Home

Mentype - Biotype

1. 80 30 100 110 120 130 140 150 160 80 30 100 110 120 130 140 150 160 80 30 100 110 120 130 140 150 160 80 30 100 110 120 130 140 150 160 4200 DNA Size Standard 550 BTO Fig 6 Electropherogram of the Mentype DIPplex using 200 pg Control DNA XY5 Analysis was performed on an ABI PRISM 3130 Genetic Analyzer with the DNA Size Standard 550 BTO Allele assignment was performed using the GeneMapper ID Software and the Mentype DIPplex template file Mentype DIPplex December 2009 30 Figure 7 130 140 150 160 2000 1600 DNA Size Standard 550 BTO 400 Fig 7 Electropherogram of the allelic ladder Mentype DIPple analysed on an ABI PRISM 3130 Genetic Analyzer with the DNA Size Standard 550 BTO Allele assignment was performed using the GeneMapper ID Software and the Mentype DIPplex template file Mentype DIPplex December 2009 Table 4 Fragment lengths of the allelic ladder Mentype DIPplex analysed on an ABI PRISM 310 3130 Genetic Analyzer blue and green panel Marker Blue DIP bp DIP bp Marker Green DIP bp DIP bp AM 77 80 Y HLD118 77 81 HLD77 84 88 HLD92 87 90 HLD45 92 96 HLD93 98 103 HLD131 100 113 HLD99 108 113 HLD70 104 108 HLD88 118 128 118 134 HLD101 131 135 HLD111 122 126 HLD67 140 147 HLD58 136 140 HLD56 144 149 Table 5 Fragment lengths of the allelic ladder Mentype DI
2. Cool down to 4 C For analysis load the samples on the tray Since injections take place simultaneously on all capillaries 4 or 16 samples must be pipetted on the plate of multi capillary analysers If fewer samples are analysed the empty positions must be filled with 12 uL Hi Di Formamide To ensure a reliable allelic assignment on multi capillary analysers several ladders should be run Room temperature may influence the performance of PCR products on multi capillary instruments so that shoulder peaks or split peaks occur especially at low temperatures Pay attention to keeping ambient conditions as recommended by the instrument manufacturer Signal intensities Options to increase the signal intensity Reduce the volume of the DNA Size Standard 550 BTO to peak heights of about 500 relative fluorescent units RFU Purify the PCR products before starting the analysis Mentype DIPplex December 2009 4 3 Setting up the GeneScan software Edit the default run module in Dye Set G5 once for the first run Select Module Editor to open the dialog box Select the appropriate Run Module as template from the GeneScan table Modify the Injection Voltage to 3 kV and the Injection Time to 10 s Run Module 3kV_10s_260bp Parameter Set up Run Temperature C Default Cap Fill Volume Default Maximum Current A Default Current Tolerance A Default Run Current A Default Voltage Tolerance kV Default Pre Run Volt
3. Click into the column header to select the entire column and select Edit Fill Down to apply the information of the selected samples Link your reaction plate on the autosampler tray with the created plate ID and start the run On completion of the run view data as Color Data in Array View of the 3100 Data Collection software or as Analyzed Sample Files under D AppliedBio 3100 DataExtractor ExtractRuns 4 4 Analysis parameter The recommended analysis parameters are Analysis Range Start 2200 Stop 6000 Data Processing Baseline Checked Multicomponent Checked Smooth Options Light Peak Detection Peak Amplitude Thresholds Bir wu G 0 Min Peak Half Width 2 pts Polynominal Degree 3 Peak Window Size 11 pts Size Call Range Min 60 Max 550 Size Calling Method Local Southern Method Split Peak Correction None The peak amplitude threshold cutoff value corresponds to the minimum peak height that will be detected by the GeneScan or GeneMapper ID software Thresholds are usually 50 200 RFU and should be determined individually by the laboratory Recommendation The minimal peak height should be three times as high as the background noise of the baseline Mentype DIPplex December 2009 5 Electrophoresis using the ABI PRISM 3130 3130xI Genetic Analyzer For detailed instructions on instrument setup spectral calibration or application of the ABI PRISM Data Collection software version 3 0 an
4. DIPplex 25 reactions Cat No 45 31110 0025 Mentype DIPplex 100 reactions Cat No 45 31110 0100 Mentype DIPplex 400 reactions Cat No 45 31110 0400 Storage Store all components at 20 C and avoid repeated thawing and freezing Primer mix and allelic ladder must be stored protected from light The DNA samples and post PCR reagents allelic ladder and DNA size standard should be stored separately from the PCR reagents The expiry date is indicated on the kit cover Additionally required reagents Additional reagents are needed in order to use the Biotype PCR Amplification Kit Reagent Supplier Order Number Hi Di Formamide 25 mL Applied Biosystems 4311320 Matrix Standards BT5 single capillary instruments 5x25 pL Biotype Diagnostic GmbH 00 10411 0025 Matrix Standards BT5 multi capillary instruments 25 ul Biotype Diagnostic GmbH 00 10421 0025 Matrix Standards BT5 multi capillary instruments 50 Biotype Diagnostic GmbH 00 10421 0050 Mentype DIPplex December 2009 Warning and safety instructions The PCR Amplification Kit contains the following potentially hazardous chemicals Kit component Chemical Hazards Primer mix reaction mix Sodium azide NaN toxic if swallowed develops toxic gases and allelic ladder when it gets in contact with acids Observe the Material Safety Data Sheets MSDS for all Biotype products which are available on request Please contact the respective manufacturers for copies of the
