Release Notes - Thermo Fisher Scientific
Contents
1. Server SYBASE Database biolims2 Save this consensus as 0208 188 Contig 1 The contig sequence is saved into a root level collection called Consensus Sequences You can use the BioLIMS Manager program to rename the collection or to move the contig sequence into another collection Name v7 G Consensus Sequences 0X208 188 Contig 1 Release Notes New Features in AutoAssembler v 2 1 Page 21 of 40 IUPAC IUB Codes Recognized AutoAssembler v 2 1 Recognizes TUPAC IUB Codes Using IUPAC IUB Page 22 of 40 Codes AutoAssembler v 2 1 Software recognizes IUPAC IUB ambiguity codes when it builds the consensus sequence In previous versions the AutoAssembler program would not put an ambiguity code in a consensus sequence Some applications like mutation detection heterozygote detection and microbial identification can benefit from the ability to assemble using the full IUPAC IUB character set The extended set of 14 base characters provides the ability to indicate ambiguous knowledge about bases Whenever IUPAC IUB ambiguity codes are present in the base called sequence the AutoAssembler program takes them into account in displaying the consensus sequence If your sequences do not contain IUPAC IUB codes but you want to take advantage of the new capability use Factura Feature Identification software to identify and assign IUPAC IUB codes within sequences For more information about2. File Begin End Release Notes New Features in AutoAssembler v 2 1 To automate loading of sequences into assemblies continued Step Action 4 Choose Save As from the File menu Save the assembly with the same name as the collection that contains the sequences you want to assemble step 1 above For example Server SYBASE Database biolims2 Owner Your Name Save this assembly as 5 Choose AutoUpdate Settings from the Edit menu 6 In the dialog box a Check the Activate Automated Update box b Choose at least a 10 minute wait before starting c Click Add Project and select the empty saved assembly w Activate Automated Update Wait minutes before starting update Projects to update Add Pro Aad Project 7 After the specified wait time the sequences in the collection are added to the assembly and the sequences are assembled using the current Assembly Setup Release Notes New Features in AutoAssembler v 2 1 Page 17 of 40 For more information about AutoUpdating see pages 3 43 to 3 45 of the ABI PRISM AutoAssembler DNA Sequence Assembly Software v 2 0 User s Manual P N 904947 Deleting Data from Assemblies like individual sequence data can be deleted from the the BioLIMS BioLIMS database using the BioLIMS Manager program You cannot Database delete from the database using the AutoAssembler program
3. and Estonia Warszawa Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Russia Moskva 7 095 935 8888 7 095 564 8787 South East Europe Zagreb Croatia 385 1 34 91 927 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d IJssel 31 0 180 331400 31 0 180 331409 United Kingdom Warrington Cheshire 44 0 1925 825650 44 0 1925 282502 Release Notes New Features in AutoAssembler v 2 1 To Reach Technical Support Through the Internet Telephone Fax Region Dial Dial All other countries not 44 0 1925 282481 44 0 1925 282509 listed Warrington UK Japan Japan Hacchobori 81 3 5566 6230 81 3 5566 6507 Chuo Ku Tokyo Latin America Del A Obregon Mexico 305 670 4350 305 670 4349 We strongly encourage you to visit our Web site for answers to frequently asked questions and for more information about our products You can also order technical documents or an index of available documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is http Avww appliedbiosystems com techsupp To submit technical questions from North America or Europe Step Action 1 Ac
4. Page 18 of 40 Release Notes New Features in AutoAssembler v 2 1 Saving a Contig as a Sequence in a BioLIMS Database Introduction You may want to save an assembled contig sequence to the database as a sequence For example once the contig is saved as a sequence object in the database the contig can itself be used as a sequence in a larger assembly When saved to the database the contig looks like a text file uploaded by the Sample2DB program would That is there is no electropherogram data no EPT data and only minimal annotation information associated with the sequence Saving a Contig as a Sequence To save a contig as a sequence in a BioLIMS database Step Action 1 If the assembly window containing the contig is not already open open it Choose Build Consensus from the Project menu Project Sequence Window Add Sequence s from BioLIMS 3T Add Multiple from BioLIMS at Re Add Modified Sequences Remove Sequence 3R Assembly Setup BF Assemble ey Build Consensus 3 The following dialog box appears Build Consensus Name Case 0 208 188 Contig 1 Mixed vj AJ Delete insertion gap characters Release Notes New Features in AutoAssembler v 2 1 Page 19 of 40 Page 20 of 40 To save a contig as a sequence in a BioLIMS database continued Step Action 3 Use the pop up menu to choose the case
5. Oracle Corporation Sybase is a registered trademark and Sybase SQL Server is a trademark of Sybase Inc All other trademarks are the sole property of their respective owners P N 4304077B
