g a BAM alignment track may also be accompanied by a TDF file containing coverage information to be displayed at lower resolutions In order to be loaded as a track by Savant a file must be in one of the formats described in Table 3 1 Files which are not already in one of those formats can be converted as described in 83 2 2 1 Projects Projects have a file extension of svp and are typically stored in the savant projects directory The project stores the following information e Reference genome
20. containing coverage information to be displayed at lower resolutions In order to be loaded as a track by Savant a file must be in one of the formats described in Table 3 1 Files which are not already in one of those formats can be converted as described in 83 2 If you attempt to load a track from one of the compatible file types described in 3 1 2 Savant will offer to format it first 2 3 1 Display Modes Every track type has one or more display modes Each of these modes is intended to emphasise a different aspect of the data For instance the Mismatch mode for read alignment tracks uses colours to emphasise mismatches in reads In contrast the Read Pair Arc mode emphasises the insert lengths showing arcs between the mapped locations of paired reads with the height of each arc proportional to the inferred insert size The display modes available for each type of track are described in 82 3 3 2 3 2 Loading a Track A track is loaded by choosing one of the File gt Load Track menu items Track data can come from any of three different sources a local file a URL or an external data source Load Track from File will present a file chooser to let you select a local file Load Track from URL presents a dialog which lets you type in an ftp http or https URL to be opened The Load Track from Other Datasource menu item presents the Savant repository browser which lets you select one of the tracks which is available from savantbro
21. d dialog Figure 9 2 which lets you browse the plugins available on the Savant web site Plugins in the repository are segregated by Savant version since Savant 2 0 0 is not compatible with plugins developed for older versions of Savant Third party plugins which are not available through the Savant Plugin Repository can be installed using the Install from File command which lets you select a JAR file to be installed Install from File will copy the selected file into Savant s plugin directory and make it available to Savant Some third party plugins may require ancillary files e g supporting libraries or data files Installing this sort of plugin cannot be done through the Plugin Manager dialog in such cases the necessary files must be manually copied into the savant plugins directory savant plugins on Windows 9 2 Using Plugins Every plugin works differently and may or may not have a user interface For instructions on how to use a third party plugin see the developer s documentation Savant supports three general types of plugins which are described below 28 Installed Plugins IReckon plugin Version 1 0 2 Amino Acid Plugin Uninstall Status Loaded Data Table Diff Plugin Seeker Plugin SQL Datasource 1000 Genomes UCSC Datasource UCSC Explorer Dismiss Install from Repository Install from File Figure 9 1 Plugin Manager Dialog 9 2 1 Panel Plugins Typical plugins such as the built in Data Tab
22. e 19 type of data contained in the track To make it clearer exactly which record corresponds to the popup the track will give the record a reddish tint while the popup is open At the bottom of the popup menu are a number of blue menu items which allow you to perform specific actions on the current record The Select Deselect and Add to Bookmarks items are common to popups for all track types certain track types may add additional items as appropriate PUF60 J PUF60 Transcript name NM_001136033 PUF60 Reference chr8 Strand JHC Transcription start 144898552 Transcription end 144911196 Coding start 144898689 Coding end 144904065 Unique ID 0 Gene name PUF60 Select Deselect Add to Bookmarks Jump to End of Interval Figure 5 1 Track Popup 5 4 Highlighting Areas of Interest Often it is helpful to focus one s attention on a particular portion of the display Savant provides three tools for making this easier found under the View menu The Crosshair tool displays a crosshair cursor and shows the current track space coordinates of the mouse This is intended to make it easier to identify particular features by location Note that the current location without the crosshair is also shown in the lower left of the Savant window The Plumbline tool displays vertical bars which run across all the tracks allowing you to clearly see how features on different tracks are aligned The Spotlight tool is similar to
