Home

TrueORFs - OriGene

image

Contents

1. containing 25 ug ml kanamycin Incubate at 37 C overnight 8 Pick at least 4 8 independent colonies to do miniprep from each ligation Confirm the insert by restriction digestion and or vector primer sequencing primers included in the kit 14 Transfer of ORF from TrueORF Entry Vector to destination vectors Subcloning with OriGene s RapidShuttling Kit OriGene has created the RapidShuttling kit to make subcloning to any of our other vectors a simple and efficient process The RapidShuttling kit provides all required reagents and protocols allowing any TrueORF insert to be transferred to any PrecisionShuttle destination vector in a mere 30 minutes TrueORF Entry Vector Kit Components Include Protein e Shuttle ready destination J vector pre digested and a Mixture dephosphorylated Neo Kara e Sgfl Asis I and Mlu I 20 uL or Sgf I Asis I and Rsr II 20 n uL e 10X Rapid digestion buffer Y 37 C Smin e T4 DNA ligase for 10 reactions e 5X Rapid ligation buffer e Water nuclease free v Mixture II RT 5min Then Y transformation Subcloning without OriGene s E F225 RapidShuttling Kit To transfer the protein coding region from the TrueORF Entry Vector donor to a PrecisionShuttle destination vector recipient choose the appropriate destination vector with the desired tag options http www origene com cdna trueorf destinationvector mspx There are three main types of PrecisionShutt
2. Kozac Consensus EcoRI BamH KpnI RBS Sof Asc CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCAGATCT Hind Ill Rsr Il Mlu I Not Xho I GFP Tag CAAGCTTAACTAGTTAGCGGACCG ACG CGT ACG CGG CCG CTC GAG ATG GAG AGC GAC T R T R P L E M E S D a B B Pmel Fsel T GAA GAA AGA GTT TAA ACGGCCGGCCGCGG E E R V Stop Figure 2 Lenti Viral Vectors e uy cs oy GA o M SN B Econt EcoRt e n Sanin A Pom E E pLenti C Myc DDK H Ssn 3 pLenti C mGFP S 6 4 kb 7 1 kb Rsrll Rsrll Mlul aut Notl 9 Xhol Xhol 9 Multiple cloning site of pLenti C Myc DDK Vector pLenti C Myc DDK Kozac Consensus EcoRI BamH I RBS Sgf Asc CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCAGATCT Myc Tag TC TCA GAA GAG Xho E Rsr Il Mlu I Not Q K I S E CAAGCTTAACTAGCTAGCGGACCG ACG CGT ACG CGG CCG CTC GAG CAG AAA CTC A T R T R P L E L Pmel DDK Tag GAT CTG GCA GCA AAT GAT ATC CTG GAT TAC AAG GAT GAC GAC GAT AAG GTT TAA ACGGCCGGCC L D Y K D D D D K V stop D L A A N D I Multiple cloning site of pLenti C mGFP Vector pLenti C mGFP Kozac Consensus EcoRI BamHI RBS Sof Asc CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCAGATCT mGFP Tag Rsr Il Mlu I Not Xho CAAGCTTAACTAGTTAGCGGACCG ACG CGT ACG CGG CCG CTC GAG ATG AGC GGG GGC T R T R P L E M S G G Pme I GGA CTC AGA GTT TAA ACGGCCGGCC
3. The following components are included e One 1 vial containing the cDNA clone as 10 ug lyophilized plasmid DNA e Forward VP1 5 and reverse XL39 sequencing primers for non Lenti based vectors or Forward VP2 0 and reverse LR50 sequencing primers for all Lenti vectors dried onto the bottom of screw cap tubes e Certificate of Analysis e Application Guide OriGene plasmids are purified using ion exchange columns for high yield low endotoxin preparations PowerPrep HP Midiprep Kit www origene com other Plasmid Purification The cDNA clone is shipped at room temperature but should be kept at 20 C for long term storage If properly stored clones are guaranteed to be stable for 12 months Related Optional Reagents Restriction enzymes and buffers Sgf I ASIS from Fermentas Mlu from Fermentas or New England Biolabs Nuclease free water T4 DNA ligase and buffer Competent E coli cells LB agar plates with kanamycin 25 ug ml Entry vector LB agar plates with ampicillin 100 ug ml Destination vectors non Lenti LB agar plates with chloramphenicol 34 ug ml Destination vectors Lenti based LB broth 10 g L Tryptone 5 g L Yeast Extract 10 g L NaCl Adjust pH to 7 0 with 1 N NaOH DNA purification reagents Anti FLAG Antibody 4C5 AntiDDK OriGene TA5001 1 Related OriGene Products TrueClone FL cDNA clones http www origene com cdna CRISPR http www origene com CRISPR CAS9 RNAi products http
4. and incubate for at least 30 min before use Set up a digestion reaction as described below substituting other restriction enzymes as appropriate Component Volume 10X restriction buffer 3 ul Sgf 10U ul 0 8 ul Mlu I 10U ul 0 8 ul Nuclease free water 15 4 ul Vector DNA 10 ul Total volume 30 ul Incubate at 37 C for 3 hrs then add 1 ul antarctic phosphatase units used according to the manufacturer s protocol and continue the incubation at 37 C for another 30 min Dephosphorylation of the digested vector is essential to eliminate self ligation 4 Purify the desired vector fragment by running the digestion reaction on an agarose gel and isolating the appropriate band using a gel purification column Elute the digested plasmid vector in 40 ul of 10 mM Tris buffer ae 5 Set up a ligation reaction with the purified vector and insert fragments Component Volume 10X ligase buffer 1 ul nuclease free water 3 5 ul T4 DNA ligase 0 5 ul Vector fragment 2 ul approx 10 ng PCR product 3 ul approx 30 ng Total volume 10 ul Incubate the ligation reaction at room temperature for 30 60 minutes Alternate ratios may need to be tested to obtain optional ligation efficiency 6 Transform 1 ul of the ligation mixture using 20 ul high efficiency competent E coli cells ideally 1x10 CFU ug Following transformation resuspend cells in 200 uL LB 7 Plate the entire transformation reaction on a standard LB agar plate
