Home
Cold Fusion User Manual
Contents
1. Technical Support zinaa a a a Eer 11 Vi Licensing and Warranty eserinin 11 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual I Introduction The Cold Fusion technology is a simple rapid and highly efficient PCR cloning kit It allows you to directly clone any PCR product s to any linearized expression vector at any site The PCR fragments can be generated by Taq DNA polymerase or other high fidelity DNA polymerases with primers that are designed to have 15 bases of homology at the linear ends where the DNA of interest will fuse The linearized vector can be generated by PCR or restriction enzyme digest single or double cut With a one tube simple reaction format a 5 minute incubation at room temperature followed by 10 minutes on ice your PCR product s rapidly and accurately fuse into the linearized vector in the desired orientation The kit is so robust that multiple DNA fragments can be assembled simultaneously and cloned into one construct in a single step The system is highly efficient with more than a 95 positive cloning rate A Key Features e Cloning is simple rapid accurate and directional e Clone any insert at any site within any vector e Restriction enzyme phosphatase and ligase free system e Broad PCR size e Joining multiple fragments at once e High efficiency with gt 95 positive clones B Applications e PCR cloning into any vector e Gene transfer from one
2. Kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement
3. of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2013 System Biosciences SBI All Rights Reserved Page 12 ver 3 02042013 www systembio com
4. vector to another e Add adaptor linker and tag before or after the insert e Gene synthesis e High throughput cloning Page 2 ver 3 02042013 www systembio com Cold Fusion Cloning Kit Cat MC010A 1 MC 100A 1 MC 101A 1 C List of Components Cat No MC010A 1 5x Master Mixture 20rxns 20ul Linearized vector positive control Sul 500bp PCR insert positive control Sul Competent cells 1x10 cfu ug 10 tubes User manual 1 Cat No MC100A 1 5x Master Mixture 20rxns 40pl Linearized vector positive control Sul 500bp PCR insert positive control Sul Competent cells 1x10 cfu ug 20 tubes User manual 1 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Cat No MC101A 1 5x Master Mixture 50rxns 100pl Linearized vector positive control 10pl 500bp PCR insert positive control 10ul Competent cells 1x10 cfu ug 50 tubes User manual 1 D Storage Store the master mixture and positive controls at 20 C Store the competent cells at 80 C E Other Reagents Needed e Gene specific primers e dNTPs Taq or other high fidelity polymerase and corresponding buffers for PCR e QlAquick PCR Purification Kit Cat 28106 Qiagen e QlAquick Gel Extraction kit Cat 28704 Qiagen e SOC orLB Broth for transformation of bacteria e LB 100 ug ml Ampicillin plates F Technical Information The competent cells provided with the Cold Fusion Cloning Kit has the follow
5. COLD EUsion SBI System Biosciences Cold Fusion Cloning Kit Cat s MC010A 1 MC100A 1 MC101A 1 User Manual Store the master mixture and positive controls at 20 C Store the competent cells at 80 C A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual Cold Fusion Cloning Kit Cat MC010A 1 MC 100A 1 MC 101A 1 Contents IMTPOMUCTION oere tanien aevi iiini nieve 2 A Key Features osrin riii iii an 2 B Applications oenn eee a lee a eed 2 C List of Component 0000 2 ee ce cecceecece ects eeeeeeeeeeeeeeeeeeetsnnanees 3 D Strage eiere eei eiai a eii aa ivan 4 E Other Reagents Needed sseecsiescssrrrsrrrnrrsrreeirrrnniennnnns 4 F Technical Information cccecccccceeceeeeeeeeeeeseeneeeeeeeenaees 4 Ihe Protocol iaieineea i iii e aA 5 AS OVIMVEW siirron E E EAEE 5 B Preparation of Linearized Vector ccceceeeeeeeeetceeeeeeees 5 Co Primer Deside n a EE 6 D PCR Requirement ccccccceceeeeeeeeeeeeeeeeeeeeeeeeeneeeeeeeeess 6 E Gold Fusion Reactoren E 6 F Transformation vise ione a AE aes 7 Ile MEX IMPICS E E E A 8 A Primer Design for Positive Control Reaction 8 B Cloning a single DNA Fragment 8 C Joining Multiple DNA Fragment s es 8 IV TrOuDIGSHOOUNG sivas tccchscteeccesaadecetesacecctd A EAEE 9 V
6. PCR Purification Kit Cat 28106 Qiagen E Cold Fusion Reaction Set up the following reaction in a 1 5 ml sterile reaction tube by mixing the following reagents gently and then spin down briefly to collect the reagents at the bottom of the tube Cloning reaction Linearized destination vector 10 100ng t1 1pl PCR insert s 20 200ng ul for each PCR Product 1ul dH20 l Page 6 ver 3 02042013 www systembio com Cold Fusion Cloning Kit Cat MC010A 1 MC 100A 1 MC 101A 1 5x master mix 2ul total 10ul Positive control reaction Linearized vector positive control Iul 500bp PCR insert positive control Tul dH20 6ul 5x master mix 2ul total 10ul Negative Control Linearized destination vector 10 100ng 1 1ul dH20 Tul 5x master mix 2ul total 10ul 2 1 or 1 1 molar ratio of insert vector works well in the Cold Fusion reaction For reactions with larger volumes of vector and insert gt 8ul of vector insert double the amount of reaction buffer and enzyme and add dH 0 for a total volume of 20uI When using Cold Fusion cloning kit for the first time we strongly recommend that you perform the positive and negative control reactions in parallel with your Cold Fusion cloning reaction The positive control 500bp PCR insert and linearized vector provided in the kit have already been purified There is no treatment needed prior to the cloning reaction Cold Fusion Reaction Incubation 1 5 minutes at room temper