23. e Absolute paths of all loaded tracks e Current display mode of all tracks Bookmarks e For variant data a summary of which participants are controls or cases see Chapter 11 2 2 Genomes Before loading any tracks the project s reference genome must be established using the File gt Load Genome command This genome is used to specify the lengths and names of all chromosomes or contigs in the data set no other tracks can be loaded until the genome has been set In many cases the genome will itself be a sequence track which can be loaded from a file from a URL or from a remote data source For the convenience of users a variety of standard published genomes are available through the Load Genome dialog The commonly used genomes include a full sequence track along with associated tracks such as UCSC and RefSeq genes Less popular genomes may provide only a list of the chromosome names and their sizes The exact list is subject to change and we welcome requests to add your favourite genomes to Savant s standard set In some unusual cases you may wish to run Savant without any existing genome information In such cases you can use the Load Genome dialog to specify a reference name and length 2 3 Tracks A track is an individual data set usually corresponding to a single data file In a few situations a track may draw data from multiple data sources this is the case for BAM alignment tracks which can have an associated TDF file
24. ect If you have more than one sequence track open in a project you can use a sequence track s Tools gt Set as Genome menu item to make it the reference genome Interval Tracks Interval tracks display data from a Tabix file This is the track type for genes and other interval oriented data Interval tracks have two display modes Standard and Squish In Standard mode intervals are packed neatly so that none overlap in Squish mode the intervals are squished together on a single line These correspond to the Pack and Squish modes of the UCSC browser In addition interval tracks also have a number of Appearance options The Enable ItemRGB option colours records based on the value of their ItemRGB column for BED files which have that column Similarly for BED files with a Score column the Enable Score option allows you to draw records with a transparency based on the Score value The Display Alternate Name option allows you to control which labels are displayed for the features e g for gene tracks which may identify genes with both accession numbers and protein IDs 1 fa savant files store sequence data in a format specific to Savant versions prior to 2 0 0 10 Alignment Tracks Alignment tracks display data from a BAM file They present reads in a choice of seven different display modes listed in Table 2 3 3 Standard Displays the reads stacked vertically in the most efficient manner Colour indi cates strand direct
25. ed in 811 11 Chapter 3 Formatting and Loading Data 3 1 Supported File Formats Savant natively supports a number of standard file formats which are indexed to ensure speedy data retrieval In addition Savant has the ability to reformat several other common formats in order to make them usable by the program 3 1 1 Native File Formats Savant natively supports the following standard file formats These are formats which Savant can read directly with no extra processing In most cases these files consist of a main file which contains the actual data and an index file which must be present in the same location as the data file in order to provide fast random access to that data Format Description Data File Index File BAM Nucleotide sequence alignments bam bai BigWig Continuous valued data bw FASTA Nucleotide sequences fa fai Tabix Genes intervals variants and other localised data gz tbi TDF Any continuous valued data tdf Table 3 1 Native File Formats 3 1 2 Compatible File Formats These are formats which Savant can convert into one of its native formats When using a file in one of these formats it must first be converted into one of Savants native formats You can convert these files either by using choosing Format from Savants File menu or by using Savants FormatTool utility 12 VCF Wig Format Description Converted To Bed genes intervals variants and other loc
26. edded icon which resembles a square To restore press the embedded icon which resembles two overlapping squares in the same location as the icon pressed to maximise On a Mac you can maximise and restore by double clicking the title bar The same functionality is possible through the title bar on Windows and Linux 6 5 Detaching and Attaching from and to the UI A module can be detached from the UI and moved to a separate location on the screen This is particularly useful for multi display setups where for example analytics modules can be moved to one display and tracks kept on another To detach a module press the embedded icon which resembles to squares The detached module can then be moved to another location by clicking and dragging its title bar To reattach it to the UI press the embedded icon which resembles a square with an L shape in it in the same location as the icon pressed to detach it On a Mac you can detach and reattach by right clicking the title bar and checking or unchecking Floating respectively The same functionality is possible through the title bar on Windows and Linux 23 Chapter 7 Bookmarks The Bookmarks module helps to keep track of interesting regions or to make annotations At any time you may add remove or seek to a bookmarked region by using buttons within the module or by using keyboard shortcuts 7 1 Adding and Removing Bookmarks A bookmark can be added by pressing the Add button LI in t