6. how to do this refer to the ABI PRISM Factura Feature Identification Software v 2 1 User s Manual P N 904946 Release Notes New Features in AutoAssembler v 2 1 An Example This table gives an example of the difference between the way the AutoAssembler v 2 0 and v 2 1 Programs handle IUPAC IUB codes within consensus sequences Version Displays a consensus this way 2 0 300 T R t CACCtCCTTT CCACCTCCTTT CCACCRCCTTT 2 1 23 ae hae CCACCACCTTT e 4 CEACETCETTT CCACCRCCTTT TUPAC IUB Codes The table below provides translations for IUPAC IUB codes used in the CAP 2 engine IUPAC IUB Codes Code Translation Adenosine Cytidine Guanosine Thymidine C G or T A G or T A C or T A or G puRine C or T pYrimidine G or T Keto A or C aMino G or C Strong 3 H bonds A or T Weak 2 H bonds z ol ZIA lt DIr owal olol aNy base Release Notes New Features in AutoAssembler v 2 1 Page 23 of 40 Complements The table below shows the complements for the IUPAC IUB character set Complement Table Character Complement A T 4 0l O gt O O zi lt I olw o ZIA lt J zl ol I lt lo xa zD lt Page 24 of 40 Release Notes New Features in AutoAssembler v 2 1 Phred Phrap Cross Match BASIS and
7. include spaces and punctuation Release Notes New Features in AutoAssembler v 2 1 Page 9 of 40 Instrument Name search criterion for sequences The Assembly Browser Window Page 10 of 40 Collection Name contains hd Sequence Frag Name starts with Y Collection Browser Select criteria hd Select Collections or Sequences to Add ox l Collection AAProject contains 7 items and The Assembly Browser window opens when Connection to a BioLIMS database is open Open is selected from the File menu The Assembly Browser window looks like this Instrument Name 377_in_Lab_3c Name Modified Sample Name Tup D 5 15 test May 15 1998 10 49 45 AM cid b 6 9 test Salil Jun 10 1998 04 00 23 PM E 7 Aarroject Jun 15 1998 02 29 34 PM fas 0x208 04 short May 08 1997 04 44 13 AM 0x208 04 short Has 0x208 131 May 21 1997 06 42 01 PM 0x208 131 Has 0x208 172 May 08 1997 05 07 05 AM 0x208 172 Has 0x208 188 May 08 1997 04 44 16 AM 0x208 188 Be o0x208 71 May 08 1997 05 07 06 AM 0x208 71 83 0x208 88 May 21 1997 09 25 17 PM 0x208 88 b amp Assemblies Jun 15 1998 02 29 26 PM oo eet Use the Assembly Browser window to search for and open or select assemblies from the BioLIMS database Release Notes New Features in AutoAssembler v 2 1 Select Criteria Search button pop up menu A
8. qualities reflect phrap s confidence in the basecalls Each of the three Release Notes New Features in AutoAssembler v 2 1 quality levels is displayed differently in the alignment view of the project window Appearance of Fragment Sequences in Project Data Quality Window Default Range Good Full color 25 and up Fair Grey 11 25 Low Light grey 0 10 The three quality levels are shown in the figure below Note The Quality Display Settings only affect the appearance of the fragment sequences The display of the consensus sequence itself is determined by phrap The purple background indicates a discrepant base that is a high quality base that disagrees with the consensus 7187 original ace H H Contigs 57 Sequences From Files 130 Sequences Total Local F Begin T18 e06 T187d09 T187a10 T187h11 T187h07 T187f03 880 1890 19p6 1916 1926 1936 ATCAGGTAATAAATTAA GGTTCCA G GTTCC FCAGATACG CoA FC TAAT GTTCCAATTCAATCABATA ATATACCACG TETTTATCCA ATCAGOTAATAAATTAACCAGACAGOTTCCAATTCAATCAGATACGAATATACCACGTTTTCTTTATCCAT ATCAGGTAATAAAT TAACCAGACAGGTICCAATFICAATCAGATACGAATATACCACGTITFICTFTATCCA PICCAATICAATCAGATACGAATATACCACGTITICTITATCOA FOAGGTAATAAAT ATACCACGTIFICTITA ATCAGGTAATAAAT TAACCAGACAGGTTCCAAT TCAATCAGATACGAABATACCACGTTTTCTTTATCCAT ATCAGGTAATAAATTAACCAGACAGGTICCAATTCAATCAGATACGAATATACCACGTTITICTITATCCOA CGTTTTCTTTATCCAT Release Notes New Features in A
9. request through the a Access the Applied Biosystems Technical Support Internet for fax Web site at or e mail http www appliedbiosystems com techsupp delivery b Under Resource Libraries click the type of document you want c Enter or select the requested information in the displayed form then click Search d In the displayed search results select a check box for the method of delivery for each document that matches your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download it immediately e Fill in the information form if you have not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax delivery but no limit on the number of documents you can order for e mail delivery Release Notes New Features in AutoAssembler v 2 1 Copyright 2001 Applied Biosystems For Research Use Only Not for use in diagnostic procedures ABI PRISM the ABI PRISM design Applied Biosystems and BioLIMS are registered trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries ABI AutoAssembler and Factura are trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries AppleScript Macintosh and Power Macintosh are registered trademarks of Apple Computer Inc Oracle is a registered trademark and Oracle7 is a trademark of
