miRCat miRCat-33 - Integrated DNA Technologies
Contents
1. www idtdna com support technical TechnicalBulletinPDF RNaseAlertTM User Guide pdf Once total RNA is extracted and purified the next step is to enrich for small RNAs The mass of RNAs in the miRNA size range of 18 nt to 26 nt is very small relative to total RNA so removal of as much competing mass as possible is essential Note This is important regardless of whether your total RNA mass is small such as from cultured cells or micro dissected tissues or large such as from whole organ preps Recovering the small RNA fraction from a slice of a 12 denaturing 7M Urea polyacrylamide gel identified by an internal size marker is the conventional method miSPIKE Internal Control Oligonucleotide The miSPIKE TUBE 3 is a 21 mer RNA designed specifically to assist in small RNA cloning Table 1 This oligonucleotide serves three functions e A size control for isolating RNAs in the 21 23 nt size range e An internal 3 ligation control that subsequently also serves as a size marker for successful 3 ligated RNAs during the next purification step e A mass carriet co precipitant for small RNAs Note This RNA oligonucleotide lacks a 5 phosphate so it cannot be 5 linkered and will not participate in subsequent steps The miSPIKE sequence does not have any significant homology to any currently known small RNA as determined via BLAST against RNAdb GenBank and miRBase Add 10 pmoles lul of miSPIKE into the total RNA be2. 8 Centrifuge at full speed 16000 x g for 10 minutes 9 Pour off the supernatant and dry the pellet 10 Add 20 ul IDT DNase RNase pyrogen free water TUBE 6 If you cannot continue directly to the next step you should store the dry pellet at 20 C Ban I Digestion of Pooled Amplicons The concentrated amplicon pool is digested with Ban I restriction endonuclease New England Biolabs RO118S for 1 hour at 37 C under the following conditions Amplicon Pool 20 ul 10X Ban I Buffer 3 ul IDT water 5 ul TUBE 6 Ban I 20 U l endonuclease 2 ul Total Volume 30ul Following digestion Add 30 ul of phenol chloroform isoamyl alcohol 25 24 1 2 Vortex and centrifuge at full speed 16000 x g for 3 minutes Transfer the upper aqueous phase to a new tube and add 3 ul of 3 M NaOAc pH 5 2 and 100 ul of ice cold 100 EtOH Place tube at 80 C for 20 minutes Centrifuge at full speed 16000 x g for 10 minutes Pour off the supernatant and wash the pellet in 100ul of ice cold 70 EtOH Centrifuge at full speed 16000 x g for 10 minutes Pour off the supernatant and dry the pellet Add 17 ul IDT DNase RNase pyrogen free water TUBE 6 W ele Oy aoe If you cannot continue directly to the next step store the dry pellet at 20 C Concatemerization The concatemerization reaction is set up as follows Ban I digested amplicons 15 ul 10X Ligation Buffer 2 ul TUBE 8 10 mM ATP 2 ul TUBE 10 T4 DNA Ligase 30 U
3. Current protocols in Molecular Biology 2003 26 4 1 26 4 18 Powell J 1998 Enhanced concatamer cloning a modification to the SAGE Serial Analysis of Gene Expression technique Nucleic Acids Research 26 3445 3446 Sunkar R and J K Zhu 2004 Novel and stress related microRNAs and other small RNAs from Arabidopsis The Plant Cell 16 2001 2019 Ye SQ LQ Zhang F Zheng D Virgil and PO Kwiterovich 2000 MiniSAGE Gene expression profiling using serial analysis of Gene expression from lug total RNA Analytical Biochemistry 287 144 152 17 Table 1 Linker and Primer Sequences miSPIKE internal control RNA 5 rCrUrCrArGrGrArTrGrGrCrGrGrArGrCrGrGrUrCrU 3 Cloning Linker Sequences 3 Linker 5 rAppCTGTAGGCACCATCAAT 3ddC 3 5 Linker 5S TGGAATrUrCrUrCrGrGrGrCrArCrCrArArGrGrU 3 Primer Sequences Tm PCR FOR 5 TGGAATTCTCGGGCACCE 3 33 0 C RT PCR REV 5 GATTGATGGTGCCTACAG 3 50 2 C The RT and REV PCR primer is the same sequence The Ban I restriction endonuclease sites shown as GGCACC 18 Appendix 1 RNA Recovery from Denaturing PAGE using DTR columns An approach that has works well is a spin column method using Edge Biosystems DTR Gel Filtration Cartridges Cat No 42453 l 10 11 Separate total RNA on a 15 denaturing PAGE 7M Urea for 90 minutes at 275V Following manufacturer s recommendations stain the gel with GelStar nucleic acid stain Lonza and pl
4. C 100 EtOH Mix by inversion or vortex briefly Place tube at 80 C for 30 min Centrifuge at full speed 16000 x g for 10 min Pour off the supernatant Dry the pellet completely Resuspend in 10 ul IDT DNase RNase pyrogen free water TUBE 6 eS OE Sl ON eS If you cannot continue directly to the next step store the dry pellet at 20 C PAGE purification Free linker must be removed from this reaction as it will compete for PCR primers in the amplification step Thus this reaction is PAGE purified the same way the first 3 ligation was purified see miRCat Technical Manual Pages 9 18 20 In this purification the desired RNA species are found at 60 nt PCR Amplification PAGE purified material 3 0 ul IDT DNase RNase pyrogen free water 35 5 ul TUBE 6 10x PCR Buffer 5 0 ul MgCl 25 mM 3 0 ul dNTPs 10 mM 1 0 ul RT Primer 10 pmole 1 0 ul TUBE 5 REV 33 Primer 10 pmole 1 0 ul Taq polymerase 5 U l 0 5 ul Total Volume 50 0 ul PCR Conditions 95 0 C for 10 minutes 95 0 C for 30 seconds 25 cycles lt 52 0 C for 30 seconds 72 0 C for 30 seconds 72 0 C for 5 minutes 26 Continue with miRCat Kit protocol at the top of Page 13 miRCat 33 Sequencing Templates Forward GATTGATGGTGCCTACAGnnnnnnnnnnnnnnnnnnnnTGGAATTCTCGGGTGCCAAGG Reverse CCTTGGCACCCGAGAATTCCAnnnnnnnnnnnnnnnnnnnnCTGTAGGCACCATCAATC Concatemer Connector Forward nnnnnnnnnTGGAATTCTCGGGTGCCTACAGnnnnnnnnn