5. HLD70 HLD6 HLD111 HLD58 HLD56 HLD118 HLD92 HLD93 HLD99 HLD88 HLD101 HLD67 HLD83 HLD114 HLD48 HLD124 HLD122 HLD125 HLD64 HLD81 HLD136 HLD133 HLD97 HLD40 HLD128 HLD39 HLD84 The reference DNA K 562 is available from ATCC http atcc org Produtcs PurifiedcDNA cfm celllines DNA 9947A 9948 and 3657 are available from Coriell Cell Repositories CCR http locus umdnj edu nigms that is up to standard of Szibor et al 2003 Mentype DIPplex December 2009 28 6 3 Lengths of fragments and alleles Table 4 to table 5 show the fragment lengths of individual alleles that refer to the DNA Size Standard 550 BTO All analyses have been performed on an ABI PRISM 310 3130 Genetic Analyzer with POP 4 polymer Different analysis instruments DNA size standards or polymers may result in different fragment lengths In addition a visual alignment with the allelic ladder is recommended Scaling Horizontal 70 205 bp Vertical Depending on signal intensity Mentype DIPplex December 2009 29 Figure 6 80 30 100 110 120 130 140 150 160
6. Prepare 12 uL of the mix formamide DNA size standard for all samples Add 1 uL PCR product diluted if necessary or allelic ladder Denaturation for 3 min at 95 C Cool down to 4 C For analysis load the samples on the tray Signal intensities Options to increase the signal intensity Reduce the volume of the DNA Size Standard 550 BTO to peak heights of about 500 relative fluorescent units RFU Purify the PCR products before starting the analysis 3 3 Setting up the GeneScan software Create a Sample Sheet and enter a sample designation Injection list Parameter Set up Module File GS STR POP 4 1 mL G5 Matrix File e g Matrix BT5 Size Standard e g SST BTO_60 200bp Injection s 5 Injection kV 15 0 Run kV 15 0 Run C 60 Run Time min 20 Deviating from the standard settings the injection time may range between 1 and 10 s depending on the type of sample If samples with very high signal intensities are recorded a shorter injection time may be selected For samples with low DNA content an injection time up to 10 s may be necessary Depending on the analysis conditions the run time for Mentype DIPplex was modified in order to be able to analyse fragments with lengths of up to 200 bp Mentype DIPplex December 2009 3 4 Analysis parameter The recommended analysis parameters are Analysis Range Start 2000 Stop 6000 Data Processing Baseline Checked Multicomponent Checked Smoo
7. click on New in the Instrument Protocol window to open the Protocol Editor dialog box Instrument Protocol Protocol Editor Set up Name Run36 4 BT5 15min Type REGULAR Run Module 10s 260bp Dye Set Any5Dye parameter see above Click on OK to exit the Protocol Editor Mentype DIPplex December 2009 23 Prior to each run it is necessary to create a plate definition as follows In the Plate Manager of the Data Collection software click on New to open the New Plate Dialog box GeneMapper Plate Editor I New Plate Dialog Set up Name e g Plate_BT5_Date Application Select GeneMapper Application Plate Type 96 Well Owner Name Operator Name Click on OK A new table in the Plate Editor will open automatically GeneMapper Plate Editor II Parameter Set up Sample Name Enter name for the samples Priority e g 100 Default Sample Type Sample or allelic ladder Size Standard e g SST BTO 60 260bp Panel e g DlPplex Panels v0 Analysis Method e g DiPplex 3130 200rfu Snp Set User defined 1 3 Results Group 1 select results group Instrument Protocol 1 Run36 POPA BT5 15min setting described before Click into the column header to select the entire column select Edit Fill Down to apply the information to all selected samples and click on OK n the Run Scheduler click on Find All select Link to link the reaction plate on the autosampler up with the newly created plate rec
8. 2 Sample rima be UTE m nnn E DI ER IER re COAT 15 4 3 Setting up the GeneScan software see 16 4 4 Analysis parameter coa ecoute te e 17 5 Electrophoresis using the ABI PRISM 3130 3130xI Genetic Analyzer 18 5 1 Spectral calibration matrix generation seen 18 5 2 Sample preparation oce doa ria rta Febris SEXE ERA GE RR Free 21 5 3 Setting up the GeneMapper ID software 22 5 4 Analysis parameter analysis method DIPplex 24 PMG SIS EROR DRE o NE URP 25 6 1 Biotype template 26 DLE COMMONS det CR 27 6 3 Lengths of fragments and 28 f Interpretation of 5 tici prag EE 32 SAn EEIE SNN DD Dr n dee EA 33 Mentype DIPplex December 2009 1 Description of the Mentype DIPplex Table 2 Locus specific information of Mentype DIPplex DIP Locus DIPplex Blue AM X AM Y HLD77 HLD45 HLD131 HLD70 HLD6 HLD111 HLD58 HLD56 DIPplex Green HLD118 HLD92 HLD93 HLD99 HLD88 HLD101 HLD67 DIPplex Yellow HLD83 HLD114 HLD48 HLD124 HLD122 HLD125 HLD64 HLD81 DIPplex Red HLD136 HLD133 HLD97 HLD40 HLD128 HLD39 HLD84 Chromosomal Localisation SNP ID Xp22 1 22 3 M55418 Yp11 2 M55419 7931 1
9. Cool down to 4 C For analysis load the samples on the tray Create a Sample Sheet and enter a sample designation Mentype DIPplex December 2009 Injection list for matrix generation Parameter Set up Module File GS STR POP 4 1 mL G5 Matrix File NONE Size Standard NONE Injection s 5 Injection kV 15 0 Run kV 15 0 Run C 60 Run Time min 24 Prepare matrix standards always without DNA Size Standard BTO Analysis of the matrix samples Run the GeneScan software File gt New Project open folder of current run Add Sample Files Select a matrix sample in the Sample File column Sample Raw Data Check the matrix samples regarding a flat baseline As shown the figure below there should be at least five peaks with peak heights about 1000 4000 Y axis for each matrix sample optimal range 2000 4000 3 7 1 Edit Project Sample Settings View Windows Help 8 x 3000 3600 I 3200 Data Points X 7 IW Y bf Fig 1 Electropherogram with raw data of the matrix standard 6 FAM Select an analysis range with flat baseline and re inject the matrix sample if necessary Note down start and end value data points of the analysis range e g start value 3200 end value 5500 Calculate the difference e g 5500 3200 2300 data points Mentype DIPplex December 2009 Generati