10. up menu is set to Custom Install as shown here fAutoAssembler Installer Custom Install v EJ AutoAssembler Disk space available 825 536K Approximate disk space needed 4 704K Install Location The folder AutoAssembler 2 1 will be created on the J disk Hard Disk Install Location Hard Disk v Page 4 of 40 Release Notes New Features in AutoAssembler v 2 1 To install AutoAssembler software from CD ROM continued Step Action 6 Use the pop up menu in the lower section of the installer dialog box to select the hard drive and folder on which to install AutoAssembler software To begin the installation choose Install The following dialog box appears when installation is complete A Installation was successful If you are finished click Quit to leave the Installer If you wish to perform additional installations click Continue Choose Quit Enable any virus protection that you turned off before installation Drag the AutoAssembler 2 1 CD ROM icon to the Trash to eject the CD ROM 10 The AutoAssembler Installer Log file is created by the Installer The log file is placed in the AutoAssembler folder and contains a list of all the files installed Use this log file if you need to remove AutoAssembler from your hard disk See Removing AutoAssembler Software below Release Notes New Features i
11. 49 and West Asia Fairlands South Africa South Africa 27 11 478 0411 27 11 478 0349 Johannesburg Middle Eastern Countries 39 0 39 8389 481 39 0 39 8389 493 and North Africa Monza Italia Release Notes New Features in AutoAssembler v 2 1 Page 35 of 40 Page 36 of 40 Telephone Fax Region Dial Dial Eastern Asia China Oceania Australia Scoresby 61 3 9730 8600 61 3 9730 8799 Victoria China Beijing 86 10 64106608 86 10 64106617 Hong Kong 852 2756 6928 852 2756 6968 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 712 5555 32 0 2 712 5516 Czech Republic and Slovakia Praha 420 2 61 222 164 420 2 61 222 168 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Poland Lithuania Latvia 48 22 866 40 10 48 22 866 40 20
12. AutoAssembler This Section Phred Phrap Software Sequences and Assembly Names for Phrap This section only applies to those who have the installed the BioLIMS database phred phrap cross_match and the BASIS suite of programs on their UNIX platforms New in BioLIMS 2 0 is the integration of the third party phred phrap and cross_match assembly software with the BioLIMS 2 0 system The suite of programs and scripts that interfaces phred and phrap to the BioLIMS database and to AutoAssembler is called BioLIMS Assembly System Integration Software BASIS For more information about the BASIS suite itself see the ABI PRISM BASIS BioLIMS Assembly System Integration Software User s Manual P N 4304074 Phred Phrap and Cross_Match Functions Program Description phred Base calls the raw sequence data and assigns quality values to each base call cross_match Screens the sequences against known vector sequences replacing vector bases by x phrap Assembles fragments into contigs and generates the consensus sequence for each contig In general we recommend restricting sequence and assembly names to letters numbers underscore characters and only one period full stop Sequence Names Sequence names for BASIS assemblies must conform to the phred and phrap sequence naming rules It is important that you refer to your phred and phrap documentation for details Common problem characters are spaces a
13. L Project Sequence Window Undo Designate as Consensus 2 Cut 38H Copy C Paste 8U Clear Shift Left Shift Right Delete from Valid Range 8 Complement Upper Case U Designate as Consensus 38 The selected bases then become the consensus bases ee ae 66 4455 AGAAAA becomes the consensus GGAAGAAAT 0GAADAAAAT GOAGGA44TT Release Notes New Features in AutoAssembler v 2 1 Page 29 of 40 Ambiguity Characters in Phrap Assemblies The ambiguity characters in phrap assembled contig display have a different meaning to the ambiguity characters displayed for a contig assembled with the local or CAP engines Ambiguity Code Meaning in Phrap CAP and Local Assemblies In a contig assembled by the ambiguity character the indicates Example phrap engine phrap s lower confidence in __ 5e the quality of the base atthat oo tsaagagTTTAC E position APETIT ambiguity AGGGG character SAATAAL aG 5 ABAGAGTTTAG CAP or local engine any mismatch in the aligned pa fragments TTAnAGACETAAATI k ambiguity MTAAAGACTTAAAT Character ITTANAGACTTAAAT TTA AGACCTAAAT Page 30 of 40 Release Notes New Features in AutoAssembler v 2 1 Known Problems Future Release Printing Smooth Peak Shapes Searching and Opening Assemblies in the Assembly Browser Assembly Sequence Status A future release of the software will address these problems We apolog