5. vector system is truly universal The PrecisionShuttle Entry and destination vectors contain the neomycin phosphotransferase gene under the SV40 promoter Expression of the neomycin phosphotransferase gene in mammalian cells allows stable cell selection with a neomycin analog such as G418 Destination vectors with alternative selection markers e g puromycin blasticidin hygromycin etc are also available A complete and up to date listing of these vectors can be found on our website at http www origene com cdna trueorf destinationvector aspx The development of the PrecisionShuttle vector system has gone through a rigorous quality control QC process Both the Entry vector and the destination vectors have been validated for transient and stable mammalian cell transfections using a tGFP marker data not shown The expression of N terminal and C terminal fusion tags has been validated by Western blot analysis shown in Figure 5 N Tag s C Tag s His HA BLK HA BLK Myc DDK BLK His DDK BLK Myc DDK BTK HA BLK Myc DDK BLK His HA BLK TA100013 TA100012 TA100010 TA50011 Figure 5 Western blot analysis of proteins expressed from N terminally and C terminally tagged PrecisionShuttle vectors Each lane of the blot contains the whole cell lysate from an overexpression experiment using a PrecisionShuttle vector BLK represents human B lymphoid tyrosine kinase NM 001715 BTK represents human Bruton agammaglobulinemia tyr
6. GCGG L R V stop B G The PrecisionShuttle Vector System The TrueORF vector system is designed to express the ORF of a gene with one or more epitope tags or with a fluorescent marker There are more than seventy destination vectors in the PrecisionShuttle vector system These vectors are either N terminally tagged pCMV6 AN or C terminally tagged pCMV6 AC Available tags include Myc DDK His HA and tGFP and many others http www origene com cdna trueorf destinationvector aspx One untagged PrecisionShuttle vector is also available to express the untagged protein in mammalian cells or using an in vitro protein expression system Due to the requirement for the Mlu restriction site the untagged vector does still append two amino acids TR to the C terminus of the encoded protein Sof Protein ORF ORF TrueORF TrueORF Miu Miu Entry Vector Mul V c tagged Vector TrueORF N tagged Vector Neo Kanat yf F 4 Mammalian Cellular in vitro Protein Protein Expression Imaging Cell Free Protein Purificatio Expression Interactions Figure 3 Potential applications of the PrecisionShuttle system for protein analysis The TrueORF cDNA clones in the pCMV6 Entry vector and other N or C tagged vectors can be directly used in your experiments All of the plasmids in the PrecisionShuttle vector system are designed for high level target gene expression in mammalian cell
7. NNN 3 An extra nucleotide after Asc is important to maintain reading frames with N terminal tags in some destination vectors 11 Reverse primer with Rsr Il 5 GCGTCGGTCCGCTNNNNNNNNNNNNNNNNNNNNNNNN 3 Extra nucleotides after Rsr Il are important to maintain appropriate reading frames with C terminal tags in some destination vectors Reverse primer with Not I 5 GCGACGCGGCCGCGTACGCGTNNNNNNNNNNNNNNNNNNNNNNNN 3 Mlu is also added for downstream subcloning We recommend using a full length cDNA clone as the template for ORF cloning The success rate is low when a cDNA pool is used as the template for a PCR cloning reaction When the GC content of an ORF or a region of the ORF longer than 100 bp is above 75 a special PCR buffer with DMSO or other additive should be used to increase the success rate The recommended PCR polymerase and buffer are available from New England Biolabs Phusion High Fidelity PCR Kit F 553S PCR reaction setup Component Volume 5X PCR buffer 4 ul dNTPs 2 5 mM each 1 6 ul Phusion polymerase 2U ul 0 2 ul Nuclease free water 11 ul Forward primer 10 uM 0 6 ul Reverse primer 10 uM 0 6 ul cDNA template 2 ul 50 100ng plasmid Total volume 20 ul All of the components should be kept on ice When setting up multiple reactions a master mix can be prepared without cDNA template or primers After aliquotting the master mix the cDNA template and primers can be added individua
8. TrueORF cDNA Clones and PrecisionShuttle Vector System Application Guide Table of Contents Package Contents and Related Products 3 Related Optional Reagent eeesesusssss 3 Related OriGene Products eeeesssessss 3 Notice to DUNC GS OM ERE o estas 4 The same ORF is offered in 4 different expression vectors 4 Non Lenti based Vectors Figure 1 4 Lenti Vectors Figure 2 ccceeeeeeeeeeeneeeeeeeeeeeeeeeenneeeeeeeees 4 Experimental protocols cceeeeeeeeeeeeeeeeeeenneeeeeeeeeeeeeees 11 Detect protein over expression using anti DDK antibody 1 1 Primer Design and PCR Amplification of ORF 11 Cloning of ORF into the Entry Vector 13 Transfer of ORF from TrueORF Entry Vector to destination jc TMMERHr 15 Subcloning with OriGene s RapidShuttling Kit 15 Subcloning without OriGene s RapidShuttling Kit 15 Protocol for Transient Transfection 17 Protocol for Stable Transfection 18 Lenti based protocols eeeeeseeeeceeeeeeeeeeeeesseeeeeeeeeees 19 Troubleshooting Frequently Asked Questions esseseseeussss 21 Revision 10 14 Package Contents and Related Products
9. V6 AN GFP Cat PS100019 can not detect any protein expression from the TrueORF clone in a pCMV6 Entry vector What are my options Answer 1 Check your transfection efficiency We recommend using a plasmid that expresses a fluorescent marker pCMV6 AN GFP PS100019 2 Anti FLAG antibodies from other vendors are not as sensitive as OriGene s optimized 4C5 Anti DDK antibody TA5001 1 when directed at the same epitope can not see any green fluorescence with the TrueORF clone in a pCMV6 AC GFP vector What are my options Answer Your protein of interest might quench the fluorescence of tGFP To confirm we suggest you first run a Western Blot with a protein specific antibody or anti tGFP The molecular weight of the tGFP fusion protein is approximately 26 kDa larger than the endogenous protein We recommend OriGene s Anti tGFP antibody part number TA50041 http www origene com antibody 2H8 AntitGFP Antibodies against other GFPs will not recognize tGFP What does your disclaimer mean Answer OriGene s disclaimer for the TrueORF clones reads as follows Our molecular clone sequence data has been matched to the accession number below as a point of reference Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding accession number e g by representing an alternative RNA splicing form or single nucleotide polymorphism SNP The NCBI RefSeq mRNA sequences are contin
