Primer Island_Book
Contents
1. ea E CELL PORATOR amp L E coli Pulser O READY VOLTAGE kV CHARGE TRIGGER LOW e HIGH JE VOLTAGE RANGE POWER LIFE Qe TECHNOLOGIES Q gu ES Copyright 1997 Life Technologies Inc All rights reserved Place 1 mL of S O C Medium into a 15 mL polypropylene tube Leave on the bench top at room temperature Prepare one tube for each sample Thaw the electrocompetent DH10BE coli cells on ice 15 25 minutes before use Note Competent DH10B E coli cells should be stored at 70 C A decline in electroporation efficiency is observed if cells remain thawed for an extended time period Proceed to Electroporation Electroporation The procedure below describes the steps for electroporation IMPORTANT Poor transposition frequencies may result from low electroporation efficiencies To perform electroporation Step Action 1 For each sample place 1 uL of chilled DNA and 16 uL of competent DH10B E coli cells into a prechilled microcentrifuge tube Store the remainder of the transposition reaction at 15 to 25 C To perform electroporation continued Step Action 2 To monitor the efficiency of the electroporation use the pUC 19 control plasmid provided with the electrocompetent DH10B E coli cells Dilu2. TlAlelcic AT 2 DNA A T C G G taroet l E coli DNA Repair TlAla cic TIA G C 2 AT 2 DNA 8 Alticlala A T c a c DER ap Figure 2 Transposase mechanism The resulting intermediate DNA structure contains 5 bp single stranded gaps that flank each end of the transposon The gaps are filled in by an E coli repair mechanism after transformation and are duplicated during the repair process The short duplications generated are called target site duplications The Primer Island Transposition Kit has been optimized to produce single transposon insertions in a plasmid target The distribution of Primers and Priming Sites transposition events will be randomly distributed over the target The sequence of the DNA insertions can be manipulated using Factura and AutoAssembler software The software removes vector TN and target site duplication sequences and aligns overlapping DNA sequences PI and PI Primers and Priming Sites The primers Pl and PI bind to the priming sites that appear shaded on the AT 2 transposon figure Figure 1 on page 4 The sequences of the primers are Pl 4 5 CAGGACATTGGATGCTGAGAATTCG 3 Pl 5 CAGGAGCCGTCTATCCTGCTTGC 3 Fluorogenic versions of these primers are available from PE Applied Biosystems as components of Primer Island Sequencing Kits These kits are used in conjunction with the ABI PRISM Dye Primer Cycle Sequencing Core Kit Refer to Appe
3. 0 0 cece eee eens 22 Performance Specifications 0 0 00 0c cece eee 23 Troubleshooting secs vera Rr a sea 24 Appendix A Primer Island Kits and Related Sequencing Kits 25 Appendix B Preparing Stop Buffer ooooooocooomomoooo oo 26 Procedure ne LUE ob OER UELUT NM V ES 26 Introduction Transposons Transposons TNs are mobile genetic elements regions of nucleic acid capable of inserting themselves or copies of themselves throughout the genome Naturally occurring transposons encode the proteins that facilitate their movement into and out of DNA The Primer Island Transposition Kit is based upon the yeast Ty1 transposable element Ty1 is a retrotransposon of the yeast Saccharomyces cerevisiae In structure and mechanism it resembles retroviral proviruses The Ty1 system is the only transposon for which random high efficiency in vitro integration has been described Devine and Boeke 1994 This in vitro transposition reaction is the basis of the Primer Island Transposition Kit The in vitrotransposition system used in the Primer Island Transposition Kit places unique primer binding sites primer islands randomly throughout a population of large DNA molecules These primer sites may be used subsequently for polymerase chain reaction PCR amplification or DNA sequencing reactions Transposon insertion is an alternative to subcloning or primer walking when sequencing a large region of DNA Dev
4. Tel 886 2 698 3505 Fax 886 2 698 3405 Thailand Bangkok Tel 662 719 6405 Fax 662 319 9788
5. binding sites for the Pl and Pl primers For the sequence of the plasmid refer to the PE Applied Biosystems FTP site The address is referenced in Primers and Priming Sites on page 6 Materials and Equipment Kit Contents The Primer Island Transposition Kit contains sufficient reagents for 20 transposition reactions Table 1 Kit Reagents Reagent Volume Description Transposase 40 uL One vial containing the transposase enzyme complex in 10 mM HEPES KOH pH 7 8 15 mM KCI 5 mM EDTA 5096 sucrose 5X Transposase Buffer 200 uL One vial containing 50 mM Tris pH 7 5 50 mM MgCl 5 mM DTT 25 PEG 8000 AT 2 Transposon 20 uL One vial containing 200 ug mL of purified transposon stored in 10 mM Tris 1 mM EDTA pH 8 0 Control Target DNA 25 uL One vial containing 1 mg mL of control plasmid stored in 10 mM Tris 1 mM EDTA pH 8 0 DNA Sequencing 34 uL One vial containing 200 ug mL Control purified double stranded sequencing template The template is stored in 10 mM Tris 1 mM EDTA pH 8 0 Note Refer to Appendix A on page 25 for descriptions and part numbers of kits closely related to the Primer Island Transposition Kit continued on next page Materials The items listed in Table 2 and Table 3 are recommended in addition to Recommended the reagents supplied with the Primer Island Transposition Kit But Not Supplied Table 2 User supplied equipment Equipment Items Source A