10. O with the new matrix f calibration was not successful use the optimised values and repeat the calibration run f all capillaries have passed the test the last calibration file for the Dye Set AnybDye is activated automatically in the Spectral Viewer Rename the calibration file e g BT5 Date of calibration using the respective button Mentype DIPplex December 2009 21 5 2 Sample preparation Component Volume Hi Di Formamide 12 0 uL DNA Size Standard 550 BTO 0 5 uL Prepare 12 uL of the mix formamide DNA size standard for all samples Add 1 uL PCR product diluted if necessary or allelic ladder Denaturation for 3 min at 95 C Cool down to 4 C For analysis load the samples on the tray Since injections take place simultaneously on all capillaries 4 or 16 samples must be pipetted on the plate of multi capillary analysers If fewer samples are analysed the empty positions must be filled with 12 uL Hi Di Formamide To ensure a reliable allelic assignment on multi capillary analysers several ladders should be run Room temperature may influence the performance of PCR products on multi capillary instruments so that shoulder peaks or split peaks occur especially at low temperatures Pay attention to keeping ambient conditions as recommended by the instrument manufacturer Signal intensities Options to increase the signal intensity Reduce the volume of the DNA Size Standard 550 BTO to peak heights
11. at the 3 end of the amplified DNA fragments The artefact peak is one base shorter than expected 1 peaks All Biotype primers are designed to minimise these artefacts Artefact formation is further reduced by the final extension step of the PCR protocol at 68 C for 60 minutes Peak height of the artefact correlates with the amount of DNA Laboratories should define their own limits for analysis of the peaks Artefacts Room temperature may influence the performance of PCR products on multi capillary instruments so that shoulder peaks or split peaks occur Especially at low temperatures loci HLD77 HLD118 HLD92 HLD114 HLD136 und HLD40 are known to display such kind of artefacts If shoulder or split peaks appear we recommend injecting the sample again Outside the allelic range gt 170 bp amplification artefacts with very low signal intensity may occur Mentype DIPplex December 2009 33 8 References Bar W Brinkmann B Budowle B Carracedo A Gill P Lincoln P Mayr W Olaisen B 1997 DNA recommendations Further report of the DNA Commission of the ISFG regarding the use of short tandem repeat systems nt J Legal Med 110 175 176 Gill P Brenner CH Buckleton JS Carracedo A Krawczak M Mayr WR Morling N Prinz M Schneider PM Weir BS 2006 DNA Commission of the International Society of Forensic Genetics ISFG Recommendations on the interpretation of mixtures Forensic Sci Int Jul 13 160 2 3 90 101
12. of about 500 relative fluorescent units RFU Purify the PCR products before starting the analysis Mentype DIPplex December 2009 22 5 3 Setting up the GeneMapper ID software Edit the run module as follows for the first run In the Module Manager of the Data Collection software click on New to open the Run Module Editor dialog box Run Module 3kV_10s_260bp Parameter Set up Oven Temperature C Default Poly Fill Volume Default Current Stability uA Default PreRun Voltage kV Default PreRun Time s Default Injection Voltage kV 3 0 Injection Time s 10 Voltage Number of Steps Default Voltage Step Interval Default Data Delay Time s Default Run Voltage kV Default Run Time s 900 Apart from standard settings the injection time may range between 1 and 20 s depending on the type of sample If samples with very high signal intensities are to be recorded a shorter injection time may be selected For samples with low DNA content an injection time up to 20 s may be necessary Depending on the analysis conditions the run time for Mentype DIPplex was modified in order to be able to analyse fragments with lengths of up to 200 bp Click on Save As enter the name of the new module e g 10s 260bp and confirm with OK To exit the Run Module Editor click on Close Starting the run Place the prepared 96 well plate on the autosampler tray In the Protocol Manager of the Data Collection software
13. rs1611048 2431 1 52307959 7936 2 rs1611001 6q16 1 52307652 16013 rs1610905 17p11 2 51305047 50141 51610937 4025 52308292 20p11 1 rs16438 11q22 2 rs17174476 12q22 rs2307570 14q23 1 rs2308163 9q22 32 rs8190570 15q26 1 rs2307433 5033 2 rs1305056 8p22 rs2308072 17p13 3 rs2307581 2011 2 528369942 22012 3 rs6481 21022 11 58178524 22q11 23 rs16388 5q12 3 rs1610935 7921 3 517879936 22013 1 516363 3 22 1 52067235 13q12 3 1817238892 1932 3 rs2307956 1431 3 52307924 1p22 1 517878444 802412 53081400 GenBank Accession Motive DIP TAAG CACG TGGGCTTATT AGCA GCAGGACTGGGCACC CACA AGGA TAAGT CCCCA GTIT ACTIT TGAT CCACAAAGA GTAG CTACTGAC AAGG TCCTATTCTACTCTGAAT GACTT GTGGA GAAGTCTGAGG ATTGCC GACAAA GTAAGCATTGT TGTIT CAACCTGGATT AGAGAAAGCTGAAG GGGACAGGTGGCCACTAGGAGA ATTAAATA CCTAAACAAAAATGGGAT CTTTC Abbreviations HLD Human Locus DIP DIP Deletion DIP Insertion Table 2 shows the DIP loci of the Mentype DIPplex their chromosomal localisation GenBank SNP ID number motive and respective reference allele Mentype DIPplex December 2009 Reference Allele DIP DIP DIP DIP DIP Content Mentype DIPplex PCR Amplification Kit 100 Reactions Nuclease free water 3 0 mL Reaction mix A 500 uL Primer mix 500 uL DNA polymerase 60 uL Control DNA XY5 10 uL DNA Size Standard 550 BTO 50 uL Allelic ladder 25 uL Ordering information Mentype