27. he Bookmarks module s toolbar The current range will be used for the bookmark although the from and to coordinates of the bookmark can be adjusted by double clicking and changing them The keyboard shortcut CTRL B or CMD B on a Mac can be used to quickly add a bookmark For tracks which contain multiple features e g gene tracks the track s Tools menu provides a way to automatically create a bookmark for each of a track s features Bookmarks Ca re From To Annotation 49768670 49768705 potential CNY 49768670 49768705 low complexity 886 49768921 interesting region io Figure 7 1 Bookmarks Module 24 Bookmarks can be removed by selecting them and choosing the Delete button D 7 2 Seeking to a Bookmark A bookmark can be sought to by selecting it and choosing the Go option 7 3 Adding Annotations to Bookmarks An annotation can be added to a bookmark by double clicking the Annotation field and typing in some text 7 4 Saving and Loading Bookmarks As bookmarks are created they are automatically stored as part of the current project file and will be saved whenever the project is saved Bookmarks can be exported to be reused in other sessions or to be shared with colleagues To save the existing bookmarks click the Save button in the Bookmarks module s toolbar These bookmarks can subsequently be loaded by clicking the Load button QUE Exported bookmarks are stored as a simple tab
28. iant track makes no attempt to visually indicate the extent of the inserted or deleted material In order to see what was actually substituted by the indel you will need to hover the mouse over the variant track and the popup will provide the details of the substitution that took place 11 2 Variation Module The Variation module groups together four different ways of viewing aggregated variant data While variant tracks contain data only from a single VCF file the visualisations on the Variation module comprise data from all currently open variant tracks 33 The variation module maintains its own visible range which is distinct from the visible range for the main track display area Changing the range in the variation module has no effect on the main range The reverse is not true since if you move the main display range outside the variation module s range e g by shifting to another chromosome the variation module will update its range to follow your navigation At the top of the variation module is a field for entering the module s desired visible range The variation module also has its own Zoom In and Zoom Out buttons to alter its visible range At the top right of the variation module is the Controls button This is used to select which participants in a dataset are considered to be controls as opposed to cases When graphing allele frequency the control and case participants are graphed separately 11 2 1 Variation T
29. ion Mismatch Like Standard but also displays SNPs and indels Requires that the reference genome be an actual sequence track Read Sequence Displays the reads stacked vertically but colour indicates nucleotides Read Pair Standard Reads are stacked vertically with paired reads at the same altitude Read Pair Arc Read pairs are shown using arcs where the height of the arc corresponds to the inferred insert size SNP For each location all the base reads supporting a particular call are stacked verti cally This is intended to make SNPs more prominent Strand SNP Like SNP mode but reads from the forward and reverse strands are grouped sep arately Table 2 1 Alignment Track Display Modes In addition to the display mode you can also adjust the appearance of the Standard Mismatch and Read Sequence modes by using the Enable Base Quality and Enable Mapping Quality items from the Appearance menu When the visible range is large enough that individual reads would not be visible Savant will display a coverage graph GeneratingCoverageFiles in place of the normal display Continuous Tracks Continuous tracks display continuous valued data from TDF or Big Wig files Variant Tracks Variant tracks display structural variation data from Tabix formatted VCF files The vertical axis is used to indicate the individuals whose data makes up the file Data from all loaded variant tracks is aggregated in the Variation sheet describ
30. le and UCSC Explorer plugins are presented in tabs at the bottom left of the Savant user interface Click the tab to reveal the plugin s user interface The windows for these plugins can be detached docked and rearranged as described in Chapter 6 Plugins can be temporarily disabled by unchecking the corresponding menu item on the Plugins menu This is a less extreme measure than uninstalling the plugin a disabled plugin is still installed and can easily be reenabled by reselecting its menu item from the Plugins menu 9 2 2 Tool Plugins New in Savant 2 0 are tool plugins which provide a way to integrate external applications into Savant To the end user these are functionally similar to panel plugins but where panel plugins consist of Java code packaged inside a JAR file tool plugins consist of an XML file providing instructions on how to invoke an external application The format of this XML file is described in the Developer Manual Like panel plugins tool plugins present their user interface in a dockable tab at the bottom left of the Savant user interface and can be enabled disabled from the Plugins menu The GATK and SRMA plugins are examples of tool plugins 29 800 Install Plugins Name Y Plugins Y Pre release SQL Plugin v1 1 4 UCSC Plugin v1 1 4 UCSC Chooser Plugin v1 0 0 Data Table v1 2 5 Amino Acid Plugin v1 0 2 Diff Plugin v1 0 1 Current Version v1 6 0 gt Previous Versions Cancel