10. ation packaging system should work with OriGene s third generation pLenti vectors although we have not tested specifically about this 26
11. ble with OriGene s precision shuttling system a simple cut and ligation process Please refer to the corresponding protocols in the TrueORF application guide Q What is the size limit for the ORF that is to be cloned into the pLenti vector A In general lentiviral vectors have the capacity to accommodate an insert of 9 kb However ORFs larger than 4kb will dramatically decrease the packaging efficiency Q Can pLenti vectors be used in direct transfections as opposed to making virus OriGene s pLenti vectors can also be used in transient transfections to achieve expression of the transgene This usually involves lower levels of protein production due to diminished transfection efficiency Q What is the difference between a lentivirus and a retrovirus A Lentiviruses are a subtype of retrovirus The main difference between lentiviruses and standard retroviruses from an experimental standpoint is lentiviruses are capable of infecting both non dividing and actively dividing cell types whereas standard retroviruses can only infect mitotically active cell types Both lentiviruses and standard retroviruses use the gag pol and env genes for packaging However the isoforms of these proteins used by retroviruses and 25 lentiviruses are different and lentiviral vectors may not be efficiently packaged by each other s packaging systems Q Can I use a second generation packaging system with the pLenti vectors A Yes a second gener
12. codon ATG It is important to add the additional C base after the Sgf site to maintain appropriate reading frames with N terminal tags in some destination vectors Reverse primer with Mlu 5 GCGACGCGTNNNNNNNNNNNNNNNNNNNNNNNN 3 Ns represent the reverse complement of the ORF sequence starting with the stop codon for N terminally tagged or untagged destination vectors This ensures that the expressed fusion protein will end at the native C terminal end of the ORF For C terminally tagged vectors the reverse complement of the ORF sequence should start with the second to last codon as the stop codon must be removed to generate a fusion protein If the recognition sites for Sgf or Mlu are present internally in the ORF another rare cutter such as Asc Rsr Il or Not can be used in the cloning strategy In these cases the sequences of these alternate restriction sites should be used in place of Sgf and or Mlu examples below This same primer design strategy described above should be used for the design of other primers The Ns in the forward primer represent the sequence of the ORF beginning with the start codon ATG The Ns in the reverse primers represent the reverse complement of the ORF sequence starting with the stop codon for N terminally tagged or untagged destination vectors or starting with the second to last codon for C terminally tagged vectors Forward primer with Asc l 5 GCCGGCGCGCCANNNNNNNNNNNNNNNNNNNN
13. eration of Lentiviral vectors The 3 generation lentiviral vectors are safer than the 2 generation vectors The 3rd generation packaging systems express gag and pol from one packaging vector and rev from another The 3 generation packaging systems DO NOT express tat Trans Activator of Transcription Q What cell line should be used in order to produce lentivirus A HEK293T cells are commonly used to produce lentivirus The HEK293T cell line for producing lentiviral particles can be obtained from ATCC www atcc org Q How do propagate the pLenti vector in E coli A Due to the long terminal repeats in the lentiviral vector recombination deficient E Coli such as Stbl3 from ThermoFish is recommended The lenti viral vector can be amplified using high efficiency competent E coli cells 2 1x10 CFU ug DNA following the manufacturer s transformation protocol Plate the transformants on LB agar plates supplemented with 34 ug ml chloramphenicol Q Can I use the pLenti vector for stable selection in mammalian cells A Only a subset of the pLenti vectors have mammalian selectable markers and those without can not be used for mammalian selection You can make stable cell lines using the pLenti C Myc DDK IRES Puro vector You might also be able to get stable cells by GFP sorting using the pLenti C Myc DDK IRES GFP vector Q How to clone an insert into the pLenti vector A The multiple cloning site of the pLenti vector is compati
14. erent epitope tags or 4 fluorescent protein tags different mammalian selection markers or expression systems Two new AAV2 expression vector are just launched for transducing difficult to transfect cells A TrueORF insert can be shuttled easily among all PrecisionShuttle vectors with a pair of restriction enzymes and the tags will be in frame with the gene if the same pair of enzymes are used For detailed vector information sequence map tag location and cloning sites go to http www origene com cdna trueorf destinationvector aspx Figure 1 The Vector Maps of pCMV6 Entry and pCMV6 AC GFP J V promoter E a T7 promoter fl ori fl ori CMV promoter CMV promoter y SV40 ori f Amp Saf sv T A OUN CMVG ENTRY opf pCMV6 AC GFP 4929 bp cati 6590 bp Rs GFP HSV TK PolyA myctag 9 Rsrll y DDK ang B N 3 ColE1 indir o eM Neo PolyA signal SV40 ori Multiple cloning site of the PrecisionShuttle pCMV6 Entry Vector ozac Consensus EcoRI BamHI Kpn 1 RBS Sgf Asc Bgl I CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCAGATCT Hind II Rsr Il Miu I Noti Xho 1 Myc Tag CAAGCTTAACTAGCTAGCGGACCG ACG CGT ACG CGG CCG CTC GAG CAG AAA CTC ATC TCA GAA GAG T R T R P L E Q K L I s E E EcoRV Flag Tag Pme Fsel GAT CTG GCA GCA AAT GAT ATC CTG GAT TAC AAG GAT GAC GAC GAT AAG GTT TAA ACGGCCGGCC L A A N D K D D D D K V Stop Multiple cloning site in the PrecisionShuttle pCMV6 AC GFP Vector
