QuantiMir User Manual
Contents
1. SSB Yuantimir System Biosciences QuantiMir RT Kit Small RNA Quantitation System Cat RA420A 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 4 150511 contained in this user manual QuantiMir RT Kit Contents Vi Vil Introduction and Background Overview mogogwp e lt oO S Oo e h v e e Q 2 Protocol A QuantiMir RT Reaction Setup B Primer Design Considerations Cc D Quality Control and Sample Data A Sensitivity Tests B Specificity Tests C Sample Data Appendix A Related Products 888 266 5066 Toll Free 650 968 2200 outside US Cat RA420A 1 aun kN ND 18 fois 19 20 21 Page 1 System Biosciences SBI User Manual I Introduction and Background A Overview This manual provides details and information necessary to use the QuantiMir RT Kit to tag and convert small non coding RNAs into detectable and quantifiable cDNAs To ensure optimal results please read the entire manual before using the reagents and material supplied with this kit B Importance of MicroRNAs and Other Small Non Coding RNAs The field of non coding RNAs has gained increasing attention in recent years particularly due to the discovery of small interfering RNAs siRNAs and micro RNAs2. 1 6 The mature miRNA sequence 5 uagcagcacguaaauauuggcg 3 can be simply converted to a DNA sequence and used directly as the forward primer for end point and qPCR analysis Forward primer for hsa miR 16 included in kit 5 TAGCAGCACGTAAATATTGGGG 3 Tm 58 9 C 45 GC and length 22 bases If the user is developing a new assay for a novel miRNA follow the guidelines of the example above Design the primer to have a Tm of at least 50 C and to have a length of at least 18 bases If the primer being designed for the miRNA to be studied has a Tm below 50 C lower the annealing temperature in your cycling conditions for end point and qPCR instrument settings An example of successfully using this approach is demonstrated in Figure 5 Page 8 ver 4 150511 www systembio com Simple Directly use sequence of mature miRNA as forward QuantiMir RT Kit Cat RA420A 1 C End point PCR Reactions The following PCR reaction conditions are recommended 1 ul QuantiMir cDNA diluted see p 7 0 5 ul Universal Reverse Primer 10 uM 1 pul miRNA specific Forward Primer 10 uM user designed 2 5ul 10X PCR Buffer with 2 5 mM MgCle 1 ul 10 mM dNTPs mix 1 ul Taq polymerase not supplied in Kit 18 ul RNase free water 25 ul Total Prepare reaction in a suitable PCR tube or plate and thermocycle as follows Heat denature at 95 C 10 min Heat denature at 95 C 15 sec Anneal Primers at 60 C 1 min
3. 30 cycles Hold at 15 C optional Prepare and pour a 3 5 agarose 1X TAE or 1X TBE gel with a suitable stain Ethidium Bromide etc Add 2 5 ul of 10X Loading dye mix and load 10 ul into a well of the gel Also run a suitable DNA size marker 50 2 000 bp along with your samples Take care to only electrophorese your gels for 10 15 minutes and then visualize An example of end point PCR primer tests and gel electrophoresis is shown in Figure 3 TOS New miRNA like Sequences a es rm a b a b c M M miR 16 4 7 Fig 3 QuantiMir end point PCR for miR 16 and seven newly identified miRNA like sequences by SBI Numbers on the top of the gel correspond to cDNA clone number Letters indicate specific sequence found in corresponding clone Include a DNA size ladder with markers in the range of 50 2 000 bp e g Bio Rad AmpliSize DNA Ladder Cat 170 8200 M denotes DNA Marker lanes The size range of the PCR products typically ranges between 50 and 100 bp The adaptor segment is 46 bp with the miRNA sequence comprising the remaining PCR product size 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI D Real time qPCR Reactions using QuantiMir cDNAs For end point PCR reactions please refer to the Section C above End point PCR Reactions using QuantiMir cDNAs 1 Page 10 qPCR Reaction Setup To determine the expression profile for your miRNA under study mix th