5. Reverse nnnnnnnnnCTGTAGGCACCCGAGAATTCCAnnnnnnnnn Appendix 4 Additional Products for use with miRCat and miRCat 33 small RNA cloning kits 31 mer piSPIKE RNA control oligonucleotide This is a ten base extension of the miSPIKE internal control RNA also synthesized without a 5 phosphate 454 Adapter Primer Sets These are pairs of longer PCR primers 40 mers that will convert the small RNA libraries made by either version standard or miRCat 33 of the miRCat Cloning Kit into PCR libraries that can be directly sequenced on the 454 platform 3 miRNA Cloning Linkers IDT offers three different adenylated linker oligos that can be used in miRNA library construction Linker 1 is the original modban sequence employed by Lau and Bartel in 2001 and contains a Ban I restriction site Linker 2 contains Ava and Sty restriction sites Linker 3 contains EcoR I and Msp I restriction sites and was adapted from Pfeffer and Tuschl All three linkers are modified with a 3 terminal dideoxy C ddC base to prevent self ligation 5 M R S Cloning Linker The 5 M R S Multiple Restriction Site Linker sequence is designed for use with any of the 3 miRNA Cloning linkers The sequence has been optimized for linking to the 5 end of RNAs containing a 5 phosphate group STARFIRE Nucleic Acid Labeling System StarFire is a proprietary labeling system for generating P radiolabeled oligo probes with 10 fold greate
6. os gt gt 4 o gt o 4 Connector 5 miR 23a 3 Linker 7 o 420 oon nny prey ool enna ay Fig 7 Electropherogram of a microRNA concatemer sequence containing six microRNAs Note that four of the five connectors are canonical but that connector four is truncated Connector 1 CTGTAGGCACCAAGGT Connector 2 CTGTAGGCACCAAGGT Connector 3 CTGTAGGCACCAAGGT Connector 4 CTGTAGGCACCAA Connector 5 CTGTAGGCACCAAGGT We expect to obtain concatemer inserts containing 3 6 miRNA linker units Cloning Option 2 PCR amplicons from the reverse transcription reaction can be cloned directly using a standard PCR cloning vector such as TOPO TA Cloning Invitrogen or pGEM T EASY Promega Whichever vector is chosen cloning will proceed according to the protocol supplied with the vector This method is simpler at the cloning phase but provides much less information for each sequencing reaction than is obtained from concatemer clones Option 1 5 M R S Linker RNA 3 Cloning Linker Sequence Templates see Table 1 Forward GGAATTCTCGGGCACCAAGGTnnnnnnnnnnnnnnnnnnnnnCTGTAGGCACCATCAATC Reverse GATTGATGGTGCCTACAGnnnnnnnnnnnnnnnnnnnnnACCTTGGTGCCCGAGAATTCC 16 References Aravin A and T Tuschl 2005 Identification and characterization of small RNAs involved in RNA silencing FEBS Letters 579 5830 5840 Bartel DP 2004 MicroRNAs Genomics biogenesis mechanism and function Cell 116 281 297 Berezikov E E
7. pestles from Kontes Glass Co The gel slice becomes a fine powder in the tubes and is easy to work with Add an equal volume of IDT Nuclease free water to the tube weigh the gel slice to determine this volume at 1 ul mg Vortex the suspension for 15 30 seconds Heat this suspension to 70 C for 10 minutes Vortex the suspension for 15 30 seconds Place tube in a 80 C freezer for 30 minutes or in a dry ice EtOH bath for 10 minutes Repeat Steps 3 to 5 two more times After the final 80 C freeze step let the tube thaw at room temperature and then spin at 1200 x g for 5 minutes Transfer the supernatant to a new RNase free tube Run supernatant over a desalting column NAP 5 or equivalent to remove urea see NAP 5 protocol below Dry the sample NAP 5 column preparation Amersham Biosciences Cat No 17 0853 02 While the freeze thaw cycle is ongoing prepare a NAP 5 column using the following protocol The NAP 5 column is used to remove the urea from your recovered RNA fragments a b C Take a new NAP 5 column and place it in a tube holder with a small container underneath to catch the washes Uncap both ends of the column and decant the liquid Rinse the column three times with IDT DNase RNase pyrogen free water It usually takes about 7 10 minutes for the wash to completely run through the column Place the cap back on the column until the RNA is recovered from the gel slice 20 e Estim
