Delta Differential Display Kit
Contents
1. control for the same primer combination Electrophorese at 70W constant power for 2 75 hr or until the xylene cyanol dye has migrated through the entire gel Dismantle the electrophoresis apparatus Allow the glass plates to cool down to room temperature before attempting to separate the glass from the gel After removing the top notched plate transfer the gel to Whatman paper Use caution 0 2 mm gels are very fragile Finally place plastic wrap carefully over the gel Dry the gel under vacuum at 75 C for 35 40 min Expose x ray film to the gel at 70 C overnight with an intensifying screen We recommend Kodak BioMax MH film Save the dried gel so that you can cut out and reamplify the differen tially expressed bands These current power settings apply only when using 5 polyacrylamide 8 M urea gels 0 5X TBE that are 0 2 mm thick CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 22 Version PR19324 Delta Differential Display Kit User Manual V Expected Results and Troubleshooting Guide A Expected results The positive control PCRs using primers P10 and T8 to compare the cDNA derived from the positive control RNAs from adult and fetal liver should give two very similar displays except that a single strong band of 380 bp should be present in the fetal liver display postive control RNA 2 but absent from the adult liver display postive control RNA 1 Figure 3 The exact patte2. 1983 Activation of mouse genes in transformed cells Cell 34 557 567 CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 Version PR19324 Delta Differential Display Kit User Manual Vil References continued Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995a An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 1087 1088 Siebert P D Chen S amp Kellogg D E 1995b The Human PromoterFinder DNA Walking Kit A new PCR method for walking in uncloned genomic DNA CLONTECHniques X II 1 3 Trentmann S M der Knaap E amp Kende H 1995 Alternatives to 355 as a label for the differential display of eukaryotic messenger RNA Science 267 1186 Also see response by P Liang and A B Pardee Science 267 1186 1187 Ulman K S Northrop J P Verweij C L amp Crabtree G R 1990 Transmission of signals from the T lymphocyte antigen receptor to genes responsible for cell proliferation and immune function The missing link Ann Rev Immunol 8 421 452 Welsh J amp McClelland M 1990 Fingerprinting genomes using PCR with arbitrary primers Nucleic Acids Res 18 7213 7218 VIII Related Products For the latest and most complete listing of all CLONTECH products please go to www clontech com e Advantage KlenTaq Polymerase Mix 8417 1 e Advantage cDNA PCR Kit K1905 1 e TagStart Antibody 5400 1 2
3. Chloroform isoamyl alcohol 24 1 For Delta Differential Display 50X polymerase mix You will need a Taq based 50X polymerase mix suitable for LD PCR The Delta protocol has been optimized with CLONTECH s Advantage KlenTaq Polymerase Mix 8417 1 which contains KlenTaq 1 DNA Polymerase exo minus N terminal deletion of Tag DNA polymerase as the primary polymerase a minor amount of a 3 5 proofreading polymerase and TaqStart Antibody for hot start Kellogg et al 1994 Advantage KlenTaq Polymerase Mix is available in the Advantage cDNA PCR Kit 22K 1905 1 y If you choose not to use Advantage KlenTaq Polymerase Mix Table gives instructions for mixing TaqStart Antibody with other commercially available LD PCR licensed enzyme mixes In our experience Delta Differential Display reactions are somewhat less efficient with these other enzyme mixes In general we recommend that the primary enzyme in the mix be Taq DNA polymerase ora Taqderivative instead of Tth DNA polymerase which results in higher backgrounds and more smearing Taq DNA polymerase can be used by itself however more cycles will be needed Furthermore the size range of the products will be much smaller So you will obtain fewer differentially expressed bands per display and miss the larger bands that would be identified using the LD PCR mixes Also LD PCR has a significantly lower error rate than PCR with Taq DNA polymerase alone Barnes 1994 so the sequen
4. If you are using a buffer system in which the Mg is added separately we recommend using a final Mg of 1 5 mM o 3 P dATP 1000 3000 Ci mmole 3 3 uM o 33P dATP produces much sharper bands than 32 and thus increases the resolution of your differential displays and therefore the number of bands that you can distinguish a 9 S dATP can also be used however longer exposure times will be required Also volatilization of a 85S dATP upon heating may lead to low level contamination of thermal cyclers Trentmann et al 1995 e 0 5 ml PCR tubes We recommend Perkin Elmer GeneAmp 0 5 ml reaction tubes Cat N801 0737 or N801 0180 X ray film We recommend Kodak BioMax MR film e Gel electrophoresis apparatus For best results use a temperature controlled thermostatic gel electro phoresis apparatus such as the Macrophor System from Pharmacia Biotech AB or the genomyxLR DNA Sequencer from Genomyx Corporation Gel loading buffer 95 0 Formamide 0 2 Bromophenol blue 0 2 Xylene cyanol CLONTECH Laboratories Inc www clontech com Protocol PT1173 1 10 Version PR19324 Delta Differential Display Kit User Manual lll Additional Materials Required continued 18 eq pinoys Jejynq XI sexiu 2 xog JAMO BY jo esneoeg esejeulA od periddns
5. PR19324 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued E Design Considerations for Delta Experiments 1 Choice of primers and number of primer combinations The Delta Differential Display Kit contains 10 arbitrary P primers and 9 oligo dT T primers This gives you 90 possible two way primer combi nations The arbitrary P primers can also be used alone i e without a downstream primer or in pair wise combinations with other P primers McClelland etal 1990 This gives you 55 additional primer combina tions Although there is some overlap some bands will be detected with the P primer alone that would have been missed in pair wise combina tions with T primers The T primers can also be used alone or in combination with each other Presumably the oligo dT portion of the primer anneals to internal runs of As during the initial low stringency cycles Note that combinations of P and T primers or T primers alone will generally produce PCR products derived from the 3 end of the mRNA while P primers alone or combinations of P primers will favor internal regions of the mRNA Reactions using a P T primer pair typically generate 40 80 bands When comparing two different RNA samples the number of differen tially expressed RNAs will vary depending on the relatedness of the two sources For example 4 of the mRNAs differ between SV40 trans formed and untransformed mouse cells
6. This result is probably due to the higher priming specificity of Tag DNA polymerase relative to reverse transcriptase D yachenko et al 1993 since primers with a 3 terminal T are used to prime cDNA syntheses in other differential display procedures Liang amp Pardee 1992 Liang et al 1993 CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 32 Version PR19324 Delta Differential Display Kit User Manual Appendix B Size of Delta Differential Display Experiments TABLE III SIZE OF DELTA DIFFERENTIAL DISPLAY EXPERIMENTS Your Experiment Number of primer combinations 1 6 6 12 20 20 45 90 Number of RNA samples 2 2 3 2 2 3 2 2 Experimental displays no of RNA samples x 2 dilutions of each cDNA 4 24 36 48 80 120 180 360 x no of primer pairs H5O controls 1 6 6 12 20 20 45 90 Total RNA controls 2 2 3 2 2 3 2 2 Positive control experiment 4 positive controls 1 control 7 7 7 7 7 7 7 7 7 2 total RNA controls Total PCRs 14 39 52 69 109 150 234 459 Protocol PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 33 Delta Differential Display Kit User Manual Notes CLONTECH Laboratories Inc www clontech com Protocol PT1173 1 Version PR19324 Delta Differential Display Kit User Manual Notes Advantage Delta and MTN are registered trademarks of CLONTECH Laboratories Inc CHROMA SPIN CLONTECH PCR Select GenomeWalker Marathon Marathon