4. 74 Sequence SICER experimental cloned 1 The mature miRNA sequence 5 ugugacagauugauaacugaaa 3 can be converted to a DNA sequence along with designing its complement or antisense primer sequence Forward sense primer for hsa miR 542 3p 5 T TGACAGATTGATAACTGAAA 3 Forward antisense primer for hsa miR 542 3p 5 TTTCAGTTATCAATCTGTCACA 3 Tm 49 6 C 32 GC and length 22 bases miR542 3p Sense and Antisense Signal Profiles miR542 3p Sense Primer miR542 3p Antisense Primer Signal Undil 1 2 1 5 1 10 NTC Undil 1 2 1 5 1 10 NTC Fig 5 Sense and antisense test of the QuantiMir cDNA Dilutions of the QuantiMir cDNA template as well as no template controls NTC were tested with either sense or antisense orientation for the Human miR 542 3p molecule Quantitative results are observed for the sense orientation of miR 542 3p No signals are observed in the antisense or no template controls The annealing temperature for the qPCR cycling conditions was lowered to 50 C 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual C Sample Data 1 Tissue Expression Pattern Determinations using the QuantiMir Kit The QuantiMir cDNA sets were synthesized from 18 separate normal Human tissues and tested with 2 primers specific for 2 known miRNA molecules miR 1 heart and skeletal muscle sp
5. 92 were using to detect the corresponding microRNA species in the tissues detailed in the expression graph below Figure 7 The signals were normalized to expression levels of the U6 snRNA transcript Fold increases and decreases in Normal vs Tumor tissues are graphed below and are consistent with published findings for the particular microRNA in the specific tumor type Lymph Node E Normal E Tumor miR 125b miR 125b miR 17 3p Fig 7 Quantitative analysis of MicroRNA expression in tumor and normal tissue samples The Bar graph data are grouped by tissue type with normal tissues in blue bars and tumor tissues in red bars The specific MicroRNAs being detected are listed below the bar graphs The expression levels are normalized to U6 snRNA transcript levels to control for RNA input The MicroRNA expression levels are depicted as ACt vales Y axis Real time assays were performed as described in Section II D 2 of this manual 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual 3 Detection and Quantitation of siRNA Production from Transduced shRNA Expression Constructs The QuantiMir cDNAs were synthesized from Human T Rex 293 cells transduced with equivalent amounts of Lentivirus containing the SBI shRNA expression constructs for the p53 shRNA driven by the H1 promoter with Tet repressor elements p53 H1 Tx2L or without Tet responsive elements p53 H1
6. Hannon G J Hammond S M 2005 A microRNA polycistron as a potential human oncogene Nature 435 828 833 Page 18 ver 4 150511 www systembio com QuantiMir RT Kit Cat RA420A 1 16 17 18 19 Lai E C Wiel C Rubin G M 2004 Complementary miRNA pairs suggest a regulatory role for miRNA miRNA duplexes RNA 710 171 175 Ambros V Bartel B Bartel D P Burge C B Carrington J C Chen X Dreyfuss G Eddy S R Griffiths Jones S Marshall M Matzke M Ruvkun G Tuschl T 2003 A uniform system for microRNA annotation RNA 9 277 279 Obernosterer G Leuschner P J F Alenius M Martinez J 2006 Post transcriptional regulation of microRNA expression RNA 12 1 7 Dostie J Mourelatos Z Yang M Sharma A Dreyfuss G 2003 Numerous microRNPs in neuronal cells containing novel microRNAs RNA 9 180 186 VI Appendix A Related Products Cancer microRNA qPCR Array Cat RA610A 1 Pre formatted 96 well plate containing assays for 95 oncomirs and U6 control 10 complete profiles plus QuantiMir kit included Stem Cell microRNA qPCR Array Cat RA620A 1 Pre formatted 96 well plate containing assays for 95 different microRNA invioved in stem cell self renewal hematopoiesis neural development and tissue specificity Arra also contains U6 control 10 complete profiles plus QuantiMir kit included miRNome Profilers Cat RA660A 1 Human Cat RA670A 1 Mouse P
