Home

Tutorial - Oligo Software

1. Oligo 3 Pentamer GC Clamp Position Length Score Tm AG AC 1 l 19 24 928 71 1 6 8 7 9 2 57 27 Bb 714 6 9 7 9 7 3 173 24 ba 74 9 6 3 9 6 Oligo tm Pel Degeneracy File 1 57U27 GGAGAAAACGGAATCTAATCAGGAGGT 100 70 7 l File 2 67U27 GGAGAARACGGAATCTAATCAGGAGGT 100 70 7 1 Fila 3 71027 AGAGAAAACAGAATCTAATCAGGAGGT g3 68 1 l Fila 4 76U2 GGARAAAACAGACTCTAATCAGGAGGT 89 69 2 l File 5 58027 GGAGAAAACAGACTCTAATCAGGAGGT 93 70 2 l File 6 105Uz GGARAAAACAGAGTCTAATCAGGAGGT 89 69 2 1 Consensus 5 RGARAAAACRGARTCTAATCAGGAGGT 89 100 68 1 70 7 16 Analyzed files Human elF 4E seq 1 2 Chimpanzee elF 4E seq 3 Cow elF 4E seg 4 Mouse elF 4E seq 5 Rabbit elF 4E seq 6 Rat elF 4E seq Note that the mismatches with the File 1 the principal sequence are marked in red 17 4 5 Searching for TaqMan Probes amp PCR Pairs 1 Choose the Primers and Probes option from the Search menu 2 Click the TaqMan Probes amp PCR Pairs button 3 Click the Search button The sets are found and displayed in the Oligonucleotide Sets Table 4 Click once on a Set to select it or click twice to choose it and open the PCR analysis window at the same time 5 If you don t like the default Tm difference between the primers amp the probe before the search you may alter it by changing the Tm of Probe Tm of Primer search parameter in the Constraints window 6 If you need only a specific DNA r
2. Parameters Sequence Constraints Scores General Constraints More Constraints This will let you change the search stringency globally change sequence frequency table and salt and primers concentration in the reaction mix By default the stringency search is set to High If you experience a long search time you may shorten the search by starting from a lower stringency type Otherwise Oligo will reduce the stringency automatically if needed as long as the Automatically change stringency box is checked a Search Stringency High H wi Automatically change stringency Choose the Fair search stringency Check the Constraints and More Constraints options Each sub search option that will be active for a given search method has a blue dot on the left The irrelevant sub searches have no blue dots To the right of this dot you should see an open or closed lock This represents whether a given parameter can be changed during automatic stringency search You may wish to permanently fix a specific parameter to the displayed value by clicking on an open lock The lock should close Some parameters Oligo is not able to change automatically These sub searches are labeled with grey out locks The image below shows one of the sub searches in the More Constraints window 15 8 9 Template Loop AG Threshold 20 0 kcal mol This is active parameter for Compatible Pairs search blue dot on the left and the aut
3. 3 Navigating in Oligo Note if you want to duplicate the results in the search examples open Human elF 4E seq for your sequence file 3 1 Moving around a sequence file After the registration described in the User Manual Chapter 2 3 you may open a sequence file or a database This example describes how to move around and what features are immediately available to you after opening a sequence file 1 10 Open a sequence file use File Open and in the Test sequences Folder choose Human elF 4E seq Click on the CDS row displayed at the top right of the window You should see the Sequence window as depicted on the figure below e008 Sequence File Human elF 4E seq DNA Sequence Selected Oligo Position Length Feature Location Sequence Length 1868 nt O Forward Primer 1 source 18 1850 O Upper Oligo O Lower Oligo PCR Product nt Current Oligo Length 21 nt Reading Frame 1 O Reverse Primer 2 CDS 1 651 Position 18 len 12 100 200 300 400 500 600 700 500 300 1000 1100 1200 1300 1400 1500 1600 1700S CGATCAGATCGATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAGGAGAAAACGGAAT CTAAT CAGGAGGTT GCTAACCCAGAACACT GCTAGTCTAGCTAGATTCTACCGCTGACAGCTTGGCCTTTGGTGGGGATGAGGATTAGGGGGCTGATGTCTTCTCCTCTTTTGCCTTAGATTAGTCCTCCAACGATTGGGTCTTGTGA RS OR SKWATVEPETTPTPNPPTETEBCERKRTESNQOEVANPER YI lt G amp 9 4 gt Clicking on CDS highlighted the c
4. 71l Myalz6al 72 Nsil 73 Ppulol 14 Pyul 75 Sau96l 76 Sdul 77 SfaNl ii 78 Sfcl A 79 Spel i Enzyme Site Cuts Positions amp Fragment Sizes ell Lf oO 70 Mall CAYNNANNRTG 5 415 398 368 766 136 902 383 1285 132 1417 396 1813 37 Fl Mval269 GAATGC 1 1 l 1331 1314 536 fa Neil ATGCAAT a 1097 1080 290 1370 480 73 PpulOl AATGCAT a 1097 1080 290 1370 480 F4 Pvul CCATCG l 395 378 1472 73 Sau9bl G4GNCC l 934 Sl 933 i4 fb Sdul GDGCH4C 3 145 128 90 218 1537 1755 95 77 SfaNl GCATC S 9 1 1096 1079 771 78 Sfcl CATRYAG 3 64 4 668 115 317 432 1418 T Search Entire Sequence Linear Restriction Enzyme Database 5 amp UP EMZ This window consists of two parts The top one is a graphical representation the entire row represents the length of the sequence file and the blue vertical lines are the recognition sites The bottom part is the enzyme listing ended at the bottom with a list of non cutting enzymes scroll the bar down to see it the picture above does not show it The actual recognition sites are listed in black and the fragment sizes are in green 5 3 Search for restriction enzyme sites in protein This search reverse translates a protein sequence into all combinations of reading frames and finds all possible restriction enzyme sites that could be made This feature is useful in gene construction projects The example below shows how to find a protein of interest set the proper reading frame and
5. Add b Files Oligo 7 folder Test sequences Co w elF 4E seq m Files Oligo 7 folder Test sequences Mouse elF 4E seq Remove Files Oligo 7 folder Test sequences Rabbit elF 4E seq Files Oligo 7 folder Test sequences Rat elF 4E seq Save Set by repetitively clicking on a file name and the Add button 7 Click the Done button and return to the Select Files window The window should look similar to the one depicted above 8 You may click OK now but if you d like to memorize this set so that you can use it at later time click the Save Set button and give it a descriptive but short name than click OK 9 Go back to the Search for Primers amp Probes and click the Search button 10 The results are displayed in the Selected Oligonucleotides window Sort it by Oligo Position by clicking on the Oligo Position title 11 Double click on the second oligo pos 57 You ve just selected a non degenerate probe You may check it on any relevant Analyze windows In the top right of the Selected Oligonucleotides window there is a check box Select consensus oligos If it s checked the selected probe would contain a few degenerate bases This is because it is a consensus probe You may check the alignment by dragging up the dot located at the bottom center of the Selected Oligonucleotides window see below 22 Selected Oligonucleotides File Human elF 4E seq Upper Oligos HH 14 Select consensus oligos