6. Add the following 25 uL deionized water 25uL 7 5 M ammonium acetate 75yL isopropanol Note Ethanol precipitation can be performed instead of isopropanol precipitation Refer to Sambrook et al 1989 for DNA precipitation methods Centrifuge immediately in a microfuge at 14 000 rpm for 30 minutes at 2 6 C Note Quantitative DNA recovery is essential for an adequate yield of trimethoprim resistant tmpP colonies An excellent way to achieve this is to pellet the DNA to the bottom of the tube by using a rotor which secures the sample at a right angle with respect to the spindle axis Alternatively if a fixed angle rotor is used be sure to resuspend the DNA by washing the side wall of the microcentrifuge tube extensively in step 6 Carefully remove the supernatant with a 200 uL fine bore pipet tip Leave 5 10 uL of supernatant at the bottom of the tube Note Do not allow the pipet tip to disturb the DNA pellet Rinse the pellet with 500 uL of ice cold 70 ethanol and repeat step 2 and step 3 Place the tube on the bench to air dry or dry in a vacuum centrifuge for several minutes Resuspend the DNA pellet in 20 uL of sterile deionized water The final DNA concentration should be approximately 50 ng uL IMPORTANT Do not resuspend the DNA in 1X TE 10 mM Tris 1 mM EDTA or any conductive buffer Proceed to Preparing for Electroporation on page 15 continued on next page Preparin
7. thoroughly by flicking the tube and inverting it several times 2 Set up the following reaction in a 1 5 mL microcentrifuge tube Reagents are listed in preferred order of addition Reagent Volume uL Deionized water 12 5X Transposase Buffer 4 AT 2 Transposon 0 2 ug 1 Control Target DNA 1 ug 1 or desired target DNA at 1 ug uL Transposase 2 Total volume 20 Note The target DNA preparation can be resuspended in 1X TE or sterile deionized water Adjust the volume of deionized water in the reaction according to the volume of target DNA used The total volume of deionized water and target DNA in the reaction is 13 uL 3 Mix reagents gently Do not vortex 4 Incubate at 30 C for one hour Prepare Stop Buffer immediately prior to use Refer to Appendix B on page 26 Note Using anything other than freshly prepared Stop Buffer may result in low electroporation efficiencies To complete the transposition reaction continued Step Action 6 Stop the reaction by adding 5 uL of freshly made Stop Buffer and incubating at 65 C for 30 minutes 7 Proceed to Transposition Reaction Cleanup on page 14 continued on next page 13 14 Transposition Follow the steps below to precipitate wash and resuspend the DNA R i x encon CI To clean up the transposition reaction Step Action 1 After 30 minutes at 65 C briefly centrifuge the samples to collect condensate at the tube bottom
8. BI 373 DNA Sequencer ABI PRISM 377 DNA Sequencer or ABI PRISM 310 Genetic Analyzer Factura software AutoAssembler software See your local PE Applied Biosystems representative for more information concerning these products 1 5 mL microcentrifuge tubes Major laboratory suppliers MLS 15 mL polypropylene screw cap tubes MLS Adjustable volume pipettors MLS 0 20 uL 20 200 uL 100 1000 uL Bunsen burner MLS Cell Porator E coli Electroporation System Life Technologies Inc P N 11613 015 Disposable gloves MLS Environmental shaker 37 C MLS Fine bore gel loading pipette tips MLS filter plugged 200 uL capacity Incubator 37 C MLS Microcentrifuge MLS Microelecroporation Life Technologies Inc chamber P N 11608 015 Plate streaker MLS Pipette tips with filter plugs MLS Rotating platform for uniform MLS streaking of agar plates Two heat blocks 30 C and 65 C MLS Thermometers 0 100 C MLS Vacuum centrifuge DuPont Speedvac or MLS 10 Table 3 User supplied reagents Reagent Items Source Ammonium acetate molecular biology grade Major laboratory suppliers MLS Carbenicillin LB agar platea Teknova Inc P N 0133 C75 or MLS Deionized water nuclease and MLS protease free EDTA molecular biology grade MLS Electromax competent frozen E coli cells strain DH10B Life Techn