14. Release Notes New Features in AutoAssembler v 2 1 1998 Updated 02 2001 SUBJECT AutoAssembler DNA Sequence Assembly Software v 2 1 Summary of New These are the new features in the version 2 1 release of the Features AutoAssembler software Installation from CD ROM see page 3 Inclusion of IUPAC IUB ambiguity codes in the consensus sequence see page 22 Client support for the BioLIMS 2 0 database on an Oracle7 Database Server and on a Sybase SQL Server see page 7 Complete integration with the BioLIMS 2 0 database including saving of assembly projects to the database see page 14 An enhanced BioLIMS Chooser that replaces the Sequence Chooser and permits searches for collections and assembly projects in the BioLIMS database see page 8 Integration of AutoAssembler with the phrap assembly engine and the BioLIMS database see page 25 If you are upgrading from AutoAssembler v 1 X to AutoAssembler v 2 1 software these features incorporated in version 2 0 will be new to you The CAP v 2 engine which is twice as fast as the local CAP v 1 algorithm Support for AppleScript commands Applied KS Biosystems In These Release These release notes supplement the ABI PRISM AutoAssembler DNA Notes Sequence Assembly Software v 2 0 User s Manual P N 904947 New features and configuration instructions that are not documented in the user s manual are described here Topics i
15. able search text boxes criteria are explained in detail in the table on page 12 IMPORTANT Search criteria are combined using the logical AND operation That is only those assemblies that match each and every criterion you specify are returned IMPORTANT Narrowing the search criteria makes the search process faster as there is less query time on the database Release Notes New Features in AutoAssembler v 2 1 Page 11 of 40 Item Description Split bar Drag on this bar to alter the amount of space allocated to the top and bottom portions of the Assembly Browser window Search results After a successful query assemblies found are listed in this area The assembly name owner date assembled algorithm and status are displayed The assemblies are Sorted alphabetically numerically by name Prefaced by the assembly icon El Status line Error messages and other important information are reported here For example the status line shows how many assemblies were found in a search Assembly Search Criteria These are the criteria by which you can search for assemblies in the BioLIMS database Assembly Search Criteria Pop up Menu Criterion Choices Allowed Text Description Assembly is Up to 255 Name of the Name starts with characters assembly ends with including letters c ntains numbers and punctuation Assembly is Up to 255 Name of the Owne
16. ater System Disk Space Approximately 6MB of free disk space Memory The suggested memory allocation is 10MB of RAM random access memory RAM System Recommendations System Component Recommendations Monitor A 17 inch monitor or larger is recommended Although a monitor of 640 x 480 resolution can be used you will benefit from having a monitor of higher resolution Printer A PostScript compatible color printer is recommended e g HP DeskJet 1600CM and 1200C PS printers Release Notes New Features in AutoAssembler v 2 1 Page 3 of 40 Installing Before you begin installing the AutoAssembler software please do the following Check that you have at least 5MB of free disk space to accommodate the AutoAssembler software Quit all open programs Turn off any virus protection software that you may have running To install AutoAssembler software from CD ROM Step Action 1 Insert the AutoAssembler 2 1 CD ROM into the computer s CD ROM drive 2 Double click the AutoAssembler Installer icon as Auto assembler Installer 3 When the Installer start up screen appears choose Continue The About AutoAssembler dialog box appears 4 This dialog box contains important information that you should read You may print or save the contents if you want After you have read About AutoAssembler 2 1 click Continue to open the AutoAssembler Installer window 5 Check that the pop
17. cess the Applied Biosystems Technical Support Web site 2 Under the Troubleshooting heading click Support Request Forms then select the relevant support region for the product area of interest 3 Enter the requested information and your question in the displayed form then click Ask Us RIGHT NOW blue button with yellow text 4 Enter the required information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive an e mail reply to your question from one of our technical experts within 24 to 48 hours Release Notes New Features in AutoAssembler v 2 1 Page 37 of 40 To Obtain Documents on Page 38 of 40 Demand our Web site Free 24 hour access to Applied Biosystems technical documents including MSDSs is available by fax or e mail or by download from To order documents Then by index a Access the Applied Biosystems Technical Support number Web site at http Awww appliedbiosystems com techsupp b Click the Index link for the document type you want then find the document you want and record the index number c Use the index number when requesting documents following the procedures below by phone for a From the U S or Canada call 1 800 487 6809 or fax delivery from outside the U S and Canada call 1 858 712 0317 b Follow the voice instructions to order the documents you want Note There is a limit of five documents per