8. side reactions from occurring See table 1 for the linker sequence 3 Linkering Reaction In an RNase free 0 2ml tube add the following Recovered small RNA fraction y ul 3 RNA linker 50 uM 1 ul TUBE 1 10X Ligation Buffer 2 ul TUBE 8 Ligation Enhancer 6 ul TUBE 9 T4 RNA Ligase 1 U ul 1 ul TUBE 13 IDT water 10 y ul TUBE 6 Total Volume 20 ul It is important to dilute the stock 5 U ul RNA ligase in 1X ligation buffer TUBE 8 as needed Excess enzyme can promote unwanted side ligation reactions including circularization of the target RNAs Aravin and Tuschl 2005 Incubate these reactions at 22 C for two hours then Add 80 ul IDTE pH 7 5 TUBE 7 Transfer entire volume to an RNase free 1 5 ml tube Add 3 ul glycogen 10 mg ml TUBE 11 Add 1 10 volume 10 ul 3 0 M NaOAc TUBE 12 Add 2 5 volumes 250 ul 20 C 100 EtOH Mix by inversion or vortex briefly Place tube at 80 C for 30 min Centrifuge at full speed 16000 x g for 10 min 1 2 3 4 5 6 7 8 9 Pour off the supernatant 10 Dry the pellet completely 11 Resuspend in 10 ul IDT water TUBE 6 If you cannot continue directly to the next step store the dry pellet at 20 C PAGE Purification of 3 Linkered Species Free 3 linker competes with the linkered RNAs in the 5 ligation step and must be removed Successfully ligated RNAs are 40 nt long while unreacted 3 linker is 19 nt long These sizes are easily resolved on a 12 denaturi
9. small RNAs from any total RNA source using the miRCat Kit is shown Desired small RNAs are represented by the yellow bar the spike in internal RNA control is shown as the green bar the 3 cloning linker is shown as the red bar and the 5 M R S Linker is shown as the blue bar The Ban I restriction enzyme sites in the cloning linkers are shown by cross hatching Page numbers in the manual are noted where each step of the protocol begins Sufficient materials are provided in this kit to generate more than ten small RNA libraries The two most important aspects of miRNA cloning are the quantity and quality of the starting RNA and the maintenance of relative mass relationships during the Cloning Linker Attachment Phase Total cellular RNA can be used to clone small RNA species but the absolute mass of small RNAs is very small and larger RNA species will compete for linker molecules For this reason it is best to prepare a highly enriched and purified small RNA fraction at the outset see below Once purified small RNA species are obtained it is crucial that sufficient linker mass is used to ensure efficient 3 and 5 linker attachment We strongly encourage using the 3 and 5 linkers in the amounts and at the concentrations called for in the Cloning Linker Attachment Phase Reductions in the mass of linker in either of the linkering steps will result in a substantial reduction in linkering efficiencies Getting Started miRCat Ki
10. Cuppen and RHA Plasterk 2006 Approaches to microRNA discovery Nature Genetics 38 S2 S7 Cummins JM He Y Leary RJ Pagliarini R Diaz LA Sjoblom T Barad O Bentwich Z Szafranska AE Labourier E Raymond CK Roberts BS Juhl H Kinzler KW Vogelstein B and VE Velculescu 2006 The colorectal microRNAome Proceedings of the National Academy of Sciences USA 103 3687 3692 Datson NA van der Perk de Jong J ven den Berg MP de Kloet ER and E Vreugdenhil 1999 MicroSAGE a modified procedure for serial analysis of gene expression in limited amounts of tissue Nucleic Acids research 27 1300 1307 Denli AM BB Tops RH Plasterk RF Ketting and GJ Hannon 2004 Processing of primary microRNAs by the microprocessor complex Nature 432 231 235 Elbashir SM W Lendeckel and T Tuschl 2001 RNA interference is mediated by 21 and 22 nucleotide RNAs Genes and Development 15 188 200 Gregory RI KP Yan G Amuthan T Chendrimada B Doratoaj N Cooch and R Shiekhattar 2004 The microprocessor complex mediates the genesis of microRNAs Nature 432 235 240 Lau NC LP Lim EG Wienstein and DP Bartel 2001 An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans Science 294 858 862 Lee RC RL Feinbaum and V Ambros 1993 The C elegans heterochronic gene lin 4 encodes small RNAs with antisense complementarity to lin 14 Cell 75 843 854 Pfeffer S Lagos Quintana M and T Tuschl 2003 Cloning of small RNA molecules
11. P INTEGRATED DNA TECHNOLOGIES miRCat miRCat 33 microRNA Cloning Kit Technical Manual THE CUSTOM BIOLOGY COMPANY WWW IDTDNA COM Contents Overview and Kit Contents RNA Isolation and Size Fractionation RNA Linkering Reverse Transcription PCR Amplification Concatemerization and Cloning References Appendix 1 RNA Recovery from PAGE Appendix 2 PCR Purification from Agarose Gels Appendix 3 miRCat 33 Conversion Appendix 4 Additional Products for Small RNA Cloning 11 12 17 19 21 22 27 miRCat Small RNA Cloning Kit Technical Manual Overview MicroRNAs miRNAs are small non coding RNAs that are involved in post transcriptional gene regulation cf Bartel 2004 First identified in C elegans just over a decade ago Lee et al 1993 miRNAs have been identified in virtually every metazoan and plant species examined Experimental evidence is rapidly accumulating that shows miRNAs play key roles in process such as cellular differentiation cell death and cell metabolism MiRNA biogenesis has been mapped to at least a first order level An outline of miRNA development is presented in Bartel 2004 In general an miRNA is composed of a highly conserved core sequence of 21 23 nucleotides the mature miRNA contained within a less well conserved precursor sequence pre miRNA ranging in size from 60 nucleotides to more than 120 nucleotides This pre miRNA sequence is part of a larger primary tra