14. A If individual capillaries are labelled X refer to AB PRISM Genetic Analyzer User s Manual Click on OK to confirm completion of the run Mentype DIPplex December 2009 Matrix check Select Tools Display Spectral Calibration Dye Set G5 to review the spectral calibration profile for each capillary The quality value Q value must be greater than 0 95 and the condition number C value must be between 1 and 20 Both values must be within the previously determined range Check the matrix samples for a flat baseline There should be five peaks with peak heights of about 1000 5000 Y axis in each matrix sample optimal range 2000 4000 Check the new matrix with your current samples There should be no pull up peaks between the dye panels B G Y R 0 with the new matrix f calibration was not successful try to change the Sensitivity and Quality values the parameter file as described above f all capillaries have passed the calibration the last calibration file for Dye Set G5 must be activated manually under Tools Set Active Spectral Calibration Rename the calibration file under Set Matrix Name e g BT5 Date of calibration 4 2 Sample preparation Component Volume Hi Di Formamide 12 0 uL DNA Size Standard 550 BTO 0 5 uL Prepare 12 uL of the mix formamide DNA size standard for all samples Add 1 uL PCR product diluted if necessary or allelic ladder Denaturation for 3 min at 95 C
15. Il Parameter Set up Sample Name Enter name for the matrix samples Priority e g 100 Instrument Protocol 1 Spectral36_POP4_BT5 setting described before Click into the column header to select the entire column select Edit Fill Down to apply the information to all selected samples and click on OK n the Run Scheduler click on Find All select Link to link the reaction plate on the autosampler up with the newly created plate record position A or B and start the run GA Instruments gt ga3130 gt 3130 1 gt Spectral Viewer 3000 Intensity vs Scan Number Capillary Data Mon May 25 09 21 23 CEST 2009 0 Ree X B AD1 Dye Set AnySDye Active Calibration for Dye Set AnySDye Matrix used for Capillary 4 4 Mon May 25 09 21 23 CEST 2009 Condition 6 937256 Q Value 0 978649 List of Calibrations for Dye Set AnySDye Mon May 25 09 21 23 CEST 2009 Fig 4 Electropherogram of spectral calibration with matrix standard BT5 on an ABI 3130 Matrix check The quality value Q value of each capillary must be greater than 0 95 and the condition number range C value must be between 1 and 20 Check the matrix samples for a flat baseline As shown in the figure above there should be five peaks with peak heights of about 1000 5000 Y axis in each matrix sample optimal range 2000 4000 Check the new matrix with your current samples There should be no pull up peaks between the dye panels B G Y R
16. MSDS for any additionally needed reagents Quality assurance All kit components undergo an intensive quality assurance process at Biotype Diagnostic GmbH The quality of the test kits is permanently monitored in order to ensure unrestricted usability Please contact us if you have any questions regarding quality assurance Trademarks and patents Mentype is a registered trademark of Biotype Diagnostic GmbH ABI PRISM GeneScan Genotyper GeneMapper and Applied Biosystems are registered trademarks of Applied Biosystems Inc or its subsidiaries in the U S and certain other countries 6 FAM POP 4 and Hi Di are trademarks of Applied Biosystems Inc GeneAmp is a registered trademark of Roche Molecular Systems The PCR is covered by patents Patentees are Hoffmann La Roche Inc and F Hoffmann La Roche Roche GenBank is a trademark of National Institute of Health Mentype DIPplex December 2009 6 Protocols for PCR amplification electrophoresis and analysis 2 PCR amplification 2 1 Master mix preparation The table below shows the volumes of all PCR reagents per 25 uL reaction volume including a sample volume of 1 0 uL template DNA The number of reactions to be set up shall be determined taking into account positive and negative control reactions Add one or two reactions to this number to compensate the pipetting error Component Volume Nuclease free water 13 4 uL Reaction mix A 5 0 uL Primer mix 5 0 uL M