15. idelines and regulations of your institution Perform the experiments with due caution to avoid exposure to infectious materials A Production of pseudovirus 10 cm plate format the production size can be scaled up or down accordingly 1 Day 1 plate HEK293T cells in a 10 cm dish to approximately 40 confluency the day before transfection Cells should reach 65 70 confluency within 24 hours 2 Day2 1 Re suspend the Lenti plasmid in 100 ul dH2O to obtain a final concentration 100 ng ul Label a sterile 1 5 mL eppendorf tube and to the tube add 50ul of the Lenti plasmid 5ug and 50yl of the packaging plasmids 6ug from the Lenti vpak packaging kit cat TR30022 2 Add 110 ul Opti MEM Invitrogen to the tube Mix the DNA by gently vortexing Add 44 ul of MegaTran 1 0 or other transfection reagent to the DNA tube Mix the solution by gently vortexing 3 Set the DNA tube inside a cell culture hood for 20 mins 4 Transfer the DNA transfection solution to the 10 cm plate prepared the day before by gentle and even dropping Gently rock the plate back and forth and from side to side to achieve even distribution of the transfection complex Incubate the plate in a CO2 incubator 3 Day3 change the growth medium and continue to incubate the plate for 48 hours 4 Day5 1 After the 48 hour incubation transfer the cell culture supernatant to a 15 mL centrifuge tube 2 Centrifuge the tubes at 3K RPM for 10 mins and fil
16. in product from Evrogen JSC that works well in standardized GFP assays Excitation max is 482nm and emission max is 502nm It yields 11296 of the brightness compared to eGFP and has no known cellular toxicity It is an isoform of the naturally occurring protein from Pontellina plumata that has been optimized for rapid labeling of cells organelles and tracking of promoter activity It is a perfect choice for monitoring transient protein expression Has OriGene fully sequenced all TrueORF clones Answer Not always When transferring the cDNA into the TrueORF Entry Vector OriGene always uses fully sequenced plasmids as templates and Phusion High Fidelity DNA Polymerase New England Biolabs which has a mutation rate less than 4 x 10 This ensures the highest fidelity of every TrueORF clone After cloning into the Entry vector each of OriGene s TrueORF clones was sequenced at both the 5 and 3 ends and the resulting sequence was matched to the corresponding reference sequence For ORFs of 1 Kb or less in length the 5 and 3 sequencing reads have covered the full ORF For longer cDNAs the ORF was not fully covered by sequencing reads Do TrueORF clones exactly match the reference gene sequence Answer All TrueORF clones are guaranteed to match the corresponding ORF sequence posted on our website However some clones may contain nucleotide changes compared to the published reference sequences This is due to SNPs single nucleotide polymorphi
17. ion or 301 340 3188 outside the US E mail inquiries to techsupport origene com are also invited No colonies or low number of colonies from transformation Cause Remedy The competent cells used in the Obtain a fresh batch of competent cells transformation were not as efficient as and ensure that the efficiency is 2 necessary 1x10 CFU ug DNA by performing a separate transformation reaction with a transformation qualified control usually a fixed amount of supercoiled plasmid such as pUC19 In some extreme cases especially for larger inserts 25 kb higher efficiency cells or electroporation may be required Should a gene be toxic to the cells growing bacteria at a lower temperature such as 30 C or transforming into strains that reduce the copy number can increase the odds of obtaining colonies i e ABLE C or ABLE K strains from Stratagene CopyCutter from Epicentre Too little DNA was used in the Add more DNA but not more than 10 transformation reaction of the volume of competent cells used The ligation of the ORF donor DNA 1 The ligase enzyme may not work into the recipient plasmid was not properly Repeat the reaction with fresh Bis successful ligase and ligation buffer which contains the temperature sensitive component ATP or perform troubleshooting as recommended by the manufacturer of the ligase 2 Change amounts and ratios of DNA ORF insert vs vector in the reac
18. ite is immediately downstream of Mlu I Using one of the five different subcloning combinations any ORF can be transferred from one vector to another The recommended subcloning combination for every TrueORF cDNA is listed in the product information on our website Why does my Certificate of Analysis COA indicate cloning sites other than Sgf I and Mlu I Whenever one or both of these sites is present within the ORF of the transcript the PrecisionShuttle vectors share other sites engineered to accommodate this e g Rsr Il or Asc I What sites should I use to transfer a TrueORF clone into the Gateway system Answer There are multiple sites in pCMV6 Entry than can be used to move the insert of a TrueORF clone into any of Gateway s Entry vectors pENTR 1A 2B 3C 4 and 11 These sites are EcoR I Sal BamH and Kpn at the 5 end and Not at the 3 end What restriction sites are available for subcloning into other vectors Answer The vector map and nucleotide sequence can be found at http www origene com cdna trueorf destinationvector mspx How many amino acids are present in the linker between my protein and tGFP Answer To accommodate the Mlu I cloning site which maintains the proper reading frame this vector appends a threonine and arginine This is far fewer than with other recombination based shuttling systems Which vector serves the negative control for the GFP fusion clone Dos Answer We recommend pCM