7. and then cloned into a T A cloning vector for additional analysis The AdvanTAge PCR Cloning Kit K1901 1 pro vides all the reagents needed for T A cloning C Northern Blot Analysis The most direct way to verify differential expression of bands identified by Delta Differential Display is to use the reamplified bands as probes on Northern blots of poly A RNA from the original RNA sources Examples of Northern blot confirmation of differentially expressed bands can be seen in the article that appeared in the April 1995 issue of CLONTECHniques pp 5 7 1 Labeling probes Each reamplified differentially expressed band can be used as a template for random primer labeling Sambrook et al 1989 If you have followed the steps in Section B for reamplifying purifying precipitating and resuspending your PCR products use 5 ul as a template for making the random primed probe 2 Make Northern blots with poly A RNA Use poly A RNA for Northern blots whenever possible Many differen tially expressed bands identified by Delta Differential Display will correspond to mRNAs of average or low abundance Such mRNAs may not be detectable on a Northern blot of total RNA Protocol 4 PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 27 Delta Differential Display Kit User Manual VI Additional Procedures continued 3 Exposure times may vary The exposure time required for Northern blots varies dramatically fro
8. 1 www clontech com CLONTECH Laboratories Inc Version PR19324 17 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued inherent background in all differential display reactions per formed with that primer pair This is an important control for the quality of your cDNA synthe sis If your cDNA synthesis reaction does not work well then your experimental differential display PCR will be of similar intensity to the control If you get no signal in your controls and experimental samples you may have a problem with your DNA polymerase Once you are familiar with the H O control for a primer pair it is not necessary to repeat the control with every new experiment ii Total RNA control Perform a total RNA control the first time you use each freshly made cDNA template for differential display PCR For this control use 1 of a 1 100 dilution of the RNA that served as a template for synthesis Initially this control only needs to be done with one primer pair The resulting differential display pattern should be compared to the H O control performed with the same set of primers If there was genomic DNA contamina tion in your RNA you will see a significant number of bands in the RNA control that are not present in the control Such contamination can lead to many false positives when a con taminated sample is being compared to a non contaminated sample I
9. MMLYV reverse transcriptase 200 A N 9 Add 5 ul of the Master Mix to each reaction tube Protocol PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 15 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued 10 11 12 13 14 15 16 17 18 19 20 Mix the contents of the tubes by gently pipeting Spin the tubes briefly in a microcentrifuge Incubate the tube at 42 C for 1 hr in an air incubator Note Using a water bath or thermal cycler for this incubation may reduce the volume of the reaction mixture due to evaporation and therefore reduce the efficiency of first strand synthesis Terminate the reactions by incubating at 75 C for 10 min Place the tubes on ice Spin the tubes briefly in a microcentrifuge For each RNA sample including positive controls label a sterile 0 5 ml microcentrifuge tube with a number followed by B i e tubes should be labeled 1B 2B PC1B PC2B This is for the B dilution of each cDNA sample Transfer 2 ul of each reaction to the appropriate B tube Add 78 ul of sterile H5O to each B tube Add 72 ul of sterile to the tube containing the remaining 8 ul of each ss This is the A dilution of each cDNA sample Store all cDNA dilutions at 20 C until ready for use CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 16 Version
10. RNA sample 2 2 ug of total RNA FIRST STRAND SYNTHESIS Oligo dT primer MMLV reverse transcriptase e 42 C for 1 hr ss cDNA template ss cDNA template DIFFERENTIAL DISPLAY PCR Pairwise combinations of P and T primers Advantage KlenTaq Polymerase Mix with TaqStart Antibody o 9P dATP 3low stringency cycles Tannea 40 C 22 25 high stringency cycles Tannea 60 C Differential Display Differential Display PCR products PCR products Electrophorese on 5 acrylamide gel Expose x ray film Primers P1 T1 P2 T1 P3 T1 P1 T2 P2 T2 P3 T2 RNAsample 1 2 12 12 12 12 12 4 2kb 100 bp Cut differentially expressed bands and Reamplify and confirm by Northern blot Clone and sequence Conduct further studies Generate full length cDNAs using Marathon Ready cDNAs or Marathon cDNA Amplification Kit Obtain genomic clones or regulatory sequences using GenomeWalker Kits Figure 1 Overview of the Delta Differential Display protocol In the actual protocol each differential display PCR is performed using two different dilutions of each cDNA sample CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 4 Version PR19324 Delta Differential Display Kit User Manual Introduction continued 5 AAA RAMI Oa FIRST STRAND SYNTHESIS TETAS e 2 ug of each total RNA sample poly A RNA in Add reverse transcript
11. Ready and TagStart are trademarks of CLONTECH Laboratories Inc GeneAmp is a registered trademark of Roche Molecular Systems Inc licensed to The Perkin Elmer Corporation Expand is a trademark of Boehringer Mannheim Corporation Macrophor is a trademark of Pharmacia Biotech AB genomyxLR is a trademark of Genomyx Corporation 2001 CLONTECH Laboratories Inc Protocol PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 35
12. Scott et al 1983 Similarly 2 of the transcripts differ between T and B lymphocytes Hedrick et al 1984 while over 100 genes are activated during T cell differentia tion following antigenic stimulation Ulman et al 1990 In our experiments comparing human adult and fetal liver total RNA i e the positive control RNAs in the Delta Kit we typically obtained 1 2 differentially expressed bands for each combination of P and T primers When these bands were used as probes on Northern blots more than 8596 were confirmed as unique differentially expressed mRNAs each having a different size In contrast in studies comparing stimulated and unstimulated mouse macrophages Raw cell lines or stimulated and unstimulated T cells Jurkat cell line we typically obtained 1 differen tially expressed band for every 2 3 combinations of P and T primers 2 Use of controls a Negative controls i control For each pair of primers you use it is important to perform an control using 1 ul of H5O as the template Although there is no template in this reaction it nevertheless produces a light banding pattern in some cases In other cases there will be no signal after the specified number of cycles Whatever bands are present in the control should take at least 5 additional cycles to reach the same intensity as the bands in real differen tial displays If present the light banding pattern is an Protocol 4 PT1173
13. Secondly the 3 end of each primer is not significantly complementary to any other sequence in the primer Finally we placed several additional restrictions on the nine bases at the 3 ends of the P primers These positions are the most significant for priming events These positions favor common sequence motifs found in the coding region of eukaryotic especially mammalian mRNAs however the Delta Kit also yields good results with nonmammalian species including plants The probability of two primer binding sites occurring within one mRNA molecule is less than 3 We also carefully avoided sequences that might allow slippage during DNA synthesis or other artifacts Chenchik et al 1992 To ensure optimal performance of the Delta Kit we synthesized a large pool of primers that met the above criteria We then performed many Delta experiments to select the best primers for the kit T primer design The T primers in the Delta Kit have the general structure 5 anchor dT sN 4N where N_ A G or C The 5 anchor adds the extra length needed for the high stringency cycling described above We have also reduced the oligo dT portion to 9 T residues to increase the influence of the N_ bases the protocol described by Liang amp Pardee 1992 uses oligo dT Also the Delta Kit does not include primers with T in the terminal position i e 5 since these primers produced high backgrounds in our experiments