17. Mentype DIPplex pce ampiitication Product description Human identification is commonly based on the analysis of short tandem repeats STRs or single nucleotide polymorphisms SNPs depending on the demands of an examination or on the sample quality While being able to merge the advantages of both STRs and SNPs biallellic Deletion Insertion Polymorphisms DIPs have yet substantial capability regarding identification in forensics or paternity analysis The Mentype DIPplex PCR Amplification Kit was developed for multiplex amplification of 30 DIPs and Amelogenin The primers are fluorescence labelled with 6 FAM BTG BTY or BTR In order to resort genotypes for easy interpretation of the results it is recommended to use the special freeware DIPSorter DIP loci with short amplicon length have substantial benefits to analyse degraded samples with respect to forensic applications Therefore the maximal amplicon length within the Mentype DIPplex was restricted to 150 bp A further advantage of DIPs is the absence of stutter peaks which makes them suitable for mixed stain analyses Furthermore the 30 DIPs are distributed over 19 autosomes that are at least 10 Mbp away from any commercially available STR and SNP marker see Tab 1 Hence in combination with standard markers the new DIP markers improve the discrimination power and provide a potential supplementation for paternity analyses The detection limit of Mentype DIPplex is ab
18. Mills RE Luttig CT Larkins CE Beauchamp A Tsui C Pittard WS Devine SE 2006 An initial map of insertion and deletion INDEL variation in the human genome Genome Res 16 9 1182 1190 2006 Sanchez JJ Phillips C Bersting C Balogh K Bogus M Fondevila M Harrison CD Musgrave Brown E Salas A Syndercombe Court D Schneider PM Carracedo A Morling N 2006 A multiplex assay with 52 single nucleotide polymorphisms for human identification Electrophoresis 2006 May 27 9 1 713 24 Weber JL David D Heil J Fan Y Zhao C Marth G 2002 Human diallelic insertion deletion polymorphisms Am J Hum Genet 71 4 854 862 Mentype DIPplex December 2009 34 Notes Mentype DIPplex December 2009 Notes Mentype DIPplex December 2009 35 36 Notes Mentype DIPplex December 2009
19. Pplex analysed on an ABI PRISM 310 3130 Genetic Analyzer yellow and red panel Marker Yellow DIP bp DIP bp Marker Red DIP bp DIP bp HLD83 76 80 HLD136 79 84 HLD114 83 100 HLD133 91 102 HLD48 89 94 HLD97 97 110 HLD124 104 109 HLD40 106 129 HLD122 115 126 HLD128 113 121 HLD125 129 135 HLD39 125 143 HLD64 138 144 HLD84 135 140 HLD81 147 158 rounded to integer Mentype DIPplex December 2009 32 7 Interpretation of results As mentioned above post PCR analysis and automatic allele allocation with suitable analysis software ensure a precise and reliable discrimination of alleles Pull up peaks Pull up peaks may occur if peak heights are outside the linear detection range gt 3000 RFU or if an incorrect matrix was applied They appear at positions of specific peaks in other colour channels typically with lower signal intensities Peak heights should not exceed 3000 RFU in order to prevent pull up peaks Stutter peaks For STR loci the appearance of stutter peaks depends on the sequence of the repeat structure and on the number of alleles In contrast no stutter peaks result from DIP structures so that peak assignment of DNA mixtures is much easier For peak evaluation please see defaults in Genotyper and GeneMapper ID software Template Files Template independent addition of nucleotides Because of its terminal transferase activity the Taq DNA Polymerase tends to add an adenosine radical
20. Support Files Data Collection Support Files CalibrationData Spectral Calibration ParamFiles Select MtxStd Genescan_SetG5 to open the PAR file Change Condition Bounds Range to 1 0 20 0 If calibration was not successful also change Sensitivity to 0 1 and Quality to 0 8 in a second step Select File gt Save As to save the parameter file under a new name e g MtxStd Genescan_SetG5_BT5 par Always use this parameter file for spectral calibration runs using Biotype matrix standards BT5 Plate Editor for spectral calibration 1 Place the 96 well plate on the autosampler tray Run the ABI PRISM 3100 Data Collection software In Plate View click New to open the Plate Editor dialog box Enter a name of the plate Select Spectral Calibration Select 96 Well as plate type and click on Finish Plate editor for spectral calibration 11 Parameter Set up Sample Name Type name for the matrix samples Dye Set G5 Spectral Run Module Default e g Spect36_POP4 Spectral Parameters MtxStd GeneScan_SetG5_BT5 par parameters created before Click into the column header to select the entire column select Edit Fill Down to apply the information of the selected samples and confirm with OK Link your reaction plate on the autosampler tray with the created plate ID and start run On completion of the run check in the Spectral Calibration Result dialog box if all capillaries have successfully passed calibration label
21. age kV Default Pre Run Time s Default Injection Voltage kV 3 0 Injection Time s 10 Run Voltage kV Default Number of Steps Default Voltage Step Interval Default Data Delay Time s Default Run Time min 15 Deviating from the standard settings the injection time may range between 1 and 20 s depending on the type of sample If samples with very high signal intensities are recorded a shorter injection time may be selected For samples with low DNA content an injection time of up to 20 s may be necessary Depending on the analysis conditions the Run Time for Mentype DIPplex was modified in order to be able to analyse fragments with lengths of up to 200 bp Click on Save As enter the name of the new module e g 3kV 10s 260bp and confirm with OK Click on Close to exit the Run Module Editor Starting the run Place the prepared 96 well plate on the autosampler tray Run the ABI PRISM 3100 Data Collection software In Plate View click on New to open the Plate Editor dialog box Enter a name of the plate Select GeneScan Select 96 Well as plate type and click on Finish Mentype DIPplex December 2009 Plate Editor Parameter Set up Sample Name Type name for the samples Dyes 0 Colour Info Ladder or sample Project Name e g 3100_Project1 Dye Set G5 Run Module 3kV_10s_260bp Analysis Module 1 DefaultAnalysis gsp parameter see above Complete the table in the Plate Editor and click on OK