18. formation about the Assembly Browser window see page 10 Note If the sequences in the project are stored in the BioLIMS database then the assembly project is also saved to the database When AutoAssembler is in BioLIMS mode the assembly project cannot be saved to a local file Saving an Note Unusual Macintosh characters can create problems We Assembly Project recommend restricting assembly and owner names to letters numbers periods full stops and underscore characters To save a project to the BioLIMS database Step Action 1 The first time you choose to save a new project with Save from the File menu or if you choose to Save As or Save a Copy In a box like this appears Server SYBASE Database biolims2 Owner Save this assembly as 2 Enter a name in the Owner box This is usually your own name An owner name is suggested if you are saving as or saving a copy as Page 14 of 40 Release Notes New Features in AutoAssembler v 2 1 To save a project to the BioLIMS database continued Step Action 3 Enter a name for the assembly in the Save this assembly as box 4 Choose Save to save the assembly project to the BioLIMS database When a Phrap When an assembly project is saved a collection with the same name Assembly Is Saved as the assembly project is created in the root directory and references to all the sequence
19. ize for any inconvenience they may cause Printing electropherograms with between 1000 and 1400 points per panel may result in peak shapes that do not appear smooth To avoid this select less than 999 points per panel or greater than 1400 points per panel The default is 1500 points per panel Opening an assembly from the Assembly Browser in BioLIMS mode takes significantly longer than opening an assembly in file mode If your database is very large searching for assemblies and sequences may also be slow The Sequence Status search criteria in the Collection Browser window includes the status assembly AutoAssembler software does not assign the assembly status to sequences The assembly item will be removed from the Sequence Status menu in the next release of software Release Notes New Features in AutoAssembler v 2 1 Page 31 of 40 Fixed Bug Don t Save Option In the AutoAssembler v 2 0 Program if you edited bases of a Is Back for sequence from within the sequence window in Electropherogram view or Sequence view the edits took effect immediately because when the sequence window closed the sequence edits were always saved to the project or to the sequence file and the project file Sequence Edits This problem is resolved in the AutoAssembler v 2 1 program When you close an edited sequence window the following alert box appears You can choose not to save changes to the sequence file Save changes to the Au
20. ly Software v 2 0 User s Manual P N 904947 When the Browser There are three reasons to access the browser windows from within Windows Are Used the AutoAssembler program Adding new sequences to a project from the BioLIMS database Collection Browser Opening an existing assembly in the BioLIMS database Assembly Browser See Saving an Assembly Project on page 14 Selecting assemblies for AutoUpdate Assembly Browser See Saving an Empty Assembly and Updating It on page 16 The Collection Use the Collection Browser window to search for and add sequences Browser Window _ to assembly projects The Collection Browser window opens when Connection to a BioLIMS database is open and Add Sequence s from BioLIMS or Add Multiple from BioLIMS is selected from the Project menu The Collection Browser window works the same way as the Sequence Chooser window in AutoAssembler v 2 0 A detailed description can be found in Adding Sequences From the BioLIMS Database on pages 3 12 to 3 24 of the ABI PRISM AutoAssembler DNA Sequence Assembly Software v 2 0 User s Manual P N 904947 One new search criterion has been added to the Collection Browser window The Instrument Name identifies the sequencing instrument on which the gel or capillary sample was run This name is set in the General Settings Preferences of the Data Collection software The name can be up to 255 characters and
21. mbler folder yourself Release Notes New Features in AutoAssembler v 2 1 Configuring Your Computer for Access to a BioLIMS Database Introduction Oracle and Sybase Database Compatibility How to Set Up Your Computer The extensions and other support files required for access to a BioLIMS database are not part of the AutoAssembler v 2 1 installation Before you can use AutoAssembler in BioLIMS mode you must install either the BioLIMS Client Software or the BioLIMS Instrument Software For BioLIMS 2 0 the database platform is either an Oracle7 Database Server v 7 3 3 X or a Sybase SQL Server v 11 0 2 The procedure for configuring your computer to connect to a BioLIMS database depends upon the server type Detailed information about how to configure your Macintosh computer for connection to an Oracle based or a Sybase based BioLIMS database and how to troubleshoot problems with database connection is given in the following manuals ABI PRISM BioLIMS Sample2DB Software User s Manual P N 4304072 ABI PRISM DNA Sequencing Analysis Software User s Manual P N 4306158 ABI PRISM BioLIMS Manager Software User s Manual P N 4304073 Release Notes New Features in AutoAssembler v 2 1 Page 7 of 40 Accessing Sequence and Assembly Data in the BioLIMS Database Introduction Switching Between BioLIMS and File Mode Page 8 of 40 There are two browser windows that allow you to view and access da