12. TGTAGGCACCAAGGT Fig 7 or ACCTTGGTGCCTACAG if cloned in reverse orientation Note that these connector sequences are not always perfectly reconstituted so some care needs to be taken in reading the sequence traces The following ABI 3130 sequencing trace was obtained from a clone made using the miRCat Kit The identity of 6 miRNAs cloned in a concatemer are shown below their respective sequences The linker connector units are also indicated Note the variation seen between different linker connectors in this concatemer unit eee es E TRUUUUOOUPL OPO MORE UCU RIOD OCR TRP OUD OU dalilan PUTERUUEI CCGCGGGAATTCGATTTGGAATTCTCGGGCACCAAGGTCTGTAGGCACCATCAATCATGGAATTCTCGGGCACCAAGGTTTCAAG 90 100 110 120 130 440 450 160 5 Linker N WIA An NVA My AN Nn l Al y N wy AN nh AJ y M J N NN N AMN AN MVNA wy d Nex YAAN Vy De ode ABR SOI MA SA SAL AMIS Birch AAPM AN BS IPN Bee O PON ONS iil IAAI PEELE EEE EERE TELE SPSS POSS PECSSOP OS OIIC COLE OSEPOOSCOCECIOS TOSSES ESIERSICOLF ISSCC ESOS SESS EELEEL OTe 170 180 86 200 210 220 230 240 250 miR 26a Connector 1 miR 122a Connector 2 miR 34a N NAN An A Aina NANA r A A AAN pf AMANA MN VV N NW N AANV y NIV Wy ANNA AVAVVAVAYAVAVATR N PNT ALAT 13 GGTTGTCTGTAGGCACCAAGGTTAGCTTATCAGACTGATGTTGACCTGTAGGCACCAATGGAGTGTGACAATGGTGTTTCTGTAG 260 270 280 290 310 320 w 7 Connector 3 miR 21 Connector 4 miR 122a e 8 g gt o o gt o o o gt 4 g om gt a gt 4s
13. ace on a medium wavelength 312 nm UV light box Select RNA fragment s to be purified and excise them from the gel Place the gel slice in a 1 5 ml tube and crush the gel slice with a glass rod NOTE we have had very good results using the 1 5 ml tubes and disposable pestles from Kontes Glass Company Add 200 ul sterile nuclease free water and continue to crush the gel into a fine slurry Place the tube at 70 C for 10 minutes Following manufacturer s recommendations prepare a DTR column EDGE Biosystems for each gel slice Vortex the gel slice slurry for 15 to 30 seconds and transfer the entire volume onto the DTR column and spin at 850 x g for 3 minutes Discard the DTR column Add 3 ul 10 mg ml glycogen TUBE 11 25 ul of 3 M NaOAc pH 5 2 TUBE 12 and 900 ul ice cold 100 EtOH Mix by inversion and hold at 80 C for 30 minutes Spin tubes at full speed 16 000 x g for 10 minutes Pour of the supernatant and dry the RNA Proceed to next procedure application This protocol successfully removes the Urea and other salts with substantially less loss of RNA than is seen with conventional crush and soaks methods followed by NAP 5 column desalting 19 Standard Crush and Soak RNA Recovery Method Once the gel slices are in the tubes l 10 11 Using a sterile RNase free glass rod break the gel slice into small pieces Note We have had very good results with the 1 5 ml RNase free tubes and
14. an all DNA substrate via reverse transcription using the RT REV primer Tube 5 The purpose of reverse transcription at this point is that regardless of the composition of the 5 end the DNA copy will have a free 3 hydroxyl group Figure A2 S Ban I p 2 PZZZZZZA ddC SSS RT REV Primer P BanlI i 3 ZZZZZZA OH Fig A2 Reverse transcription of 3 linkered small RNAs The reverse transcription protocol provided below is for SuperScript II Reverse Transcriptase Invitrogen Cat Nos 18080 093 or 18080 044 In an RNase free 0 2 ml tube add the following Recovered linkered RNA fraction yul dNTPs 10 mM 1 0 ul RT primer 10 uM 1 0 ul TUBE 5 IDT DNase RNase pyrogen free water 11 0 y ul TUBE 6 Total Volume 13 0 ul Incubate at 65 C for 5 minutes Place tubes on ice and add 5X First Strand Buffer 4 ul 0 1 M DTT 1 ul RNase OUT 40U ul 1 ul SuperScript HI RT 200U pl l ul Total Volume 20 0 ul Incubate at 50 C for one hour followed by 15 minutes incubation at 70 C This reaction can be stored at 20 C until needed 24 Exonuclease Digest At this point an exonuclease digest is carried out to remove the unused deoxynucleotides and the primer This protocol is for the ExoSAP IT USB Cat No 78200 clean up ExoSAP IT contains Exonuclease I and Shrimp Alkaline Phosphatase in a buffer that is compatible with the RT reaction Thus no buffer exchange or precipitation is required prior t