9. G CHEMICAL HAZARD Certain chemicals used with this kit may be hazardous and require special handling Do not store handle or work with any chemicals or hazardous materials unless you have received appropriate safety training and have read and understood all related Material Safety Data Sheets Comply with all federal state and local laws related to chemical storage handling and disposal Microorganisms WARNING Always follow CDC NIH principles of biosafety for activities involving biological agents These principles can be found in the U S Department of Health and Human Services Publication No CDC 93 8395 Biosafety in Microbiological and Biomedical Laboratories 11 Transposition Electroporation and Selective Plating 12 Transposition During the transposition reaction transposons are randomly integrated into the target DNA The insertion is facilitated by a protein complex containing transposase This reaction is described in detail by Devine and Boeke 1994 and by Kimmel et al 1997 IMPORTANT Target DNA purity is critical Plasmid DNA should be purified by a standard method such as CsCl gradient centrifugation Sambrook et al 1989 or by column purification kits such as those sold by Qiagen or PE Applied Biosystems P N 401015 Miniprep DNA does not perform well in this reaction Reaction To complete the transposition reaction Step Action 1 Thaw frozen reagents When thawed mix
10. Primer Island Transposition Kit Protocol PE Applied Biosystems A DIVISION OF PERKIN ELMER Products and procedures described in this protocol are intended for research purposes only Copyright 1997 The Perkin Elmer Corporation All rights reserved Printed in the U S A The PCR process is covered by patents owned by Roche Molecular Systems Inc and F Hoffman LaRoche Ltd Use of the PCR process requires a licence Information on licenses to practice the PCR process may be obtained by contacting the Director of Licensing at PE Applied Biosystems 850 Lincoln Center Drive Foster City California 94404 or at Roche Molecular Systems 1145 Atlantic Ave Alameda California 94501 This product is sold under licensing arrangements with the Johns Hopkins University for patents pending in In vitro Transposition of Artificial Transposons Perkin Elmer is a registered trademark of The Perkin Elmer Corporation ABI ABI PRISM and the ABI PRISM design Applied Biosystems AutoAssembler Factura PE and PE Applied Biosystems are trademarks of The Perkin Elmer Corporation AmpliTaq is a registered trademark of Roche Molecular Systems Inc All other trademarks are the sole property of their respective owners P N 402920 Rev A Contents INTO UC ON al c ter LOB EEE T S SUE oet 1 T atsposotls ccs aide sh eee a Ue URS Anos CANIT RR Mp 1 HOW it Works our eoo ee Oe ARE CER el aad 2 Benefits of This System llle 2 Artificial T
11. Repeat steps 3 8 until all of the samples and the pUC 19 controls have been electroporated and resuspended in S O C Medium 11 Shake the tubes at 225 rpm for 60 minutes at 37 C 12 Proceed to Selective Plating Selective Plating Follow the procedure below for making serial dilutions of the electroporated DH10B cells and plating them on selective media Two types of selective media will be used Carbenicillin 75 ug mL in LB agar Carbenicillin and Trimethoprim each at 75 ug mL in LB agar Note This protocol provides guidelines for DH10B plating dilutions The appropriate dilution will depend on your DNA sample The goal is to select plating dilutions that will yield 100 300 colony forming units CFU per plate To make dilutions and plate cells Step Action 1 Prepare plating dilutions by setting up six 1 5 mL microcentrifuge tubes for each electroporated sample except pUC 19 see step 6 Label the dilution series as follows 10 1 10 2 10 3 10 4 10 5 10 9 Pipette 900 uL of S O C Medium into each tube Pipette 100 uL of electroporated E coli bacteria into the tube labeled 10 1 Gently invert the closed tube several times Remove 100 uL from this tube and pipette the volume into the tube labeled 10 2 Repeat mixing and pipetting routine until all tubes for a dilution series contain electroporated bacteria To make dilutions and p
12. TGGATGCTGAGAATTCGATATCAAGCTTATCG 844 ATACCGTCGACCTCGAGAACA 3 EcoR Hind II Sal Xhol U3 EcoR V Acc Ava Figure 1 The artificial transposon AT 2 For description refer to Artificial Transposon on page 3 Figure adapted from Kimmel et al 1997 continued on next page Transposase The in vitro transposase reaction is catalyzed by a Ty1 encoded Mechanism enzyme complex purified from Saccharomyces cerevisiae strain JB1143 This strain was modified from JB1141 Devine and Boeke 1994 The transposase often referred to as an integrase in the literature proceeds via a cut and paste transesterification mechanism to insert the transposon into the target DNA Craigie 1992 This process is shown in Figure 2 The DNA sequence shown in Figure 2 has been arbitrarily chosen During integration the double stranded target DNA is cleaved resulting in a five base pair staggered cut The two blunt ends of the linear transposon DNA are simultaneously joined to the target DNA ends by single phosphodiester bonds Because the reaction requires no additional energy source e ATP it is assumed that the energy produced by the strand cleavage is subsequently used to create the phosphodiester bond Braiterman and Boeke 1994 gt TIA ERES target DNA A TI C GIG T AT 2 Transposon