22. n AutoAssembler v 2 1 Page 5 of 40 Removing AutoAssembler Page 6 of 40 Software This section describes how to remove the AutoAssembler v 2 1 Software from your Macintosh computer The Uninstall process deletes all folders and files installed by the AutoAssembler Installer Note If you have moved AutoAssembler files or folders from their original installed locations they may not be found and deleted by the uninstall operation Also any files that have been added to the application folders such as those created when the applications are run are not deleted by the uninstall operation To remove installed AutoAssembler software Step Action 1 Follow steps 1 4 in the procedure Installing on page 4 to open the AutoAssembler Installer window 2 Select Uninstall from the pop up menu in the upper left corner of the window 3 Choose the Select Folder item on the Install Location pop up menu A Macintosh browser box appears 4 Use the browser box to locate the folder that contains the AutoAssembler folder 5 Click Uninstall to begin the removal of the files from your disk 6 At the conclusion of the remove operation an alert box appears with the message whether or not the remove was successful Note If files have been moved or added to the AutoAssembler folder the remove operation will be reported as unsuccessful you should then examine and delete the remaining files in the AutoAsse
23. n This Document Topic See Page Installation of AutoAssembler v 2 1 Software 3 Configuring Your Computer for Access to a BioLIMS 7 Database Accessing Sequence and Assembly Data in the BioLIMS 8 Database Saving Assemblies to a BioLIMS 2 0 Database 14 Saving a Contig as a Sequence in a BioLIMS Database 19 IUPAC IUB Codes Recognized 22 Phred Phrap Cross_Match BASIS and AutoAssembler 25 BioLIMS only Known Problems 31 Fixed Bug 32 Technical Support 33 Page 2 of 40 Release Notes New Features in AutoAssembler v 2 1 Installation of AutoAssembler v 2 1 Software Introduction AutoAssembler v 2 1 is installed from a CD ROM This section contains information about Power Macintosh computer requirements and recommendations page 3 How to install the AutoAssembler software page 4 How to remove the software page 6 System Below are the system requirements and recommendations for Requirements and running the AutoAssembler v 2 1 on your computer Recommendations Note These are the minimum requirements In general the more memory the larger the screen size and the more processing power you have the better System Requirements System Component Requirements CPU A Power Macintosh PowerPC CPU computer You will benefit from using the fastest computer available CD ROM Drive Any Operating Mac OS version 8 0 with Open Transport 1 1 or l
24. nd bullets Assembly Names Assembly names must conform to UNIX file name rules Common problem characters are slashes and spaces Release Notes New Features in AutoAssembler v 2 1 Page 25 of 40 Setting Phrap as Assembly Method Viewing Phrap Assemblies Page 26 of 40 To set and use phrap for assembly in AutoAssembler v 2 1 Step Action 1 Choose Assembly Setup from the Project menu The following dialog box appears Assembly Setup Assemble GO ft Local Engine phrap phrap Parameters Click phrap IMPORTANT If the phrap icon does not appear the phrap option may not have been installed or the file SAServer Config may be missing from the ABI Folder Occasionally you may want to specify phrap parameters to be passed on to phrap when the program is executed Enter the parameters into the phrap Parameters field Each parameter must be separated from others by a space The format of the individual parameters must comply with phrap s requirements See phrap documentation for more details To set the assembly method to phrap and close the dialog box click OK or To assemble the project using phrap click Submit Phrap assemblies stored in the BioLIMS database can be opened and viewed like other assemblies using the AutoAssembler program in BioLIMS mode One difference is that there are three qualities of phrap data The
25. of the characters in the consensus in one of the following ways To retain the case the characters have in the project window lowercase characters for ambiguous base positions and uppercase characters for all others use the default Mixed To create a consensus sequence with all upper case characters choose UPPER Tocreate a consensus with all lower case characters choose lower Note Itis easier to identify ambiguous base positions in the consensus if you choose Mixed case Click OK A sequence window with the consensus sequence appears SS 08208 188 Contig 1 1 BGGGGGTAAA AACAGGATGT TCCTCTGTCA CCCAGGCTGG AGTGCAATGG 50 51 CAGGTCCATA GCTCACTGCA ACTTCAAACT CCTGGGCTGA AGCAATCCTC 100 101 TTGCCTTAGT CTTTCAAAGC ACTGGGATTA TAGGTGTGAG CCATCATGCC 150 151 TGCCCATCTC TTTACATTTT CATTTCATGT TAATTTTATG CTATCAAATA 200 201 ACATAAAATG GCTCCATAGA TGAAGCCACT TTTGATCTTT CACTCTTTGT 250 251 GGCyAwrrmT dwesmyAskT TTkmCmTwkm AsyCTTkKkyr ryTArGnCyA 300 301 usumytggut dtbchhygby netttbtety ttatbtbhga edchnadrwd 350 351 tbahahdggd sdchagedvh aahvtbdgag vedgagvAgd cdchtetnga 400 401 acaatAghgy bytddgvaGn kgvagvuGtb htbTetevgG CwyTAYAKTk 450 Choose Save from the File menu Release Notes New Features in AutoAssembler v 2 1 To save a contig as a sequence in a BioLIMS database continued Step Action 6 Save the contig sequence to the database
