Home
User Manual
Contents
1. Amplicon Size 2 round PCR 251 bp For the Illumina HiSeq and GAIIx Platforms only Primer Name Used for Sequence IDT preferred F2 1st Round 5 TCGGATTCGCACCAGCACGCTA 3 R2 1st Round 5 AGTAGCGTGAAGAGCAGAGAA 3 Gex1 NF2 24 Round 5 TCAAGCAGAAGACGGCATACGATCGCACCAGCACGCTACGCA 3 Gex2 NR2 2 d Round 5 AATGATACGGCGACCACCGAGAGCACCGACAACAACGCAGA 3 GexSeqS HT Sequencing 5 AGAGGTTCAGAGTTCTACAGTCCGAA 3 HPLC Purified FwdU6 1 Standard sequencing 5 CAAGGCTGTTAGAGAGATAATTGGAA 3 FwdU6 2 Standard sequencing 5 CCTAGTACAAAATACGTGACGTAGAA 3 M 3 Common Library Vector Features Feature Function Source Rous Sarcoma Virus RSV enhancer promoter Allows Tat independent production of viral mRNA Dull Rous sarcoma et al 1998 virus HIV 1 truncated 5 Permits viral packaging and reverse transcription of the LTR viral mRNA Luciw 1996 iia dise psi y Allows viral packaging Luciw 1996 HIV 1 packaging signal Jodie MN Permits Rev dependent nuclear export of unspliced HIV 1 RRE viral mRNA Kjems et al 1991 Malim et al 1989 U6 Human U6 promoter drives RNA Polymerase III Human transcription for generation of shRNA transcripts Central polypurine tract cPPT improves transduction cPPT efficiency by facilitating nuclear import of the vector s HIV 1 preintegration complex in the transduced cells Ubiquitin C promoter drives
2. Reagent Life Technologies Cat 18324 020 e Plus Reagent Life Technologies Cat 11514 015 e 15 ml BD FALCON screw cap centrifuge tubes 12 000 RCF rated PP P CHCls resistant BD Biosciences Cat 352196 e Buffer P1 SOmM Tris HCl pH 8 0 10mM EDTA QIAGEN Cat 19051 e RNase A QIAGEN Cat 19101 e Sonicator for Genomic DNA Shearing e Phenol Chloroform pH 8 0 Sigma Aldrich Cat P3803 e DNase I RNase free Epicentre Cat D9905K e Titanium Taq DNA polymerase with PCR buffer Clontech Takara Cat 639242 e dNTP Mix 10 mM each GE Healthcare Cat 28 4065 52 e OlAquick PCR purification kit QIAGEN Cat 28106 e QlAquick Gel Extraction Kit QIAGEN Cat 28706 e Primer for sequencing shRNA inserts in shRNA constructs IDT See Appendix M e PCR primers for barcode amplification from genomic DNA IDT See Appendix M e HT sequencing primers IDT See Appendix M tech cellecta com 6 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual e HT Sequencing Kits Illumina Platform Kit Type Illumina Cat Description Sequencing FC 104 5001 TruSeq SBS Kit v5 GA 36 cycle GAIIx Cluster Generation GD 203 5001 TruSeq SR Cluster Kit v5 CS GA Sequencing FC 401 3002 TruSeq SBS Kit v3 HS 50 cycle HiSeq Cluster Generation GD 401 3001 TruSeq SR Cluster Kit v3 cbot HS NextSeq 500 Sequencing FC 404 2005 NextSeq 500 v2 Kit See Illu
3. to any commercial partner or any other third party for any commercial purpose except only in the following case Customer may transfer the unmodified Product to a commercial third party contractor who pursuant to a written agreement with Customer and only for non royalty based payment s undertakes on behalf of Customer to use the Product solely for Customer s benefit and internal research purposes which third party shall not after termination of such work retain or receive subsequent rights to possess access or use any Product or any results of such work and from whom Customer receives no payments pursuant to such agreement Compliance Customer may only use the Product in compliance with all local state federal and other applicable laws regulations and rules including without limitation for uses in the United States EPA FDA USDA and NIH guidelines Customer may not directly or indirectly use the Product or allow the transfer transmission export or re export of all or any part of the Product or any product thereof in violation of any export control law or regulation of the United Sates or any other relevant jurisdiction Disclaimers THE PRODUCT IS PROVIDED AS IS WITHOUT WARRANTY OF ANY KIND NO WARRANTY IS MADE THAT THE PRODUCT WILL MEET CUSTOMER S REQUIREMENTS OR THAT ANY RESULT CAN BE ACHIEVED OR THAT USE OF THE PRODUCT WILL NOT INFRINGE ANY PATENT OR OTHER PROPRIETARY RIGHT ALL WARRANTIES EXPRESS OR IMPLIED ORAL OR WRITT
4. Cells 2 Twenty four 24 hours prior to transfection plate 12 5 x 109 293T cells in each of twenty 20 15 cm plates or 150 cm flasks Use 30 ml of media per plate Disperse the cells and ensure even distribution At the moment of transfection the cells should have reached 80 confluency Increase or decrease the number of 293T cells seeded if optimal confluency is not achieved in 24 hours Incubate at 37 C in a CO incubator for 24 hours tech cellecta com 7 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual C 2 Day 1 Transfection Twenty 15 cm plates 3 In sterile 50 ml polypropylene tube mix the Ready to use Packaging plasmid mix with the plasmid DECIPHER library and add the plasmid mixture to D MEM medium without serum or antibiotics Add the Plus Reagent mix and incubate at room temperature for 15 min See the table below for the volumes to use 20 X 15 cm plates Component 1200 ul Ready to use Packaging Plasmid Mix 0 5 ug ul 120 ul Plasmid shRNA Library 1 ug pl 24 000 ul D MEM no FBS no antibiotics 1200 ul Plus Reagent 26 520 ul Total volume IMPORTANT DO NOT use less than twenty 15 cm plates to package a batch of hGW or 55K library A smaller amount may cause shRNA insert representation to be adversely affected 4 Add Lipofectamine Reagent to D MEM medium without serum or antibiotics in order to make a convenient m
5. For a complete list of References and Product Citations please see http www cellecta com resources publications M Appendix M 1 Lentiviral shRNA Expression Vector Maps h 1 MluI SphI 96 7438 SspI NruI 612 7114 ScaI EcoNI 945 MfeI 964 BbvCI 1199 6634 AhdI PpuMI SanDI 1709 BspDI ClaI 1798 BsaAI 1928 pRSI16 U6 sh HTS6 UbiC TagRFP 2A Puro 8025 bp BbsI Bpil 2064 BbsI Bpil 2090 PaeR7I PspXI TliI XhoI 2113 EcoRI 2280 Agel 2289 BstBI 2298 AfeI 2358 5741 PciI CPPT ays gue 5319 SfiI XbaI 2702 BsrGI 2764 4699 KpnI 4695 Acc65I 4618 NaeI Bsu36I 2980 PshAI 3354 BamHI 3426 PfIFI Tthi11I 3534 BsiWI 3548 4616 NgoMIV BspEI 3605 4100 HincII RsrII 3608 4098 SalI BstEII 3626 4059 SexAI EagI 3940 For sequences and cassette designs for other standard library vectors please visit the Cellecta website http www cellecta com resources vectors or contact Cellecta at tech cellecta com All Cellecta lentiviral vectors including the hGW vectors are covered by a lentiviral expression system license owned by Life Technologies Corporation LTC See Terms and Conditions tech cellecta com 18 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual M 2 HT Sequencing Primers HTS6 Cassette e g pRSI16 U6 sh HTS6 UbiC TagRFP 2A Puro