22. alue of the DNA concentration varies depending on the quantification method used so that it may be necessary to adjust the optimal DNA amount Mentype DIPplex December 2009 2 2 PCR amplification parameter Perform a hot start PCR in order to activate the Multi Tag2 DNA Polymerase and to prevent the formation of non specific amplification products The number of cycles depends on the amount of DNA 30 cycles are recommended for all samples For critical stains lt 100 pg DNA it is recommended to increase the number of PCR cycles from 30 to 32 Standard method Recommended for all DNA samples Temperature Time 94 C 4 min hot start for activation of the Multi 2 DNA Polymerase 94 C 30s 61 C 120s 30 cycles 72 C 758 68 C 60 min 10 C oo hold Optional Recommended for stains with small amounts of DNA Temperature Time 94C 4 min hot start for activation of the Multi Taq2 DNA Polymerase 94C 30 s 61 C 120s 32 cycles 72 C 758 68 C 60 min 10 C oo X hold Too small amounts of DNA may result in allelic dropouts and imbalances of the peaks Furthermore unspecific amplification products could appear With increasing numbers of cycles there is the risk of cross contamination caused by minimal amounts of impurities Mentype DIPplex December 2009 3 Electrophoresis using the ABI PRISM 310 Genetic Analyzer For general instructions on instrument setup matrix generation and application of the GeneSc
23. an or GeneMapper ID software refer to the ABI PRISM 310 Genetic Analyzer User s Manual Electrophoresis using the GeneScan software is described below The virtual filter set G5 shall be used for combined application of the five fluorescent labels 6 FAM BTG BTY BTR and BTO the matrix standard will be called BT5 hereinafter Material Capillary 47 cm 50 um green Polymer 310 Genetic Analyzer POP 4 Buffer 10x Genetic Analyzer Buffer with EDTA 3 1 Matrix generation Prior to conducting DNA fragment size analysis with the filter set G5 a matrix with the five fluorescent labels 6 FAM BTG BTY BTR and BTO must be generated Colour Matrix standard Blue B 6 FAM Green G BTG Yellow Y BTY Red R BTR Orange 0 BTO Five electrophoresis runs shall be conducted one for each fluorescent label 6 FAM BTG BTY BTR and BTO under the same conditions as for the samples and allelic ladders of the Biotype test kit to generate suitable matrix files Matrix sample Component Volume Hi Di Formamide 12 0 uL Matrix standard 6 FAM 1 0 uL Hi DiTM Formamide 12 0 uL Matrix sample 2 Matrix standard BTG 1 0 uL Hi Di Formamide 12 0 uL Matrix sample Matrix standard BTY 1 0 uL 1 Hi Di Formamide 12 0 uL Matrix sample 4 Matrix standard BTR 1 0 uL Matrix sample 5 Hi Di Formamide 12 0 uL Matrix standard 1 0 uL Denaturation for 3 min at 95 C
24. cation of DIPSorter please use the recommended Table Settings for displaying and exporting the genotype table from GeneMapper ID Table for 20 Alleles or Genotyper software Vertical Table for 20 Alleles Sample Name Allele 1 Alele2 Allele 20 Export Table from GeneMapper ID software Sample Info Category Peak Peak2 Peak20 E xport Table from Genotyper software Recommended Biotype templates for GeneMapper ID software are Panels DIPplex Panels vO or higher versions BinSets DIPplex Bins vO or higher versions Size Standard SST BTO_60 260bp Analysis Method DIPplex_HID_310_50rfu DIPplex HID 310 200rfu DIPplex HID 3130 50rfu DIPplex HID 3130 200rfu Plot Settings Plots 5dyes Table Settings Table for 20 Alleles Recommended Biotype template files for Genotyper software are DIPplex vO or higher versions General procedure for the analysis 1 Check the DNA size standard 2 Check the allelic ladder 3 Check the positive control 4 Check the negative control 5 Analyse and interpret the sample data Mentype DIPplex December 2009 27 6 2 Controls The Control DNA XY5 of the test kit and other commercially available DNA from standard cell lines represent the following alleles Table 3 Allele determinations of Mentype DIPplex Control ATCC CCR CCR CCR Locus DNAXY5 K 562 9947A 9948 3657 AM XN X X XN XN HLD77 HLD45 HLD131
25. d the GeneMapper ID software refer to the ABI PRISM 9 3130 3130xl Genetic Analyzers Getting Started Guide The system with 4 capillaries is named ABI 3130 and the system with 16 capillaries is named ABI 3130xl The virtual filter set AnybDye shall be used for the combined application of the five fluorescent labels 6 FAM BTG BTY BTR and BTO the matrix standard will be called BT5 hereinafter Material Capillary 36 cm Capillary Array for 3130 31 30xI Polymer POP 4 Polymer for 3130 Buffer 10x Genetic Analyzer Buffer with EDTA 5 1 Spectral calibration matrix generation Prior to conducting DNA fragment size analysis it is necessary to perform a spectral calibration with the five fluorescent labels 6 FAM BTG BTY BTR and BTO for each analyzer The calibration procedure creates a matrix which is used to correct the overlapping of fluorescence emission spectra of the dyes Spectral calibration comprises the following steps Preparation the spectral calibration standards Loading the standards to the 96 well reaction plate one sample per capillary Creating the instrument protocol for spectral calibration Protocol Manager Defining the plate composition in the plate editor Plate Manager Performing a spectral calibration run and checking the matrix Mentype DIPplex December 2009 Setting up the spectral calibration standards Example for 4 capillaries ABI 3130 Component Volume Hi Di Formamide 60 0 uL Matr