14. XL 94 Apoqnuy ueisbe jo eunjoA payloads au Ajduuis amp poqnuy ueisbe sexiu eu Azue xos aiedaid oL 0 Apoquue eu einiip 0499 6 OG 1e s poqnuy ueisbe 2202 16 5 eq poqnuy ueisbe 20 XOS q jenueJeyiq eieq SUNS 1598 e gApoqyuy ueisbe jo G JO XIN 444 jou 2 06 ee bej 7 8 18914 ueis S HOd ejejduie puedx3 wiayuuey a pognuy yeysbe 10 rl op be1X3 jo ri 01 0S m suun be 1x3 LLOHHA WM Apoqnuy Jes e A L 806 L4 HOd 0 oDejueApy 2 oDejueApy S HO3 LNO 12 2 XOS ul pe ddns 2uo2 4 129 10 suon1odoag XIN ASVYAWAI1Od 06 JO NOILWYVd3dd ME REM CLONTECH Laboratories Inc www clontech com Protocol PT1173 1 Version PR19324 11 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display PLEASE READ ENTIRE PROTOCOL BEFORE STARTING A Gene
15. proven reproduc ibility of the Delta Differential Display Kit The design features that distinguish the Delta primers from the primers used in previously described methods and in other commercial kits are discussed in detail in Appendix A With 10 arbitrary primers and 9 oligo dT or T primers the kit has 90 possible combinations of upstream and downstream primers Furthermore each P primer can be used alone or in pairwise combinations with other P primers Similarly the T primers can be used alone or in combination with other T primers See Section IV E for a discussion on choosing primers Long distance PCR with the Advantage cDNA PCR Kit Delta Differential Display uses the conditions of long distance LD PCR Barnes 1994 Cheng et al 1994 in which a combination of thermophilic DNA poly merases produces much larger PCR products than are possible with conven tional PCR Yields are also increased relative to conventional PCR Furthermore the presence of a minor amount of a DNA polymerase with 3 5 exonuclease i e proofreading activity makes LD PCR more accurate than conventional PCR with a single DNA polymerase Barnes 1994 Frey amp Suppman 1995 Nelson et al 1995 We recommend CLONTECH s Advantage KlenTaq Polymerase Mix 8417 1 which was specifically developed for LD PCR using cDNA templates and is the enzyme mix used to optimize the protocols in this booklet This 50X mix contains KlenTaq 1 DNA Polymera
16. that produce a known product in your hands If necessary repeat the PCR using fresh 50X polymerase mix b If after five additional cycles bands appear and the intensity and pattern in all displays including the positive controls is similar to the patterns in the corresponding total RNA controls your cDNA synthesis probably failed Repeat the cDNA synthesis using fresh RNA Protocol PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 23 Delta Differential Display Kit User Manual V Expected Results and Troubleshooting Guide cont d 1234567 2 kb 380 bp L 250 CLONTECH Laboratories Inc 24 Figure 3 A typical positive control experiment using the P10 amp T8 primers to compare the positive control RNAs total RNA from human adult and fetal liver First strand cDNA synthesis using 2 ug of total RNA and PCR were performed as described in this User Manual Lane PCR template Dilution B of cDNA made from positive control RNA 1 Dilution A of cDNA made from positive control RNA 1 Dilution B of cDNA made from positive control RNA 2 Dilution A of cDNA made from positive control RNA 2 1 100 dilution of positive control RNA 1 1 100 dilution of positive control RNA 2 H O Water control for the primer pair The exact pattern of the positive control display may vary depending on the particular enzyme mix you use and the lot of RNA However the strong differentially expres
17. 3 1 www clontech com CLONTECH Laboratories Inc Version PR19324 13 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued 2 A O O CO 11 12 13 14 15 16 17 18 19 20 21 22 In appropriately labeled sterile 0 5 ml microfuge tubes add an equal volume of the DNase mixture to each RNA sample Do not use polystyrene tubes which may melt during phenol chloroform extraction Incubate the tubes at 37 C for 30 min To each tube add 2 5 ul of 0 2 M EDTA and 2 ul of 3 M NaOAc If you started with less than 25 ul of RNA adjust the reaction mixture volume to 50 ul by adding a solution of 10 mM Tris pH 7 5 and 50 mM NaOAc Note The concentration of total RNA at this point should be at least 20 ug ml Decreasing the RNA concentration below this optimum level may result in loss of RNA during phenol chloroform extraction and precipitation To each tube add a volume of phenol chloroform isoamyl alcohol 25 24 1 equal to the reaction volume Vortex the tubes thoroughly Centrifuge the tubes at 14 000 rpm for 10 min to separate phases For each sample transfer the top aqueous layer to a clean 0 5 ml tube To each tube add a volume of chloroform isoamy alcohol 24 1 equal to the volume of the aqueous layer Vortex the tubes thoroughly Centrifuge the tubes at 14 000 rpm for 10 min to separate phases For each sample transfer the
18. 9 H3 H O P2 amp T9 4 2B P1 amp T9 and so 5 1A T8 Total RNA conirols for each RNA 6 1B amp 8 Use any of the above primer pairs 7 2A P1 amp 8 R1 RNA 1 P1 amp T9 8 2B P1 8 T8 R2 RNA 2 P1 amp T9 and soon 9 1A P2 amp T9 zi 3 10 1B P2 amp T9 Complete positive control PC experiment 11 2A P2 amp T9 PC1A PC1A P10 amp T8 12 2B P2 8 T9 PC1B PC1B P10 amp T8 ads pn PC2A PC2A P10 amp T8 m PC2B PC2B P10 amp T8 HPC H O P10 amp T8 RPC1 PC RNA 1 P10 T8 RPC2 PC RNA 2 P10 amp T8 Protocol PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 19 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued The Delta Differential Display protocol has been optimized with CLONTECH s Advantage KlenTaq Polymerase Mix which includes TagStart Antibody for automatic hot start PCR If you choose not to use Advantage KlenTaq Polymerase Table Section III provides instructions for mixing TaqStart Antibody with other commercially available LD PCR licensed enzyme mixes We recommend using some form of hot start PCR i e TagStart Antibody wax beads or manual hot start to minimize background and false positives in your differential display reactions Note on Steps 1 3 If you are performing PCR with a single P or T primer use 2 ul of that primer If you are performing PCR with 2 P primers or 2 T primers use 1 ul of each primer 1 For eac
19. CLONTECH Innovative Tools to Accelerate Discovery Delta Differential Display Kit User Manual PT1173 1 PR19324 Published 05 September 2001 Catalog K1810 1 Storage Conditions Positive control RNAs 70 C All other components 20 C FOR RESEARCH USE ONLY Delta Differential Display Kit User Manual Table of Contents I Introduction 3 ll List of Components 8 Ill Additional Materials Required 9 IV Protocol for Delta Differential Display 12 A General Considerations 12 B Preparation and Handling of Total RNA 12 C Optional DNase Treatment of Total RNA 13 D First Strand cDNA Synthesis 15 E Design Considerations for Delta Experiments 17 F Differential Display PCR 19 G Electrophoresis and Autoradiography 22 V Expected Results and Troubleshooting Guide 23 VI Additional Procedures 26 A Purification of DNA Fragments from Dried Polyacrylamide Gels 26 B Reamplification of the Band of Interest 26 C Northern Blot Analysis 27 D Additional Experiments 28 Vil References 30 Vill Related Products 31 Appendix A Design of the Delta Primers 32 Appendix B Size of Delta Differential Display Experiments 33 Notice to Purchaser This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use CLONTECH products may not be resold modified for resale or used to manufacture commercial products without written approv
20. TTAACCCTCACTAAATGTGGCAGG 3 P10 5 ATTAACCCTCACTAAAGCACCGTCC 3 e 9x90 uw Oligo dT primers 20 uM T1 5 CATTATGCTGAGTGATATCTTTTTTTTTAA 3 T2 5 CATTATGCTGAGTGATATCTTTTTTTTTAC 3 5 CATTATGCTGAGTGATATCTTTTTTTTTAG 3 T4 5 3 T5 5 CATTATGCTGAGTGATATCTTTTTTTTTCC 3 T6 5 CATTATGCTGAGTGATATCTTTTTTTTTCG 3 T7 B CATTATGCTGAGTGATATCTTTTTTTTTGA 93 T8 5 CATTATGCTGAGTGATATCTTTTTTTTTGC 3 T9 5 CATTATGCTGAGTGATATCTTTTTTTTTGG 3 General reagents e 200 ul dNTPs 5 mM each dATP dCTP dGTP dTTP 2x4 ml Sterile H2O CLONTECH Laboratories Inc www clontech com Protocol PT1173 1 8 Version PR19324 Delta Differential Display Kit User Manual lll Additional Materials Required The following reagents are required but not supplied For optional DNase treatment of total RNA 0 5 Tris HCl pH 7 5 0 5M MgCl 3M NaOAc 0 2M EDTA Phenol chloroform isoamyl alcohol 25 24 1 Prepare as follows 1 Melt phenol 2 Equilibrate with an equal volume of sterile TNE buffer 50 mM Tris pH 7 5 150 mM NaCl 1 mM EDTA 3 Incubate the mixture at room temperature for 2 3 hr 4 Remove and discard the top layer 5 Add an equal volume of chloroform isoamyl alcohol 24 1 to the remaining layer Mix thoroughly Remove and discard the top layer 6 Store the bottom layer of phenol chloroform isoamyl alcohol at 4 C away from light for a maximum of 2 weeks