6. RT Method Lathe Codons for Arginine AGA AGG CGA CGC CGG CGT 10 9 11 1 6 0 11 0 11 4 4 7 10 _ A i 179 ui 120 a PEE 1 R SD R SKMA T V E P E T T P T P N P gt A 4 gt aii 3 CCCTAATCCTCATCCCCACCAAAGGCCAAGCTGTCAGCGGTAGAATCTAGCTAG Clipboard is empty INS DNA 5 Close the Edit window and open the Melting Temperature window 6 Click on the Options button You should see this 292 Melting Temperature File Human elF 4E seq ea a ez 1868nt 21 mers pos tm TI 66 0 w Show Mean Value aod Show Threshold Values A a 2 0 Teoma 50 0 m ki a T y j Dots Pa 58 0 B Bg _ a E E poco s LT a e TAS j T ef Be 54 03 g b 52 0 e a 50 0 48 0 46 0 44 0 42 0 40 0 CGATCAGATCGATCTAAGATGGCGACTGOTCGAACCGGASACCACCCCTACTCCTAATCCCCCGACTACE a moe ae 4 7 Click on the Bars Now the Tms of the oligos is displayed as bars instead of dots This type of change is available on Internal Stability and Sequence Frequency windows as well 8 Click on the small graph icon e You should see this menu a fe Melting Temperature File Human elF 4E seq a aA l868nt 21 mers pos tm me i Aree pera is ae giant n CDR 5 66 05 2 Tm 64 0 Tir T kas J Tmi j 62 0 Tm Fea p Pa PS ee z 60 05 Ag g s O a ee d TIETE O SA a 54 0 TIT AG e 0 e 52 078 GC f 50 07 a a Ri 48 0 Degeneracy 46 0 44 0 42 0 40 0 CGATCAGATCGATCTAAGATGGCGACTGTCGAACCGGASACCACCCCTACTCCTAATCCCOCGACTA
7. Tutorial amp Examples Z Version 7 I Insights www oligo net OLIGO Primer Analysis Software Version 7 Assembled in 2009 by Wojciech Rychlik Molecular Biology Insights Inc Cascade CO USA http www oligo net OLIGO 7 Tutorial amp Examples Table of Contents 1 Oligo 7 Installation 1 1 Installation 1 2 Registration 2 File Opening and Viewing 2 1 Open a sequence file 2 2 Open a database file 3 Navigating in OLIGO 3 1 Moving around a sequence file 3 2 Changing windows appearance 3 3 Open and Print all relevant windows with one mouse click 4 Search for Primers and Probes 4 1 Searching for PCR primers a simple search 4 2 Searching for PCR primers an example to show the options 4 3 Searching for sequencing primers 4 4 Searching for consensus hybridization probes 4 5 Searching for TaqMan Probes amp PCR Pairs 4 6 Searching for Molecular Beacons amp PCR Pairs 4 7 Searching for siRNA Probes 4 8 Searching multiple files batch processing 4 9 Searching multiple files for PCR primer pairs and than multiplexing the selected sets 4 10 Searching a file for probes only in the selected regions 5 Other Search Options 5 1 Search for a sequence string 5 2 Search for restriction enzyme sites 5 3 Search for restriction enzyme sites in protein 1 Oligo 7 Installation 1 1 Installation Oligo software can be installed only if you have administrator privilages for this particular computer If yo
8. Selected Oligonucleotides You may also check the Primers amp Probes Search Data from the Search menu window to make sure that the final search stringency is acceptable OLIGO automatically reduces search stringency if it does not find any compatible pairs There are six sort options on the Oligonucleotide Sets and Selected Oligonucleotides windows The sort order is indicated in the figure below by red arrows 898 Oligonucleotide Sets File Human elF 4E seq g Forward Reverse Product Opt a Pri Length T FC l 59 332 932 294 52 5 40 5 2 101 336 920 256 51 6 39 8 1175 You may change the sort order by simply clicking at the column name Option click or Alt click allows for multiple sorts You may also sort the data by product length or any other field not sorted in the example above Click on a primer pair to select this primer pair or double click on a pair to view the PCR window for the selected pair 10 Choose the primers from the Analyze Key Info menu or other Analyze menu windows to view the primer sequence and or related data 4 2 Searching for PCR primers an example to show the options 1 Choose the Primers and Probes option from the Search menu 2 3 Verify that the Compatible Pairs button under PCR Primers in the dialog box is checked Click the Parameters button At this point you see the General Parameters as indicated at the top of the window mts Search Parameters
9. 151 Defaults it Pi ad Length Score Tw 3 adie me 1 1 1230 23 861 72 5 8 8 9 6 a 2 1287 21 810 73 0 5 6 9 6 0 3 1328 22 917 72 1 5 5 8 5 4 1367 22 947 71 2 6 4 9 1 5 2215 22 912 68 7 5 9 8 4 z 2247 21 815 65 0 6 0 8 5 7 4866 24 976 67 3 6 3 re 8 5018 24 934 68 5 4 7 8 6 9 10843 24 962 66 4 5 9 8 5 10 11987 22 901 68 5 5 9 7 6 11 5 Other Search Options 5 1 Search for a sequence string Oligo s search for string is not just a plain Find function commonly implemented in most editing software It allows searching for mismatches and for ambiguous bases This example shows the process 1 Start Oligo open Human elF 4E seq and choose Search for a Sequence String strand 2 Type a degenerate sequence CAYNNNNRTG It s an Msl I recognition site and click the Find button 22 String Search in strand Sequence String CAYNNNNRTG Allow 0 mismatches v Translate ambiguous bases K GT M AC R AG S CG W AT Y CT B not A D not C H not C V not T INX any 3 The results pop up in the Selected Bases window in the Strings column Click the last position 1813 You should see the following window 009o Selected Bases File Human elF 4E 5eq b String search results Loops Stems Palindromes Strings 18 13 17 T 12 16 a 11 15 10 l4 9 11 4 8 10 T 7 0 512 156 The pos 1813 is highlighted At the same time the Current Oligo pos 1813 is selected and you can
10. 3 The Test sequences folder doesn t have any database files so all the files are greyed out Go up one folder higher by choosing Oligo 7 folder form the top menu 4 Open universal primers odb You should see the database window 200 Oligonucleotide Database File universal primers odb Oo of Records 18 i Date ID Number Sequence 3 Dim AG PE p e Tm tr MO 1 07 13 94 X02513 6309L19 GGTTTTCCCAGTCACGACG 55 D 482 57 8 4 2 07 13 94 X02513 6290L17 GTAAAACGACGGCCAGT 1 2 SC 479 54 0 v 3 07 13 94 X02513 6209U16 AACAGCTATGACCATG 40 D 381 46 7 0 4 07 13 94 X52330 670U17 CGAGGTCGACGGTATCG 9 5 D 453 55 7 S 5 07 13 94 X52330 720L17 TCTAGAACTAGTGGATC 3 7 D 376 44 6 6 08 12 94 X52330 774L17 ATTAACCCTCACTAAAG 1 9 SC 369 43 7 S 7 08 12 94 X52330 633U21 ACTCACTATAGGGCGAATTGG aa IE 504 56 4 8 08 12 94 X52330 779L18 CGCGCAATTAACCCTCAC sc 516 156 0 Y This database is linked to Human elF 4E seq i 5 Click on record 3 From the table you can read that it forms a 3 dimer of 4 kcal mole and that this value is above the parameters threshold to change the thresholds you d have to use Options button 6 To see the actual dimer go to the Analyze menu database has a different Analyze menu and choose Duplex Formation When you check this window you may close it 7 The database has a powerful multiplexing option Click on Analyze Multiplex All Oligonucle