15. ate the volume of material recovered from the gel slice at Step 8 Add IDT DNase RNase pyrogen free water to 500 ul f Load this on the prepared NAP 5 column and let it completely enter the gel bed g Place a new RNase free tube below the column and add 1 0 ml of IDT DNase RNase pyrogen free water h Collect the material coming off the column and dry the sample Appendix 2 Purification of PCR Reactions from Agarose Gels Occasionally extra bands are observed on RT PCR gels when using the cloning linkers These result from two sources Bands that are smaller than the expected size usually result from linker linker ligations Bands that are larger than the expected size are due to promiscuous linkering that sometimes occurs in which the PCR primers participate and concatamers are formed In both cases these extra PCR products will interfere with cloning the properly linkered cDNAs When this occurs it is recommended that the desired PCR product be purified and reamplified prior to cloning A number of agarose gel purification products and protocols are available Among these are the QIAEX II purification kit Qiagen Gene Clean Q BIOgene Montage Millipore and Freeze N Squeeze columns BioRad We have had success with each of these products 21 Appendix 3 miRCat 33 Conversion For 5 Ligation independent Cloning Overview Conventional small RNA cloning including the miRCat method begins with enrichment o
16. c Acid Stain Lonza BioScience Cat No 50535 Reverse Transcriptase SuperScript HI Invitrogen Cat No 18080 093 PCR Reagents No specific recommendation 100 EtOH No specific recommendation PCR amplicon cloning kit pGEM T EASY Promega Cat No A1380 TOPO TA Cloning Invitrogen Cat No K4550 DTR desalting columns Edge Biosystems Cat No 42453 NAP 5 desalting columns GE Healthcare Cat No 17 0853 02 Disposable pestles for 1 5 ml tubes Kontes Glass Co Cat No 749521 1590 UV transilluminator 312nm No specific recommendation QIAQuick PCR clean up columns QIAGEN Cat No 28104 Materials and equipment to run No specific recommendation PAGE and Agarose gels NOTE ethidium bromide staining is not appropriate to visual single stranded nucleic acids on gels GelStar or other single strand binding dye should be employed RNA Isolation and Small RNA Enrichment While every step in a protocol is important and should be followed as closely as possible the very first step in cloning miRNAs is absolutely crucial to your ultimate success RNA isolation methods utilizing glass fiber filters GFF or silicate adsorption should not be used as these will deplete small RNAs Organic extraction reagents such as Trizol or RNA STAT 60 are recommended In addition it is important to take great care in maintaining an RNase free environment see IDT Technical Report RNase Alert User s Guide available on line at http
17. ctors during RNAi in C elegans Science 315 241 244 22 ll Total RNA TRIZOL RNA STAT 60 OR OTHER ORGANIC EXTRACTION REAGENT Small RNA Enrichment 5 3 1 3 Cloning Linker Ligation 5 3 es O PAGE Purification Reverse 5 3 Transcription 5 3 SS gt OH Exonuclease I Digestion and 2 3 Cloning Linker PCR Ligation Ss A a A DIRECT Ban I CLONING AND Digestion SEQUENCING A ZIZA Concatemers Small RNAs 3 cloning linker SSS 3 cloning linker CONCATAMER CLONING AND SEQUENCING Figure A1 The process of cloning miRNAs and other small RNAs from any desired tissue or cell source using miRCat 33 is shown Target small RNAs are shown as the yellow bar the first 3 cloning linker is the red bar and the second 3 cloning linker is the blue bar The Ban I restriction enzyme sites in the cloning linkers are shown by cross hatching Note that the miSPIKE internal control RNA is not used here see below Instead of the 5 Linkering Reaction Reverse Transcription and PCR Amplification on Pages 10 through 12 of the miRCat Technical Manual substitute the following protocol Tube Numbers refer to the tubes provided in the miRCat Kit NOTE if you are using this method you cannot use miSPIKE as it will be cloned by this method 23 Reverse Transcription Reaction The 3 ligated small RNA fragments contain both RNA and DNA regions This is converted to
18. er sequence In an RNase free 0 2 ml tube add the following Recovered 3 linkered RNA fraction y ul 5 RNA linker 50 uM 1 ul TUBE 2 10X Ligation Buffer 2 ul TUBE 8 Ligation Enhancer 6 ul TUBE 9 10 mM ATP 2 ul TUBE 10 T4 RNA Ligase 5 U l 1 ul TUBE 13 IDT water 8 y ul TUBE 6 Total Volume 20 ul Incubate the ligation reactions at 22 C for two hours Following incubation Add 80 ul IDTE pH 7 5 TUBE 7 Transfer entire volume to an RNase free 1 5 ml tube Add 3 ul glycogen 10 mg ml TUBE 11 Add 1 10 volume 10 ul 3 0 M NaOAc TUBE 12 Add 2 5 volumes 250 ul 20 C 100 EtOH Mix by inversion or vortex briefly Place tube at 80 C for 30 min Centrifuge at full speed 16000 x g for 10 min Pour off the supernatant Dry the pellet completely Resuspend in 10 ul IDT water TUBE 6 pe oO OAD Sw le If you cannot continue directly to the next step store the dry pellet at 20 C NOTE It is not necessary to gel purify this reaction However if you choose to do so it should be purified the same as for the small RNA fraction and the 3 ligation If you gel purify be sure to carefully desalt the recovered material as residual salt will interfere with the subsequent RT reaction 11 Reverse Transcription The 5 and 3 ligated RNAs contain both RNA and DNA regions These are converted to DNA using reverse transcriptase with the RT REV primer Tube 5 Note that these cDNA reverse transcripts have Ban I restr