21. al Display Kit User Manual IV Protocol for Delta Differential Display continued F Differential Display PCR Delta Di fferential Display experiments tend to get very large the more primer combinations you try the more differentially expressed bands you may identify See Table IIl in Appendix B for examples of how the size of Delta ex periments varies with the number of primer combinations and RNA samples We recommend that you keep your initial experiments small For your first experiment try using two T primers and three P primers for a tot positive al of six PCRs with each template With two RNA samples and controls this requires a total of 39 PCRs and the results can be examined on 1 2 large gels 24 6 2 7 Experimental displays no of RNA samples x 2 dilutions of each cDNA sample x no of primer pairs controls Total RNA controls Complete positive control experiment 4 positive controls 2 total RNA controls 1 H2O control 39 Total PCRs A good organizational plan and labeling system is very helpful Table Il gives an example of how Delta experiments are often set up at CLONTECH TABLE Il SAMPLE ORGANIZATIONAL AND LABELING CHART FOR SETTING UP DELTA DIFFERENTIAL DISPLAY PCR Tube cDNA Tube cDNA Label Sample Primers Label Sample Primers Experimental displays Water controls for each primer pair 1 1A P1 amp T9 H1 H O P1 amp T9 2 1B P1 9 H2 H O P1 amp T8 3 2A P1 amp T
22. al of CLONTECH This product is optimized for use in the Polymerase Chain Reaction PCR covered by patents owned by Hoffmann La Roche Inc and F Hoffmann La Roche Ltd Roche No license under these patents to use the PCR process is conveyed expressly or by implication to the purchaser by the purchase of this product A license to use the PCR process for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers such as CLONTECH Laboratories Inc when used in conjunction with an authorized thermal cycler or is available from Perkin Elmer Corporation Further information on purchasing licenses to practice the PCR process may be obtained by contacting the Director of Licensing at the Perkin Elmer Corporation 850 Lincoln Centre Drive Foster City CA 94404 or at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda CA 94501 CLONTECH Laboratories Inc www clontech com Protocol PT1173 1 2 Version PR19324 Delta Differential Display Kit User Manual Introduction The Delta Differential Display Kit formerly named the Delta RNA Fingerprinting Kit enables researchers to identify RNAs that are expressed in one RNA population but missing in another Diachenko et al 1996 The identification of such differentially expressed RNAs is a powerful tool for studying differentia tion the cell cycle carcinogenesis inductive events and other biological phen
23. ase and oligo dT total RNA sample 42 C for 1 hr Prepare A and B dilutions 2 1 o DIFFERENTIAL DISPLAY PCR Add one P and one T primer to the A and B dilutions of each cDNA e Add dNTPs and o 9P dATP Add long distance PCR enzyme mix with P primer TaqStart Antibody e g Advantage m KlenTag Polymerase Mix ITTTTTTTTT Y Three low stringency cycles 40 C so the P primer can bind AAAAAAAAAAAA imprecisely to various cDNA strands Y AAAAAAAAAAAAAA NNT TTTITITT Ru N N bases position the primer at the Y T primer beginning of the poly A tail SS A A AAAAAAAAAAA TTTTTTTTT G Y AAAAAAAAA 22 25 high stringency cycles se SSS Primer tails allow shift to Ta 60 C leading to higher yields of specific products y lower backgrounds amp high reproducibility Examine products on PAGE gel For clarity only one set of annealing extension events is shown During the low stringency cycles many other cDNA strands are primed with the same P primer producing the mix of PCR products that are amplified in the later high stringency cycles to produce the differential display for each RNA sample Figure 2 Detailed flow chart of the cDNA synthesis and PCR in the Delta Differential Display protocol This figure shows differential display PCR using one P primer and one T primer Although these are the most commonly performe
24. at approximately 4 5 and 1 9 kb respec tively with a ratio of intensities of about 1 5 2 5 1 If this ratio is less than 1 1 we suggest you prepare fresh RNA after checking your RNA purification reagents for RNase and other impurities If problems persist you may have to find another source of tissues cells C Optional DNase Treatment of Total RNA Unless total RNA samples are seriously contaminated with genomic DNA DNase treatment is not necessary If analysis of total RNA on a denaturing formaldehyde agarose EtBr gel reveals visible genomic DNA contamina tion indicated by EtBr stained material stuck in the wells then you should treat your samples with DNase before continuing with the first strand cDNA synthesis Likewise if the total RNA control display patterns are identical to your experiments you should treat your RNA with DNase I 1 For each total RNA sample prepare an equal volume of DNase mixture Combine the following components in a sterile 0 5 ml microfuge tube per 25 ul RNA sample components 1 ul 0 5 M Tris HCI pH 7 5 0 5 MgCl 22 Sterile HO 1 ul RNase free DNase 1 unit ul 25 ul total We generally recommend that you use 25 ul of each RNA sample at a concentration of 0 1 1 mg ml For multiple RNA samples scale up the amounts of the components of the DNase mixture proportionately To avoid pipeting errors do not make less than 25 ul of the DNase mixture Protocol PT117
25. ce of your PCR products will be more Protocol 4 PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 9 Delta Differential Display Kit User Manual lll Additional Materials Required continued faithful to the original mRNA This is a particularly important consideration for designing primers for subsequent experiments such as Marathon cDNA amplification or sequencing Using TaqStart Antibody in the 50X polymerase mix greatly reduces nonspe cific synthesis in Delta Differential Display PCR TaqStart Antibody has already been added to CLONTECH s Advantage KlenTaq Polymerase TaqStart is an effective method for hot start PCR that is simpler more convenient than wax based or manual methods The TaqStart Antibody binds to and inactivates Tag DNA polymerase native or truncated and thus eliminates DNA synthesis from nonspecifically bound primers while reac tions are being assembled PCR amplification proceeds efficiently after an initial incubation at 94 C which irreversibly inactivates the TaqStart Anti body TaqStart Antibody is available from CLONTECH 5400 1 2 PCR reaction buffer Included in the Advantage cDNA PCR Kit Use the 10X reaction buffer supplied with your source of native or truncated Taq DNA polymerase in all reactions that call for 10X PCR buffer Of the three buffers supplied with the Expand Long Template PCR System we obtained the best results with buffer 1
26. container Store eluted bands at 20 C B Reamplification of the Band of Interest Reamplify each differentially expressed band using the primer s used in the original PCR 1 For each band combine the following reagents in an 0 5 ml PCR tube 7 ul Eluted DNA 5 ul 10X PCR buffer 0 5 ul 5SmMdNTP 25 ul P primer 20 uM 2 5 ul T primer 20 uM 50Xpolymerase mixture 31 5 ul Sterile H2O 50 ul Total Note If you performed PCR with a single P or T primer use 5 ul of that primer CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 26 Version PR19324 Delta Differential Display Kit User Manual VI Additional Procedures continued 2 Overlay each reaction with 1 2 drops of mineral oil and place caps firmly on tubes 3 Commence cycling in a Perkin Elmer DNA Thermal Cycler 480 or GeneAmp PCR Systems 2400 9600 20 cycles 94 C 1 min 60 C 1 min 68 C 2 min 4 Analyze 10 ul of your product on a 2 agarose EtBr gel The reamplified product should be the same size as the original band 5 Store the remaining material at 20 C 6 Optional Purify the PCR products from the primers and unincorporated nucleotides using a CHROMA SPIN 100 Column K1302 1 2 from CLONTECH or other comparable method 7 Ethanol precipitate the reamplified PCR product and resuspend in 10 ul of sterile H2O The reamplified product can now be used to make a probe for Northern analysis see next section