11. User Manual 25
12. cgtcAcTAATTTAATGCCTGGCTGatoaca I CERT IG IC TAGTAATITAATGCCTGOCTGTCACTACTCACTTTTTAAGEATOGTAT TGABCCTATCTCOGAAGATEAGAIUI GAAAACCCGAGACATGTTGGTATAGGTCAACAGATCATTAAATTACGGACCGACACTGATGAGTGAAAAATTCCTACCATAACTCGGATACACCCTTCTACTCTTTI CTCGGATACACCCTTCTACTC FRALYNATQUSSNIWPGCDYSLFRDGIEPM NE DEK a Pl alei 6 View the probe under various Analyze windows especially Analyze Hairpin Formation Upper Oligo 18 4 7 Searching for siRNA Probes OPUN O NO N Open Human elF 4E seq Choose DNA to RNA from the Change menu Choose the Primers and Probes option from the Search menu Click the siRNA Probes button Click the Search button The oligos are found and displayed in the Selected Oligonucleotides Table Double click on the first record You ve selected the sense strand of a siRNA probe Choose Lower Oligos from the pull down menu top left of the window Double click on the first record You ve selected the antisense strand of a siRNA probe Check the Internal Stability window Analyze Internal Stability Lower Oligo It should like similar to this one Lower Oligo Internal Stability File Human elF 4E seq kd 19nt F end 92 pos 11 Ag 10 0 14 0 13 0 12 0 11 0 10 0 a 9 0 a bea 8 0 a 704 g 18 6 0 a 5 04 3 UGUUUAAUAUAGUGLLICUG The negative strand probe always a 19 mer should start from a pentamer of 7 5
13. displayed at the top of the window 3 At he bottom of this window you may choose a file format available to you The default is Nucleic Acid so that the DNA and RNA sequence files can be opened instantly by clicking on the Open button However when you click on the Nucleic Acid pull down menu you would get this 9 098 Open File Test sequences B Y DEVICES 4 7 FreqSeq 7 cbp odb a r HDLT 7 Frequencies Chicken elF 4E seq 2 HD 1T m libO goLibrary jnilib 7 Chimpanzee elF 4E seq Y PLACES gt Oligo 7 app Chimpanzee elF 4E seq Deane be ol 90_7_manual pat gt Cow iii AN oligo_7_tutorial pdf 7 Database 6 odb ut wr l 7 Tables Dictyosteli elF 4E seq A Applications C Test sequences 7 Human elF 4E gene seq Sa Utilities nivers Pyrir ars oor Ga 2 universal primers odb Human elF 4E seq Name Cow elF 4E seq k Documents M13MP18 seq Kind Nucleic Acid E Files 7 masa seq Size 2 KB C Photos Mouse elF 4E seq Y 1 997 bytes s CI PikesPeakPhotc NewDatabase odb Modified 8 14 088 264AM Bm m ME gt Previewer OLIGO sequence data VER 1 ACCESSION NM_174310 FEATURES Location Qualifiers Details gt Nucleic Acid i Protein Format Nucleic Acid Oligonucleotide Database New Folder Cancel Open and you would be able to choose any of the three types of files If you d choose All Files Oligo would show a slightly different window shown below from which you d ne
14. particular computer Principal Investigator or Manager s Name Mark Brown Institution and Department lowa State University Address Dept of Molecular Biology 4321 Campus Dr A 2345 Phone Number Ext Fax Number E Mail 123 456 7890 321 123 456 0987 mb isu edu Comments If you re re installing or replacing a komputer write it here License Workstation Code Access Code 7 1001 9703 9775 2346 Print Setup 3 4 Print f Save Exit Register If you re connected to the the Internet click the Register button at this point The registration e mail will be sent to MBI automatically and upon its completion the window should display the message Registration form successfully sent If you perform the registration during the MBl s normal operation hours Monday through Friday h 8 16 Mountain Time expect the returning Access Code within an hour Otherwise you may Exit the Oligo and start it again at later time when you d receive the Access Code Click the OK button to exit 3a If your network does not permit Oligo to send e mails to us press the Save button and this saved text file attach to your e mail and send it to mbisupport oligo net No screen shots please 3b If your computer is not connected to the Internet please print out the Registration Form by clicking the Print button and fax it to MBI 1 719 684 7989 4 When you recei
15. then find the restriction sites only in this protein 1 Start Oligo open BRCA gene seq and open the Open Reading Frames window from the Analyze menu 2 Find the longest pen reading frame in the sequence This is the one we d like to analyze for potential restriction enzyme sites Click on the graphical representation of it to set the proper reading frame see the graph below You may use the zoom in slider located at the top left of the window for a better view 24 68686 Ogen Readirey Frames Il pi HU TE A the A A AU Mut Moti bo PM Pe o A Tua W O PPR Eana M a d luu ul ATM foi be Au a T hae et i T odom colored by frequency fhiphari on ift Fr Pra ote kipenak Ma he nnn E ed Fiii IPH UT aa Lag Too Ri i roby Peery Lie Leela ia het rete ui ger ETEA EHA ILI EILA EEA EPR E treed tre abia teeta teeta Et a ET Lui sl E 6 RAE ILIA REA GG A HEE EL amp amp C BEF E E E S wat MOI N SE FEE I P E 4 uF E a NH N L H a BRB amp EES TE n 3 8 EEE i K n E Ek 3 w E 1 T k E I N t ERPG h vy BEL eE H x ER TELI FFEFCETHA YA z P a aE JF F LE a L E F I E I OH J i E K E 4 T44 HL Edi amp gt I SEE LE i EEIIE ETLES E E ELERT LH 5 E 5 E E ACC TMA TGA TTT TAA ATEN TACAAAATS Laza s TA M TAT ATERAT CTOATGTTOAATTAMDI saa TEs a coast sale ate TCT T TARA CRRA TA T RRS T Tia TG TM Ayana BE ZA ahi an Ti CAN LAL ri som TAL ur tante cana a T AAN PEFAAEAGTANTCCAAAAA F r gee pem Ti Tihi TETE aT MET Taal TaTE
16. CE TO lt r Z At this point you may choose a different kind of Current Oligos representation The default was tm showing melting temperature graph of oligos without dangling ends Tm shows the same but with the dangling ends and Tm shows Tm with dangling ends of oligo complements Similarly AG and AG shows free energy graph with dangling ends of Current Oligos and their complements respectively while Ag represents the standard values without the dangling ends CG shows the CG content and Degeneracy active when the sequence is degenerate shows the number of possible sequence combinations 12 9 Close the Melting Temperature window and open the Open Reading Frames window When you Click the Options button you ll be able to change Min ORF Size laa Color by 4 Aminoacid Type Codon Frequency EMI the meaning of open reading frames color coding from amino acid type to codon frequency 10 Note a slide button at the top left of the ORF window amp O amp By dragging it to the right you ll see zooming in the ORF graph This feature is very useful when the opened sequence is large 3 3 Open and Print all relevant windows with one mouse click You can open or print all the windows of your choice with just a one click To set this up you need to 1 Open the File Print Save Options window The default is to print or save only the top current window as shown below A Print Save Options Anal