19. k the plate back and forth and from side to side to achieve even distribution of the complexes Incubate at 37 C for 24 48 hrs 17 Table 1 Recommended starting transfection conditions for Turbofectin 8 Tissue Culture Growth area ug of DNA Ratio of Vessel cm well Turbofectin DNA 96 well plate 0 35 0 1 0 3 3 1 24 well plate 2 0 25 1 25 31 12 well plate 4 0 5 2 5 3 1 6 well plate 9 5 1 5 3 1 35 mm plate 8 1 5 3 1 60 mm plate 20 2 10 3 1 100 mm plate 60 5 15 3 1 Protocol for Stable Transfection Perform a transfection as described above protocol for transient transfection Twenty four hrs post transfection passage the cells at 1 10 or higher dilution into fresh growth medium containing selective agent the correct dose needs to be determined by killing curve experiment A mock transfection should be performed in parallel as a control Grow and passage the cells as necessary maintaining selection pressure by keeping the selective agent in the growth medium After 1 2 weeks a large number of the cells will be killed the cells that remain growing in the selective medium have retained the expression plasmid which stably integrates into the genome of the targeted cells Monitor the mock control to ensure the cells are dying 18 Lenti based protocols NOTE Performing Lentiviral experiments may require special laboratory conditions and or permissions BL2 Follow the gu
20. le destination vectors each of which is designed to express 1 a native untagged protein 2 an N terminally tagged protein or 3 a C terminally tagged protein The translation of an N terminally tagged protein initiates from the ATG of the tag and continues through the ORF of the gene of interest whereas translation of an untagged or a C terminally tagged protein initiates from the ATG of the protein of interest The ORF of a C terminally tagged protein is followed by either a single tag or a double tag including a short spacer 5 6 amino acid residues The transfer protocol between TrueORF vectors is shown schematically in Figure 4 and is detailed below fc 1 Digestthe TrueORF Entry clone 15 Component Volume 10X restriction buffer 2 ul Sgf I 10 U ul 0 6 ul Mlu I 10 U ul 0 6 ul nuclease free water 13 8 ul TrueORF Entry vector 200 ng 3 ul Total volume 20 ul Incubate at 37 C for 3 hrs Digest the TrueORF destination vector Component Volume 10X restriction buffer 2 yl Sgf I 10 U l 0 6 ul Mlu I 10 U ul 0 6 ul nuclease free water 14 8 ul TrueORF destination vector 200ng 2 ul Total volume 20 ul For the 4 of the clones that have internal Sgf or Mlu sties please use the appropriate combination of restriction sites as recommended by OriGene Incubate at 37 C for 3 hrs Add 0 5 ul antarctic phosphatase units used according to the manufacturer s protocol to the digestion and continue to incuba
21. lly to each tube PCR cycling conditions The optimum Tm for annealing should be 55 60 C The extension time depends upon the length of the ORF The following program is generally used for ORFs from 500 bp 4000 bp 1 cycle of 95 C 1min 2 cycles of 95 C 10sec 62 C 20sec 72C 4min 2 cycles of 95 C 10sec 60 C 20sec 72C 4min 2 cycles of 95 C 10sec 58 C 20sec 72C 4min 12 15 cycles of 95 C 10sec 56 C 20sec 72 C 4min 72 C 10min 4 C hold Cloning of ORF into the Entry Vector 1 Confirm that the size of the amplification product is correct by agarose gel electrophoresis and purify the remainder of the reaction using a purification column or similar method Elute the DNA from the purification column in 26 ul of 10 mM Tris buffer Set up a digestion reaction as described below substituting other restriction enzymes as appropriate Component Volume 10X restriction buffer 3 ul Sgf 10U ul 0 6 ul Mlu I 10U ul 0 6 ul Purified PCR product 26 ul Total volume 30 ul Mix well and incubate at 37 C for 3 hrs 2 Purify the digestion reaction using a purification column and elute in 18 ul of 10 mM Tris buffer Quantitate the DNA by UV at A260 or by OriGene s QuantiLadder Cat QLD200 3 Digest pCMV6 Entry with the restriction enzymes corresponding to the sequences added to the ORF pCMV6 Entry is available from OriGene as 10 ug lyophilized DNA Cat PS100001 Resuspend the lyophilized DNA in 100 pl dH20
22. n Tag ORF Sofl Mlul Precision Mlul TrueORF Shuttle Destination Vector Entry Vector Neo Kan Neo 4 Ligation Transformation and Selection with Ampicillin Tag Sgfl Protein ORF Precision Shuttle Destination Vector Mlul Amp Neo Figure 4 Schematic of the PrecisionShuttle subcloning procedure The Entry and destination vectors are digested with Sgf and Mlu or other specified enzymes After a ligation reaction the resulting clones are grown on ampicillin containing plates to select for successful subcloning of the ORF into the destination vector Two rare cutting restriction enzymes are utilized in transferring an ORF between vectors Most subcloning from the Entry to a destination vector involves Sgf l Asis present in 0 37 of human ORF and Mlu 4 In the very unusual case when Sgf and Mlu sites are inside the ORFs the TrueORF vector MCS provides other rare restriction sites such as Asc I Rsr Il and Not so that any ORF can be shuttled from the Entry vector to a destination vector by using some combination of these five rare restriction enzymes Unlike site specific recombination vector systems the TrueORF Clone System does not append multiple amino acids to the amino or carboxy terminus of the protein of interest The subcloning strategy maintains insert orientation and reading frame 8 eliminating the need to resequence the insert after each transfer Becau