6. or indirectly in humans for any purpose Customer may not isolate extract reverse engineer derive copy or separately use any component of the Product such as for example any shRNA component for any commercial purpose including without limitation for the purpose of making Products other than solely for Customer s internal research purposes Non Profit Customers If Customer is a Non Profit Entity then the following additional restrictions shall apply Customer obtains no right to use the Product for any commercial purpose Commercial Customers If Customer is a Commercial Entity unless Customer has already entered into a separate written agreement that has been executed by CSHL that covers the shRNA IP rights and that is then currently in effect then the following additional restrictions shall apply This License and Customer s rights hereunder automatically terminate 1 year after delivery of Product to Customer After 1 year of Product use customer must enter into a separate written agreement with CSHL that covers the shRNA IP rights or Customer shall immediately stop using and destroy all Product in its possession The Product may not be used to make any mouse that is of a strain of mice for germ line transmission by embryonic transfer of a gene encoding an ShRNA that induces suppression of a gene or genes by RNAi No Transfers Customer may not distribute or transfer the Product by license sale loan lease rental or any other means
7. EN ARE HEREBY EXPRESSLY DISCLAIMED INCLUDING WITHOUT LIMITATION ALL IMPLIED WARRANTIES OF NON INFRINGEMENT QUIET ENJOYMENT MERCHANTABILITY OR FITNESS FOR ANY PARTICULAR PURPOSE AND ALL WARRANTIES ARISING FROM ANY COURSE OF DEALING COURSE OF PERFORMANCE OR USAGE OF TRADE Other Uses Except for the limited use expressly specified above no other license is granted no other use is permitted and CSHL retains all rights title and interests in and to the shRNA IP Rights Nothing herein confers to Customer by implication estoppel or otherwise any right or license under any patent patent application or other proprietary intellectual property right of CSHL other than the shRNA IP Rights For information on purchasing a license to use the Product for longer time periods in greater quantities or for other purposes or to practice more broadly under the shRNA IP Rights or to practice under other CSHL intellectual property rights please contact the CSHL Office of Technology Transfer at 516 367 8301 Definitions Affiliate means at the time of reference thereto any corporation company partnership joint venture or other entity which controls is controlled by or is under common control with the subject entity where control means direct or indirect ownership of more than 50 of i the outstanding stock or other voting rights entitled to elect directors or ii all ownership interests or in any country where the local law shall not permit foreig
8. NA Libraries please email technical support at tech cellecta com with the answers to the questions below if applicable Library Used 1 Which library did you use and which Module s 2 What are the lot numbers Packaging the Library 1 What was the lentiviral titer and what was the total number of TU packaged 2 How was the virus concentrated if applicable Transducing Target Cells 1 What MOI did you use to transduce your target cells 2 What target cells did you use 3 How many replicates did you use i e duplicate triplicate etc 4 Did you use puromycin after transduction and at what concentration 5 For how long did you use puromycin on the cells RNAi Screen 1 Could you briefly explain your experiment 2 How many infected cells were used Sample Preparation amp HT Sequencing 1 Describe the protocol you used to amplify the barcodes 2 What HT sequencing system and which Illumina HT Sequencing Kits did you use 3 How much PCR product was used for HT Sequencing 4 How many sequences were read per sample 5 Would you be able to send us the raw data so that it may help us diagnose the issue Please refer to the questions above and contact us by phone or email Phone 1 650 938 3910 Toll Free 1 877 938 3910 Fax 1 650 938 3911 E mail Technical Support tech cellecta com General Information info cellecta com Sales sales cellecta com Orders orders cellecta
9. aq DNA polymerase mix Clontech Takara Use of other PCR enzymes and or thermal cyclers may require additional optimization The lentiviral shRNA library and PCR primer designs include sequences complementary to the sequences of the immobilized primers necessary for generating amplification clusters in Illumina s GAIIx or HiSeq Flow Cells Our library design is only compatible with Single Read Flow Cells in the SingleRead Cluster Generation Kit because our primers are not complementary to the sequences immobilized on Paired End flow cells in the Paired End Cluster Generation Kit See Required Materials for the appropriate Illumina catalog numbers HT sequencing of samples on the Illumina MiSeq is not supported The goal of the first PCR is to amplify barcodes from genomic DNA The goal of second PCR which uses only 596 of volume from the 1st PCR with nested PCR primers is to separate the amplified barcodes from non specific PCR products and excess genomic DNA These extraneous contaminants can interfere with gel purification of the amplified barcodes Moreover the nested PCR primers introduce sequences complementary to the oligos immobilized in the Illumina flow cell which are required for sequencing Use 10 ng of plasmid shRNA library as an amplification control in the first round of PCR and the PCR product from this amplification for the remaining steps F 1 First Round of PCR The first round of PCR serves to amplify the barcodes remai
10. aster mix according to the table below Mix gently 20X plates Component 24 000 ul D MEM no FBS no antibiotics 1800 ul Lipofectamine 25 800 ul Total volume 5 Add the diluted Lipofectamine Reagent from step 4 to the DNA Plus Reagent complex from step 3 mix gently by flicking the tube or vortexing and incubate at room temperature for 15 min 6 Add 2 5 ml of the DNA Plus Reagent Lipofectamine Reagent complex from step 5 to each 15 cm plate from step 2 and mix complexes with medium by gentle rotation Take care not to dislodge cells from the plate Incubate at 37 C in the CO incubator for 24 hours C 3 Day 2 DNAse I Treatment 7 At 24 hours post transfection replace the medium containing complexes with fresh 30 ml D MEM medium supplemented with 10 FBS DNase I 1 U ml MgCl 5 mM 20mM HEPES pH7 4 Continue incubation in the CO incubator at 37 C overnight Overnight DNase I treatment before harvesting virus does not negatively affect lentiviral titer or infectivity and helps prevent undesirable carryover of plasmid library into the virus prep NOTE Failure to change the media the day after transfection results in large carryover of plasmid free and or Lipofectamine bound in your lentiviral prep This may cause problems with most downstream molecular biology applications especially whenever there is a PCR step involved tech cellecta com 8 of 23 v4a 9 15 2015 Celle