17. T Tagua a ee TT ee ae de Age IT Pa Pata CARA PTT ae a TIT aa i ADADO Coal TOR ra ee Ral eC eae aso DAMAGE CETE TEA IE bii iremen i HH ES amp Y YLELEEFTYIIFATI F 4 FIR a F I ETT ECE LE TRPLeerearr wt as z LTLE TLT i a a COOH a 5 A rT Ek F kb e f Ti i p heh 4 Ft F amp F F T pi Ct E Pt E ipf F F mii i L L l E EEbTHEFTEE Ss TCRPHITIQGHPELE SE TE HF HT G af aw F S L ri l I E L L y EF I 5 ait The zoom in slider When you click on this ORF it gets underlined in green and TIT Mi DHIE oe E the information about this particular protein is shown in the ORS Statistics table This green rectangle shows what part of the sequence is displayed in the t of the wind d i ini iai If AISI VC Im MAT parl 0 OWI SOOT eo Tn Pa ih ilb a th i R Fr Position Protein Molecular Weight Mean pKa are e the se 3 cc af reg u ici i ai ai al E eer ee 2 22454 27004 1517aa 170223 0 7 1 3 Choose Search for Restriction Sites in Protein option It should indicate Reading Frame 2 r OO Search for Restriction Sites in Protein Search O Sequence Reading Frame 2 9 Portion Start 22454 End 27004 End Cut Type v Blunt v 3 overhang v Odd v 5 overhang Limit v Limit the number of sites Maximum of restriction sites 5000 Cancel Search 4 Type in the Start and End position numbers of the protein You should find
18. earch in Strand if you want primers to sequence forward they would be annealing to the negative strand and uncheck the Strand Choose the region you want the primers located click the Ranges button and type Positive strand search range 400 to 450 The negative strand search range is irrelevant Make sure the No overlapping primers probes box is checked if you want to avoid multiple choices of almost identical primers Click OK button Click the Search button You should get only one primer in the Selected Oligonucleotides window Double click on this primer in the Selected Oligonucleotides window You ve just selected a sequencing primer 4 4 Searching for consensus hybridization probes ROWDND OI 16 Choose the Primers and Probes option from the Search menu Click on the Hybridization Probes button Click on the Subsearches tab at the top of the window Click on the Consensus Probes box at the bottom of the window A new window Select Files pops out and you need to select other homologous sequences Click the Add button and navigate to the Test sequences folder supplied with the software by default it is located in the Oligo 7 folder in the Applications folder 6 Choose the files as shown on the image below a z ao 3 Select Files File Sets Select Set Remove Set Search in Files Oligo 7 folder Test sequences Chimpanzee elF 4E seq
19. ed to choose the kind of file with Open As pull down menu Open File Test sequences Y DEVICES 4 i FreqSeq E 7 cbp odb a a E HD1T D Frequencies Chicken elF 4E seq r Sj HD 1T libOligoLibrary jnilib Chimpanzee elF 4E seq n i i ai Y PLACES 4 d sea pdf A ob ora nng Name Cow elF 4E seq Desktop E go_ P AAE a Kind Nucleic Acid AN oligo_7_tutorial pdf 7 Database 6 0db Size 2 KB u ME Tables 7 Dictyosteli elF 4E seq y 1 997 bytes A Applications CJ Test sequences n Human elF 4E gene seq Modified 8 14 088 26AM Utilities ME 7 gt gt Previewer OLIGO sequence data VER 1 ACCESSION NM_174310 FEATURES Location Qualifiers Nucleic Acid Protein Oligonucleotide Database lene Details a Format All Files EEEE SS aci SS New Folder Cancel Open tee Seeing ee Nucleic acid file is selected Y Nucleic Acid Protein Oligonucleotide Database j Open As Nucleic Acid s 4 By choosing Format Protein and than choosing Human elF 4E ami you would open this protein file and automatically reverse translate it to DNA The default reverse translation method is Lathe choosing most probable codons for human proteins but if before opening a protein file you would Change Rev Translate Method to Degenerate you would end up with an entirely different DNA sequence this time a degenerate one Please try it 5 W
20. egion to work with before the search you may set the search range by choosing it from the Search Ranges window click the Ranges button and enter the positive and negative strand search range in the top of the window following by the OK button 4 6 Searching for Molecular Beacons amp PCR Pairs 1 Choose the Primers and Probes option from the Search menu 2 Click the Molecular Beacons amp PCR Pairs button 3 Click the Search button The sets are found and displayed in the Oligonucleotide Sets Table 4 Double click on a set to select it and open the PCR analysis window at the same time Note that you get a seemingly disturbing comments The Upper Oligo does not match the template and 3 end Upper Oligo dimer This is a sign that the beacon probe was selected successfully 5 To see the alignment with the template choose the Sequence window and move the horizontal scroll bar to see the probe AOA Sequence File Human elF 4E seq DNA Sequence Selected Oligo Position Length Feature Location Sequence Length 1868 nt Ji B Forward Primer 216 19 l source 18 1850 Reading Frame 1 Ji B Reverse Primer 295 21 2 CDS 1 651 Current Oligo Length 2lnt Li E Upper Oligo 243 30 Position 213 O Lower Oligo PCR Product 100 nt ji 100 00 500 400 Pi a rtn soa 300 1000 1100 1200 1400 1100 1500 1600 1700 l TIGGGCTCTGTACAACCAT hor Fo Fr RF RF F FR Fr RF FF Eoo Eeoa th e o o E we c
21. hen you open a protein sequence file in a degenerate mode you ll see lots of degenerate nucleotide symbols in the Sequence window but the translation will not look exactly like the original amino acid file because some degenerate symbols would cover more than one amino acid kind Instead of arginine symbol R for example you will get low case r indicating that arginine is most likely but also that some other amino acid ma exist at certain position 6 Choose Melting Temperature Graph from the Analyze menu 7 Click at the graph e button and choose Degeneracy You should get this window F 608 Degeneracy File Human elF 4E ami 2 a a i ez 651nt 21 mers pos 136 Degeneracy 64 120 130 140 150 160 170 180 HIGH 1 0E5 g e RAAYMGNTGGGCNYTNT GGTTYTTYAARAAY GAY AARWSNAARACNTGGCARGCNAAYYTNMGNYTNATH 8 At this point the scale displays degeneracy Those numbers are usually high for a default size of Current Oligo of 21 bases To get more manageable degeneracy change the Current Oligo length using the Change menu to 17 At this time you should be able to find oligos with relatively low degeneracy 9 Click on the Analyze menu Note that in place of former Melting Temperature Graph item you d find Degeneracy Graph You may change the display back to tm analogously as described in point 7 2 2 Open a database file 1 Choose File Open from the File menu 2 Choose Oligonucleotide Database as File Format