26. e baseline All DIPs will be examined by GeneMapper ID software like Amelogenin Mentype DIPplex December 2009 25 6 Analysis For general instructions on automatic sample analysis refer to the GeneScan or GeneMapper ID Software User s Manual Finding the exact lengths of the amplified products depends on the device type the conditions of electrophoresis as well as the DNA size standard used Due to the complexity of some DIP loci determining the size should be based on evenly Mentype DIPplex The DNA Size Standard 550 BTO shall thus be used with the following lengths of fragments 60 80 90 100 120 140 160 180 200 220 240 250 260 280 300 320 340 360 380 400 425 450 475 500 525 and 550 bp 500 100 200 300 Mentype DIPplex The basic template files for the DNA Size Standard 550 BTO was adjusted to 260 bp within the GeneMapper ID software An own created new template could be saved as e g SST BTO_60 260bp and used for further analyses Mentype DIPplex December 2009 6 1 Biotype template files Allele allocation should be carried out with suitable analysis software e g the GeneMapper ID or Genotyper software in combination with the Mentype DIPplex template files from Biotype Template files are available from our homepage or as CD ROM on request In order to resort genotypes for easy interpretation of the results we offer the special freeware DIPSorter For appli
27. ix standard BT5 5 0 uL Load 12 uL of the mix to a 96 well reaction plate e g position A1 D1 Denaturation for 3 min at 95 C Cool down to 4 C Example for 16 capillaries ABI 3130xl Component Volume Hi Di Formamide 204 0 uL Matrix standard BT5 17 0 uL Load 12 uL of the mix to a 96 well reaction plate e g position A1 H1 and A2 H2 Denaturation for 3 min at 95 C Cool down to 4 C Performing a spectral calibration run Place the 96 well plate on the autosampler tray In the Protocol Manager of the Data Collection software click on New in Instrument Protocol to open the Protocol Editor dialog box Instrument Protocol for spectral calibration Protocol Editor Set up Name User e g Spectral36_POP4_BT5 Type SPECTRAL Dye Set 5 Polymer User e g POP4 Array Length User e g 36cm Chemistry Matrix Standard Run Module Default e g Spect36_POP4_1 Depends on the type of polymer and length of capillary used Click on OK to leave the Protocol Editor dialog box In the Plate Manager of the Data Collection software click on New to open the New Plate Dialog box Plate Editor for spectral calibration I New Plate Dialog Set up Name e g Spectral BT5 date Application Spectral Calibration Plate Type 96 Well Owner Name Operator Name Click on OK A new table in the Plate Editor will open automatically Mentype DIPplex December 2009 20 Plate Editor for spectral calibration
28. on of a new matrix File gt New gt Matrix x Select the Matrix Standard Sample Files Number Df Dyes B 6FAM_080204 fsa G BTG_080204 fsa Statat v 080204sa Stata 7 BTR 080204 BT0_080204 fsa StatAt Points 300 Cancel K Fig 2 Matrix sample selection Import matrix samples for all dyes B G Y R 0 Enter a Start At value e g 3200 Enter the calculated difference under Points e g 2300 Click on OK to calculate the new matrix Matrix BT5 mtx Reactions B G ar R 10000 fozoss 259 0 0017 10000 0 0020 o 1944 fo 3619 0 5311 10000 0 0095 o 150 0 0477 02082 10000 Fig 3 New matrix BT5 CJ Se Save the matrix in the matrix folder File Save as e g Matrix BT5 Matrix check Check the new matrix with current samples File New Project open folder of the respective run Add Sample Files Select sample s in the Sample File column Sample Install New Matrix open matrix folder and select new matrix Re analyse your samples There should be no pull up peaks between the dye panels B G Y R O with the new matrix Mentype DIPplex December 2009 3 2 Sample preparation Component Volume Hi Di Formamide 12 0 uL DNA Size Standard 550 BTO 0 5 uL
29. ord position A or B and start the run During the run view Error Status in the Event Log or examine the quality of the raw data for each capillary in the Capillaries Viewer or the Cap Array Viewer View data as overview in Run History or Cap Array Viewer of the Data Collection software Run data are saved in the Run Folder of the previously chosen Result Group Mentype DIPplex December 2009 24 5 4 Analysis parameter analysis method DIPplex The recommended settings in the worksheet Peak Detector are Peak Detection Algorithm Advanced Ranges Analysis Partial Range Start Pt 2200 Stop Pt 6000 Sizing All Sizes Smoothing and Baselining Smoothing Light Baseline Window 51 pts Size Calling Method Local Southern Method Peak Detection Peak Amplitude Thresholds Beo G R 0 Min Peak Half Width 2 pts Polynominal Degree 3 Peak Window Size 11 pts Slope Thresholds 0 0 Recommend settings in the worksheet Allele are Amelogenin Cutoff 0 1 Recommend settings in the worksheet Peak Quality are Heterozygote balance Min peak height ratio 0 1 Allele number Max expected alleles 20 The peak amplitude threshold Cutoff value corresponds to the minimum peak height that will be detected from the GeneMapper ID software The thresholds are usually 50 200 RFU and should be determined individually by the laboratory Recommendation The minimal peak height should be three times higher then the background noise of th