11. ation and HT Sequencing I 1 No PCR Product Problem Incorrect primers or bad reagents used or missing reagents or low transduction of target cells or poor DNA prep with PCR inhibitors Solutions Include 10 ng of plasmid library DNA as a positive control If it produces the correct amplification product the problem lies with absent or low numbers of barcodes e g low MOI or problems with the transduction efficiency or impurities in genomic DNA which block barcode amplification If the positive control works dilute the genomic DNA 2 5 fold and repeat the amplification step using 180 wg of genomic DNA in several PCR test tubes If not confirm use of the correct primers and reagents Verify that primer sequences are correct Please see Appendix M I 2 No barcodes present in HT Sequencing results Problem Incorrect primer used in Illumina Solexa Cluster Generation step Solution Ensure that you or the HT Sequencing core facility uses the proper GexSeq Sequencing primer see Appendix M NOT the Sequencing primer that comes with the Illumina Cluster Generation Kit Problem Incorrect Cluster Generation kit used Solution Ensure that you or the HT Sequencing core facility uses the proper Single Read Cluster Generation Kit see Required Materials tech cellecta com 15 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual J Technical Support For help with using hGW Pooled Lentiviral shR
12. com Blog http www cellecta com blog Postal Mail Cellecta Inc 320 Logue Ave Mountain View CA 94043 tech cellecta com 16 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual K Safety Guidelines The HIV based lentivector system is designed to maximize its biosafety features which include e A deletion in the enhancer of the U3 region of 3 ALTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells e The RSV promoter upstream of 5 LTR in the lentivector allows efficient Tat independent production of lentiviral RNA reducing the number of genes from HIV 1 that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev The corresponding proteins are expressed from different plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev are present in the packaged lentiviral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Lentiviral particles will carry only a copy of your expression construct Despite the above safety featu
13. cta hGW shRNA Libraries www cellecta com User Manual C 4 Day 3 Collect Lentiviral Supernatant 8 At 48 hours post transfection collect all 30 ml of the virus containing medium from each plate and filter the supernatant 600 ml through a Nalgene 0 2 um PES filter a low protein binding filter to remove debris and floating packaging cells Failure to filter supernatant could result in carry over of cells into your lentiviral prep NOTE Usually the peak of virus production is achieved at 48 hours post transfection Supernatant can also be collected again at 72 hours post transfection replace the collected 48 hour supernatant with 30 ml of fresh D MEM medium supplemented with 10 FBS 20mM HEPES pH7 4 and continue incubation in the CO incubator at 37 C for 24 hours CAUTION You are working with infectious lentiviral particles at this stage Please follow the recommended guidelines for working with BSL 2 safety class materials see Safety Guidelines 9 Proceed to concentration step or aliquot and store the non concentrated supernatant at 80 C Freezing and thawing usually results in 20 loss of lentiviral titer with each cycle Cellecta offers lentiviral packaging services Please contact us at sales cellecta com or visit http www cellecta com products and services lentiviral packaging for more information C 5 Concentrating Virus Optional Although concentrating virus is optional it is recommended if 1 v
14. e Product are covered by US and foreign patent applications or patents and other proprietary intellectual property rights owned by CSHL shRNA IP Rights Subject to Acceptance and all terms and conditions of this License sale of the Product to Customer by Seller acting under its license from CSHL an Authorized Sale conveys to Customer only the nonexclusive nontransferable right under the shRNA IP Rights to use the Product solely for Customer s internal research purposes and only at its facility where the Products are delivered by Seller Unlicensed Products Any Product that is acquired other than pursuant to an Authorized Sale including without limitation any Product not acquired from Seller shall be deemed to be an Unlicensed Product This License shall be void and of no effect for Unlicensed Products and shall not convey any express or implied right to make use or sell Unlicensed Products for any purpose Restrictions Customer obtains no right to sublicense it rights or to use the Product for the benefit of any third party for any commercial purpose including without limitation using the Product in connection with providing services to any third party or generating commercial databases The Product may not be used in vitro or in vivo for any diagnostic preventative therapeutic or tech cellecta com 22 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual vaccine application or used directly
15. echnology to make or sell products or offer services for consideration in the research market requires a license from Life Technologies Corporation 5791 Van Allen Way Carlsbad CA 92008 Evrogen IP JSC End User Label License for the use of lentiviral shRNA constructs comprising TagRFP encoded gene This product is for internal non commercial research use only No rights are conveyed to modify or clone the gene encoding fluorescent protein contained in this product The right to use this product specifically excludes the right to validate or screen compounds For information on commercial licensing contact Evrogen Licensing Department email license evrogen com Cold Spring Harbor Laboratory CSHL End User Label License for use of expression vectors encoding an shRNA Acceptance This Limited Use License License contains the exclusive terms and conditions between CSHL and Customer for use of the Product By opening the Product container or in any other way accessing or using the Product Acceptance you will create a binding legal contract upon the terms and conditions herein without modification Customer s purchase order or similar terms shall not apply to this License If you are not authorized by Customer to enter into this License or do not agree to all terms and conditions in this License then you are prohibited from opening the Product container or otherwise accessing or using the Product Permitted Use Portions of th