7. nearly all commercially available T7 IVT kits using Full Spectrum technology Just replace the existing T7 primer with the Full Spectrum primers Compatible with Affymetrix GeneChip hybridization B Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 265 North Whisman Rd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com Page 20 ver 4 150511 www systembio com QuantiMir RT Kit Cat RA420A 1 Vil Licensing and Warranty Statement Limited Use License Use of the QuantiMir RT Kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights
8. Heat for 5 min at 60 C dT Adaptor Synthesize cDNAs Done Let cool to room temp for 2 min Add 4 ul 5X RT Buffer STEP 3 2 pl dNTP mix 1 5 pl 0 1M DTT 1 5 pl RNase free H20 1 ul Reverse Transcriptase 20 5 ul Total in tube Incubate for 60 min at 42 C Heat for 10 min at 95 C The QuantiMir cDNAs can be stored at 20 C How much cDNA template per qPCR reaction Starting RNA QuantiMir cDNA per qPCR reaction 10pg 100 ng 0 5ul to tul 100ng 1 ug Dilute 1 100 gt 1 pg Dilute 1 1000 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual B Primer Design Considerations for QuantiMir cDNA Detection and Quantitation The user needs only to design the forward sense orientation primer to perform the end point or qPCR reactions MicroRNAs typically range in size from 19 24 nt We recommend using the exact sequence of the miRNA or siRNA being studied when designing the forward primer If the miRNA under study is known and documented using the miRBase database can be an easy starting point http microrna sanger ac uk sequences search shtml An example of the known and documented miRNA Human miR 16 is shown below Hsa miR 16 Mature sequence MIMATO000069 MIMATOOO0069 Accession Hew hsa miR 16 primer in oligo design 14 uageagcacgquaaauanuggeg 35 Sequence iSYtelgeem experimental cloned 1 5 7 Northern
9. T TTT 5 RT to create first strand Convert to cDNA cDNAs 42 C 60 min cDNA pool of anchor tailed microRNAs ee TTT am 5 Single cDNA synthesis 3 Profile all microRNAs Universal Reverse cDNA templates ready for qPCR primer provided L_____ TTTTTTTTT 5 3 p microRNA specific Forward Primer Assay e Real time PCR Analysis or End point PCR and Gel Analysis Fig 2 Workflow schematic for a typical QuantiMir RT experiment Trizol purified total RNA is recommended to ensure small RNA fraction present Page 4 ver 4 150511 www systembio com QuantiMir RT Kit Cat RA420A 1 D List of Components Each QuantiMir RT Kit contains the following components with enough material to perform 20 reactions as outlined in this manual 0 ui EX Reverse Transcriptase Buller enough tor 20 reactions 20 ut Reverse Transcriptase id 30 u orm Dihiotwenot OT sow fantom ooo Human U6 snRNA Control Human Mouse miR 16 Control Forward Primer Sequence Forward Primer Sequence 5 CGCAAGGATGACACGCAAATTC 3 5 TAGCAGCACGTAAATATTGGCGG 3 Tm 59 C amplicon size 84 bp Tm 58 9 C amplicon size 68 bp Mouse U6 snRNA Control Forward Primer Sequence 5 TGGCCCCTGCGCAAGGATG 3 Tm 63 C amplicon size 97 bp The kit is shipped on blue ice and should be stored at 20 C upon arrival Properly stored kits are stable for 1 year from the date received E Additional Required Materials