13. abeled with 5 FAM JOE TAMRA and ROX Primer Island Sequencing Kit 403014 Contains reagents necessary to perform 100 sequencing reactions Contains the Pl primers and P N 402070 Primers are labeled with 5 FAM JOE TAMRA and ROX Primer Island Sequencing Kit 403018 Contains reagents necessary to perform 100 sequencing reactions Contains the PI primers and P N 402070 Primers are labeled with 5 FAM JOE TAMRA and ROX Primer Island Sequencing Kit 402980 Contains reagents necessary to perform 100 sequencing reactions Contains the Pl and PI primers and P N 402070 ABI PRISM Dye Primer Cycle 402114 Sequencing Core Kit Protocol ABI PRISM Dye Primer Cycle 402125 Contains reagents to perform 100 sequencing Sequencing Core Kit with AmpliTaqe reactions Does not contain primers Includes the DNA polymerase FS protocol ABI PRISM Dye Primer Cycle 402070 Same reagents as P N 402125 above Does not Sequencing Core Kit with AmpliTaq DNA polymerase FS include the protocol Appendix B Preparing Stop Buffer Procedure The table below describes how to prepare the Stop Buffer used in the Transposition Reaction on page 12 Step Action 1 Combine the following Reagent Volume uL Deionized water 27 5 0 5 M EDTA 50 0 10 SDS 10 0 40 mg mL Proteinase K 12 5 Total volume 100 0 Note The Proteinase K should be suspended in 10 mM CaCl aliquoted and frozen at 70 C Under th
14. aha Tel 2 61 22 21 64 Fax 2 61 22 21 68 Denmark Aller d Tel 48 100 400 Fax 48 100 401 Finland Espoo Tel 0 880 144 Fax 0 803 8002 France Paris Tel 1 49 90 18 00 Fax 1 48 63 22 82 Germany Weiterstadt Tel 0 6150 101 0 Fax 0 6150 101 101 P N 402920 Rev A Hungary Budapest Tel 1 251 11 16 Fax 1 251 14 61 Italy Milano Tel 039 23831 Fax 039 2383490 Norway Oslo Tel 0 22 68 65 65 Fax 0 22 68 70 68 Poland Warszawa Tel 22 33 09 36 Fax 22 33 09 96 Russia Moskva Tel 095 952 7961 Fax 095 952 7514 Spain Madrid Tel 1 803 4210 Fax 1 804 0414 Sweden Sundbyberg Tel 08 706 22 00 Fax 08 706 22 01 Switzerland Rotkreuz Tel 041 799 7708 Fax 041 790 0676 United Kingdom Warrington Cheshire Tel 01925 825650 Fax 01925 282502 All Other European Countries Middle East West Asia Africa Langen Germany Tel 49 6103 708 301 Fax 49 6103 708 310 Regional Sales O ffices JAPAN PACIFIC RIM Chiba Japan Tel 0473 80 8500 Fax 0473 80 8505 EASTERN ASIA CHINA OCEANIA Australia Scoresby Victoria Tel 03 9212 8585 Fax 03 9212 8502 China Beijing Tel 86 10 6238 1156 Fax 86 10 6238 1162 Hong Kong Tel 852 2590 0238 Fax 852 2590 0513 Korea Seoul Tel 822 592 7238 Fax 822 532 4908 Malaysia Kuala Lumpur Tel 60 3 758 1118 Fax 60 3 758 5688 Singapore Tel 65 336 0322 Fax 65 338 3991 Taiwan Taipei Hsisn
15. ain a plasmid with one copy of integrated transposon Insertions may be mapped by colony PCR amplification or miniprep DNA may be isolated for DNA sequencing or PCR analysis For a more detailed explanation of how this technology works refer to Devine and Boeke 1994 Devine et al 1997 and Kimmel et al 1997 The Primer Island Transposition Kit has several advantages Employs a simple in vitro reaction Uses any plasmid or F coli host strain Inserts transposon randomly into diverse DNA sequences Inserts priming sites for PCR amplification 9 9 Inserts priming sites for bidirectional DNA template sequencing continued on next page Artificial The linear transposon AT 2 is shown in Figure 1 on page 4 This Transposon artificial transposon has the following features How displayed in Feature Figure 1 on page 4 Function Four base pair Labeled U3 Sequence recognized by termini Ty1 transposase Allows the TN to be inserted efficiently into the target DNA DHFR genea Start and stop codons Codes for trimethoprim GTG and TAA respectively resistance are boxed Primer binding Sequences are shaded During a sequencing sites Pl 4 PI extends from reaction the primers are and PI nucleotide 809 828 extended out into the PI extends from adjacent DNA template nucleotide 42 59 allowing the target DNA to be sequenced bidirectionally Primer binding Sequences are under
16. being sequenced by the ABI 373 or ABI PRISM 377 DNA Sequencer then the raw data can be imported into Factura software to remove vector sequences from sequencing files Factura software can also be used to recognize and remove the TN sequence from the sequencing file AutoAssembler software from PE Applied Biosystems can be used to align overlapping DNA sequences and remove 5 bp target site duplications from the template sequence These duplications provide a useful point to generate a mini contig from each transposition A deletion of a segment of the target DNA occurs infrequently during transposon insertion The reasons for deletion of target DNA are not known but appear to be target DNA sequence dependent There are two indications of a target DNA deletion The typical 5 bp target site duplication is not observed Refer to Figure 2 on page 5 for transposase mechanism The sequences from both ends of the transposon do not align as expected during the final sequence assembly The sequences may be separated by ten base pairs to several kilobases depending upon the size of the target DNA deletion When a target DNA deletion occurs the sequence data obtained from each end of the transposon is valid There have been no reports of internal deletions or scrambling of sequences by the transposon The two sequences may be considered separately and assembled accordingly continued on next page Performance The performance specif