22. hould get the Full Screen Edit window 2 This window has its own menu Click on Edit item You should see the following menu 209 Edit Sequence File Human elF 4E seq Accept Discard 20 Search Change Rev Translate as et CantUndo dz 10 p i Can t Redo Z E CGATCAGATC GA u Cut eX CCACCCCTAC TCCTAATCCC CCGACTACAG AA l TTGCTAACCC AGAACACTAT ATTAAACATC CC Copy C TTAAAAATGA TAAAAGCAAA ACTTGGCAAG CA JE apy CTGTTGAAGA CTTTTGGGCT CTGTACAACC AT Clear GCTGTGACTA CTCACTTTTI AAGGATGGTA TT Clear AACGGGGAGG ACGATGGCTA ATTACATTGA AC GCTTTTGGCT AGAGACACTT CTGTGCCTTA Tr Select All HA ATGTATGTGG CGCTGTTGTT AATGTTAGAG CT CTGAATGTGA AAACAGAGAA GCTGTTACAC AT Merge with b GACTTCCTCC AAAGATAGTG ATTGGTTATC AG Group by TITGTTGTIT AA AGACTGCGTC AAGCAATCOA H Clipboardisempty Overwrite o INS DNA 4 Sound On Readback On a Full Screen Edit Mutagenesis a Nucleic Acid Protein 3 Note a dot by the Full Screen Edit It indicates the current window style 4 Click on the Mutagenesis item The window changes its appearance see the following figure If you d be editing a primer this type of window would open automatically 11 r 3 O OOA Edit Sequence File Human elF 4E seq Accept Discard Edit Search Change Rev Translate 5 18 J Ia BB Lic Bi e pos 1 Sequence Length 1868 nt tm 76 7 C Reading Frame l AG 96 9 kcal mol Degeneracy 1 Loop Tm 54 5 C Loop AG 2 1 kcal mol
23. kcal mol or so its 3 end should be slightly more stable than 5 end the internal 12 mer stability should be about 22 kcal mol should not form significant internal hairpin loops should not have sequence repeats and should be as unique as standard hybridization probes Add manually TT or attach dinucleotides corresponding to the original mRNA to the 3 ends of the oligos use Edit Upper Lower Oligo options The dTdT is preferred for a better probe stability 4 8 Searching multiple files batch processing OuRWND Start Oligo and choose Search Sequence files Select files choose the entire Test sequences folder Choose the Method of search Hybridization Probes Click the Ranges button and check the Choose hybridization probes every 1000 bp Click OK and another OK to get back to the Batch Processing window Click the Search button Before Oligo starts searching it asks you for a file name for the results data Default is BatchResults txt a plain text file Enter anew name or leave it as is Note that you may save the file in three different formats Simple List Full Analysis or Oligonucleotide Database Accept the name by clicking at the Save button The Search Progress window displays how many files were processed and scheduled The search ends when this progress window disappears Open the BatchResults txt file with any word processor 19 4 9 Searching multiple files f
24. lts odb 4 O of Records 16 Date ID Number Sequence 3 Dim AG P E p e Tm ty S 1 11 10 09 X61939 242F21 TTGTCTAGTAATTTAATGCCT 2 3 SC 422 49 2 S 2 11 10 09 X61939 841F20 TTTAATTTTGGCTAGAGTGT SC 421 49 3 5S 3 11 10 09 X61939 875F20 AAAGAATTACAGTACACGTA 0 8 SC 411 48 4 D 4 11 10 09 X61939 333R19 AACGTAATTAGCCATCGTC SC 431 51 9 5 11 10 09 X61939 1294R21 AAAATTACCAAAGAATGCACA 1 7 SC 436 51 5 3 6 11 10 09 X61939 1295R20 AAAATTACCAAAGAATGCAC SC 423 49 4 3S 7 11 10 09 M61731 1296F22 AATAAACATTAAATTTGTGCAT 1 3 SC 421 48 0 S 8 11 10 09 M61731 1461F20 CTAGAATTAGTATGTCTGCC SC 429 49 1 D 9 11 10 09 M61731 1740R21 AACATAATAAACTAGTGCTCC SC 431 49 9 D 10 11 10 09 M61731 1990R20 TATATACTTTCCTTACGCTA 0 7 SC 422 46 7 3 11 11 10 09 M61731 1990R23 CTCTATATACTTTCCTTACGCTA 0 7 SC 455 51 2 I 12 11 10 09 HumanelF 4E 60F GAAAACGGAATCTAATCAGG SC 424 50 6 I 13 11 10 09 HumanelF 4E 10 ATATTAAACATCCCCTACAGA 0 2 SC 423 50 3 I 14 11 10 09 HumanelF 4E 12 AATAAACATTAATTTTGTGCAT 1 3 SC _ 421 480 Y Oligonucleotide Sets 9 Product Length is based on ID Numbers a Forward Reverse Upper Lower Product 7 Primer Primer Oligo Oligo Length _ l l 4 110 2 2 5 474 3 3 6 440 _ 4 7 9 465 5 7 10 714 6 8 ll 552 ri 12 15 297 8 13 15 256 9 14 16 477 This database is linked to Human elF 4E seq On the t
25. m DNA a sub search to eliminate frequent oligos will not take place Below this box you see a list of possible search types that Oligo can perform Buttons on the right the Search button starts the actual search Cancel closes the window and Apply memorizes the current type of search so that when you Cancel the window and come back to it you d see the most recent setting Apply also sets the search parameters and accordingly modifies the Sequence and other relevant windows Button Parameters opens the search parameters windows including windows that define the stringencies and scoring system Button Ranges opens a complex dialog that controls not only the search ranges but the number of results you need within the ranges Button Defaults changes all parameters to the default values This chapter will guide you through various search types 14 4 1 Searching for PCR primers a simple search This example takes you through a quick search for a pair of optimal PCR primers To run this search open Human elF 4E seq file and 1 Choose the Primers and Probes option from the Search menu 2 3 4 9 Verify that the Compatible Pairs button under PCR Primers in the dialog box is checked Click Search to start the search The Search Status progress window appears and the message Search Completed appears when the search is complete When the search is complete two windows open Oligonucleotide Sets and
26. n at the low left of the window and type name of the featue such as ends double click in the Location column and type join 1 1000 84468 85469 and click on the check box 6 When the Feature 3 is highlighted the bottom of the window shows a map of the regions where the search will be performed Click the Accept button returning to the Search Ranges window Note not only when you enter a new feature but even if you check another feature you myst click the the Accept button Later on Oligo will ask you to save the sequence to make this change permanent 7 Check the Find oligos in checked region s only as shown 21 Sequence file BRCA2 gene seq 1 to 86101 Search method Hybridization Probes trand earch range v Find oligos in checked region s only l Choose hybridization probes every M No overlapping primers probes 100 bp gaps Perform False Priming Sites or Homology Searches Within the search ranges only On the entire sequence N ra Check Region s 3 Cancel Ok Note that another option to search in discontinuous regions could be Choose hybridization probes every x number bases 8 Click OK and in the Search for Primers amp Probes window click the Search button 9 The search returned 151 Upper Oligos and 148 Lower Oligos located only in the mRNA regions 200 Selected Oligonucleotides File BRCA2 gene seq OO Upper Oligos