10. Thermocycler with heated lid Thermocycler PCR tubes or plates for end point reactions PCR Mastermix including Taq polymerase for PCR 3 0 3 5 Agarose Gel in Tris Borate EDTA TBE or Tris Acetate EDTA TAE Buffer e DNA Size Ladder with markers from 50 to 2 000 bp Bio Rad AmpliSize DNA Ladder Cat 170 8200 e Real time qPCR Instrument 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual IMPORTANT Recommended 2X SYBR Green qPCR Mastermixes SBI has tested and recommends SYBR Green Master mix from three vendors Power SYBR Master Mix Cat s 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat s 11760 100 11760 500 and 11760 02K and RT Real Time SYBR Green ROX PCR Cat s PA 012 and PA 112 from SuperArray Page 6 ver 4 150511 www systembio com QuantiMir RT Kit Cat RA420A 1 ll Protocol A QuantiMir RT Reaction Setup W Start STEP PolyA Tail It is important to start with total RNA that includes the small RNA fraction In a thin walled PCR tube or PCR compatible plate well combine 5 ul Total RNA 10 pg 10yg 1 2 ul 5X PolyA Buffer 1 pl 25mM MnCl 1 5 pl 5mM ATP 0 5 pl PolyA Polymerase 10 ul Total in tube l Incubate for 30 min at 37 C Add 0 5 ul Oligo dT Adaptor STEP 2 Anneal Anchor
11. cific for Human miR 16 and Human miR 24 For procedure see Section II D 1 Protocol Real time qPCR z a F E miR 16 gt f miR 24 n t AN y l Z a l z 7 on B l m i i en nw 209 mone re a 29 pm pon pya a zrs RNA Input pdr eies miR 16 R miR 26 F R eoor i yros 2m9 pe p some pe r gt r a ee B Fig 4 Real time qPCR data for Human miR 16 and Human miR 24 Real time qPCR amplification plots are shown in the upper inset Cycle threshold Ct values were determined using the software automatic baseline and Ct settings The Bar graph depicts the relative Signal per RNA input amount for the microRNA The graph below shows the linear regression analysis with a R value of 0 971 for miR 16 and 0 993 for miR 24 Both microRNAs are readily detectable down to 200 pg of total starting RNA input Page 12 ver 4 150511 www systembio com QuantiMir RT Kit Cat RA420A 1 B Specificity Tests To assess the specificity and proper orientation of the miRNA array oligonucleotide primers are synthesized both in the sense and the antisense orientation An example for the known documented miRNA miR 542 3p is detailed below Hsa miR 542 3p Mature sequence MIMAT0003389 Accession Sequence of mature miRNA MIMATO003389 as forward primer in sense TIM hsa miR 542 3p oligo design and then designed in the antisense oligo as control 53 ugugacagauugauaacugaaa
12. e following per well For Single well determination 15 ul 2X SYBR Green qPCR Mastermix buffer 1 pul User designed Forward Primer 10 uM o5 ul Universal Reverse Primer 10 uM 1 ul Diluted QuantiMir cDNA see p 7 12 5 ul RNase free water 30 ul Total well The Mastermix contents can be scaled up or down depending upon on your experimental needs Once reagents are loaded into the wells cover the plate with the optical adhesive cover and spin briefly in a centrifuge to bring contents to bottom of wells Place plate in the correct orientation well A1 upper left into the Real time qPCR instrument and perform analysis run Real time qPCR Instrument Parameters Follow the guidelines as detailed for your specific Real time instrumentation The following parameters tested by SBI were performed on an Applied Biosystems 7300 Real time PCR System but can also apply to an ABI 7500 or an ABI 7900 96 well system The details of the thermocycling conditions used in testing at SBI are shown below A screenshot from SBI s instrument set up is shown on the right Default conditions are used throughout except for those cases where the Forward Primers Tm is below 55 C then the annealing temperature in Step 2 of Stage 3 is lowered from 60 C to 50 C ver 4 150511 www systembio com User Manual QuantiMir RT Kit Cat RA420A 1 q PCR cycli ng and Setup Yinstrument YResutts Y data accumulation Instrument Control Temperat