16. eeeeeesseesaes 9 C 5 Concentrating Virus Optional srcour a SE 9 D Transduction Protocols Lentiviral Titer Estimation and Screening Protocols 10 E Genomic DNA Extraction for Barcode Amplification and HT Sequencing sees 10 F Amplification of shRNA specific Barcodes from Genomic DNA sees 11 er First ROUNG Wo Ri 0p 11 F 2 Second ROUNA of PCR retten retur Ee DERE ERE e Re a ERR LEER VE See Ea CER XR sient Rue NEUE dIE Ei 12 G HT Sequencing of Pooled shRNA specific Barcodes on IIlumina s GAlIx or HiSeq 14 H Barcode ENUMENAtIOM casei itor erm eet Deni ATE ete E E aE Eaa EE ever ee ER MESH FEARS 15 l Troubleshooting Difficulties with Probe Preparation and HT Sequencing essss 15 1 1 NO PCR Product d aN ian 15 1 2 No barcodes present in HT Sequencing results cceccessssecececeseesenececeescesscaaeaeeeesessseseaeens 15 J Technical SUP POM lt 5 ecee lt 16 K Safety GUISES 254 sent tete tti PUN EIE D NE USE Ne ILU ens 17 L aicut MR 18 M ADDGIdDstiecoseiii em doit urne mei eri eM LEM 18 M 1 Lentiviral shRNA Expression Vector Maps cccccccccsssceceessececeeseeeecsesaeeecsesaeeecsesaeeeceesaeeeeeeaaes 18 M 2 HT Sequencing Primers HTS6 Cassette eeesesss
17. ered to be functional M 6 hGW Barcode Analyzer and Deconvoluter This software is required to convert raw HT sequencing data from hGW library screens into a summary file for subsequent processing and it includes annotation for every identified gene Next data can be processed edited normalized and transformed using your data analysis tool of choice such as SAS SPSS or for simpler analyses Microsoft Excel contacting tech cellecta com tech cellecta com 21 of 23 The software is available for hGW customers by v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual N Terms and Conditions Cellecta Inc Limited License Cellecta grants the end user the Recipient of the Pooled Lentiviral shRNA Libraries and Vector the Product a non transferable non exclusive license to use the reagents for internal research use only as described in the enclosed protocols in particular research use only excludes and without limitation resale repackaging or use for the making or selling of any commercial product or service without the written approval of Cellecta Inc separate licenses are available for non research use or applications The Product is not to be used for human diagnostics or included used in any drug intended for human use Care and attention should be exercised in handling the Product by following appropriate research laboratory practices Cellecta s liabilit
18. ery high titer virus stock is needed to achieve desired MOI in hard to transduce target cells 2 virus should be suspended in another media besides DMEM 10 FBS which is optimal for sensitive target cells or 3 18h post tranduction baseline control is used in your screen to minimize problems with possible plasmid library carry over However because of the additional manipulation of samples there is the added risk of contamination and loss of virus The following protocol was optimized to concentrate virus with high recovery The protocol assumes that lentiviral supernatant was harvested 48 hours after transfection and filtered as in step 8 above 1 Aliquot lentiviral supernatant in clear sterile centrifuge tubes 2 Add LentiFuge to a final concentration of 5 ug ml and incubate for 1 hour at 4 C 3 Centrifuge at 10 000 rpm for at least 1 hour at 4 C in a Beckman JA 14 or JA 10 or equivalent rotor Mark the tubes to identify the location where the pellet will be At the end of centrifugation you may or may not be able to see a pellet assume it is at the location of the mark 4 Immediately discard the supernatant by aspirating Place the tubes on ice resuspend the in visible pellet in PBS 10 FBS or PBS 1 BSA make aliquots and freeze at 80 C Alternatively you may concentrate virus by the any of the methods below However the yield of virus is superior 80 recovery using Cellecta s protocol above e Ultracentr
19. es vectors e HT Sequencing QC data of plasmid library http www cellecta com resources vectors tech cellecta com 4 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual The vector map sequence feature map and restriction map can be downloaded from http www cellecta com B 2 Materials Available Separately from Cellecta e Lentiviral packaging mix Cat CPCP K2A Libraries can be packaged into lentiviral particles with nearly any 2 d or 3 generation HIV based lentiviral packaging mix Cellecta s lentiviral packaging mix contains two plasmids psPAX2 and pMD2 G pre mixed in an appropriate ratio e Positive control targeting lentiviral shRNA constructs Custom or premade e Negative control non targeting lentiviral shRNA constructs Custom or premade e Linearized shRNA expression vector for cloning individual constructs used to validate hits from your screen e LentiFuge lentiviral concentration reagent The following custom services are available from Cellecta at additional cost For more information visit www cellecta com email us at sales cellecta com or call 1 650 938 3910 Additional Products and Services Catalog Ready to Use Packaging Plasmid Mix 250 ug CPCP K2A LentiFuge Viral Concentration Reagent 1000X for 1 L supernatant LFVC1 HT Sequencing of hGW Library experimental samples frozen cells DNA CANA SQ CANA SQD or xenograf
20. eseseseeeee eene nnn ann n an ih inihi aia a n inan 19 M 3 Common Library Vector Features ccccccssssecececeesesenncaeceeeceseeseaeaecececseseseeaeaeeeeesessessaeaeeeesens 19 M 4 hGW Library HT Sequencing Q C Data cccsccsssscecececessesseaeeeseeeessscseaeeeeeeseeeseseaeeeesesseesees 20 tech cellecta com 2 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual M 5 hGW Library Individual Clone Sequencing Q C Data ssseseseseneneennn nnne 21 M 6 hGW Barcode Analyzer and Deconvoluter ssesssssseseseseeeeeee nennen enne nnns 21 N Terms and Condition S sereset tn naci tenti ee ha Eae c y ee Ra NENNE RC Ee IN aod e aae ee aa edu 22 A Background The Human Genome Wide pooled lentiviral shRNA library hGW targets all 19 276 protein encoding genes It covers all genes in the human genome and each gene is targeted by 8 hairpins We have incorporated clonal barcodes to enable you to track growth differentiation or migration of specific cells containing a specific shRNA throughout your experiment The hGW consists of three modules each covering 6 500 genes Since each gene is targeted by 8 hairpins there are a total of 55 000 hairpins per module The modules are made with non overlapping barcodes so that they can be combined to form a complete genome wide shRNA library Each hairpin in the hGW includes a clonal barcode which facilitates HT sequencing data anal