27. oding region of elF 4E DNA sequence it is actually the mRNA sequence reverse transcribed to DNA Move the horizontal bar You will notice that the yellow shaded box moves around the Tm graph Sequence in this box is displayed at the bottom of this window Click on any nucleotide displayed this window you just changed the Current Oligo position All the features of the Sequence window are described in the Manual Chapter 2 5 You may move down or up the sequence using the keyboard arrows page up or down Keep the Sequence window opened and choose Open Reading Frames from the Analyze menu If you click on any nucleotide position you also change the Current Oligo position observe the Sequence window while playing with the ORF window You may change the reading frame just by clicking on the open reading frames displayed in the top portion of the ORF window Close the ORF window for clarity and open the Melting Temperature Graph and or Internal Stability Current Oligo windows from the Analyze menu Note that by clicking on the nucleotide symbols or the graph itself you are actually moving to the new positions If you zoom out the Tm window by clicking on the loupe symbol with sign you still can change the Current Oligo position by clicking on the graph Close all but the Sequence window and choose Selected Bases from the Search menu You will see 4 columns there Loops showing strong stems of the sequence and St
28. omatic stringency may change it if necessary For sake of this example increase this value to 6 kcal mol and lock this value and click OK You ve just set the parameter of a sub search that will eliminate all the PCR products not the primers that would make a hairpin with a AG larger than 6 kcal mol with the size of this hairpin not larger than 40 nt if the Template Loop Window Size was set to 40 nt Note that this test sequence has only one loop like this around pos 160 200 Sequence window marks it in maroon color Click the Ranges button Instead choosing the search ranges manually click the Check Region s button From the Features window select the 2 CDS coding sequence so you should see this 900 Features Feature Location B 1 source 18 1850 m 2 CDS 1 651 and click the Accept button Check the Find products in checked region s only box Check also the box No multiple products in one sequence region and Cover the entire search area with Overlapping products 10 Change the PCR product length to 150 to 300 11 Click the OK button You should get just the coding region covered with PCR products and the hairpin loop in the template gone from any PCR products 4 3 Searching for sequencing primers 1 2 3 Choose the Primers and Probes option from the Search menu Click on Sequencing Primers button Choose the DNA strand the primers should be made of leave checked S
29. on the short cut key Ctrl X Windows or Command X Mac is activated see the last item of the Analyze menu so with this keystroke you will open all the windows that you ve checked of course if you ve previously selected the primers Saving Results will also save multiple windows data 4 Search for Primers and Probes This section describes methods in searching primers and probes the Search for Primers amp Probes menu item A Search for Primers amp Probes Search Options Subsearches Search 3 Search in Cancel Search Mode fe Select Apply n vi Complex Substrate Q PCR Primers Compatible with the Forward Primer Reverse Primer TaqMan Probes amp PCR Pairs Compatible with the Upper Probe _ Lower Probe Selected Primers O Molecular Beacons amp PCR Pairs Nested Primers Sequencing Primers Hybridization Probes Parameters Ranges After successfull search show All Results HH Defaults Take a quick look at the Search for Primers dialog window At the top you see two tabs Search Options and Subsearches Below this there are two check boxes if both checked the search will proceed in both DNA strands The Search Mode is set to Select that is the search will start from scratch and not continue on already selected primers that s the Verify mode If you uncheck the Complex Substrate box good when working with plasmids not with total organis
30. op you d see the individual primers and on the bottom the sets You may sort data of any of the columns by clicking on the column title Secondary sort when holding the option or Alt key pressed This applies also for the Sets portion of the window Product length is calculated from the ID Number description so if you make a set manually the product length may be incorrect or not show at all 9 From the Analyze menu choose Multiplex All Sets Minimize Reaction The bottom of the 20 window shows the compatible sets of primers LII LVJ UF TIUIMaiicir l l PAPA ILAMA IAU IUL Iri V W Je lt 7 2U 9 Results of Multiplexing All Sets E5 TAE i Select Minimize Reaction stea Group 1 3 141 4 212 5 8113 15 e e a one T Op t ta is a a where the set numbers are marked in red and in parenthesis you see the individual primer numbers Depending on the Database Options the results may vary You may change the Group display by clicking on the slider and when you click the Select button all the primers in a displayed Group get highlighted 10 You may select those primers by clicking on the check boxes individually on the left of the window or check all selected primers from the Export menu Checking may be important for saving or printing data depending on how is the priting set from the Print Save option in the File menu The Show Hide icon to the left of the checkbox icon a Highlighted Record Oligon
31. or PCR primer pairs and than m dl n ea SD multiplexing the selected sets Start Oligo and choose Search Sequence files Select files click the Select Files and than Add in the Select Files window Make sure the File Format is set to Nucleic Acid and choose the Test sequences folder Select three files Human Mouse and Rabbit elF 4E seq and click Add and than Done button Clicking OK button will accept the selected files but before clicking OK you may want to save the set of files for later use with the Save Set button In the Batch Processing window set Save 3 results per file and click the Method button Choose PCR Primers option and click the OK button Click the Search button Before Oligo starts searching it asks you for a file name for the results data Default is BatchResults txt a plain text file Simple List You d need to save this file in Oligo database format so change the File Format low portion of the window into Oligonucleotide Database Enter a new file name on the top or leave it as is Note the destination folder and if it is not correct change it Accept the name by clicking at the Save button The Search Progress window displays how many files were processed and scheduled The search ends when this progress window disappears Open the BatchResults odb file with Oligo The database window should look like this 200 Oligonucleotide Database File BatchResu