7. ain a Kozak sequence and or ATG start site 15bp 18 20bp Forward Primer NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN m NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 Reverse Primer Design Reverse primers should be made to the negative strand of DNA Depending on the vector you are using the 3 end of the insert may need to contain a stop codon TAG TAA or TGA The 3 primer should contain 18 20 bases complimentary to the 3 end of your gene of insert plus 15 bases corresponding to the vector 18 20bp 15bp NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN _ NINNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN Reverse Primer Introducing Restriction Sites A restriction site can be introduced in the middle of the primer and can be the same as or different than the one used to linearize the vector For multiple DNA fragment joining it is recommended that each PCR product shares 18 base pairs of homology D PCR Requirements e The PCR fragments for the cDNA of interest should be generated using Taq DNA polymerase or other high fidelity DNA polymerase e The melting temperature Tm should be calculated based on the gene specific ends of the primer NOT the entire primer e Specific PCR reaction conditions should be optimized for the cDNA of interest e After completion of the PCR reaction gel purify the appropriate band to remove any extra primers or primer dimmers that will inhibit the Cold Fusion reaction We recommend the QlAquick
8. asmid circular DNA contain no may have carried through cloning reaction oe insert DORE purification and contaminated with plasmid with s the cloning reaction We the same ie er recommended gel purifying antibiotic r sistan your PCR product or linearizing the template DNA before performing PCR 2 Large meee Plates are too old Make sure that your antibiotic numbers of or contained plates are fresh Check the colonies bodes f incorrect antibiotic resistance of your contain no E 3 antibiotic fragment insert 3 Clones PCR products Optimize your PCR reaction contain contain non to improve the specificity incorrect specifically Screen more colonies for the insert amplified artifacts correct clones Page 10 ver 3 02042013 www systembio com V Vi Cold Fusion Cloning Kit Cat MC010A 1 MC 100A 1 MC 101A 1 Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com System Biosciences SBI 265 North Whisman Rd Mountain View CA 94043 Licensing and Warranty Limited Use License Use of the Cold Fusion
9. ature 2 10 minutes one ice Transformation Add 50ul Cold Fusion competent cells to the cloning mixture Incubate on ice for 20 minutes Heat shock at 42 C for 50 seconds Transfer on ice for 2 minutes Add 250ul S O C medium or LB broth Incubate at 37 C for an hour Take 100uI culture spread on pre warmed 37 C culture plate containing Ampicillin Incubate the plate at 37 C overnight ONOARWN gt T 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual lll Examples A Primer Design for Positive Control Reaction amp Original Vector Sequence Linearize with EcoRI and BamHI 5 ACGACGTTGAAAACGACGGCGAGTGAAT TCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCT 3 3 Construct of interest shown below Black Vector sequence Blue insert sequence Red restriction site Forward Primer 5 D E 3 5 ACGACGTTGAAAACGACGGCGAGTGAATTC atggagagcg acgagagcgg cctgcecgec atggagatcg agtgceegcat caccggcacc Ctgaacggcg tggagttcga gctggtgggc ggcggagagg gcacccccaa gcagggccge atgaccaaca agatgaagag caccaaaggc gccctgacct tcagccccta cctgctgage cacgtgatgg gctacggctt ctaccacttc ggcacctacc ccagcggcta egagaacccc ttcctgcacg ccatcaacaa cggcggctac accaacaccc gcatcgagaa gtacgaggac ggcggcgtge tgcacgtgag cttcagctac cgctacgagg ccggccgcgt gatcggcgac ttcaaggtgg tgggcaccgg cttccccgag gacagcgtga tcttcaccga caagatcatc cgcagcaacg ccaccgtgga gcacctgcac cccatgggcg ataacgtgct ggtgggcage ttcgcccgca ccttcagect gcgcgacggc g
10. gctactaca gcttcgtggt ggacagccac atgcacttcaag GGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCT 3 3 cctgtcggtg tacgtgaagttc CCTAGGAGATCTCAGCTGGAC 5 3 Aamo 5 Reverse Primer 3 Forward primer Sequence 5 AAAACGACGGCCAGTGAATTCatggagagcgacgagagcggc 3 Reverse primer Sequence 5 CAGGTCGACTCTAGAGGATCCctigaagtacatgtagctgte 3 B Cloning a single DNA Fragment Broad PCR product cloning range with high efficiency Vector insert S00bp insert 1000bp insert 2000bp insert Good for any vector with 5 overhangs 3 overhangs and blunt ends Vector alone EcoRI Not cut 5 overhangs Kpni cut 3 overhangs mae 4 EcoRV cut ends C Joining Multiple DNA Fragments Note For multiple DNA fragments cloning depending on the number and the size of each insert you may obtain fewer colonies than those with one or two fragments Assemble and clone multiple DNA fragments simultaneously into one construct in a single step Oct4 T2A Sox2 E2A Kif4 P2A c myc 5 out of 6 clones with 5kb inserts Page 8 ver 3 02042013 www systembio com Cold Fusion Cloning Kit Cat MC010A 1 MC 100A 1 MC 101A 1 IV Troubleshooting the transformation linearized vector Transform with too much reaction mixture Problem Probable cause Solution Check primer sequences to Primer ensure that they provide 15 sequences are bases of homology with the incorrect region flanking the insertion site Optimize your PCR amp