21. expression of TagRFP and UbiC promoter PuroR Human tech cellecta com 19 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual TagRFP fluorescent protein Evrogen serves as an 2 Anene d indicator of successful transduction Fntacmaea quadricolor Thosea asigna virus 2A translational cleavage site containing 18 amino acid residues Cleavage occurs via a co translational ribosome skipping mechanism Thosea asiqna 2A T2A between the C terminal glycine and proline residues vifus g leaving 17 residues attached to the end of TagRFP and 1 residue to the start of the puromycin resistance marker in the hGW vectors PuroR Puromycin resistant marker for selection of the Streptomyces transduced cells alboniger i E uci uU ge Lind y hepatitis virus transcripts 3 Self inactivating long terminal repeat Allows viral packaging but self inactivates the 5 LTR for biosafety purposes Dull et al 1998 The element also contains AU3 HIV 1 a polyadenylation signal for transcription termination truncated 3 LTR and polyadenylation of mRNA in transduced cells HIV 1 Required for viral reverse transcription self inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA 2v40 F Allows transcription termination and polyadenylation of polyadenylation SV40 A mRNA signal SV40 Ori Allow
22. f analytical PCR with nested primers in each 100 ul reaction 5 pl First Round PCR Product 5 ul Forward 2 round PCR primer 10 pM 5 ul Reverse 2 round PCR primer 10 uM 2 pl 50X dNTP Mix 10 mM each 10 ul 10X Titanium Taq Buffer 71 pul Deionized water 2 ul 50X Titanium Taq 100 ul Total volume tech cellecta com 12 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual Run PCR under the following cycling conditions 94 C 3 minutes 1 cycle 94 C 30 seconds 10 12 or 14 cycles 65 C 10 seconds 72 C 20 seconds 68 C 2 min Please see Appendix for primer sequences for vectors with HTS6 shRNA cassettes NOTE During the PCR please take a 5 ul aliquot from the tube after 10 12 and 14 cycles and save it for the next step The goal is to find the optimal cycle number in order to avoid overcycling of PCR reactions which can result in the generation of a longer fragment that corresponds to a fusion double barcode product 2 The amplified barcodes are then analyzed on a 3 5 agarose 1XTAE gel load 5 ul lane The results should reveal a bright band of amplified barcode products HTS6 cassette 251 bp The goal of this analytical PCR step is to optimize the starting amount of First Round PCR product and the number of cycles if necessary in order to achieve equal intensities of a single band across all DNA samples from the genetic screen 3 Repeat second round ampli
23. fication of barcodes from each sample using the optimized volume of First Round PCR product 2 x 100 ul of Second Round PCR product per sample and 12 18 cycles of PCR Set up 2 x 100 ul reactions for each sample containing an adjusted equal amount of First Round PCR product 2 ul or more Prepare a master mix for the second prepration PCR X ul First Round PCR Product 10 ul Forward 24 round PCR primer 10 uM 10 ul Reverse 2 d round PCR primer 10 uM 4 ul 50X dNTP 10 mM each 20 ul 10X Titanium Taq Buffer Y ul Deionized water 4 ul 50X Titanium Taq 200 ul Total volume Split into 2 x 100 ul reactions Perform PCR under the following cycling conditions 94 C 3 minutes 1 cycle 94 C 30 seconds 12 or 14 cycles the number of 65 C 10 seconds cycles that worked the best in the previous step 72 C 10 seconds 68 C 2 min tech cellecta com 13 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual 4 Analyze the PCR products by gel electrophoresis on a 3 5 agarose 1XTAE gel in order to ensure equal yields of amplified barcodes for all samples Combine amplified barcodes from the 2 x 100 ul Second Round PCR reactions and purify the samples as follows a Purify the PCR product with the QlAquick PCR purification kit QIAGEN following the manufacturer s protocol In the last centrifugation step use a centrifuge spin filter at maximum speed for 5 minutes This is to dry the membrane co
24. ifugation at 50 000 g for 90 minutes at 4 C e Sucrose cushion ultracentrifugation e PEG precipitation followed by centrifugation tech cellecta com 9 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual D Transduction Protocols Lentiviral Titer Estimation and Screening Protocols For complete protocols on transduction of target cells with pooled lentiviral shRNA libraries titer estimation and examples of screening protocols please see the Pooled Lentiviral shRNA Library Screening Reference Manual E Genomic DNA Extraction for Barcode Amplification and HT Sequencing Identification of shRNA barcodes in the experimental samples requires amplification of the barcode portion of the integrated lentiviral constructs from sample genomic DNA Subsequent high throughput sequencing of barcodes by the Illumina GAIIx or HiSeq is done to quantify each barcode and generate digital expression data using Deconvolution software We currently do not support HT sequencing of samples on the Illumina MiSeq Cellecta now offers sample prep HT sequencing and analysis services Please contact us at sales cellecta com or visit http www cellecta com products services cellecta pooled lentiviral libraries next gen sequencing and analysis for more information Due to the large amount of cells and resulting genomic DNA the following protocol is recommended for isolating genomic DNA rather than using a co
25. lely for convenience to describe the major groups of genes targeted in the module Many genes targeted in a module do not fall within the description all modules target a variety of genes throughout the genome and not all genes generally considered to fall under a specific description will be found in the module with the specific gene description Please refer to the gene lists and complete gene annotations associated with each module for detailed information regarding which genes are present in each specific module on our website www cellecta com B hGW Pooled shRNA Library Required Materials B 1 Included Materials e For Plasmid Library purchases 200 ug of each plasmid library ordered in the pRSI16 U6 sh 13kCB18 HTS6 UbiC TagRFP 2A Puro vector enough to generate lentivirus for approximately 50 100 screens depending on cell type e For Virus Library purchases Aliquots of virus at the ordered titer plus a small amount of extra packaged library for titering purposes Exact number and titer are indicated on the Product Analysis Certificate e For Plasmid Library purchases 10 ug empty library vector as a packaging and transduction control or after linearization by BbsI Bpil restriction digest for cloning individual constructs used to validate hits from your screen e User Manual and Product Analysis Certificates http www cellecta com resources protocols e List of shRNA and barcode sequences http www cellecta com resourc