27. d reactions Delta Differential Display can also be performed using P primers alone or pairs of P primers Similarly Delta Differential Display can be performed using T primers alone or pairs of T primers See Section IV E for a discussion of choosing primers for your Delta experiments Protocol 4 PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 5 Delta Differential Display Kit User Manual Introduction continued and or incomplete matches The products of these early cycles are then amplified using the P primer and the downstream T primer during 22 25 high stringency PCR cycles When examined by polyacrylamide electrophoresis and autoradiography these reactions produce characteristic banding patterns or displays of the starting RNA A sample display using the positive control reagents can be seen in Figure 3 in Section V Expected Results and Troubleshooting Guide Each different pair of primers will produce a different display and may therefore identify a different set of differentially expressed RNAs Once differentially expressed bands have been identified they can be eluted from the gel and reamplified to make probes for Northern blot confirmation of differential expression as discussed in Section VI Additional Procedures Confirmed positives can then be cloned and further characterized The Delta Differential Display primers The design of the Delta primers is critical to the success and
28. e CLONTECH PCR Select cDNA Subtraction Kit K1804 1 e Marathon cDNA Amplification Kit K1802 1 e Marathon Ready cDNAs many CHROMA SPIN Columns many e GenomeWalker DNA Walking Kits many e Multiple Tissue Northern MTN Blots many e Libraries Protocol PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 31 Delta Differential Display Kit User Manual Appendix A Design of the Delta Primers The sequences of the P and T primers are given in Section II List of Components The most important feature of the Delta primers is that they are longer than the primers used in previously described methods Each P primer is 25 ntlong while each T primer is 29 nt long The longer primer means that following three initial low stringency PCR cycles at Tanneai 40 C the annealing temperature be increased to 60 C for the final 22 25 cycles The resulting increase in stringency is critical to the proven repro ducibility and relatively low backgrounds of Delta Differential Display In addition the optimal primer length for Tag DNA poly merase is greater than 11 nt D yachenko et al 1994 so the Delta primers work more efficiently in PCR than the shorter primers used in most other similar protocols P primer design Several factors were considered in choosing the actual sequence of the P primers First the primers are incapable of forming significant stable secondary structure
29. earchers will also want to clone the corresponding locus in genomic DNA particularly the upstream region containing the promoter and other cis regulatory elements Conventional methods involve screening genomic libraries with cDNA probes a very time consuming task The GenomeWalker technique is a novel PCR based method that allows researchers to walk upstream or downstream in uncloned genomic DNA from known sequences Siebert et a 1995a 1995b Human Mouse and Rat GenomeWalker Kits K1803 1 K1805 1 K1806 1 respectively include five PCR ready pools of uncloned genomic DNA The Universal GenomeWalker Kit K1807 1 supplies the reagents needed to construct these genomic DNA pools enabling you to walk in the genome of any species The use of LD PCR together with nested gene specific primer and nested adaptor primers allows steps of up to 6 kb in uncloned genomic DNA adjacent to known sequences such as the first exon of a differentially expressed cDNA identified using the Delta Kit Protocol 4 PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 29 Delta Differential Display Kit User Manual Vil References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Bauer D Warthoe P Rohde M amp Struss M 1994 Detection and differential display of expressed genes by DDRT PCR PCR M
30. ethods Appl Manual Supplement Cold Spring Harbor Laboratory USA pp 597 5108 Chenchik A D yachenko L amp Bibilashvili R Sh 1992 Quantitative analysis of individual RNAs in poly A RNA of mammalian cells Mol Biol 26 5 part 2 784 793 In Russian Cheng 5 Fockler C Barnes W M amp Higuchi 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 D aquila R T Bechtel L J Videler J A Eron J J Gorczyca N P amp Kaplan J C 1991 Maximizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 3749 The Delta RNA Fingerprinting Kit April 1995 CLONTECHniques X 2 5 7 Diachenko L B Ledesma J Chenchik A A amp Siebert P D 1996 Combining the technique of RNA fingerprinting and differential display to obtain differentially expressed mRNAs Biochem Biophys Res Comm 219 824 828 D yachenko L Chenchik A Khasperov G L Tatarenko A A amp Bibilashvili R Sh 1993 Analysis of cDNA synthesis efficiency initiated by matched and mismatched base pair primers Mol Biol 28 1014 1027 In Russian Farrell Jr R E 1993 RNA Methodologies A Lab Guide for Isolatio
31. f your total RNA control differs from your H2O control you can still use the cDNA as a template for PCR but you should repeat the total RNA control for each different primer pair Alternatively you may wish to repeat your cDNA synthesis after either making fresh RNA or treating your RNA with RNase free DNase Once you have determined that a given RNA was not contaminated with genomic DNA it is not necessary to repeat the total RNA control in later experiments b Positive control For a positive control perform differential display PCR with the positive control cDNAs made in Section C from the positive control RNAs and the P10 and T8 primers This should produce two good displays with a strong differentially expressed band of 380 bp in the fetal lane PC2 see Figure 3 in Section V To prevent running out ofthe P10 and T8 primers you may wish to use one of your own successful differential display reactions as the positive control in your later experiments 3 Use both the A and B dilutions of each cDNA sample as templates for differential display PCR In some cases a band will show up in one dilution but will be absent from the other dilution however real differentially expressed bands always appear in both dilutions Thus using both dilutions as templates provides a positive control for true differentially expressed bands CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 18 Version PR19324 Delta Differenti
32. h different experimental display i e each pair of cDNAs and each combination of primers combine the following reagents in an 0 5 ml PCR tube 1 Experimental cDNA sample 1 ul P primer 1g T primer 2 Recommended For each pair of primers prepare an control by combining the following reagents in an 0 5 ml PCR tube 1 ul Sterile H O 1 ul P primer 1 ul T primer 3 Recommended For each different template prepare a total RNA control by combining the following reagents in an 0 5 ml PCR tube 1 Total RNA 1 100 dilution of RNA used as cDNA template 1 ul P primer 1 ul T primer 4 Recommended For the positive control experiment combine the following reagents an 0 5 ml PCR tube include and RNA controls 1 ul Positive control sample 1 ul P10 primer 1 ul T8 primer CLONTECH Laboratories Inc www clontech com Protocol PT1173 1 20 Version PR19324 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued 5 Prepare enough Master Mix for all of the PCRs plus one additional tube per 25 100 Component rxn rxns rxns 10X KlenTaq PCR reaction buffer 2 ul 50 ul 200 ul Sterile HO 1421 355ul 1420 ul dNTP mix 5 mM each 0 2 ul 5 ul 20 ul final concentration 50 uM a 3P dATP 1000 3000 Ci mmole 3 3 uM final concentration 50 nM 0 2 ul 5 ul 20 ul Advantage KlenTaq Polymerase Mix 50X 0 4 ul 10 ul 40 ul Final volume 17 4251 1700 ul Mi