19. f the small RNA fraction of total RNA followed in order by a 3 ligation of a linker sequence a 5 ligation of a second linker sequence reverse transcription PCR amplification and cloning The success of these methods relies on the fact that the small RNAs will have a 3 hydroxyl group and a 5 phosphate group Recently Pak and Fire 2007 showed that some small RNA species in C elegans are tri phosphorylated on the 5 end and therefore cannot be cloned by the conventional method This raises the possibility that there are other small RNAs with 5 modifications that render them refractory to conventional cloning Pak and Fire 2007 introduced a modification of the conventional small RNA cloning procedure that circumvents the problem of non standard 5 ends Called 5 Ligation independent Cloning this method involves reversing two of the steps in the conventional protocol Following 3 ligation the ligated material is reverse transcribed and then a second 3 ligation is carried out using a different linker sequence Fig A1 miRCat 33 converts the standard miRCat Small RNA Cloning Kit into a 5 Ligation independent Cloning Kit The protocol provided here is to be used with the two miRCat 33 oligonucleotides shown below Linker 33 5 rAppTGGAATTCTCGGGTGCCAAGGT ddC 3 Rev 33 5 CCTTGGCACCCGAGAATT 3 Tm 55 3 C Reference Pak J and A Fire 2007 Distinct populations of primary and secondary effe
20. fore loading on the PAGE gel After staining with GelStar Nucleic Acid Stain the 21 mer RNA will be clearly visible To obtain an enriched small RNA fraction cut the gel 2 mm above and below the control band and recover the RNA from the gel slice see Figure 3 Note Several optional methods for recovering RNAs from acrylamide gel slices are presented in Appendix 1 Ambion offers two other methods for enriching small RNA species One of these is the mirVana miRNA Isolation Kit Cat No AM1560 that uses spin columns for selecting RNA less than 200 nt in length The other is the flashPAGE fractionator Cat No AM13100 that electrophoretically excludes RNA species greater than 40 nt in length RNA linkering Once the enriched small RNA fraction has been recovered from the acrylamide gel slice the small RNAs are ligated with a 3 and a 5 linker in two separate reactions The first reaction is the 3 ligation In order to avoid circularization of the RNA fragments the 3 linker is ligated to the small RNAs using T4 RNA ligase in the absence of ATP Figure 2 This reaction requires use of a pre activated 5 adenylated rApp cloning linker with a 3 ddC end block Lau et al 2001 RNA Fragments Adenylated 3 Linker POEH rApp ddC YZ T4 RNA ligase without ATP Fig 2 Ligation of small RNAs with the pre activated 3 cloning linker The 3 end of the linker is blocked with a dideoxycytidine to prevent any
21. iction sites at both ends within the linkers see Figure 5 and Table 1 Ban I Ban I EY 7777 7 Ae 7 dC rl RT REV Primer Fig 5 Reverse transcription of the double linkered small RNAs The reverse transcription protocol provided below is for SuperScript III Reverse Transcriptase Invitrogen Cat Nos 18080 093 or 18080 044 In an RNase free 0 2 ml tube add the following Recovered linkered RNA fraction y ul dNTPs 10 mM 1 0 ul RT primer 10 uM 1 0 ul TUBE 5 IDT DNase RNase pyrogen free water _ 11 0 y ul TUBE 6 Total Volume 13 0 ul Incubate at 65 C for 5 minutes Place on ice and add 5X First Strand Buffer 4 ul 0 1 M DTT 1 ul RNase OUT 40 U ul 1 ul SuperScript IN RT 200 U l 1 ul Total Volume 20 0 ul Incubate at 50 C for one hour followed by 15 minutes at 70 C This reaction can be stored at 20 C until needed PCR amplification restriction endonuclease digestion and concatemerization cloning At this point there are two options for cloning Option 1 is serial ligation concatemerization followed by cloning Option 2 is simple direct cloning of the amplicons generated by PCR amplification of the RT reaction 12 Cloning Option 1 Introduction This miRNA clone concatemerization protocol is based upon elements of SAGE tag protocols and newer methods published by Dr David Bartel Lau et al Science 294 858 862 2001 Dr Andrew Fire Pak and Fire Science 315 241 244 2007 and Dr Vic