26. ls This Internal Use only license grants End Users the sole right to use and fully consume or destroy this product the Product Use of the Product is limited to Research Use ONLY not for diagnostic procedures solely to determine genetic loss of function with short hairpin RNA shRNA interference libraries In all cases sale or other transfer or distribution to third parties of i the Product or any portion of the Product ii DNA RNA and protein constructs or libraries created from the Product or any portion of the Product or of iii transformed phage viruses cells or tissues created directly or indirectly from the Product or any portion of the Product is strictly prohibited without prior written approval by Agilent Technologies Inc Life Technologies Corporation End User Label License for the use of Lentiviral Expression System This product or service based upon the Lentiviral Expression System is sublicensed from Life Technologies Corporation under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 6 218 187 6 428 953 6 924 144 7 083 981 and 7 250 299 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for nonhuman research use requires a license from GBP IP LLC Please contact GBP IP LLC 537 Steamboat Road Suite 200 Greenwich CT 06830 Use of this t
27. mina website for information on HiSeq 2500 rapid run kits NOTE We currently do not support HT sequencing of samples on the Illumina MiSeq B 4 Related Services from Cellecta e Custom Pooled shRNA Library Construction e RNAi Functional Genetic Screens with Pooled shRNA Libraries Cat CRGS X e HT Barcode Sequencing of Cell Pellets DNA or Xenografts from RNAi Screen with Cellecta Library e Pre made and Custom shRNA and CRISPR Constructs e Linearized shRNA Expression Vectors C Packaging Protocol for Pooled Lentiviral shRNA Libraries The following protocol describes the generation of a packaged Human Genome Wide pooled lentiviral 55K shRNA library 55K shRNA complexity using Invitrogen s Lipofectamine and Plus Reagent Other transfection reagents may be used but the protocol should be adjusted to fit the manufacturer s protocol The yield of recombinant lentiviral particles typically produced under these optimized conditions is 1 10 x 105 TU ml In this protocol using twenty 20 15 cm plates at least 6 x 108 TU of total lentiviral particles can be made and then concentrated to up to 100 fold using several described methods We do not recommend scaling down the lentiviral packaging protocol due to risk of compromising the representation of the shRNA library 1 Start growing 293T cells in D MEM medium plus glutamine supplemented with 1096 FBS without antibiotics 2 to 3 days prior to transfection C 1 Day O Plate
28. mmercial column based kit Use of a commercial column based kit may result in loss of genomic DNA and loss of representation of barcodes that survived the screening protocol If you are starting with fewer than 1 million cells we recommend using the Qiagen QIAamp DNA Micro Kit according to the manufacturer s instructions instead of using the protocol here NOTE Use of disposable tubes is highly recommended in order to avoid contamination 1 Suspend cell pellet in 5 ml QIAGEN buffer P1 with RNaseA in 15 ml POLYPROPYLENE phenol chloroform resistant BD FALCON screw cap centrifuge tube 12 000 RCF rated BD Biosciences Cat 352196 2 Add 0 25 ml 10 SDS mix and incubate 5 minutes at RT Using an ultrasonic homogenizer sonicate to shear DNA into 10 100 kb sized fragments To prevent cross contamination thoroughly wash the ultrasound head with running water and dry with clean paper towel between samples 4 Add 10 ul of proteinase K mix and incubate 15 minutes at RT Add 5 ml Phenol Chloroform Isoamyl Alcohol solution vortex hard and spin down 60 min 20 C at 8 000 rpm in JA 14 or equivalent rotor Beckman 6 You should have about 5 ml of clear upper phase Transfer 4 ml of upper phase to new 15 ml DISPOSABLE screw cap tube same as in Step 1 7 Add 0 5 ml 3M Sodium Acetate 4 ml isopropanol mix well and spin down 30 min 20 C at 8 000 rpm in JA 14 or equivalent rotor 8 In order to have a more visible pellet c
29. mpletely to avoid ethanol contamination in the purified PCR product b Separate by electrophoresis in a preparative 3 5 agarose 1XTAE gel c Cut out band and extract DNA from the gel using the QIAquick gel purification kit QIAGEN d Quantitate using A260 nm measurement using NanoDrop spectrophotometer or equivalent and adjust concentration to 10nM 1 8 ng ul for 251 bp HTS6 product G HT Sequencing of Pooled shRNA specific Barcodes on Illumina s GAIIx or HiSeq HT sequencing of pooled amplified barcodes can be performed on the Illumina GAIIx 20 30 million reads per sample or HiSeq 80 100 million reads per sample using the GexSeq sequencing primer and following the manufacturer s protocol The final concentration of GexSeq primer in the reaction should be 500 nM For the cluster generation step use 20 fmoles 2 ul of 10 nM PCR product of the gel purified band from the 2 d round of PCR The number of cycles read length required depends on the length of the barcode and is 44 for the hGW library The shRNA library and PCR primer designs include sequences complementary to the sequences of the immobilized primers necessary for generating amplification clusters in Illumina s GAIIx or HiSeq flow cells Our design is only compatible with Single Read Flow Cells in the Single Read Cluster Generation Kit because our primers are not complementary to the sequences immobilized on Paired End flow cells in the Paired End Cluster Gene
30. n equity participation of 50 or more then the direct or indirect ownership or control of the maximum percentage of such outstanding stock voting rights or ownership interests permitted by local law Commercial Entity means any entity or organization other than a Non Profit Entity CSHL means Cold Spring Harbor Laboratory Customer means the company or other entity or organization that orders pays for and takes delivery of the Product Non Profit Entity means any college university or governmental entity including without limitation governmental and quasi governmental institutes and research laboratories or any non profit scientific research or educational organization that is of the type described in section 501 c 3 of the Internal Revenue Code or that is qualified under a state non profit organization statute Product means a product including without limitation expression vectors encoding an shRNA the design manufacture or use of which in whole or in part is the subject of the shRNA IP Rights and is deemed to include all components progeny reproductions modified versions and other derivatives thereof Seller means Cellecta Inc 2015 Cellecta Inc All Rights Reserved Trademarks CELLECTA is a registered trademark of Cellecta Inc CRL 11268 is a trademark of ATCC Invitrogen Lipofectamine and Plus Reagent are trademarks of Life Technologies Corporation tech cellecta com 23 of 23 v4a 9 15 2015