23. ng products All of the vectors have a unique combination of N and C terminal epitope tags or a fluorescent marker as described in Table l How do you transfer the ORF insert purchased into another tagging vector Answer Over 70 destination vectors are designed with compatible MCS for easy shuttling of TrueORF inserts This can be performed easily using a specific pair of restriction enzymes to cut and ligate subclone into the desired destination vector OriGene simplifies this process by offering the RapidShuttling Kit see D http www origene com rapid shuttling kit OriGene also provides a custom cloning service available through our website What are the functional aspects of the pCMV6 AC GFP vector Answer Like all OriGene vectors the CMV promoter drives the heterologous expression of the specified open reading frame ORF which is in frame with Turbo Green Fluorescent Protein tGFP on the C terminus tGFP expression permits the positive identification of mammalian cells transfected with plasmid The neomycin resistance gene is also expressed downstream of the SV40 promoter within the same vector and permits positive selection of transfected cells as well as stable cell line production For bacterial amplification the ampicillin resistance gene is engineered on the opposite strand OriGene s GFP is listed as TurboGFP How is this different from other available GFPs Answer TurboGFP is a fully licensed 26kDA prote
24. osine kinase NM 000061 These two cDNAs were cloned into the destination vectors identified at the top of the blot GFP represents one empty destination vector pCMV6 AC GFP used for cloning C terminal GFP fusion proteins Specific antibodies against BLK and BTK detected the same size proteins as antibodies against the N terminal and C terminal tags 10 Experimental protocols Detect protein over expression using anti DDK antibody The protein expression level can be detected using anti DDK antibody OriGene product number TA50011 4C5 Anti DDK monoclonal antibody with Western blotting method This antibody is shown to be 5 10 times more sensitive than Sigma s M2 anti FLAG antibody Therefore it is important to use TA50011 mAb when accessing protein over expression using OriGene s TrueORF clones When OriGene s 4C5 Anti DDK monoclonal antibody is used the suggested starting dilutions are 1 2000 for Western blot 1 200 for immunoprecipitation and immunostaining and 1 1000 for immunofluorescence Primer Design and PCR Amplification of ORF The open reading frame ORF of the clone must be PCR amplified in order to append cloning sites to the 5 and 3 ends of the sequence Add the target sequences of the selected restriction enzymes to the forward and reverse PCR primers examples are shown below Forward primer with Sof 5 GAGGCGATCGCCNNNNNNNNNNNNNNNNNNNNNNN 3 Ns represent the sequence of the ORF beginning with the start
25. pCMV6 AC GFP In this vector a TrueORF is fused with turboGFP at its carboxy terminus The antibiotic selection marker for E coli is ampicillin 25ug ml and neomycin G418 for mammalian cells The green fluorescence tag allows one to monitor the ORF product in live mammalian cells Lenti Vectors Figure 2 pLenti C MYC DDK In this vector a TrueORF is fused with Myc andDDK tags at its carboxy terminus The antibiotic selection marker for E coli is Chloramphenicol The lenti based vector allows the TrueORF insert to be packaged into pseudoviral particles and to be introduced into some difficult to transfect cells through infection The small dual tags facilitate the detection and purification of the ORF product with anti Myc or anti DDK antibody pLenti C mGFP In this vector a TrueORF is fused with a monomeric GFP at its carboxy terminus The antibiotic selection marker for E coli is chloramphenicol The green fluorescence tag allows one to monitor the ORF product in live mammalian cells The monomeric GFP tag can avoid a potential mis translocation of a target caused by dimeric form of GFP such as tGFP Note For LentiORF clones due to the long terminal repeats in the vector to make more plasmid DNA recombination deficient E Coli competent cells are recommended such as Stbl3 from ThermoFisher In addition to the commonly used vectors listed above OriGene provides over 90 PrecisionShuttle vectors for a variety of utilities diff
26. s or in vitro translation in a cell free system The plasmids contain the promoter and enhancers of the human cytomegalovirus CMV immediate early gene to drive mammalian gene expression and the T7 promoter for in vitro transcription translation A Kozak consensus sequence is included in the plasmid to enhance mammalian expression The PrecisionShuttle vector system employs a basic cut and ligate molecular cloning method Figure 4 It is faster cheaper more reliable and flexible than a recombination strategy and no intellectual license is required for either academic or commercial users The transfer of the ORF from the Entry clone to any destination vector is a rapid process Digestion ligation and transformation take as little as 3 hrs Figure 4 since the Entry vector and destination vectors use different antibiotic selection markers Unlike recombination based systems in which the Entry clone is only a preliminary product OriGene s Entry Vector contains C terminal Myc and DDK tags and can be used directly for many applications including 1 tagged protein expression C terminal Myc DDK in 7 mammalian cells and 2 tagged protein expression in a cell free system using the T7 promoter Sof Tag Protein ORF Sof Precision Mlul Shuttle Destination Vector TrueORF Entry Vector Mlul Myc DDK Neo Kan Tag Amp Digestion with Digestion with Sof I Sgf land Mlu I Sof Mlu I and CIP Protei
