Home

CytoTracers User Manual

image

Contents

1. The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research HIV Vector System This product is for non clinical research use only Use of this Product to produce products for resale or for any diagnostic therapeutic clinical veterinary or food purpose is prohibited In order to obtain a license to use this Product for these commercial purposes contact the Office of Research and Technology Ventures at the Dana Farber Cancer Institute Inc in Boston Massachusetts USA This Product or the use of this Product is covered by U S Patents Nos 5 665 577 and 5 981 276 and foreign equivalents owned by the Dana Farber Cancer Institute Inc WPRE Technology SBI has a license to sell the Product containing WPRE under the terms described below Any use of the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If y
2. CYTOxxx Peptide Tag Neuromodulin Farnesylation signal Cytochrome C Oxidase VIII ER targeting consensus Galactosyltransferase Secretory consensus peptide Cathepsin B RhoB Peroxisomal Consensus Signal LC3 CD63 Tetraspanin B actin a tubulin Microtubule associated protein 4 MAP4 H2B Cyclic inactive luciferase BAX B Catenin activation PSD 95 GFP Untagged RFP Untagged GFP and Luciferase Untagged lll Protocol A Transfection of pCT Vector into Target Cells The pCT vectors can be transfected into target cells for use in pilot experiments or for use in cells that are easy to transfect We recommend using SBI s PureFection nanotechnology based transfection reagent according to the protocol http www systembio com downloads PureFection protocol ver2 pdf 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual B Transduction of pCT Vector into Target Cells For cells that are more difficult to transfect such as stem cells primary cells or hematopoietic cells or to create stable GFP tracer cell lines we recommend packaging the pCT vector into virus and then transducing the target cells with the virus For a protocol and list of necessary supplies and reagents please refer to the Lentivector Expression Systems manual http www systembio com lentiviral technology delivery systems ppack id product_11 product_8 tab 1 4 C Creating your own Cyto Trac
3. only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center lowa City IA 52242 CopGFP Conirol This product contains a proprietary nucleic acid coding for a proprietary fluorescent protein s intended to be used for research purposes only Any use of the proprietary nucleic acids other than for research use is strictly prohibited USE INANY OTHER APPLICATION REQUIRES A LICENSE FROM EVROGEN To obtain such a license please contact Evrogen at license evrogen com SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Page 10 ver 1 070610 www systembio com Cyto Tracers Cat CYTOxxx Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Pr
4. to infect cells This portion of the vector differs protein depending on the CytoTracer you have ordered Drives expression of the puromycin resistance gene 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Puro Provides puromycin resistance for creation of stable cell lines from transfection or for selection of infected cells Enhances stability and translation of the lentivector driven transcripts Self inactivating LTR that enables integration into the host genome Ensures high copy replication and maintenance of the plasmid in E coli cells resistance Provides stable propagation the lentiviral plasmid in 293TN aed cells SV40 Enables efficient termination of polyadenylation transcription and processing of signal recombinant transcripts GFP Fusion Protein Characteristics Each construct encodes a fusion protein consisting of an organelle specific signaling peptide and the copGFP The organelle specific signaling peptide directs the copGFP to the appropriate subcellular location SBI also offers a GFP untagged vector for researchers who would like to create their own tag for subcellular locations not currently available copGFP is a novel natural green monomeric GFP like protein derived from copepod Pontellina sp The copGFP has optimized human codons for a high level of expression of the fluorescent protein CopGFP is a non toxic non aggregating protein with fast p
5. Cyto Tracers Cat CYTOxxx SSB System Biosciences Cyto Tracers GFP fusion proteins for in vivo tracing Cat CYTOxxx User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 1 070610 contained in this user manual 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Contents I Introduction anmi Backgnounds 4 i 4 ste thine eR ee Ai A ee ed ee eA 3 il Available Gyto TraCers orrasa Argue savagery A e a aR AA a nana eA ewe AR hand endan Amines 5 III Protocolo carirer i Aner a A AE NE AAEE lt pen AEE A NOE AE A ede 5 Transfection of pCT Vector into Target Cells aessssesssresesrseesrrnnesternnattnneaetandennnassntnannatinndantanaatanatteaaaatannaantn nae 5 B Transduction of pCT Vector into Target Cells 0 0 ee eecceeeeeereeeeeseeeeeeeseeeeeeeeeeeaeeeseeeeeeeeseeeeeeeseeeaeeeseeaeeeeseaaeees 6 Creating your own Cyto Tracer fusion protein Optional ce eeeeeeeneeeeeeeeeeeeeneeeeeeeeaeeeseeaeeeeeeaeeeseenaeeeeeeaes 6 IV EX IMPI SS iiss pn seethaec Peers aie a a a tl peed et ahaa aa aa restate eecte dees eats eth dees utero ate eet denies 8 A GFP fluorescence from Cyto Tracers with different subcellular location SpeCific tags ceceeeeetteeeeeenteeeeeeeee 8 B pCT vectors can be either transduced or t