30. out 100 pg genomic DNA However it is recommended to use 0 2 0 5 ng DNA The test kit was validated and evaluated using the GeneAmp 9700 thermal cycler ABI PRISM 310 Genetic Analyzer and ABI PRISM 3100 3130 Genetic Analyzer Table 1 Discrimination power of DIPs STRs and SNPs Loci CPE Trio CPI Population Mentype DIPplex 30 DIPs 0 9980 2 83 x 10 German AmpFISTR Minifiler 8 STRs 0 99976 8 21 x 10 US Caucasian AmpFISTR SEfiler 11 STRs 0 999998 746x104 US Caucasian Powerplex 16 15 STRs 0 9999994 5 46 x 10 US Caucasian Sanchez et al 2006 52 SNPs 0 9998 5 00 x 10 European combined probability of paternity exclusion combined probability of identity Content 1 Description of the Mentype DUP bos rate edat s UO te ctn t 3 2 PGR ambDilfllCall0 lk x e cs dl an san KA r ki ona SORT ape DA AUR ES 6 2 1 Master mix preparati0f e eode 6 2 2 PCR amplification parameters cassa eoi e Ia RO MATES EORR DEUDA UR 7 3 Electrophoresis using the ABI PRISM 310 Genetic Analyzer 8 e M tik generatio tco erret rd uda leen m 8 3 2 Sample preparation L L o LR SOR PR a t DE 11 3 3 Setting up the GeneScan software se 11 3 4 Analysis hee a aet cs 12 4 Electrophoresis using the ABI PRISM 3100 Avant 3100 Genetic Analyzer 13 4 1 Spectral calibration matrix generation 13 4
31. ration is critical to evaluate multicolour systems with the ABI PRISM 3100 Avant 3100 Genetic Analyzer and shall be done prior to conducting fragment length analysis The calibration procedure creates a matrix which is used to correct the overlapping of fluorescence emission spectra of the dyes Spectral calibration comprises the following steps Preparation of the spectral calibration standards Loading the standards to the 96 well reaction plate one sample per capillary Entering the plate composition Performing a spectral calibration run and checking the matrix Setting up the spectral calibration standards Example for 4 capillaries ABI 3100 Avant Component Volume Hi Di Formamide 60 0 uL Matrix standard BT5 5 0 uL Load 12 uL of the mix to a 96 well reaction plate e g position A1 D1 Denaturation for 3 min at 95 C Cool down to 4 C Example for 16 capillaries ABI 3100 Component Volume Hi Di Formamide 204 0 uL Matrix standard BT5 17 0 uL Load 12 of the mix to a 96 well reaction plate e g position A1 H1 and A2 H2 Denaturation for 3 min at 95 C Cool down to 4 C Mentype DIPplex December 2009 Performing a spectral calibration run First of all the parameter file for DyeSetG5 must be modified once to achieve successful calibration with the Data Collection software version 1 0 1 or 1 1 Spectral parameter To change settings in the parameter file go to the following path D AppliedBio
32. th Options Light Peak Detection Peak Amplitude Thresholds BA Ys G R 0 Min Peak Half Width 2 pts Polynominal Degree 3 Peak Window Size 11 pts Size Call Range Min 60 Max 550 Size Calling Method Local Southern Method Split Peak Correction None The peak amplitude threshold cutoff value corresponds to the minimum peak height that will be detected by the GeneScan or GeneMapper ID software Thresholds are usually 50 200 RFU and should be determined individually by the laboratory Recommendation The minimal peak height should be three times as high as the background noise of the baseline Mentype DIPplex December 2009 4 Electrophoresis using the ABI PRISM 3100 Avant 3100 Genetic Analyzer For detailed instructions on instrument setup spectral calibration application of the ABI PRISM 3100 Data Collection software version 1 01 or 1 1 and the GeneScan software refer to the ABI PRISM 3100 Avant 3100 Genetic Analyzer User s Manual The system with 4 capillaries is named ABI 3100 Avant and the system with 16 capillaries is named ABI 3100 The virtual filter set G5 shall be used for combined application of the five fluorescent labels 6 FAM BTG BTY BTR and BTO the matrix standard will be called BT5 hereinafter Material Capillary 3100 Capillary Array 36 cm Polymer 3100 POP 4 Polymer Buffer 10x Genetic Analyzer Buffer with EDTA 4 1 Spectral calibration matrix generation Proper spectral calib
33. ulti 2 DNA Polymerase hot start 2 5 U uL 0 6 uL Volume of master mix 24 0 uL contains dNTPs BSA All components should be mixed vortex and centrifuged for about 10 s before preparing the master mix The DNA volume applied to the assay depends on its concentration A volume of up to 5 uL may be necessary for DNA trace templates DNA volumes of more than 5 uL are not recommended because potential PCR inhibitors may interfere with the process Fill up the final reaction volume to 25 uL with nuclease free water Generally DNA templates shall be stored in nuclease free water or in diluted TE buffer 10 mM Tris pH 8 0 and 1 mM EDTA e g 0 1x TE buffer The primer mixes are adjusted for balanced peak heights at 30 PCR cycles and 0 2 ng Control DNA XY5 in a reaction volume of 25 uL If more DNA template is introduced higher peaks can be expected for small PCR fragments and relatively low peaks for large fragments Reduce the amount of DNA template to correct this imbalance Positive control For the positive amplification control dilute the Control DNA XY5 to 0 2 ng in the appropriate volume Instead of the template DNA pipette the diluted Control DNA into a reaction tube containing the PCR master mix Negative control For the negative amplification control pipette nuclease free water instead of template DNA into a reaction tube which contains the PCR master mix Template DNA Sometimes the measured v

Mentype - Biotype

Contents

Download Pdf Manuals

Related Search

Related Contents