13. ecific and miR 122a abundant in liver The amplification plots and corresponding expression bar graphs are shown in Figure 6 panels a and b Page 14 ines T m 5 D 5 s ES 3 123456 7 8 9 10 1112 1314 1516 1718 miR 122a z 5 5 5 s 123456 7 8 9 10 1112 1314 1516 1718 Fig 6 Real time qPCR data using primers specific for Human miR 1 Panel a and for miR 122a Panel b The amplification plots are shown on the left with the resulting expression profile bar graphs based on Ct values is shown on the right The default qPCR cycling conditions were used with an annealing temperature of 60 C in Step 2 of Stage 3 These two known miRNAs miR 1 and mir 122a have very specific tissue expression patterns Real time qPCR data confirmed that miR 1 is restricted to skeletal muscle and heart The sensitivity of the assays also reveals very low but detectable signals in additional tissues miR 122a is known to be highly abundant in liver ver 4 150511 www systembio com QuantiMir RT Kit Cat RA420A 1 2 Analysis of Tumor and Normal Tissue MicroRNA Expression Levels using the QuantiMir Kit and Real time qPCR The QuantiMir cDNAs were synthesized from both Normal and Tumor Breast Lung Ovary Colon and Lymph node RNAs MicroRNA forward primers specific for miR 9 1 miR 155 miR 125 miR 145 miR 7 miR 17 3p miR 18a miR 20a and miR
14. kas E J Goulub T R Mooth V Lindblad Toh K Lander E S and Kellis M Systematic discovery of regulatory motifs in human promoters and 3 UTRs by comparison of several mammals Nature 434 338 45 Lagos Quintana M Rauhut R Lendeckel W Tuschl T 2001 Identification of Novel Coding for Small Expresses RNAs Science 294 853 858 Basyuk E Suavet F Doglio A Bordonne R Bertrand E 2003 Human let 7 stem loop precursors harbor features of RNase III cleavage products Nucleic Acids Res 37 6593 6597 Chomczynski P and Mackey K One hour downward capillary blotting of RNA at neutral pH 1994 Anal Biochem 221 303 305 Shi R Chiang V L 2005 Facile means for quantifying microRNA expression by real time PCR BioTechniques 39 519 525 Ding Y Chan C Y and Lawrence C E 2005 RNA secondary structure prediction by centroids in a Boltzmann weighted ensemble RNA 11 1157 1166 Griffiths Jones S Grocock R J Van Dongen S Bateman A Enright A J 2006 miRBase microRNA sequences targets and gene nomenclature Nucleic Acids Research 34 D140 D144 Shingara J Keiger K Shelton J Laosinchai Wolf W Powers P Conrad R Brown D Labourier E 2005 An optimized isolation and labeling platform for accurate microRNA expression profiling RNA 11 1461 1470 He L Thomson J M Hemann M T Hernando Monge E Mu D Goodson S Powers S Cordon Cardo C Lowe S W
15. les the cDNAs are ready to use for either End point PCR experiments or to perform Real time qPCR analysis The user simply only needs to design the forward primer which corresponds to the miRNA or siRNA of interest and provide Real time PCR SYBR green master mix for Real time PCR or typical PCR mastermix with Taq DNA polymerase for End point PCR expression profiling Page 2 ver 4 150511 www systembio com QuantiMir RT Kit Cat RA420A 1 Recently previously unknown germline specific classes of miRNA like molecules were identified in mouse testes and mouse oocytes illustrating the need for continued and in depth miRNA discovery efforts across a wide range of tissues These facts taken together demonstrate an ever increasing need for simple robust and sensitive methods that enable discovery and quantitation of microRNAs and their precursors Pre miRNA Pri miRMA Mature miRNA within RISC Fig 1 Diagram of MicroRNA biogenesis processing and function 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual C Overview of Protocol How QuantiMir Works A Single Tube 10pg 10yg microRNA total RNA anchor tailed 3 Step Assay microRNA 5 3 poly A polymerase TEY g Tag small RNA polyA tailed Incubate at 37 C 30 min microRNA gt TT AAAA 5 N T T rT i 5 2 Anneal adaptor Anneal oligo dT adaptor 60 C 5 min Se AAAA AAA AA 3 F A TOT TT