17. ed bacteria produced per microgram of DNA subjected to electroporation Calculate the transformation efficiency for each electroporation using the formula CFU 10 ng Dilution 1 _ CFU F a ng DNA ug Factor Fraction of Dilution Plated ug DNA For example DH10B is electroporated with 2 5 ng of pUC 19 and 1 mL of a 1075 dilution of electroporated bacteria is prepared A 100 uL plating of the 10 5 dilution yields 25 CFU The transformation efficiency is calculated as follows 25 CFU _ 103 ng 1 CFU T 105 10 Een woo Goon 505 DNA The Frequency of Transposition F Tp is defined as the frequency of transposon insertion into the Control Target DNA and is expressed as the ratio of two transformation efficiencies the efficiency of transforming DH10B to carbenicillin trimethoprim resistance with the target DNA containing at least one copy of the transposon the efficiency of transforming DH10B to carbenicillin resistance This ratio is expressed mathematically as follows F Tp Efficiency of carbP tmpR transformation Tf carbP tmp m Efficiency of carb transformation Tr carb continued on next page 21 22 Five Base Pair Repeats Target DNA Deletions As discussed in Transposase Mechanism on page 5 the insertion of the AT 2 transposon into the target DNA results in the generation of a five base pair target site duplication This sequence flanks the transposon If the DNA is
18. ese storage conditions the stock is usable for months Do not reuse thawed aliquots If a precipitate appears in the Stop Buffer warm the bottom of the microcentrifuge tube by gently rubbing it with your fingers Gently mix the tube Do not vortex Appendix C References Baker Brachmann C Sherman J M Devine S E Cameron E Pilus L and Boeke J D 1995 The SIR2 gene family conserved from bacteria to humans functions in silencing cell cycle progression and chromosome stability Genes Dev 10 2888 2902 Braiterman L T and Boeke J D 1994 In vitro integration of Ty1 a direct physical assay Mol Cell Biol 14 5719 5730 Craigie R 1992 Hotspots and warmspots integration specificity of retroelements Trends Genet 8 187 189 Devine S E and Boeke J D 1994 Efficient integration of artificial transposons into plasmid targets in vitro a useful tool for DNA mapping sequencing and functional analysis Nucleic Acids Res 22 3765 3772 Devine S E Chissoe S L Eby Y Wilson R K and Boeke J D 1997 A transposon based strategy for sequencing repetitive DNA in eukaryotic genomes Genome Res in press Fling M E and Richards C 1983 The nucleotide sequence of the trimethoprim resistant dihydrofolate reductase gene harbored by Tn7 Nucleic Acids Hes 11 5147 5158 Kimmel B Palozzolo M J Martin C H Boeke J D and Devine S E 1997 Transposon mediated DNA seq
19. g for After completing the transposition reaction and post reaction DNA Electroporation clean up prepare for the electroporation of the transposition reaction into electrocompetent DH10B E coli cells The procedures described below and in Electroporation on page 16 apply to use of an electroporator from Life Technologies Inc Similar devices from other manufacturers may also be used IMPORTANT All electroporation components must be chilled to 2 6 C prior to contact with E coli cells To prepare for electroporation Step Action 1 Store the two section base and the disposable microelectroporation chambers at 2 6 C Place on ice immediately before use CS Lid M Disposable Microelectroporation Chamber Positioning post Top base Chamber R Bottom base Chamber Copyright 1997 Life Technologies Inc All rights reserved Prechill one microcentrifuge tube for each sample Separate the base into two components Fill the top base chamber with water and ice then attach the bottom base chamber Place at 2 6 C until ready to use Allow the base to chill for at least 30 minutes before electroporation 15 16 To prepare for electroporation continued Step Action 4 Turn on the electroporator to allow time for warm up Allow a 30 minute warmup before charging the capacitor Set the voltage range to Medium