26. one following times Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time Release Notes New Features in AutoAssembler v 2 1 Page 33 of 40 To Contact In North America Technical Support To contact Applied Biosystems Technical Support use the telephone by Telephone or or fax numbers given below To open a service call for other support Fax needs or in case of an emergency dial 1 800 831 6844 and press 1 Page 34 of 40 Product or Product Area Telephone Dial Fax Dial ABI Prism 3700 DNA Analyzer 1 800 831 6844 then press 8 1 650 638 5981 DNA Synthesis 1 800 831 6844 then press 21 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 then press 22 1 650 638 5981 Fluorescent Fragment Analysis includes GeneScan applications 1 800 831 6844 then press 23 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM 877 and Catalyst 800 instruments 1 800 831 6844 then press 24 1 650 638 5981 ABI Prism 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge and SQL GT applications 1 800 831 6844 then press 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then pre
27. r starts with characters person who ends with including letters created the amp contains numbers and assembly punctuation Assembly any Date set with Date assembly Mod Date is arrow buttons was modified before The format is after month day year between Page 12 of 40 Release Notes New Features in AutoAssembler v 2 1 Assembly Search Criteria continued Criterion Pop up Menu Choices Description Assembly any Status of the Status new waiting assembly assembly edit in progress open on another client computer ready for assembly applies to projects waiting to be processed by the phrap assembly engine assembly in progress applies only to projects being assembled by the phrap assembly engine up to date project has been assembled and assembly has been attempted and failed Release Notes New Features in AutoAssembler v 2 1 Page 13 of 40 Saving Assemblies to a BioLIMS 2 0 Database Introduction In the previous version of the AutoAssembler program sequences could be read in from the BioLIMS database but assembled contig data could not be stored in the database it had to be written out to local project files Now using AutoAssembler v 2 1 assembly results can be written to the BioLIMS 2 0 database Use the Assembly Browser window to search for assemblies The terms assembly and assembly project are used interchangeably For more in
28. s that belong to the assembly project are placed in a collection If a collection with that name already exists sequences are added or removed from the collection so that the collection contains only sequences belonging to the assembly project The assembly itself is saved in the root collection Empty Projects Are a Special Case Empty assembly projects are treated as a special case When you save a project that does not contain any sequences the collection with the same name as the assembly is not modified or created This allows you to automate the loading of sequences into an assembly Release Notes New Features in AutoAssembler v 2 1 Page 15 of 40 Saving an Empty Assembly and Updating It Page 16 of 40 To automate loading of sequences into assemblies Step Action 1 Note down the name of the collection that contains the sequences that you want to assemble You can use the BioLIMS Manager program to search for edit or rename this collection In this example the sequences to be assembled are contained in a collection called Test_One v G Test One H Sequence_A Bet Sequence_B Be Sequence_C Be Sequence_D Be Sequence_E Det Sequence_F Open the AutoAssembler program and establish connection to a BioLIMS database Choose New from the File menu to open a new untitled project window o untitled B 0 Sequences From BioLIMS O Sequences Total
29. ss 31 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 then press 32 1 650 638 5981 PCR and Sequence Detection 1 800 762 4001 then press 1 for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 Release Notes New Features in AutoAssembler v 2 1 Product or Telephone Fax Product Area Dial Dial Voyager MALDI TOF 1 800 899 5858 1 508 383 7855 Biospectrometry and then press 13 Mariner ESI TOF Mass Spectrometry Workstations Biochromatography 1 800 899 5858 1 508 383 7855 BioCAD Workstations then press 14 and Poros Perfusion Chromatography Products Expedite Nucleic acid 1 800 899 5858 1 508 383 7855 Synthesis Systems then press 15 Peptide Synthesis 1 800 899 5858 1 508 383 7855 Pioneer and 9050 Plus then press 15 Peptide Synthesizers PNA Custom and 1 800 899 5858 1 508 383 7855 Synthesis then press 15 FMAT 8100 HTS System 1 800 899 5858 1 508 383 7855 and Cytofluor 4000 then press 16 Fluorescence Plate Reader Chemiluminescence 1 800 542 2369 1 781 275 8581 Tropix U S only or 1 781 271 0045 Applied Biosystems MDS 1 800 952 4716 1 650 638 6223 Sciex Outside North America Telephone Fax Region Dial Dial Africa and the Middle East Africa English Speaking 27 11 478 0411 27 11 478 03