31. nd using pooled shRNA lentiviral libraries information on transduction of target cells viral targeting or for examples of positive and negative screens using pooled lentiviral libraries please read the Pooled Lentiviral shRNA Library Screening Reference Manual The protocols and methods apply specifically to Human Genome Wide Modules 1 3 To ensure you have the latest version of this user manual please visit http www cellecta com resources protocols IMPORTANT The barcode sequences in the Human Genome Wide Modules do not overlap therefore these modules can be combined in any step of the procedure including HT Sequencing tech cellecta com 3 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual Library Vector Target Genes Catalog mRNA shRNA HGW M1 P2 plasmid Human Module 1 pRSI16 Signaling Pathways 6 500 55 000 HGW M1 V8 reg titer virus HGW M1 V9 high titer virus HGW M2 P2 plasmid 6 500 55 000 HGW M2 V8 reg titer virus HGW M2 V9 high titer virus Disease Associated and Human Module 2 pRSI16 Drug Targets HGW M3 P2 plasmid 6 500 55 000 HGW M3 V8 reg titer virus HGW M3 V9 high titer virus Cell Surface Extracellular Human Module 3 pRSI16 DNA Binding HGW P2 plasmid pRSI16 All Modules 19 276 HGW V8 reg titer virus HGW V9 high titer virus Human Modules 1 3 NOTE The module names for hGW are used so
32. ning in the genomic DNA pool after the phenotypic screen is complete We recommend not exceeding 100 wg in 100 ul total volume per reaction Prepare a master mix according to the table below For each sample prepare 4 x 100 yl reactions containing a total of 400 ug of genomic DNA ul Genomic DNA 400 ug 12 ul Forward 15 round PCR primer 10 uM tech cellecta com 11 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual 12 ul Reverse 1 round PCR primer 10 uM 8 ul 50X dNTP Mix 10 mM each 40 ul 10X Titanium Taq Buffer Hl Deionized water 8 ul 50X Titanium Taq 400 ul Total volume Split into 4 x 100 ul test tubes 94 C 3 minutes 1 cycle 94 C 30 seconds 65 C 10 seconds j 16 cycles 72 C 20 seconds 68 C 2 min Please see Appendix for primer sequences for vectors with HTS6 shRNA cassettes F 2 Second Round of PCR The second round of PCR nested PCR is required in order to significantly reduce genomic DNA carryover into the samples used for HT sequencing Additionally the second round PCR primers have complimentary sequence to the immobilized primers in the HT sequencing Illumina flow cells Amplify each DNA sample with the Forward and Reverse 2 round primer set and perform HT sequencing on one sample per lane in the flow cell with the GexSeq primer 1 Combine together the 4 x 100 ul First Round PCR reactions and use a 5 ul aliquot in the second round o
33. ompacted at the bottom of the tube it is recommended to incubate overnight at RT before centrifugation IMPORTANT If starting material is less than 5 million cells add carrier before centrifugation linear polyacrylamide 25 ug ml final and spin down for a longer time 60 min tech cellecta com 10 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual 9 Discard supernatant add 10 ml 70 ethanol spin down 5 min 20 C at 8 000 rpm in JA 14 or equivalent rotor 10 Discard supernatant and air dry pellet 11 Dissolve DNA pellet in appropriate volume of dH20 to a concentration of approximately 2 mg ml Expected yield is about 10 ug per 1 million cells 12 Incubate 30 minutes at 80 C before spectrophotometer reading F Amplification of SshRNA specific Barcodes from Genomic DNA An adequate amount of DNA needs to be used in the first amplification to ensure full representation of the barcodes from all the cells isolated from each experimental sample For negative screens where DNA was isolated in the previous step from 50 million or more cells the pooled barcodes should be amplified from 400 ug of genomic DNA When amplifying barcodes from samples generated by positive selection screens use the entire amount of genomic DNA recovered up to 400 ug with a proportionally fewer number of 100 ul reactions per sample This protocol was optimized using an ABI GeneAmp PCR System 9700 with Titanium T
34. ration Kit 1 Adjust purified PCR samples to 10nM 1 7 ng ul concentration 2 For cluster generation step use Illumina Single Read SR flow cell and for each lane add 2 ul of each sample and add PhiX174 control template based on standard Illumina protocol 3 For HT sequencing step Add GexSeq primer 10 uM i e 20x to the PhiX174 primer to a final concentration of 0 5 LM 4 Run HT sequencing reaction for the appropriate number of cycles with GexSeq PhiX174 primer mix See Required Materials for a list of recommended Illumina kits for HT Sequencing of samples transduced with a Cellecta library Please see Appendix for HT sequencing primer sequences for vectors with HTS6 shRNA cassettes For other vectors refer to the Product Analysis Certificate that came with the product or contact Cellecta Cellecta now offers sample prep HT sequencing and analysis services Please contact us at sales cellecta com or visit http www cellecta com products services cellecta pooled lentiviral libraries next gen sequencing and analysis for more information tech cellecta com 14 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual H Barcode Enumeration Software for conversion of raw sequencing data to number of reads for each barcode for Human Genome Wide shRNA Libraries is available from Cellecta Please contact tech cellecta com I Troubleshooting Difficulties with Probe Prepar
35. res use of HIV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous lentiviral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov biosafety publications bmbl5 bmbl5 sect iv pdf It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and follow standard microbiological practices which include e Wear gloves and lab coat at all times when conducting the procedure e Always work with lentiviral particles in a Class II laminar flow hood e All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory tech cellecta com 17 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries User Manual www cellecta com L References