31. n Mac and under the Edit menu on Windows and Linux Preferences are divided into five categories Colour Schemes General Settings Interface Settings Remote Files and Track Resolutions Each category appears on a separate panel in the preferences dialog As described in Appendix A these settings are stored in the savant settings file in your Savant home direc tory Deleting the savant settings file will restore Savant to its factory defaults 12 1 Colour Settings Colour Settings allow you to adjust the colours which are used for rendering the various track types 12 2 General Settings General Settings controls some behaviours of the Savant application At present all of these happen to involve connecting to the savantbrowser com web site at startup time By default Savant contacts the savantbrowser com web site at startup time to determine whether a newer version of Savant has been released Unchecking the Check version on startup to disable this feature if you do not wish to be reminded of new versions At startup Savant also contacts savantbrowser com to retrieve the Savant news feed Uncheck the Show Start Page check box to disable this behaviour at startup Savant will display a blank page instead of the news page As an aid to our developers as part of its startup process Savant reports back to the savantbrowser com web site with information about the usage environment The information reported is summarised in Table 12 1
32. n addition to making it easy to navigate quickly and efficiently through the genome Savant provides a variety of mechanisms for making it easier to visualise the data more effectively 5 1 Track Locking Individual tracks can also be locked to a particular range so that they are not updated until they are unlocked Locked tracks can be used as overview profiles from which subregions can be selected to specify range changes for other tracks To lock a track select the Lock Track option from the track s Tools menu While a track is locked you may select a subrange from the track by using the mouse zoom options described previously which will become the new range for other unlocked tracks To unlock a track go to the track s menu and uncheck the Lock Track option 5 2 Selecting Records In most cases a track consists of a collection of underlying records which can be selected individually By default selected records are highlighted in green Selected records remain selected when the display mode changes so for instance you could select an arc in Read Pair Arc mode and then switch to Mismatch mode to see the details of the selected reads Records selected in a track are also selected in the Data Table Chapter 8 5 3 Popup Menus Hovering the mouse over a track will pop up a menu which provides information about the record under the mouse as shown in Figure 5 1 The details of what fields are displayed in the popup is dependent on th
33. the Plumbline tool except that portions of tracks outside the spotlight area are dimmed to deemphasise them 20 Chapter 6 Docking Framework Savant features a docking framework which allows you to rearrange modules to your liking Such modules include tracks and built in items e g Bookmarks Variants etc and plugins Non track modules are con strained to be docked to the sides of the Ul and not among tracks Similarly track modules are constrained so that they cannot be docked among other modules While a number of important functions are presented here the best way to learn all the features of the docking framework is to try using it 6 1 Showing and Hiding Modules By default built in modules are hidden Hidden modules appear as tabs located on the region of the UI to which they are docked A module is shown once the tab is clicked Click the tab again to hide the module 6 2 Resizing Modules Modules can be resized To resize a module click an edge and drag it until it occupies the desired size 6 3 Rearranging Modules Modules can be arranged in virtually any configuration within the UI To move a module click its title bar and drag it to the desired new location While dragging a grey outline will appear showing the location the module will occupy if the mouse is released Track modules can be docked to the top or bottom of the track space while other modules can be docked to any edge of the UI In addition modules can
34. wser com In addition this menu item is also used by plugins such as the SQL and UCSC plugins to allow you to open a track using that plugin 2 3 3 Track Types Savant supports five different types of tracks which are described below Each track appears in a separate window which can be manipulated as described in 86 At the right of the track is a legend which describes its contents Above the legend is a track specific menu bar which allows you to control the display and behaviour of that track This menu bar will have at least two items Tools and Appearance In addition some tracks have menu items which let you control Display Mode and Interval Height The Tools menu provides useful functionality such as the ability to Lock a track see 85 1 and to copy the track s URL to the clipboard Track types which have the ability to filter their contents add a Filter item to the Tools menu which invokes a dialog to specify filter parameters The Appearance menu controls the track s colour settings For tracks which have a vertical scale all but sequence tracks the Scale to Fit menu item controls whether the track scales its y axis to fit the size of the window or uses a vertical scrollbar when necessary Sequence Tracks Sequence tracks take their data from a fa or fa savant file They display a sequence of colour coded nucleotides Sequence tracks are often used by File gt Load Genome to provide the reference genome for a proj
Download Pdf Manuals
Related Search