30. ssembly Browser Ej Select criteria hd Select an Assembly to Open Search criteria Assembly Name contains v J pop up menus Assembly Owner contains bd and text boxes Assembly Mod Date ani bad K Assembly Status is any hei Split bar Name Owner Assembled Algorithm AATest2 Jane Jun 15 1998 02 27 24 PM CAP1 afs J assembly example JNCD Jun 15 1998 02 27 24 PM CAPI AutoUpdateCollection Jane Jun 15 1998 04 50 52 PM CAPI Search judy_assembly judy Jun 29 1998 02 32 08 PM cap results ox208_Assembly Jane Jun 12 1998 05 09 56 PM CAPI ox_data JNCD Jun 15 1998 02 27 24 PM CAP1 T11 M467 Jane Jun 15 1998 04 58 28 PM CAP1 TestAssembly Jane Jun 12 1998 05 05 09 PM phrap J X2384 Assembly Jane Jun 12 1998 05 12 35 PM CAPI Status line E 9 assemblies found Function of the Window Parts This table describes the six parts of the Assembly Browser window see the figure on page 11 Item Description Select Criteria Use this pop up menu to specify which search pop up menu criteria are visible in the Assembly Browser window Note The search results are the same whether a criterion is invisible or blank and visible Search button Click this button to query the BioLIMS database This button is the default Pressing the Return key also begins a search Search criteria Use these pop up menus and text boxes to define pop up menus and your BioLIMS database query The avail
31. ta in the BioLIMS database They are the Collection Browser and the Assembly Browser windows The browser windows are accessible only when the AutoAssembler program is in BioLIMS mode that is when there is an open connection to the BioLIMS database IMPORTANT In AutoAssembler v 2 1 you can only switch between BioLIMS mode and file mode when there are no projects open To switch between BioLIMS mode and file mode Step Action 1 Close any open projects 2 Select BioLIMS Access from the Edit menu Settings Statistics Settings AutoUpdate Settings BioLIMS Access Quality Display Settings Show Clipboard This opens the BioLIMS Access Information box Biolims Access Information Username MyUsertame Password O Save Password Database biotims2 Server SYBASE Alias Sybase jia O Open on Launch O Make Default This connection is currently closed Open Cancel When the connection to the database is AutoAssembler is in closed file mode open BioLIMS mode Release Notes New Features in AutoAssembler v 2 1 To switch between BioLIMS mode and file mode continued Step Action 3 To open a database connection fill in the username password database and server fields For more information about database connection see page 3 13 of ABI PRISM AutoAssembler DNA Sequence Assemb
32. toAssembler 2 1 document ox208 04 short before closing Page 32 of 40 Release Notes New Features in AutoAssembler v 2 1 Technical Support Contacting You can contact Applied Biosystems for technical support by Technical Support telephone or fax by e mail or through the Internet You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section To Obtain Documents on Demand following the telephone information below To Contact Contact technical support by e mail for help in the following product Technical Support areas by E Mail Product Area E mail address Genetic Analysis DNA Sequencing galab appliedbiosystems com Sequence Detection Systems and PCR pcrlab appliedbiosystems com Protein Sequencing Peptide and DNA Synthesis corelab appliedbiosystems com Biochromatography PerSeptive DNA PNA and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers tsupport appliedbiosystems com LC MS Applied Biosystems MDS Sciex apisupport sciex com or api3 support sciex com Chemiluminescence Tropix tropix appliedbiosystems com Hours for Technical Support In the United States and Canada technical support is available at the Teleph
33. utoAssembler v 2 1 Page 27 of 40 Page 28 of 40 The Phrap Display Setting Dialog Box The defaults for the data quality ranges are given in the table page 27 To alter the quality ranges Step Action 1 Choose Quality Display Settings from the Edit menu The following dialog box appears Quality Display Settings SB Low quality data has phred scores from zero through Fair quality data has phred scores above the low quality limit through Good quality data has phred scores above the fair quality limit 2 Edit the Low quality and Fair quality fields Values of 0 100 are allowed 3 Click OK to save the Quality Display Settings and close the dialog box Release Notes New Features in AutoAssembler v 2 1 Overriding Phrap AutoAssembler v 2 1 software allows you to override the phrap Consensus with consensus sequence contig without changing the individual AutoAssembler sequence records that make up the assembly Follow the steps in the table below to edit a contig by overriding the phrap consensus for a given basecall To designate as consensus Step Action 1 In Alignment view select a base or range of bases in a fragment sequence a GGAGGAAATT GG644644 4T 6644644442 Select AGAAAA in fragment GG4564544TT To enter alignment view choose the alignment button ira in the bottom left of the project window Choose Designate as Consensus from the Edit menu
Download Pdf Manuals
Related Search