27. se the Entry and destination vectors have different antibiotic resistance genes selection after subcloning is a very simple process Therefore the shuttling process can be readily adapted to a 384 well format With the availability of over 32 000 unique full length human cDNA clones and mouse and rat clones OriGene is in an enviable position to develop and support such high throughput applications While the PrecisionShuttle vector system can be used for any cDNA we have developed this system to take advantage of the largest collection of full length cDNA clones available at OriGene Every cDNA clone is offered in the Entry vector as a TrueORF clone and the customer can easily transfer this ORF into any destination vector A special effort has been made during the synthesis of these TrueORF clones to minimize the generation of mutations Using a large quantity of high quality cDNA template a minimum of PCR cycles and a polymerase with the highest fidelity one mutation in 40 000 000 bp the number of PCR mutations is very limited No mutations were identified during the initial cloning of over 200 ORF cDNAs ranging from 500 6000bp into the Entry vector after full length sequencing of each of these clones The MCS of the PrecisionShuttle vectors was engineered to be compatible with most other commercially available vector systems including Gateway vectors Invitrogen PET vectors Novagen and Flexi vectors Promega In this sense the TrueORF
28. sms reflecting the unique differences from genes expressed in different tissues and different individuals Published references may represent a different SNP than the OriGene transcript Should a specific SNP be required this can be obtained via OriGene s wholly owned subsidiary company Blue Heron www blueheronbio com Sequences of the sequencing primers Answer VP1 5 forward seq primer 5 GGACTTTCCAAAATGTCG 3 Tm 51C XL39 reverse seq primer 5 ATTAGGACAAGGCTGGTGGG 3 Tm 60C 22 V2 0 forward seq for Lenti vector non EF1a promoter 5 AGAGCTCGTTTAGTGAA 3 Tm 48C LR50 reverse seq for Lenti vector 5 CAGAGGTTGATTATCGATAAG3 Tm 55C EF50 forward seq primer for vectors with EF1a promoter 5 CTTCCATTTCAGGTGTCGTGAC 3 Tm 55C Can transfer large ORFs using this system Answer It has been reported that ORFs larger than 4 Kb are unstable in recombination based systems conversely our restriction digest based vector system has no real size limitation An ORF up to 18 Kb can be readily transferred from one vector to another What restriction enzymes should I use if Sgf or Mlu I sites are present in my ORF Answer While 96 of all human and mouse ORFs can use the Sgf Mlu combination some ORFs do contain internal Sgf or Mlu site s Most of those ORFs can be transferred using another rare cutter Asc which is down stream of Sgfl Rsr Il whose restriction site is upstream of Mlu I or Not I whose s
29. t of sequencing primers are used for TrueORFs cloned in Lenti vectors V2 0 as the forward sequencing primer LR50 as the reverse sequencing primer Protocol for Transient Transfection A sample protocol is listed here for experiments performed in 24 well plates If performing experiments in other cell culture plates simply multiply the suggested quantities by the relative surface area of your plate See Table 1 for more details OriGene recommends using TurboFectin 8 0 TF81001 for all transfections It consistently produces high transfection efficiency and high protein overexpression 1 2 Preparation of cells a Approximately 18 24 hours before transfection plate 5x1 0 adherent cells or 5x10 suspension cells per well to obtain 50 70 confluence on the following day Preparation of the Turbofectin 8 0 DNA Complexes prepare immediately prior to transfection a Dilute 0 5 ug of DNA in 50 uL of Opti MEM I Gibco 51985 Vortex gently b Add 1 5 uL of Turbofectin 8 0 to the diluted DNA not the reverse order and Pipette gently to mix completely c Incubate for 15 minutes at room temperature Note We recommend starting with the ratios of Turbofectin 8 0 and DNA listed in Table 2 however subsequent optimization may further increase the transfection efficiency 3 Transfection Gently add the Turbofectin 8 0 DNA mixture from step 2 drop wise to each well already containing about 500 uL of culture medium Gently roc
30. te at 37 C for an additional 30 minutes Purify the digestion using a commercial PCR purification column and elute in 20 ul 10 mM Tris Set up a ligation reaction Component Volume 10 x T4 DNA ligation buffer 1 ul T4 DNA Ligase 4U ul 0 75 ul nuclease free water 3 25 ul digested DNA from Step 1 ORF clone 2 ul digested DNA from Step 2 destination vector 3 ul Total volume 10 ul Incubate the ligation reaction at room temperature for 1 hour Transform the ligation reaction into high efficiency competent E coli cells gt 1x10 CFU g DNA following the appropriate transformation protocol Plate the transformants on LB agar plates supplemented with 100 ug ml ampicillin for non Lenti vectors or 34ug ml chloramphenicol for Lenti vectors Pick at least four colonies for subsequent DNA purification and screening Amplify and purify the selected clone s by growing overnight in liquid LB containing the corresponding antibiotics 16 ampicillin for non lenti vectors chloramphenicol for lenti vectors then isolating the DNA using standard plasmid purification procedures Confirm the insert by restriction digestion and or vector primer sequencing using the provided V1 5 for 5 end sequencing and XL39 for 3 end sequencing non lenti vectors A different set of sequencing primers are used for TrueORFs cloned in the pTUNE vector pTUNE F as the forward sequencing primer pTUNE R as the reverse sequencing primer A different se