6. agctagcgaattcgaatttaaatcggatccgcggccgcatggecccttagtaag 2288 BstBl Please refer to the SBI website http Awww systembio com for other sequences and MCS maps 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual IV Examples A GFP fluorescence from Cyto Tracers with different subcellular location specific tags r Cat CYTO113 PA 1 Cat CYTO10SPA 1 Peroxisomes Ae a Secretory Catt CYTO108 PA 1 Nucleus Vesicles i r Cat CYTO1118A 1 Microtubules p v R Catt CYTO112 PA 1 Tublin Cat CYTO118 PA 1 Cat CYTO119 PA 1 Plasma Membrane N x P Cytosol Green Cytosol Red I cat cytor00 pa 1 Page 8 ver 1 070610 www systembio com Cyto Tracers Cat CYTOxxx B pCT vectors can be either transduced or transfected into cells Transduced 293 cells pCT cD63 GFP CD63 Tetraspanin Tag _ Catalog CYTO120 PA 1_ gt v ANN A gt TAA NaS R J w ahr Transfected 293 cells 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual V Licensing and Warranty Limited Use License Use of the Cyto Tracers i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms
7. er fusion protein optional SBI offers both N and C terminal RFP and GFP Cyto Tracer vectors for creating your own fusion proteins Two strategies can be used to clone a cDNA in frame with the RFP or GFP tag 1 SBs Cold Fusion Kit Cat MCO10A 1 2 Use the MCS with appropriate restriction enzymes followed by sequencing of the construct Cloning your own fusion protein into pCT with Cold Fusion SBI s Cold Fusion kit allows you to directly clone any PCR product to any linearized expression vector at any site The PCR fragments can be generated by Taq DNA polymerase or other high fidelity DNA polymerases with primers that are designed to have at least 15 bases of homology at their linear ends to where you want the product to fuse The linearized vector can be generated by PCR or restriction enzymes single or double cut The system is highly efficient with more than 95 positive cloning rate To use the Cold Fusion kit with the N terminal RFP or GFP tag the 5 primer should contain 18 20 bases complimentary to the 5 end of your insert plus 15 bases corresponding to the vector You do not need to omit the ATG start site from the 5 portion of your insert The 3 portion of the insert MUST contain a stop codon The 3 primer should contain 18 20 bases complimentary to the 3 end of your insert plus 15 bases corresponding to the vector 15bp 18 20bp 18 20bp 15bp Maia eee Forward Primer NNNNNNNNNNNNNNN
8. ese constructs in a variety of cell types constructs are available with two extensively tested promoters The Murine Stem Cell Virus promoter MSCV is useful for stem cells and hematopoietic cell types The Cytomegalovirus promoter CMV driven constructs can be used for other easier to infect cell types Cyto Tracers can be used in transfections or packaged into virus to create stable GFP tracer cell lines in primary cells tumor cell lines and stem cells This allows researchers to perform preliminary plasmid based transfection experiments before proceeding to package lentivirus particles which allow long term and in depth studies Fusion Tag Directs Tracer Localization Nucleus with H2B Tag r pCT CMV MSCV GFP Fusion EF1 Puro pCR Mitochondria with COX8A Tag Vector Components The components of the pCT CMV MSCV GFP Fusion EF1 Puro vectors are displayed in the table below Hybrid RSV 5 LTR For HIV based vectors Provides a high promoter level of expression of full length pseudoviral constructs in 293 producer cells cPPT GAG LTRs Genetic elements necessary for the packaging transduction and stable integration of the viral expression construct into genomic DNA CMV or MSCV Promoter that drives expression of the GFP fusion protein in the construct The MSCV promoter is useful for cells that are difficult to infect or transfect such as stem cells and hematopoetic cells The CMV promoter is useful for easy
9. oduct or provide the purchaser with a credit This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a credit limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2010 System Biosciences SBI All Rights Reserved 888 266 5066 Toll Free 650 968 2200 outside US Page 11