11. ing genotype F proAB laclq lacZ A M15 Tn10 TetR A ccdAB mcrA A mrr hsdRMS mcrBC 80 lacZ AM15 A lacZYA argF U169 endA1 recA1 supE44 thi 1 gyrA96 relA1 tonA panD Due to the presence of the Tn10 transposon element which encodes the tetracycline resistance gene TetR the competent cell will be able to grow in LB Agar plates containing 10 ug ml of tetracycline Cloning of inserts into plasmids containing a TetR marker and transforming the competent cells in the kit will likely lead to the failure of the cloning reaction In this case we would recommend another high quality competent cell that does not have built in tetracycline resistance TetR for best results Page 4 ver 3 02042013 www systembio com Cold Fusion Cloning Kit Cat MC010A 1 MC 100A 1 MC 101A 1 Protocol A Overview Step 1 Step 2 Amplify the insert s to be cloned by PCR Generate a linearized vector EEE gene specific primers with Any Linearized 15bp extention homologous to vector ends Step 3 Mix PCR product s with linearized vector Step 4 incubate the reaction 5 min room temperature 10 min on ice C Step 5 a Transformation G ee Hundreds of colonies with gt 95 positive rate Cold Fusion reaction B Preparation of Linearized Vector Complete linearization of the vector is critical to achieve a successful Cold Fusion cloning reaction Incomplete linearization of the vector will result in high backgr
12. lification reactions so Suboptimal PCR that you generate pure PCR product products Use a different method to purify your PCR product Low DNA It is imperative to obtain as ol os high a DNA concentration as concentration in ae possible in your Cold Fusion reaction reaction Inhibitory 1 No or few contaminants Both the PCR product and colonies from PCR the linearized vector should obtained from product or be purified Do not add more than 10ul of reaction mixture to 50uI of competent cells Too much reaction mixture inhibits the transformation Low quality or poor handling of competent cells Handle the competent cells gently Do not re freeze cells after thawing Quality of competent cells may be tested by transforming a circular plasmid to determine cells competency Competent cells with a transformation efficiency of 1x10 cfu ug are recommended Wrong antibiotic or too much Choose plates with the appropriate concentration of 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual Problem Probable cause Solution antibiotic in the the right antibiotic media It is critical to remove any Incomplete uncut vector prior to use in linearization of the Cold Fusion reaction If your vector necessary re digest your vector and gel purify 2 Large numbers of If you insert was amplified colonies Contamination of from a pl
13. ound The linearized vector can be generated by PCR or restriction enzyme digest single or double digest and should be purified using a gel or PCR purification kit Due to the digestion efficiency different restriction enzymes will generate different levels of background In general two enzyme digestion is better than a single enzyme digestion The further the restriction sites are apart the better the digestion efficiency Increasing the enzyme digestion time and the digestion reaction volume will also help reduce the background For many enzymes we recommend incubate the digestion reaction between 3 hours and overnight in order to increase linearization and reduce background Check the background of your vector by transforming 1ug 10 100ng linearized and purified vector into competent cells If the background is high continue digesting the remaining vector for a longer time after the addition of more restriction enzyme s We recommend digesting 21g vector in 501 reaction overnight Use QIAGEN s QlAquick Spin Gel Extraction kit for gel purification and elute the DNA with 30ul dH20 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual C Primer Design Forward Primer Design The forward primer should contain 18 20 bases complimentary to the 5 end of your gene of interest plus 15 bases corresponding to the vector Depending on the purpose of your cloning your primers might also need to cont
Download Pdf Manuals
Related Search
Related Contents
PipePro 450 RFC steel heat pump – steel series · air/water system Trust Slimline Keyboard KB-1350D CH VS-BT プログラマ 2 取扱説明書 Propriétés : Caractéristiques Physico Chimiques : Mode d`emploi Copyright © All rights reserved.
Failed to retrieve file