20. ication is based upon the frequency of Specifications transposition F Tp Using control reagents and protocol the F Tp value should equal or exceed 1 x 10 5 That is for every 10 carbenicillin resistant transformants recovered at least 104 transposition events should be recovered Note Inefficient electroporation will adversely impact the yield of trimethoprim resistant colonies Twenty nanograms of Control Target DNA recovered from the transposition reaction should yield 100 300 carbenicillin resistant trimethoprim resistant bacterial colonies Troubleshooting Observation Possible Cause Recommended Action Poor recovery of tmpP bacterial colonies and the transformation efficiency of the pUC 19 control is gt 1 x 1010 CFU ug or The transformation efficiency of bacteria plated on carbenicillin carbP is at least a factor of 106 greater than the transformation efficiency of bacteria plated on carbenicillin trimethoprim carbR tmpR DNA impurities Establish the transposition frequency empirically using your reagents with the Control Target DNA Compare with the transposition frequency obtained using your template DNA Purify plasmid DNA using column chromatography or CsCl centrifugation Mini prepped DNA is not recommended Electrophorese cut and uncut target DNA overloaded on an agarose gel to screen for contaminants DNA contaminated with protein Extract the transposition
21. ine and Boeke 1994 Baker Brachmann et al 1995 Devine et al 1997 Nam et al 1997 Williams et al 1997 continued on next page How it Works Benefits of This System The Primer Island Transposition Kit provides the necessary reagents and control system for generating artificial transposon insertions into DNA in vitro The Primer Island Kit reagents are combined and incubated with a target DNA which is subsequently purified and electroporated into Escherichia coli The reagents in this kit have been optimized for transposon insertion into plasmid DNA Insertion frequencies will vary according to the type and size of the DNA target To select for bacteria harboring a plasmid with a transposon insertion the electroporation reaction is plated on Luria Bertani LB agar plates containing the appropriate antibiotics e one for the target plasmid and a second for the transposon The artificial transposon AT 2 is included with the kit In addition to the unique primer binding sites AT 2 contains a gene that encodes dihydrofolate reductase DHFR DHFR confers resistance to trimethoprim Fling and Richards 1983 Assuming that the target plasmid encodes for the gene conferring ampicillin resistance plating on ampicillin and trimethoprim LB agar plates should permit the growth of only those bacteria containing a plasmid with a transposon insertion Each ampicillin resistant and trimethoprim resistant colony will typically cont
22. late cells continued Step Action 5 Repeat this serial dilution procedure until each of the electroporated samples is serially diluted Prepare plating dilutions for the pUC 19 electroporation control by setting up five 1 5 mL microcentrifuge tubes Label this dilution series as follows 10 1 10 2 10 3 10 4 10 5 Repeat steps 2 4 for the pUC 19 controls For each of the following dilutions plate 100 uL of the transposition DH10B electroporation mixture onto carbenicillin LB agar plates 10 5 10 6 Note The agar plates should not be wet or have condensation on the lids Prewarm the plates at 37 C for 30 minutes prior to use Plate in triplicate to ensure accuracy when assessing transposition frequency and electroporation efficiency For each of the following dilutions plate 100 uL of the transposition DH10B electroporation mixture onto carbenicillin trimethoprim LB agar plates Undiluted 101 10 For each of the following dilutions plate 100 uL of pUC 19 DH10B electroporation mixture onto carbenicillin LB agar plates 104 105 11 Plate 100 uL of undiluted pUC 19 DH10B electroporation mixture onto carbenicillin trimethoprim LB agar plates 12 Invert the plates and place them at 37 C overnight Note Discard all serial dilutions upon completion of step 10 13 Proceed to Data Analysis on page 20 19 Data Analysis Transpo
23. lined Allows amplification of sites SD110 PCR products using a and SD111 single TN specific primer in conjunction with a vector specific primer Polylinker Boxed Useful for restriction sequence mapping of the site of transposon insertion prior to sequencing a The gene was originally derived from Tn7 Fling and Richards 1983 Pac Xho BamH Ava Spe Sal Xba Acc Eag Hind III Not EcoR V P ll E GTG DHFR TAA Ey U3 lt SD110 SD111 gt U3 PIE Pl gt Eag U3 Sac Il Not Xbal Spel BamH 1 5 TGTTCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCTGCA 45 AGCAGGATAGACGGCATGCACGATTTGTAATAACAGAGTGTCTTGTA 92 TTTTTAAAGAAAGTCTATTTAATACAAGTGATTATATTAATTAACGG 139 TAAGCATCAGCGGGTGACAAAACGAGCATGCTTACTAATAAAATGTT 186 AACCTCTGAGGAAGAATTGTGAAACTATCACTAATGGTAGCTATATC 233 GAAGAATGGAGTTATCGGGAATGGCCCTGATATTCCATGGAGTGCCA 280 AAGGTGAACAGCTCCTGTTTAAAGCTATTACCTATAACCAATGGCTG 327 TTGGTTGGACGCAAGACTTTTGAATCAATGGGAGCATTACCCAACCG 374 AAAGTATGCGGTCGTAACACGTTCAAGTTTTACATCTGACAATGAGA 421 ACGTATTGATCTTTCCATCAATTAAAGATGCTTTAACCAACCTAAAG 468 AAAATAACGGATCATGTCATTGTTTCAGGTGGTGGGGAGATATACAA 515 AAGCCTGATCGATCAAGTAGATACACTACATATATCTACAATAGACA 562 TCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATCCCCAGCAATTTT 609 AGGCCAGTTTTTACCCAAGACTTCGCCTCTAACATAAATTATAGTTA 656 CCAAATCTGGCAAAAGGGTTAACAAGTGGCAGCAACGGATTCGCAAA 703 CCTGTCACGCCTTTTGTGCCAAAAGCCGCGCCAGGTTTGCGATCCGC 750 TGTGCCAGGCGTTAGGCGTCATATGAAGATTTCGGTGATCCCTGAGC 797 AGGTGGCGGAAACAT