33. ing them One way to reduce band overlap is to use temperature controlled gel electrophoresis systems Section IV G such as the Macrophor System from Pharmacia Biotech AB or the genomyxLR DNA Sequencer from Genomyx Corporation These thermostatic systems increase the resolu tion of differential display thereby reducing band overlap D Additional Experiments 1 Notes on cloning Reamplified bands are most readily cloned by T A cloning we recom mend the AdvanTAge PCR Cloning Kit K1901 1 As discussed above reamplified bands often contain multiple cDNA species though minor these other cDNAs will also be cloned into your vector We therefore recommend that you pick a clone and test it by making a probe and reprobing a Northern blot If you do not detect the same differentially expressed band that you detected with your reamplified cDNA the particular clone you picked is probably a minor band that is not differentially expressed The correct clone is usually present in your transformation Simply pick another colony and check it in the same fashion CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 28 Version PR19324 Delta Differential Display Kit User Manual VI Additional Procedures continued 2 Marathon cDNA amplification Once some sequence information has been obtained from differentially expressed cDNAs many researchers will want to clone the corre sponding full length cDNAs as rapidly as
34. ly a single synthesis reaction for each RNA sample The multiple cDNA syntheses in other methods use different oligo dT NM primers to subdivide the pool of total RNA In Delta Differential Display this subdivision occurs during the PCR The single cDNA synthesis saves considerable time and since reverse transcriptase is an expensive reagent it reduces costs as well We also find the subsequent PCR to be more reproducible Another time and cost saving feature of the Delta Kit is that each cDNA synthesis reaction uses only 2 ug of total RNA In our experience the Delta Kit gives similar results with total and poly A RNA so there is no need to purify poly A RNA Whenever possible RNA samples should be prepared side by side using the same reagents and purification protocol In differential display PCR sequences are amplified in the presence of o 33P dATP based on chance homology to arbitrary P primers The Delta PCR cycling program differs substantially from conventional PCR cycling programs Three initial cycles are performed at low stringency i e low annealing tempera ture to allow the primers to anneal and initiate DNA synthesis Because of the low stringency each P primer will bind sites on many cDNAs with imperfect Protocol 4 PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 3 Delta Differential Display Kit User Manual Introduction continued RNA sample 1 2 ug of total RNA
35. m bandto band This is because Delta Differential Display can detect both abundant and relatively rare RNAs For example in our experiments with adult and fetal liver i e the positive control RNAs the exposure needed for Northern blot confirmation of differentially expressed bands ranged from 10 min to 7 days The products of differential display PCR are complex mixtures containing many different sequences In some cases differentially expressed bands will overlap with bands that are presentin both RNA samples albeit at much lower levels In these cases the reamplified band will often detect multiple bands when used as a probe on a Northern blot The differentially ex pressed band may or may not detectable on a Northern blot under these conditions For example if the differentially expressed band corresponds to a rare mRNA the signal may disappear in a high background of signal generated from the more abundant mRNAs This does not necessarily mean that your original band is false however isolating the true differen tially expressed RNA from the background of non differentially expressed RNAs may be difficult since it requires cloning different PCR products of the same size and determining which of the clones correspond to a differentially expressed cDNA Bauer et al 1993 Consequently if you have other differentially expressed bands that are easily confirmed by Northern analysis your time may be better spent characteriz
36. n and Characterization Academic Press San Diego CA Frey B amp Suppmann B 1995 Demonstration of the Expand PCR system s greater fidelity and higher yields with a lacl based PCR fidelity assay Biochemica 2 8 9 Hedrick S M Cohen D I Nielson E A amp Davis M M 1984 Isolation of cDNA clones encoding T cell specific membrane associated proteins Nature 308 149 153 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TagStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Liang P amp Pardee A 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction Science 257 967 970 Liang P Averboukh L amp Pardee A B 1993 Distribution and cloning of eukaryotic mRNAs by means of differential display refinements and optimization Nucleic Acids Res 21 3269 3275 McClelland M et al 1993 In State of the Science Eds S D Pena et al Birkhauser Verlag Switzerland pp 103 115 Nelson K Brannan J amp Kretz K 1995 The fidelity of TaqPlus DNA Polymerase in PCR Strategies in Mol Biol 8 24 25 Sambrook J Fritsch E F amp Maniatis T 1987 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY Scott M R Westphal K H amp Rigby P W
37. nes The PCR Select method allows you to selectively and simultaneously amplify all sequences that are differentially expressed in a given tissue or cell type and also enriches for rare mRNAs CLONTECH s suppression PCR technology U S Patent 5 565 340 prevents amplification of sequences that are not differentially expressed Protocol PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 7 Delta Differential Display Kit User Manual ll List of Components Store total RNA at 70 C Store all other reagents at 20 C The following reagents are sufficient for 12 cDNA syntheses and 900 PCRs For optional DNase treatment of total RNA 12 ul DNase I RNase free 1 unit ul Reagents for first strand cDNA synthesis e 30 Oligo dT primer 1 uM 12 ul MMLV reverse transcriptase 200 units ul e 500 ul 5X First strand buffer 250 mM Tris pH 8 3 30 mM MgCl 375 mM KCI Control reagents 5 ul Positive control RNA 1 1 mg ml of total RNA from adult liver 5 Positive control RNA 2 1 mg ml of total RNA from fetal liver PCR primers for Delta Differential Display 10x90 ul Arbitrary primers 20 uM P1 5 ATTAACCCTCACTAAATGCTGGGGA 3 P2 5 ATTAACCCTCACTAAATCGGTCATAG 3 5 ATTAACCCTCACTAAATGCTGGTGG 3 P4 5 ATTAACCCTCACTAAATGCTGGTAG 3 P5 5 ATTAACCCTCACTAAAGATCTGACTG 3 P6 5 ATTAACCCTCACTAAATGCTGGGTG 3 P7 5 ATTAACCCTCACTAAATGCTGTATG 3 P8 5 ATTAACCCTCACTAAATGGAGCTGOG 3 P9 5 A
38. ntical If you treated your RNA samples with DNase l you may have lost your RNA during purification Repeat DNase treatment 5 Smearing in all lanes If you observe smears in all your lanes you have problems with either your PAGE gels or with your PCR See Sambrook et al 1989 for a general discussion of troubleshooting PAGE gels If you suspect you have problems with the PCR try using a fresh batch of 50X polymerase mix or reducing the MgCl concentration in the PCR buffer 6 Smearing only in experimental samples If the positive controls show the expected patterns but you observe smears in your experimental lanes your experimental RNAs have impurities which inhibit the reverse transcription and or PCRs Repeat the phenol chloroform extraction and ethanol precipitation and repeat the Delta procedure 7 Ladders In rare and apparently random instances we have observed a ladder of fairly even bands instead of a display i e an irregular pattern of bands of varying intensities If this occurs repeat the PCR Protocol 4 PT1173 1 www clontech com CLONTECH Laboratories Inc Version PR19324 25 Delta Differential Display Kit User Manual VI Additional Procedures Once a differentially expressed band has been identified the next step is to elute the band from the PAGE gel and reamplify it for use as a probe in Northern analysis If you have many differentially expressed bands focus your initial efforts on well is