32. otides Minimize Reaction Oligo automatically finds compatible oligo sets among the entries labeled SC that stands for Self Compatible You may view those sets by clicking on the triangles located at the lower right diki Jade Group 1 3 2 6 9 10 The example above shows Group 1 consisting of oligos 4 2 6 9 and 10 in the database All those four oligos do not form 3 end dimers among themselves within currently set search parameters in the Database Options Note if your database contains probes instead of primers you need to change the multiplexing mode from checking for 3 dimers to checking homology or rather inverse homology to find out what probes stick to each other In this case use the Change menu and choose Multiplexing Mode gt Probes check homology View Window Help lt Options Multiplexing Mode a v Primers check 3 dimers Probes check homology 8 Let s make a new set of primers in the database From the Edit menu choose Add Set The lower part of the window changes and shows four edit boxes under Enter Record s 9 Enter to the Forward Primer box 9 and to Reverse enter 10 The Add button activates 10 Click the Add button followed by Show All button 11 You should see a new row added to the database If the window is not tall enough use the slider a dot separating individual oligo entries from sets and drag it up 12 Close the Database window without saving
33. rings columns are empty because you haven t searched yet for the strings and there are no strong stems below 12 kcal mol a default search parameter setting for Template Loop AG Threshold with the Template Loop Window Size of 40 nt in this DNA sequence file Columns Hairpin loop Stems and Palindromes are filled with numbers as those searches are initiated automatically as soon as you open a sequence file By clicking on any of those numbers you change the Current Oligo position 6 Another method to change the Current Oligo position is to open the Select New Current Oligo Position from the Select menu and entering the desired position number 7 Make a quick search for Sequencing Primers Search gt for Primers amp Probes gt click Sequencing Primers followed by Search buttons After the search you ll see the Analyze gt Selected Oligonucleotides window You may also select the Current Oligo by clicking on any row displaying Forward or Reverse Primers By double clicking on these primers in the Selected Oligonucleotides window you will not only change the Current Oligo position but also you will select the actual primer observe the Sequence window how it changes 3 2 Changing windows appearance The display of certain windows can be customized The Edit windows for example have two display modes as well as all the Analyze windows with the Options ag button 1 Open the Edit Entire Sequence window You s
34. see this in the Sequence window i_ IL E E 1 E 1 i_ E eral m E n B BER E m E m m D ee pos tm LILI 1740 LIJI I 11750 LIJI I 1780 LIII irri LIII 1780 Littl 1790 Littl 11600 LIII 11810 LIII 11820 LIII 11830 LI Ti 1840 LIII CATATATATG r r r TGTGAACAGCATAAGTITOGAGCACTAGTTTGATTATTATOTITATTACAATITTITAATAAATTGAATAGGTAGTATCATATATATGOGAAAAAAAAAAAAAAAAAAAAAAAAAAA ACACTTUTCGTATTCAAALCTCGTGATCAAACTAATAATACAAATAATIUTTAAAAAT TATTTAALTTATCCATCATAGTATATATALCTTTTITITITITITITIITTITITITI CEA ETA LV Liei co firu NI TYNE EEEERERS The arrows point to pos 1813 marked in orange This position is at the beginning of a 10 bp long palindrome marked in green The palindrome itself was selected as the Upper Oligo shown above as the top sequence in red 5 2 Search for restriction enzyme sites Start Oligo open Human elF 4E seq and choose Search for Restriction Sites option Click the Select Enzyme Database The files are located in the Tables sub folder Click the 5 amp UP ENZ file containing most 5 cutters and higher and the Select button Choose Linear sequence and click the Search button You should see the results in the Restriction Enzyme Sites Analyze window ee 09 23 800 Restriction Enzyme Sites File Human elF 4E seq Enzyme jt 100 pend 700 pati EL pati 700 Si sna 1600 1100 1200 1400 1400 1300 1600 1700 l 68 Mphlloal FA 69 Msel on Ll LI HE 70 Msi
35. stallation is complete double click on the Oligo 7 icon to start it and register your program license Alternatively you can start Oligo by choosing Start from the desktop followed by Programs 1 2 Registration In order to protect your copy of the OLIGO program and provide you with prompt technical support we need you to register as an OLIGO user with your distributor prior to accessing OLIGO or seeking technical support The registration form takes a few minutes to complete and you should receive your access code within an hour after contacting your distributor during normal business hours Each installation creates a unique workstation code so you will need to register each computer separately To register your OLIGO software on a computer please follow these steps 1 Double click on the OLIGO icon to call up the registration procedures 2 Once the Customer Registration window appears complete each field Use either the mouse or lt Tab gt to move to each field This window must be completed for each workstation you are registering See the figure below Your e mail address must be entered to make the Register button active The Fax number should be entered only to get the Print button active Leave the Access Code field blank QO OLIGO 7 Customer Registration Welcome to OLIGO 7 Primer Analysis Software In order to protect your program license and provide you with prompt technical support please comple
36. te this customer registration form and click Register button If you are not connected to the Internet please Print and fax this form to 1 719 684 7989 After this you may Exit Oligo and when you receive the Access Code back from us you may re start Oligo enter the Code and click the Confirm Code button The registration would then be completed for this particular computer Principal Investigator or Manager s Name i Institution and Department Address Phone Number Ext Fax Number E Mail Comments License Workstation Code Access Code 9703 9775 2346 Print Setup Exit The OLIGO Customer Registration window Note Your software license number is on the OLIGO CD User Manual or and in the e mail conformation of the purchase 3 When you enter the license number the Register button should become active as shown below A OLIGO 7 Customer Registration Welcome to OLIGO 7 Primer Analysis Software In order to protect your program license and provide you with prompt technical support please complete this customer registration form and click Register button If you are not connected to the Internet please Print and fax this form to 1 719 684 7989 After this you may Exit Oligo and when you receive the Access Code back from us you X may re start Oligo enter the Code and click the Confirm Code button The registration would then be completed for this