22. ncluding denaturing PAGE the miRVana kit Ambion or the flashPAGE fractionator Ambion Cloning Linker Attachment Phase The 3 and 5 cloning linkers are ligated to purified small RNA species in preparation for cDNA synthesis and amplification Amplification and Cloning Phase Reverse transcription of the linkered RNA species is carried out followed by PCR amplification and cloning Two cloning options are available The preferred option is a SAGE like method where the small RNA cloning units miRNA linkers are serially ligated concatemerized and then cloned This method is more efficient for sequencing using sequencing platforms with long read lengths The second option is to directly clone the PCR amplicons In both options cloning can be done using any available PCR cloning vectors e g TOPO TA Cloning pGEM T Easy etc Internal SE Total RNA ps RNA TRIZOL RNA STAT 60 Control OR OTHER ORGANIC n EXTRACTION REAGENT Small RNA Enrichment 3 Cloning Pg 7 Linker Ligation PO ee PO Pg 8 PAGE J Purification 5 M RS Linker PO Ligation p m S Pg 9 Reverse Transcription PCR Pg 10 OI Pg 11 OZ lA SS EL Ban I Digestion Pg 12 ZZZ A ZZ ZA ZILLA E DIRECT CLONING Concatemers AND SEQUENCING Pe 13 KEY Small RNAs E miSPIKE RNA CONCATAMER CLONING mZ 3 cloning linker AND SEQUENCING 5 cloning linker Fig 1 The process of cloning miRNAs and other
23. ng 7M urea polyacrylamide gel Figure 3 P Linkered Total RNA Material 5 8S rRNA 5 0S rRNA gt tRNAs gt Gel Slice 40 nt 3 Ligated RNAs miSPIKE Control RNA Unligated 3 linker Fig 3 Example of the two PAGE RNA purification gels from Phases 1 amp 2 On the left is the acrylamide gel containing total RNA spiked with the 21 mer control RNA original small RNA enrichment gel from Phase 1 On the right is the second acrylamide gel in which the spiked RNA recovered from the gel slice has been 3 ligated and re purified during Phase 2 Both gels were prepared with 7M Urea 1x TBE 12 Polyacrylamide using 1mm thick spacers Material at the 40nt size is recovered and purified for the subsequent 5 linkering step The linkered RNAs are recovered the same way as the enriched small RNA fraction Stain the gel with GelStar and cut out a gel slice 2 mm above and below the 40 nt band and recover the RNA Note several optional methods for recovering RNAs from acrylamide gel slices are presented in Appendix 1 5 Linkering Reaction The 5 MRS Linker is ligated to the 3 linkered small RNAs in the presence of 1 0 mM ATP Figure 4 10 5 Linker 3 Linkered RNA Fragments OH PO ddC RS T4 RNA Ligase withATP Fig 4 Ligation of the 5 MRS Linker to 3 linkered small RNAs The 22 nt 5 MRS Linker is composed of 5 DNA nucleotides 5 end and 17 RNA nucleotides 3 end See Table 1 for the link
24. nscript that may contain a single pre miRNA or two or more pre miRNAs arranged as paired or polycistronic transcripts Following transcription pre miRNAs form a characteristic stem loop structure that is processed by the RNase III enzyme DROSHA Lee et al 2003 in concert with accessory proteins such as PASHA and DGCR8 Gregory et al 2004 Denli et al 2004 The pre miRNA is thus released to be exported from the nucleus whereupon it is further processed by the DICER RISC complex releasing the mature miRNA to carry out its regulatory function A number of investigators have reported on methods for cloning miRNAs from primary RNA sources Berezikov et al 2006 Cummins et al 2006 Elbashir et al 2001 Lau et al 2001 Pfeffer et al 2003 Sunkar and Zhu 2004 Here we provide a User s Guide for cloning miRNAs and other small RNAs from primary RNA sources using IDT s miRCat Small RNA Cloning Kit A schematic representation of the cloning process is shown in Figure 1 There are three distinct experimental phases involved in cloning microRNAs and other small RNA species using the miRCat Kit RNA Isolation and Enrichment Phase RNA species in the 18 to 26 nucleotide size range are purified from total RNA Best results are obtained if 50 100 ug of total RNA is used however cloning can be performed with less mass if RNA is scarce This size range contains mature microRNA sequences There are several options to perform purification i
25. o performing the clean up RT reaction 20 ul ExoSAP IT 8 ul Total volume 28 ul Incubate at 37 C for 15 minutes then Add an equal volume of Phenol Chloroform Isoamy Alcohol 25 24 1 Vortex Centrifuge at full speed 16000 x g for 3 min Transfer the aqueous upper phase to a new 0 2 ml tube 1 2 3 4 5 Add 2 8 ul 3 M NaOAc TUBE 12 6 Add 90 ul ice cold 100 EtOH 7 Place tube at 80 C for 20 minutes 8 Centrifuge at full speed 16000 x g for 10 min 9 Pour off the supernatant 10 Dry the pellet completely 11 Resuspend in 10 ul IDT DNase RNase pyrogen free water If you cannot continue directly to the next step store the dry pellet at 20 C The Second 3 Ligation In an RNase free 0 2 ml tube add the following Resuspended Reverse Transcription Reaction 10 ul 3 Linker 33 50 uM l ul 10X Ligation Buffer 2 ul TUBE 8 Ligation Enhancer 6 ul TUBE 9 T4 RNA Ligase 1 U ul 1 ul TUBE 13 Total Volume 20 ul It is important to dilute the stock 5 U ul RNA ligase in 1X ligation buffer TUBE 8 as needed Excess enzyme has been shown to promote unwanted side ligation reactions including circularization of the target RNAs Aravin and Tuschl 2005 25 Incubate these reactions at 22 C for two hours then Add 80 ul IDTE pH 7 5 TUBE 7 Transfer entire volume to an RNase free 1 5 ml tube Add 3 ul glycogen 10 mg ml TUBE 11 Add 1 10 volume 10 ul 3 0 M NaOAc TUBE 12 Add 2 5 volumes 250 ul 20