39. olated bands that are completely absent from the other RNA sample Bands that overlap or are very close to non differentially expressed bands may be difficult to isolate and clone Bands that are strongly expressed in one RNA sample and weakly expressed in other samples may not correspond to true differentially expressed mRNAs A Purification of DNA Fragments from Dried Polyacrylamide Gels 1 8 Align the autoradiograph on top of the dried gel on Whatman paper Use tape or some other method to keep the autoradiograph firmly and precisely aligned on top of the dried gel during the following steps Usingasharp pin or needle markthe differentially expressed bands by poking holes through the film and the gel beneath Using a clean sharp razor or scalpel excise the differentially ex pressed band s from the gel using the pin marks as guides Place each fragment of dried gel in a separate 0 5 ml tube Use a clean blade for each band Even small amounts of carryover contamination can cause problems during reamplification and subsequent analysis Add 40 ul of Tricine EDTA buffer 10 mM Tricine pH 9 5 0 2 mM EDTA to each tube TE buffer 10 mM Tris HCl pH 8 0 1 mM EDTA or sterile can also be used Overlay with 2 3 drops of mineral oil Heat at 100 C for 5 min Carefully remove the Whatman paper Leave as much liquid as possible in the tube Discard the Whatman paper in the appropriate radioactive waste
40. omena that involve changes in gene expression Delta Differential Display is a highly reproducible method for detecting differentially expressed RNAs In our hands more than 95 of Delta results are reproducible and more than 85 of the differentially expressed bands can be confirmed by Northern blot analysis The method requires only 2 ug of total RNA per sample and the primers in the kit give you more than 150 different combinations The protocol requires only a single cDNA synthesis for each different RNA sample in contrast to the multiple cDNA synthesis reactions required for similar methods The longer primers in the Delta Kit allow higher stringency PCR which in turn leads to much greater reproducibility of the resulting displays The use of enzyme mixes suitable for long distance PCR enables the Delta system to resolve differentially expressed bands of up to 2 kb and results in a higher fidelity of PCR products to the original RNA templates Protocol overview The Delta Kit is based on improvements to the methods described by McClelland et al 1993 The protocol consists of two stages cDNA synthesis and differential display PCR Figure 1 First strand cDNA is synthesized using each of the RNAs of interest as a template and oligo dT as a primer In contrast to the 9 12 syntheses required for each different RNA sample in other differential display protocols Liang amp Pardee 1992 Liang et al 1993 the Delta protocol requires on
41. ple we recommend that you perform two positive control cDNA syntheses with the human adult liver and fetal liver total RNA included in the kit positive control RNAs 1 amp 2 respectively This will provide templates for positive controls and thus verify that the system performs in your hands 1 For each RNA sample including positive controls label a sterile 0 5 ml microcentrifuge tube with a number followed by A Note This will distinguish each sample from the B dilution prepared in Steps 16 18 If you are comparing three experimental RNA samples you might label your experimen tal tubes 1A 2A and 3A and your positive controls PC1A and PC2A 2 Combine the following in the appropriately labeled tubes 2ug Total RNA sample 1 ul cDNA synthesis primer 1 uM The volume depends on the concentration of each RNA sample At CLONTECH our total RNA samples are typically 0 5 1 0 mg ml For the positive control RNAs 1 mg ml add 2 ul 3 Add sterile H5O to a final volume of 5 ul Mix contents and spin the tubes briefly in a microcentrifuge 5 Incubate the tubes at 70 C for 3 min Temperatures gt 70 C may lead to degradation of your RNA 6 Cool the tubes on ice for 2 min Spin the tubes briefly in a microcentrifuge 8 Prepare enough Master Mix for all of your cDNA synthesis reactions plus one additional tube per 5 rxn rxns Components 2 10 ul 5X First strand buffer 2ul 10 ul dNTP mix 5 mM 1 ul 5 ul
42. possible The Marathon cDNA Amplification Kit K1802 1 and Marathon Ready cDNAs many from CLONTECH are ideally suited to this task Marathon cDNA amplification is an advanced method for rapid ampli fication of CDNA ends or RACE Unlike conventional RACE Marathon amplification enables you to clone full length cDNAs without screening libraries Like the Delta Differential Display method Marathon RACE reactions use LD PCR enzyme mixes to allow amplification of much larger cDNAs upto 9 kb than can be amplified by conventional RACE Furthermore many different cDNAs can be amplified from the products of a single Marathon cDNA synthesis reaction Because only 23 28 nt of gene specific sequence information are needed the Marathon method is ideally suited to situations where a researcher rapidly identifies many different cDNAs that she or he then wants to clone as is often the case with Delta Differential Display By using Marathon Ready cDNAs researchers can save time while ensuringthe success of three critical aspects ofthe Marathon method purification of high quality poly A RNA synthesis of full length cDNA and efficient complete adapter ligation Marathon Ready cDNAs are available from a wide variety of tissues and organisms At CLONTECH we have used the Marathon Kit to obtain full length cDNAs for numerous genes identified by Delta Differential Display 3 GenomeWalker M Kits Besides cloning the full length cDNA many res
43. ral Considerations 1 The cycling parameters throughout this protocol have been optimized using a Perkin Elmer DNA Thermal Cycler 480 or GeneAmp PCR Systems 2400 9600 Advantage KlenTaq Polymerase Mix and ss cDNA templates prepared from the RNA controls provided in the Delta Kit The optimal cycling parameters may vary with different thermal cyclers 2 We recommend that you use some form of hot start for Delta Differential Display PCR The following protocol has been optimized using TaqStart Antibody Kellogg et a 1994 in the 50X polymerase mix Hot start PCR can also be performed using wax beads D Aquila et a 1991 or manually Chou al 1992 3 Wear gloves throughout the procedure to protect your RNA and cDNA samples from degradation by nucleases 4 When mixing reactions gently pipetthe solution up and down ortapthe bottom of the tube and spin briefly to collect the contents at the bottom of the tube 5 Set up all reactions on ice unless otherwise indicated 6 Add enzymes to reaction mixtures last Make sure that the enzyme is thoroughly mixed with the reaction mixture by pipeting the mixture up and down 7 Usetherecommended amounts of enzyme These amounts have been carefully optimized for the Delta protocol and reagents B Preparation and Handling of Total RNA 1 General precautions The integrity and purity of the total RNA used as starting material is an important element of high quality cDNA synthesis and the
44. rn of the positive control displays may vary with different enzymes different thermal cyclers and other experimental variables but the 380 bp fetal band should always be present in the fetal liver sample PC2 Your experimental displays will vary depending on the source and quality of the RNA samples and the particular combination of primers In general displays will consist of patterns of multiple bands ranging from 100 2 000 nt Typically several dozen distinct bands will be evident in each lane Depending on the relatedness of the RNA samples the number of differentially expressed bands can vary from one or more per display to one per 3 4 displays or more for closely related RNA samples See the discussion Design Considerations for Delta Experiments in Section IV E Ideally total RNA controls should give similar banding patterns to the HO controls using the same primers The pattern in these controls if any may be detectable as a weak background in actual displays B Troubleshooting guide 1 No bands in either the controls or in your experimental samples If you do not see any bands in either the positive controls or in your experimental samples perform 5 additional cycles with the remaining 15 ul of your PCRs a If no products are detectable after the additional cycles you may have a problem with your DNA polymerase Determine that your Taq DNA polymerase is good by performing a conventional PCR with primers and templates