24. ndix A on page 25 for part numbers These primers are similar to the SD118 and SD119 primers described by Boeke and Devine 1994 However they have been modified by the addition of a mobility tag CAGGA to the 5 end of each oligonucleotide In addition primer specific mobility files have been designed for these primers and are available on the Internet at the PE Applied Biosystems FTP site ftp 192 43 251 1 pub public SD110 and SD111 Nested Priming Sites An additional set of primer binding sites called SD110 and SD111 is located internal to the PI and Pl sites One of these sites can be used in conjunction with a vector specific priming site to amplify PCR products Sizing of these PCR products can be used to map the location of the TN insert in the vector These PCR products can subsequently be sequenced using the Pl and PI sequencing primers continued on next page Control Target DNA Sequencing Control A plasmid control is included with the Primer Island Transposition Kit This control is used to establish the frequency of transposon insertion a measure of reagent performance This plasmid consists of an insert of 527 base pairs from lambda DNA and confers ampicillin resistance For the sequence of the plasmid refer to the PE Applied Biosystems FTP site on the Internet The address is referenced in Primers and Priming Sites on page 6 A Sequencing Control has been included in the kit This plasmid has
25. ologies Inc P N 18290 015 Ethanol MLS Isopropanol Fluka P N 59304 Proteinase K PE Applied Biosystems P N 400457 S O C Medium Life Technologies Inc P N 15544 018 SDS molecular biology grade MLS Trimethoprim Carbenicillin LB agar platesa Teknova Inc P N 0133 C75M75 or MLS a We prefer carbenicillin to ampicillin because of its stability properties The ampR gene confers resistance to both antibiotics If ampicillin is used prepare fresh plates with 50 pg mL ampicillin b Teknova Inc Half Moon Bay CA 415 728 2557 continued on next page Storage and Stability Technical Support Safety Upon receipt store the Primer Island Transposition Kit at 15 to 25 C in a constant temperature freezer If stored under the recommended conditions the product will maintain performance through the control date printed on the label In the United States or Canada call 800 831 6844 for technical support Outside the United States and Canada call you local sales office Sales office numbers are given on the back cover of this protocol Please adhere to the following safety warnings 5X Transposase Buffer WARNING CHEMICAL HAZARD May cause skin eye and respiratory tract irritation Wear gloves a lab coat and protective eyewear when handling If contacted wash affected area with large amounts of water for 15 minutes Other Chemicals WARNIN
26. ransposon sso csc ab eke eee E RR e e 3 Transposase Mechanism 0 0 e eee ee 5 Primers and Priming Sites eese 6 PI and PI Primers and Priming Sites 6 SD110 and SD111 Nested Priming SiteS o oo oo ooo o 6 Control Target DNA crec ietis cece eee 7 Sequencing Control 0 0 00 0 ee eee ee eee 7 Materials and Equipment 0 0 ee cee eee eee eee 8 KitiContents ike ors soe pe eles piste See Suse Cartel eine aM ed ME 8 Materials Recommended But Not Supplied 0 9 Storage and Stability s sesa s ees t ee eee eee 11 Technical SUpport ssc ee e eee ee eee ee 11 odfety 2c ces ede ed eet hat tU a iba 11 5X Transposase Buffer 00 00 eee ee eee eee 11 Other Chemicals ociosas is ae ees dase eee C 11 Microorganisms e ia cece eects 11 Transposition Electroporation and Selective Plating 12 Transposition Reaction 12 Transposition Reaction Cleanup 0 0 0 0 2 eee eee 14 Preparing for Electroporation 0 0 00 eee eee eee 15 Electropotation ee bi di 16 Selective Plating coco cree Ma wel eh erie eb dU ee 18 Dat Analysis St REPE ERES cha ies ate ER 20 Transposition Data Analysis l l eee esee 20 Transformation Efficiency lessen 21 Frequency of Transposition 0 0 cece eee eee 21 Five Base Pair Repeats 0 0 cee cee eee eens 22 Target DNA Deletions