37. those numbers in the ORF window 5 Click the Search button if you want to find all possible enzyme Cut Types e608 Restriction Enzyme Sites in Protein File BRCA2 gene seq 22zyme 22500 23000 23500 24000 24500 25000 25500 26000 26500 i E tul bleat Epp Oe a E A 55 Pvul II 56 Pvull CECT Ii I I 57 ReAl m se Sai a es 59 Saci 1 60 Sal Lt 0 61 Sapi i Te 62 Scal II COO T 63 Smal 7 Enzyme Site Cuts Positions amp Fragment Sizes 68 Spll RT3VRwY5 4 21775 23132 1409 24541 1663 26204 159 26363 23094 69 Sspl NILicvY7 22 22369 22538 325 22863 173 23036 135 23171 280 23451 v 102 23553 287 23840 139 23979 14 23993 198 24191 i 162 24353 54 24407 163 24570 429 24999 192 25191 696 25887 144 26031 273 26304 111 26415 215 26630 96 26726 208 26934 22523 0 70 Stul RP1GLvA 9 21822 23085 597 23682 118 23800 495 24295 522 24817 972 25789 125 25914 742 26656 144 26800 22657 71 Swal I elFK7yLN 3 18759 26148 342 26490 19 26509 22948 da Search 22454 to 27004 End Cut Type Blunt Odd 3 overhang S overhang 6 After the search the results are displayed in a window with a very similar format to the standard Search for restriction enzyme sites window except that the degenerate protein site is listed instead of the actual DNA recognition site sequence all those symbols are explained in the Appendix E of the
38. u cannot save files to the Program Files or Applications Folder you need to log out and log in with the account that has administrator privileages or ask your IT manager to install Oligo for you 1 1 1 Installation form the Internet Download the zipped Oligo package Oligo Mac_Installer zip Macintosh or Oligo7Win_Installer zip Windows to your hard drive Some systems unpack the files automatically and some require manual unzipping Double click on the zip file to unpack the contents Double click on the Oligo7Mac_Setup installer package Mac sometimes you see the pkg at the end of the name or on the Oligo7Win_Setup PC sometimes you see the exe at the end of the name to start the installation process and follow the on screen instructions In Macintosh Oligo is installed in Oligo sub folder in the Applications folder In PC the default folder is C Program Files Oligo 7 Start Oligo 7 fill out the registration form and register it as described in Chapter 1 2 1 1 2 Installing OLIGO from a Compact Disk To load the OLIGO program to your hard drive 1 Insert the Oligo 7 Disk into computer s CD drive 2 Mac double click on Oligo7Mac_Setup pkg installer package and follow the instructions displayed on screen PC Double click on the Oligo7Win_Setup exe icon displayed in the CD drive window Follow the on screen instructions You would be asked for the folder name and location of the Oligo 7 application 3 Once the in
39. ucleotide Sets Multiplexing Results Hide may be used to show either the first highlighted record oligonucleotide sets or multiplexing results Hide option conceals the bottom part of the Database window 4 10 Searching a file for probes only in the selected regions 1 Start Oligo and open BRCA2 gene seg located in the Test sequences folder 2 Open Search for Primers amp Probes dialog window and choose Hybridization Probes 3 Make sure that the Parameters Search stringency is set to Moderate it actually may be anything but the window snap shots here would be when the Moderate stringency is used 4 Click the Ranges button and click the Check Region s button at the lower left 5 When you open the Features window check the third check box from the top as shown below a oO Features E Feature Location l source 1 86101 a 2 gene 1224 85469 a 3 mRNA join 1224 1411 2166 2271 4821 5069 10820 10928 1184 7 4 CDS join 2205 2271 4821 5069 10820 10928 11846 11895 11 5 misc_feat 12841 14548 D 6 misc_feat 27629 28079 _ 7 repeat re 27638 27739 7 gt K N La i r Cancel d 5000 10000 15000 20000 25000 30000 35000 40000 45000 S0000 55000 60000 65000 7D000 75000 s0000 This selects all the mRNA regions in the gene 5a Note you may create a new feature for example if you want probes in the end and the beginning of the sequence only you may click the butto
40. ve the Access Code from MBI go back to the registration window by bringing it to the front or by re starting Oligo enter it to the Access Code box and click the Confirm Code button The registration process is complete To register your second and following computers you need to complete the same registration process each time Any further updates are automatic but may be also performed by using Oligo s Help menu Note If you ever need to re load OLIGO write this message to the Comments field 2 File Opening and Viewing The tutorials in this section give you an opportunity to learn how the features of the OLIGO software can assist you in your research Some of the tutorial examples are intended to provide a general guide from which you can construct your specific application Others are specific so that you can duplicate if you wish similar results similar not exact because future revisions of the software may be slightly different in default parameters Note if you want to duplicate the results in the search examples open Human elF 4E seq for your sequence file It is located in the Oligo 7 folder i Test sequences subfolder Oligo example database is in Oligo 7 folder universal primers odb 2 1 Open a sequence file Oligo opens variety of file types such as DNA RNA protein sequences and databases 1 Choose File Open from the File menu 2 Navigate to the Test sequences folder by clicking at the bar
41. yze 1 Analyze2 Search Data Database Print Save C F R U L M 9 Current Selected Key Info All Opened Duplex Formation Hairpin Formation Exclude Composition amp Tm False Priming Sites Homology Internal Stability gt z Cancel i C urrent Oligo F orward Primer R everse Primer U pper Oligo Lower Oligo M ixed Oligos C ox 3 2 Click the Selected button and than check the appropriate boxes In this example we check the Key Info for the Forward and Reverse primers and Duplex Formation windows for the Forward Reverse and mixed primers and also we ve changed a different database print output to Full Analysis and the Multiplexing data as shown below O Print Save Options O Print Save Options Analyze 1 Analyze2 Search Data Database Print Save _Analyze 1 Analyze2 Search Data Database Print Save E F R U L M Current Current PR v Oligonucleotides e Selected Selected Key Info mi a l Selected only s IE All Opened ee 3 All Opened Duplex Formation mi m A m List only Full Analysis Hairpin Formation Exclude vi Oligonucleotide Sets Exclude Composition amp Tm z E z z l Selected only False Priming Sites a Multiplexing Homology ua aan Internal Stability p x Cancel Cancel i C urrent Oligo F orward Primer R everse Primer U pper Oligo Lower Oligo M ixed Oligos OK gt Ok 3 Click the OK button From now

Tutorial - Oligo Software

Contents

Download Pdf Manuals

Related Search

Related Contents