45. se an exo minus N terminal deletion of Tag DNA polymerase as the primary polymerase a minor amount of a secondary polymerase which provides 3 5 proofreading activity and TagStart M Antibody to provide a convenient and automatic form of hot start PCR Kellogg etal 1994 Advantage KlenTaq Polymerase Mix is also available in the Advantage cDNA PCR Kit K1905 1 y CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 6 Version PR19324 Delta Differential Display Kit User Manual Introduction continued There are several advantages to using LD PCR for the identification of differen tially expressed RNAs First in combination with the longer primers used in this kit LD PCR allows us to reduce the total number of PCR cycles from 40 to 25 This means that abundant products are not overcycled and differentially ex pressed bands are easier to detect Secondly the larger range of PCR products up to 2 kb increases your chances of finding differentially expressed bands with each primer combination Finally the higher fidelity of LD PCR means thatbands identified by Delta Differential Display and subsequently cloned will have greater fidelity to the original mRNA sequence CLONTECH PCR Select cDNA Subtraction Kit Another method for comparing RNA populations is CLONTECH s PCR Select cDNA Subtraction Kit K1804 1 a unique PCR based method for powerful reproducible enrichment of differentially expressed ge
46. sed band at 380 bp should always be detectable in cDNA made from positive control RNA 2 NOOR WD www clontech com Protocol PT1173 1 Version PR19324 Delta Differential Display Kit User Manual V Expected Results and Troubleshooting Guide cont d 2 Positive control works but experimental displays look identical to total RNA If the positive controls show the expected patterns but your experimen talsamples have the same banding pattern as the total RNA your initial total RNA may be contaminated with genomic DNA Treat your RNA samples with DNase before performing first strand cDNA synthesis see Section IV C 3 Positive control works but experimental displays total RNA HO controls look identical a If the positive controls show the expected patterns but your experimental samples have the same banding pattern as the total RNA and H O negative controls your initial total RNA may have been of poor quality If you have more RNA you can check the quality by examining several ug on a denaturing formaldehyde 1 agarose EtBr gel If the relative intensity of the 28S RNA band to the 185 RNA band is less than 1 1 you may need to make fresh RNA b Alternatively if you performed the optional DNase treatment of your RNA samples you may have lost your RNA during purification Repeat DNase treatment on a new aliquot of RNA 4 Control displays experimental displays total RNA and H O controls look ide
47. subsequent PCR The following precautions will help you avoid contamination and degradation of your RNA a Wear gloves to avoid RNase contamination from your hands b TreatH O usedin steps that involve RNA with diethyl pyrocarbonate DEPC Note Do not use DEPC to treat solutions containing Tris nucleotides or other amines c Rinse all glassware with 0 5 N NaOH followed by DEPC treated H O Then bake the glassware at 160 180 C for 4 9 hr d Use 70 ethanol or isopropanol to wipe all pipettes before use with RNA CLONTECH Laboratories Inc www clontech com Protocol PT1173 1 12 Version PR19324 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued 2 RNA isolation Whenever possible total RNA samples being compared in a Delta experiment should be purified side by side using the same reagents and protocol Two RNA samples purified from the same source but by a different procedure can give different banding patterns in differential display Thus more false positives may arise if the RNAs being compared were prepared in different ways See Farrell 1993 or Sambrook etal 1989 for reviews of procedures for isolating total RNA 3 RNA analysis After isolating total RNA we recommend that you examine the RNA by electrophoresis of a sample on a denaturing formaldehyde agarose EtBr gel On denaturing gels total RNA typically gives bright 28S and 18S ribosomal RNA bands
48. top aqueous layer to a clean 0 5 ml tube To each tube add 1 10 volume of 3 M NaOAc and 2 5 volumes of the total resulting volume of 95 ethanol Vortex the tubes thoroughly Centrifuge the tubes for 20 min at 14 000 rpm at room temperature Carefully remove the supernatants Gently overlay the pellets with 200 of 8096 ethanol Centrifuge at 14 000 rpm for 5 min Carefully remove the supernatants Air dry the pellets for 5 10 min Dissolve each pellet in 1 5 of for each 2 ug of starting RNA If possible measure the final concentration of each RNA sample Store samples at 20 C CLONTECH Laboratories Inc www clontech com Protocol 4 PT1173 1 14 Version PR19324 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued D First Strand cDNA Synthesis The 10 ul reaction described below is designed to convert 2 ug of total RNA into first strand cDNA This kit contains enough components for 12 sepa rate cDNA syntheses In most applications you will perform two or more separate cDNA syntheses in parallel one for each tissue stage or cell culture condition that you wish to compare The following protocol is written for total RNA Poly A RNA can also be used but in our experience poly A RNA gives no more differentially expressed bands than total RNA If you use poly A RNA you will need fewer cycles for PCR Section IV E In addition to your experimental sam
49. tories Inc Version PR19324 21 Delta Differential Display Kit User Manual IV Protocol for Delta Differential Display continued G Electrophoresis and Autoradiography Delta Differential Display products can be up to 2 kb For maximum resolution we recommend using some form of temperature controlled thermostatic electrophoresis system such as the Macrophor System from Pharmacia Biotech AB or the genomyxLR DNA Sequencer from Genomyx Corporation Nonthermostatic electrophoresis systems do not resolve differential display bands as well resulting in increased band overlap 1 N 9 A 11 12 13 Pour a denaturing 5 polyacrylamide 8 M urea gel in 0 5X TBE buffer The acrylamide bis acrylamide stock should be 19 1 At CLONTECH we use 0 2 mm spacers for maximum resolution 0 2 mm thick gels are very fragile For large experiments you will need more than one gel Prerun the gel at 33 mA constant current for at least 20 min For each reaction combine 5 ul of the PCR mixture with 5 ul of loading buffer in a clean 0 5 ml tube If desired prepare a molecular weight marker Denature all your samples by incubating at 94 C for 2 min Place tubes on ice immediately Rinse wells of the gel prior to loading Load 2 ul samples with a Hamilton syringe or equivalent device Note Load each control adjacent to the corresponding set of displays Load each RNA control adjacent to the
50. x well by vortexing and briefly spin the tube in a microcentrifuge a 33P dATP produces sharper bands than 32 and thus increases the resolution of differential displays and the number of bands that can be distinguished If you use fresh label you should obtain good overnight exposures With older label or for faster exposures you can increase the amount of label to 0 3 0 5 ul and add proportionately less HO 0 355 is not recommended because it volatilizes upon heating leading to contamination of equipment Trentmann et 1995 6 Aliquot 17 ul of PCR Master Mix into each reaction tube This gives a final volume of 20 ul 7 Add 1 drop of mineral oil on top of PCR mixture and tightly cap the tubes 8 Begin thermal cycling Use a cycler designated for radioactive use Perkin Elmer DNA Perkin Elmer GeneAmp Thermal Cycler 480 PGR Systems 2400 9600 1 cycle 1 cycle 94 C 5 min 94 C 5 min 40 5 min 40 C 5 min 68 C 5 min 68 C 5min 2 cycles 2 cycles 94 C 2 min 94 C 30sec 40 C 5min 40 C 30sec 68 C 5 min 68 C 5 min e 22 25 cycles 23 cycles 94 C 1 94 C 20sec 60 C 1 min 60 C 30sec 68 C 2min 68 C 2min 68 C for an additional 7 min 68 C for an additional 7 min For poly A RNA start with 15 cycles 9 Store the differential display reactions at 20 C until you are ready to examine them on a gel Protocol 4 PT1173 1 www clontech com CLONTECH Labora
Download Pdf Manuals
Related Search