27. reaction with phenol chloroform Precipitate the DNA using isopropanol or ethanol followed by a 70 ethanol wash No tmp colonies recovered and the transformation efficiency of the pUC 19 control is lt 8 x 109 CFU ug Inadequate recovery of DNA pellet Following precipitation of the transposition reaction carefully resuspend all of the DNA by washing the walls of the tube Incorrect electroporator settings or poor technique Check electroporator settings Repeat pUC 19 electroporation after reviewing the troubleshooting guide in the electroporator user s manual Bacterial background growth on LB agar plates is too high Bad agar plate or aggressive bacterial growth Switch to M9 agar plates to reduce growth rates Appendix A Primer Island Kits and Related Sequencing Kits Name P N Description Primer Island Transposition Kit 403015 Contains reagents necessary to perform 20 transposition reactions Includes the protocol Primer Island Transposition Kit 402984 Contains reagents necessary to perform 20 transposition reactions Does not include the protocol Primer Island Transposition Kit Protocol 402920 Primer Island Dye Primers 402983 Contains the PI primers only sufficient for 50 sequencing reactions Primers are labeled with 5 FAM JOE TAMRA and ROX Primer Island Dye Primers 402982 Contains the PI primers only sufficient for 50 sequencing reactions Primers are l
28. sition Data Count bacterial colonies and determine the efficiencies and frequencies Analysis of transposition 20 Step Action 1 The following morning count the number of colony forming units CFU per LB agar plate Note Colonies plated on carbenicillin LB agar plates grow faster than colonies plated on carbenicillin trimethoprim LB agar plates Incubating plates for excessive time intervals will cause colonies to fuse making them difficult to tabulate accurately Colonies displaying a broad range of diameters may grow on carbenicillin trimethoprim LB agar plates For an accurate CFU determination count all colonies regardless of diameter Calculate the following as described on page 21 efficiency of transformation to carbenicillin resistance efficiency of transformation to carbenicillin trimethoprim resistance frequency of transposition Pick several colonies from the carbenicillin trimethoprim plates and isolate the plasmid DNA using a standard small scale isolation miniprep procedure Amplify the purified transformant DNA using PCR for mapping and or sequencing or immediately perform Cycle Sequencing as described in the ABI Prism Dye Primer Cycle Sequencing Core Kit Protocol P N 402114 continued on next page Transformation Efficiency Frequency of Transposition Transformation efficiency Tz or electroporation efficiency is defined as the number of CFU of transform
29. te the pUC 19 control with sterile deionized water to a concentration of 2 5 ng uL Place 1 uL of plasmid DNA and 16 uL of electrocompetent DH10B E coli cells into a prechilled microcentrifuge tube Check that the electroporator is charged The voltage display should read approximately 2 45 kV Pipette 16 uL of the DNA E coli mixture into the gap between the two electrodes of the prechilled microelectroporation chamber Make sure the droplet does not contain any bubbles Gently close the top Note The droplet must remain in the electrode gap Do not squeeze the body of the microelectroporation chamber as this may alter the interelectrode distance Handle the microelectroporation chamber at the rounded head Y Copyright 1997 Life Technologies Inc All rights reserved Place the disposable microelectroporation chamber into the chilled base 17 18 To perform electroporation continued Step Action 6 Place the lid on the base and tighten by clockwise rotation 7 Press the Trigger red button of the electroporator 8 Immediately pour 1 mL of S O C Medium from the 15 mL polypropylene tube into the microelectroporation chamber thus washing the droplet of DNA and E coli from the electrode gap Pour the contents of the microelectroporation chamber back into the 15 mL polypropylene tube Leave on the bench top at room temperature 10
30. uencing Birren B Green E Hieter P and Myers R eds In Genome Analysis a Laboratory Manual Cold Spring Harbor Press New York NY In press Nam K Lee G Trambley J Devine S E and Boeke J D 1997 Severe growth defect in Schizosaccharomyces pombe mutant defective in intron lariat degradation Mol Cell Biol 17 809 819 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laboratory Press Cold Spring Harbor NY U S Department of Health and Human Services 1993 Publication No CDC 93 8395 Biosafety in Microbiological and Biomedical Laboratories 3rd edition U S Government Printing Office 27 Williams S Hayes L Elsenboss L Williams A Andre C Abramson R Thompson J F and Milos PM 1997 Sequencing of the cholesteryl ester transfer protein 5 regulatory region using artificial transposons Gene in press PE Applied Biosystems A DIVISION OF PERKIN ELMER THE AMERICAS United States PE Applied Biosystems 850 Lincoln Centre Drive Foster City CA 94404 Tel 415 570 6667 800 345 5224 Fax 415 572 2743 Canada Mississauga Ontario Tel 905 821 8183 800 668 6913 Fax 905 821 8246 Latin America Del A Obregon Mexico Tel 52 5 651 7077 Fax 52 5 593 6223 EUROPE Benelux Nieuwerkerk a d ljssel Netherlands Tel 31 0 180 331400 Fax 31 0 180 331409 Chekia Rep Pr
Download Pdf Manuals
Related Search