36. s for episomal replication of plasmid in eukaryotic SV40 cells Js bacterium Amp a reeset Ex P paratyphi pUC ori pUC bacterial origin of replication pUC c element on complementary strand M 4 hGW Library HT Sequencing Q C Data Complete Plasmid shRNA Library HT sequencing data for all modules is available http www cellecta com resources Plasmid HT Sequencing data may be used as negative control untreated untransduced day 0 data for many types of genetic screens tech cellecta com 20 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries User Manual www cellecta com The shRNA barcode representation histograms for individual hGW libraries are available on the PAC forms available on the Cellecta website at http www cellecta com resources protocols M 5 hGW Library Individual Clone Sequencing Q C Data hGW Libraries in pRSI16 Vector hGW Library Human M1 Human M2 Human M3 Plasmid Lot 12121403 12121403 12121403 Library Complexity number of clones 100 x 108 100 x 108 100 x 108 Number of random clones picked 72 72 72 Correct Structure with clonal barcode gt 95 gt 95 gt 95 Number of clones with at least one mutation nite 12 12 12 deletion or insertion Mutation Deletion Insertion Rate 0 1 0 1 0 1 Estimated of Inserts without any mutations deletions or insertions in antisense portion and gt 95 gt 95 gt 95 consid
37. t CANA SQT Pre made or Custom Lentiviral shRNA Constructs Plasmid or Packaged Many Cloning hGW Module into Custom shRNA library vector Inquire tech cellecta com 5 of 23 v4a 9 15 2015 Cellecta hGW shRNA Libraries www cellecta com User Manual B 3 Materials Needed from Other Vendors e 293T 17 Cell Line ATCC Cat CRL 11268 e Dulbecco s Modified Eagle Medium D MEM 1X Mediatech CellGro Cat 15 013 CV NOTE ADD FRESH GLUTAMINE 1X at the time a sealed bottle of D MEM is opened even if the label indicates glutamine has already been added Glutamine in solution at 4 C has a half life of 1 2 months so glutamine D MEM purchased off the shelf from a supplier is to be regarded as glutamine In our experience the addition of glutamine increases titer approximately 2 fold If D MEM comes supplemented with stable L Alanyl L Glutamine dipeptide addition of fresh glutamine is not necessary e HEPES e MgCl e Glutamine L Alanyl L Glutamine Dipeptide L glutamine Mediatech Cat 25 015 CI e Fetal Bovine Serum recommended Mediatech Cat MT 35 010 CV e Puromycin e D PBS Mediatech Cat 21 031 CV e Trypsin EDTA Mediatech Cat 15 040 CV e Polybrene hexadimethrine bromide Sigma Aldrich Cat 107689 e 500 ml 0 2 um filter units Fisher Scientific Cat 09 741 05 or Thermo Scientific Cat 569 0020 e Tissue Culture Plates and Related Tissue Culture Supplies e Lipofectamine
38. y X ite t T gt A p ES TW M i Ke j 9 H A Va fe Discovery is yours 4 3 CELLECTA Cellecta Human Genome Wide Pooled Lentiviral shRNA Libraries HT RNAi Genetic Screens User Manual V4a 9 15 2015 DATA Ae LCSTed t ee L1 Cellecta hGW shRNA Libraries www cellecta com User Manual Contents A EET ol 4241 0 0 0 Ree 3 B hGW Pooled shRNA Library Required Materials ccccccccssscccccecsssessaecececessesesseaeeeeeesssesssseaeeneeess 4 B 1 Included M terlalS iint eter torture ero trabe eoo ht axe ope Tubi odas Raua 4 B 2 Materials Available Separately from Cellecta esses enne enne nn 5 B 3 Materials Needed from Other Vendors esee eene nnne entente nennen 6 B 4 Related Services from Cellecta 0 0 eeeceeesceeeeeeecseeeeaeceeeeeenaeeeeaaeceeaaeceeeeeesaeeseaaesseaeeceaeeessaeeeeaaeeeeaeeees 7 C Packaging Protocol for Pooled Lentiviral shRNA Libraries 7 MP Day 0 Plate Cells isccscissiscccecacd c 7 C 2 Day 1 Transfection Twenty 15 cm plates ccccccssscccsessececeessececeeseeececsseeesecaeeeseesaeeeeeesaeeeeeses 8 C 3 Day 2 DNASE l Treatment sce ee asc anes o ter ei dtm eee RE Re eet 8 C 4 Day 3 Collect Lentiviral SUPernatant cccecccccecessssssseceeeeecessesseaeeeeeesceeseesaeeeeeesseesesaea
39. y is expressly limited to replacement of Product or a refund limited to the actual purchase price Cellecta s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty Cellecta does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned Cellecta disclaims any and all responsibility for injury or damage that may be caused by the failure of the Recipient or any other person to use the Product in accordance with the terms and conditions outlined herein The Recipient may refuse these licenses by returning the enclosed Product unused By keeping or using the enclosed Product you agree to be bound by the terms of these licenses The laws of the State of California shall govern the interpretation and enforcement of the terms of these Licenses Limited Use Label Licenses The Recipient acknowledges that the Product has been developed by Cellecta based on licenses from Third Parties and agrees with the Terms of Limited Use for the Recipient provided by the Third Parties Agilent Technologies Inc End User Label License for the use of shRNA libraries comprising Oligo Poo
40. ysis identification of functional shRNAs and allows for tracking of specific shRNAs in individual cells The barcodes can be read by HT sequencing on the Illumina platform Identified barcodes can be converted to lists of genes shRNAs using our enumerated barcode data analysis software The inclusion of clonal barcodes allows for identification of shRNAs without the need for amplification or sequencing of the hairpins themselves which can be cumbersome due to the secondary structure present in them For more information on how the clonal barcodes were built and how they are useful please read http www cellecta com millions of defined sequenceable barcodes for clonal cell tracking 2 Each 55K hGW library module also includes a panel of internal controls The control block consists of 2 ShRNA sequences for PSMA1 2 shRNA sequences for RPL30 and 4 shRNA sequences for luciferase Each shRNA sequence is replicated 5 times with 5 different barcodes This 5 replicate internal control is useful for assessing internal noise because the 5 replicates for each shRNA should elicit the same phenotype The protocols below provide the instructions on how to package the plasmid form of the hGW into viral particles and guidelines for the preparation of barcoded probes for high throughput HT sequencing and analysis of raw sequencing data sets Please read the entire user manual before proceeding with your experiment For a description of the theories behi
Download Pdf Manuals
Related Search
Related Contents
User Manual Part # NDM-3-288 Yamaha RM800 User's Manual HP Mini 5101 Copyright © All rights reserved.
Failed to retrieve file