26. r specific activity than traditional 5 end labeling with polynucleotide kinase It is based on 3 end labeling with DNA polymerase This labeling method is particularly useful for probes to identify small regulatory RNA and analyze the expression of miRNA genes
27. t Contents Tube Number Contents 1 3 cloning linker 2 5 cloning linker 3 miSPIKE internal control RNA 4 Forward PCR primer 5 Reverse transcription PCR primer 6 IDT RNase DNase pyrogen free water 7 IDTE pH 7 5 8 10X ligation buffer 9 Ligation enhancer 10 10 mM ATP 11 10 mg ml Glycogen 12 3 M NaOAc pH 5 2 13 T4 RNA Ligase 5 U l 14 T4 DNA Ligase 30 U l Storage Recommendations Store all kit components at 20 C NOTE Repeated freezing and thawing of ATP is not recommended It is best to store ATP in smaller aliquots and to thaw only as much as will be needed for each library construction Cloning linkers miSPIKE internal RNA control and PCR primers are provided dry Before opening centrifuge the tubes containing dried material and follow the instructions in Table 1 below All reagents should be handled with gloves under RNase free conditions Table 1 Rehydration of Stock Oligonucleotides Tube Number Contains IDTE Tube 7 Final Concentration 1 3 cloning linker 20 ul 50 uM 50 pmole ul 2 5 cloning linker 20 ul 50 uM 50 pmole ul 3 miSPIKE 12 ul 8 3 uM 8 3 pmole ul 4 Forward PCR primer 100 ul 10 uM 10 pmole pl 5 RT Reverse PCR primer 100 ul 10 uM 10 pmole l Additional Reagents and Supplies In addition to the materials supplied in this kit you will need the following Reagent Recommended Vendor Ban I restriction endonuclease New England Biolabs Cat No RO118S GelStar Nuclei
28. tor Velculescu Cummins et al PVAS 103 3687 3692 2006 PCR Amplification Concatemerization requires significantly more amplicon mass than is routinely obtained in a single PCR amplification Therefore assemble six parallel PCR amplification reactions in separate nuclease free 0 2 ml tubes as follows Reverse transcription reaction 3 0 ul IDT water 35 5 ul TUBE 6 10X PCR Buffer 5 0 ul MgCl 25 mM 3 0 ul dNTPs 10 mM 1 0 ul Forward Primer 10 uM 1 0 ul TUBE 4 Reverse Primer 10 uM 1 0 ul TUBE 5 Taq polymerase 5 U ul 0 5 ul Total Volume 50 0 pl PCR Conditions 95 0 C for 10 minutes 95 0 C for 30 seconds 25 cycles lt 52 0 C for 30 seconds 72 0 C for 30 seconds 72 0 C for 5 minutes Amplicon Processing Check the quality of the PCR amplification by running 5 ul of each reaction on a high percentage agarose gel The expected amplicon size is 62 bp The remaining 45 ul of each of these reactions is pooled in a 1 5 ml tube Add an equal volume 270 ul of phenol chloroform isoamyl alcohol 25 24 1 Vortex this reaction and centrifuge at full speed 16000 x g for 5 min Transfer the upper aqueous phase to a new 1 5 ml tube Add 1 10 volume 27 ul of 3 M NaOAc pH 5 2 and three volumes 900 ul of cold 100 EtOH ga da rm 13 5 Place the tube at 80 C for 20 minutes 6 Centrifuge at full speed 16000 x g for 10 minutes 7 Pour off the supernatant and wash the pellet in 900 ul of ice cold 70 EtOH
29. ul 1 ul TUBE 14 Total Volume 20 ul This reaction is then incubated over night at room temperature 14 End Filling and Non templated Adenosine Addition To prepare the concatemers for cloning into a PCR cloning vector it is necessary to fill in the concatemer ends and to add an overhanging adenosine nucleotide Add the following to the 20 ul concatemer reaction 10 mM dNTPs 1 7 ul MgCl 2 4 ul 10X PCR Buffer 3 0 ul IDT water 2 4 ul TUBE 6 Taq polymerase 5 U ul 0 5 ul Total Volume 30 ul Incubate this reaction at 95 C for five minutes 72 C for ten minutes then cool to 25 C before cloning Cloning This reaction can be passed through a QIAQuick PCR clean up column QIAGEN Cat No 28104 to remove buffers and dNTPs This is also helpful as it will remove small unligated fragments that will compete in the cloning reaction The QIAQuick column removes a significant amount of these smaller competing fragments At this point the reaction is ready for cloning using a standard PCR cloning vector such as TOPO TA Cloning Invitrogen or pGEM T EASY Promega Whichever vector is chosen cloning should be done as recommended by the supplier Plasmid DNA preparation and DNA sequencing can be performed using your method of choice Concatemer Sequencing Concatemerization results in a series of small RNAs separated by well defined linker units in which the Ban I site is reconstituted The connector sequence will be either C
Download Pdf Manuals
Related Search