31. ter the supernatant through a syringe filter 0 45 micron and collect the viral solution to a new sterile tube 5 The viral particles are ready to be used They can be stored at 4 C for 2 weeks or put at 80 C for long term storage B Transduction of lentivirus to target cells 1 Day 1 plate target cells in three 10 cm plates at a density that will produce approximately 6096 confluency in 24 hours Note other size formats can also be used depending on the nature of your experiment Adjust the reagent amount accordingly 19 6 Day 2 Remove the growth media from the plates prepared the day before To plate 1 add 4 5 mL of fresh growth medium and 0 5 mL of Lentiviral particles To plate 2 add 4 0 mL of growth medium and 1 mL of Lentiviral particles To plate 3 add 2 5 mL of growth medium and 2 5 mL of Lentiviral particles for a low titer viral preparation the amount of virus added can be increased to 5 mL Mix the solution by gentle swirling Add 5 ul polybrene 1 000x 8 mg mL to each plate Mix by gentle swirling Incubate the cells at 37 C with 5 CO2 for 4 hours Remove the transduction medium and add 10 mL of fresh growth medium Incubate the cells for three more days The transduced cells are ready for downstream analyses such as RNA and protein detection Troubleshooting For questions not addressed here please contact OriGene s Technical Support professionals You may dial 888 267 4436 from any US locat
32. tion The wrong antibiotic selection plate Make sure to use an LB agar plate was used containing the correct antibotics e g 25 ug ml kanamycin for Entry vector and 100 ug ml ampicillin for other non lentiviral destination vectors chloramphenicol 34ug ml for lentiviral vectors Too high self ligation background no insert from destination vector Cause Remedy The destination plasmid was not Allow the digestion reaction to completely digested continue for 3 hrs or overnight at 37 C The dephosphorylation of the Increase the concentration of antartic destination plasmid was not complete phosphatase and or the length of the and the destination vector religated dephosphorylation incubation as with its own fragment recommended by the ligase manufacturer Frequently Asked Questions What is the PrecisionShuttle System Answer The PrecisionShuttle System provides a restriction enzyme based approach to append different tags to one s open reading frame ORF of interest What is the difference between OriGene s Entry vector and the destination vectors Answer The major differences are the antibiotic selection marker and the epitope tags or markers The Entry vector carries kanamycin resistance 25 ug ml while all other non lenti destination vectors contain the ampicillin resistance gene 100 ug mL or chloramphenicol 34 g mL for lenti vectors This allows simple screening for successful subcloni
33. uously being revised as some may have been derived from aberrantly spliced transcripts or generated by incorrect prediction of intron exon junctions in silico These sequences are therefore used only as a reference and not as a standard OriGene s clones are isolated from full length cDNA libraries and may differ from the reference sequence for this reason What is the TrueORF Guarantee Answer OriGene warrants that the product will meet specifications listed At OriGene s discretion free replacement of any non conforming product will be made if OriGene is notified within 30 days of product receipt If you experience any difficulty with any OriGene product please contact our Technical Support Staff at 888 267 4436 or 301 340 3188 outside the US Lentiviral vector FAQ Q Is there any safety issue with this pLenti vector A The pLenti vector is a third generation lentiviral vector and it is the safest lenti viral vectorbecause both LTRs are truncated Please contact the biosafety office at your institution prior to use of the pLenti vector for permission and for further institution specific instructions BL2 conditions should be used at all times when handling lentivirus All decontamination steps should be performed using 70 ethanol 1 SDS Gloves should be worn at all times when handling lentiviral preparations transfected cells or the combined transfection reagent and lentiviral DNA 24 Q What is unique about the 3 gen
34. www origene com RNAi VERIFY Tagged Antigens _http Awww origene com lysate Validated Antibodies http www origene com antibody Purified Proteins http www origene com protein Transfection Reagents http www origene com cdna transfection mspx 4C5 Anti DDK Antibody http www origene com antibody 4C5 AntiDDK 2H8 Anti tGFP Antibody http www origene com antibody 2H8 AntitGFP Notice to purchaser This product is for research use only Use in and or for diagnostics and therapeutics is strictly prohibited By opening and using the product the purchaser agrees to the following The plasmids may not be distributed resold modified for resale or used to manufacture commercial products without prior written approval from OriGene Technologies Inc If you do not agree to the above conditions please return the UNOPENED product to OriGene Technologies Inc within ten 10 days of receipt for a full refund The same ORF is offered in 4 different expression vectors Non Lenti based Vectors Figure 1 pCMV6 Entry In this vector a TrueORF sequence is fused with a MYC DDK tag at its carboxy terminus The antibiotic selection marker for E coli is kanamycin 25ug ml and neomycin G418 for mammalian cells Unlike an entry clone in other shuttling systems OriGene s entry vector is a functional mammalian expression vector The small dual tags facilitate the detection and purification of the ORF product with anti Myc or anti DDK antibod

Download Pdf Manuals

image

Related Search

Related Contents

hogedrukreiniger hochdruckreiniger high  Começar a utilizar  Industrial Balances  comment mener un dialogue socratique  Fiche notice d`utilisation  Samsung VP-D250(I) User's Manual  Mode d`emploi rapide Envoi personnalisé Accès  Tecnostyl GT30/45 ruler  Samsung 无线壁挂音响 HW-F551 用户手册  Lavadora  

Copyright © All rights reserved.
Failed to retrieve file