10. ou do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies SBI grants you a non exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies This license agreement is effective until terminated You may terminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Products containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation and enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Management Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes
11. ransfected into cells cccececceceeeeeeeeeeeceeeeeeeeeesenaeaeeeeeeesessenuaeeeeees 9 Vee Eicensing and Warranty icc tae adlb A i ee tee ee a es ale 2 tale 10 List of Components Each vial contains 10 ug plasmid DNA in TE buffer Vials are shipped at room temperature or on blue ice and should be stored at 20 C upon receipt Properly stored samples are stable for 1 year from the date received Page 2 ver 1 070610 www systembio com Cyto Tracers Cat CYTOxxx I Introduction and Background Molecular trafficking is a dynamic process in eukaryotic cells The Cyto Tracers provide a means of live monitoring of molecules in real time SBI has created a line of lentivector based Cyto Tracers that utilize GFP fusion proteins to mark cellular compartments organelles vesicles and structures to enable more long term and more in depth experimentation Using Cyto Tracers cellular structures can be visualized in real time by fluorescence microscopy without the use of chemical staining You can also monitor the dynamic movement of a protein of interest in relationship to a given subcellular compartment or structure by labeling the protein of interest with separate fluorescent proteins The Cyto Tracers are built upon an HIV based lentiviral expression system to enable broad tropism for delivery stable expression via integration robust synthesis and expression by using appropriate promoter elements To ensure the expression of th
12. rotein maturation high stability at a wide range of pH pH4 12 and does not require any additional cofactors or substrates The copGFP protein has very bright fluorescence that exceeds at least 1 3 times the brightness of EGFP the widely used Aequorea victoria GFP mutant The copGFP protein emits green fluorescence with the following characteristics excitation wavelength max 482 nm emission wavelength max 502 nm Due to its exceptional properties copGFP is an excellent fluorescent marker that can be used instead of EGFP for monitoring molecular dynamics Page 4 ver 1 070610 www systembio com Cyto Tracers Available CytoTracers Cyto Tracer pCT Mem GFP pCT InnerMem GFP pCT Mito GFP pCT ER GFP pCT Golgi GFP pCT Secretory GFP pCT Lyso GFP pCT Endo GFP pCT Pero GFP pCT Autophago GFP pCT CD63 GFP pCT Actin GFP pCT Tubulin GFP pCT MAP4 GFP pCT H2B GFP pCT Apoptosis Luc pCT GFP BAX pCT Catenin GFP pCT CMV PSD95 GFP pCT Cyto GFP pCT Cyto RFP pCT Cyto GFP Luc Target Location Plasma Membrane Inner Leaflet of Membrane Mitochondria Endoplasmic Reticulum Golgi Apparatus ER Golgi Vesicles Lysosome Endosome Peroxisome Autophagosome Exosome Secretory Cytoskeleton Cytoskeleton Microtubule Nucleus Caspase3 7 activation Cytosol to Mitochondria Cytosol to Nucleus Cell Membrane Dendrite Membranes Cytosolic Compartment Cytosolic Compartment GFP and Luciferase Control Cat
13. y NNNNNNNNNNNNNNN Reverse Primer To use the Cold Fusion kit with the C terminal RFP or GFP tag the 5 primer should contain 18 20 bases complimentary to the 5 end of your insert and must contain a Kozak sequence and ATG start site plus 15 bases corresponding to the vector The 3 end of the insert must NOT contain a stop codon The 3 primer should contain 18 20 bases complimentary to the 3 end of your insert plus 15 bases corresponding to the vector 15bp 18 20bp 18 20bp 15bp Vector sequence ee Forward Primer p NNNUNNNNNNNNNG y NNNNNNNNNNNNNNN NNNNNNNNNNNNNNN emm Reverse Primer Page 6 ver 1 070610 www systembio com Cyto Tracers Cat CYTOxxx Cloning your own fusion protein into pCT using the Multiple Cloning Site To use the MCS with the N terminal RFP or GFP tag you do not need to omit the ATG start site from the 5 portion of your insert but the insert should remain in frame with the RFP or GFP tag The 3 portion of the insert MUST contain a stop codon 2976 2982 2988 2996 3005 3011 Xbal Nhel EcoRI Swal BamHI Noti N term RFP 3 vector ee a ee 2991 BstBi To use the MCS with the C terminal RFP or GFP tag your insert must contain a Kozak sequence and ATG start site The 3 end should remain in frame with the RFP or GFP sequence and must NOT contain a stop codon 2773 2779 2285 2293 2302 2308 Xbal Nhel EcoRI Swal BamHI Noti 5 vector C term RFP acctccatagaagat tctag

Download Pdf Manuals

image

Related Search

Related Contents

gebrauchsanweisung használati utasítás operating  Samsung YP-Q3 User Manual  ダウンロードを開始します。  Franke RUG 110  OCS User Guide OCS-A,B,C,G,Z  G7200 geniuschargers.com - Genius Battery Chargers  Massive Suspension light 41648/35/10      ODS Overheight Detection System  

Copyright © All rights reserved.
Failed to retrieve file