16. miRNA These RNAs are short typically 19 24 nucleotides single stranded moieties that regulate the expression of target genes by interacting with complementary sites within the target mRNAs and either repressing translation or eliciting target mRNA degradation miRNAs and siRNAs are conserved groups of non coding RNAs with very important regulatory roles Mature miRNAs and siRNAs are excised from stem loop precursors which are themselves transcribed as part of longer primary transcripts These primary miRNAs appear to be first processed by the RNase Drosha in the nucleus after which the precursor miRNAs are exported to the cytoplasm where the RNase Dicer further processes them These enzymes are also involved in the generation of mature small inhibitory RNAs siRNA from exogenously transferred double stranded siRNA precursors The current standard method for detecting and quantifying novel miRNA and siRNA molecules involves Northern blotting with hybridization Detecting and quantitating known miRNAs can be done using pre designed reverse priming and reverse transcription followed by primer sets built for the specific miRNA for Real time PCR analysis These sets require many steps and can take several hours to complete and trouble shoot The QuantiMir RT kit provides all the reagents necessary to anchor tail and convert small non coding RNAs into cDNA starting from total RNA samples Once the user performs the reactions on their RNA samp
17. ols Correct size band and larger PCR band s observed in end point PCR tests 888 266 5066 Toll Free 650 968 2200 outside US Cat RA420A 1 Possible Solution Alter thermocycle conditions lower annealing temperature Include the U6 and or miR 16 control Forward primers in separate reactions as PCR controls Alter thermocycle conditions elevate annealing temperature Include the U6 control Forward primer in a separate reaction as PCR control Dilute your QuantiMir cDNA by 1 100 and try again Potential precursor pri miRNA or pre miRNA molecules are being amplified Page 17 System Biosciences SBI User Manual References 1 10 11 12 13 14 15 Sonthelmer E J Carthew R W 2005 Silence from within Endogenous siRNAs and miRNAs Cell 122 9 12 Zamore P D Haley B 2005 Ribo gnome The big world of small RNAs Science 309 1519 1524 Bartel D 2004 MicroRNAs Genomics Biogenesis Mechanism and Function Cell 116 281 297 Kim Narry V 2005 Small RNAs Classification Biogenesis and Function Mol Cells 19 1 15 Valencia Sanchez MA Liu J Hannon GJ Parker R 2006 Control of translation and mRNA degradation by miRNAs and siRNAs Genes Dev 20 515 525 Lewis B P Burge C B Bartel D P 2005 Conserved seed pairing often flanked by adenosines indicates that thousands of human genes are microRNA targets Cell 120 15 20 Xie X Lu J Kulbo
18. oncerns about any SBI products please contact us at 888 266 5066 2014 System Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 21
19. other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or c
20. present in the promoters The T Rex 293 cell line constitutively expresses the Tet repressor protein The predicted structure of the p53 shRNA and the oligonucleotide primer designed underlined to detect the mature siRNA boxed in the structure are shown below in Figure 8a After transduction the cells were left untreated DOX or treated with 1yg ml Doxycycline DOX for 48 hours to alleviate the Tet repressor effects The quantitative PCR results normalized to the U6 signals are shown in the bar graphs below in Figure 8b shRNA Expression Molecule p53 siRNA 5 GATCTGGATTCATCAAGATTTGTTTGTGAAACAAGTCTTGGTGGATCCAGATCTTT 3 shRNA Expression Constructs 1 p53 H1 2 p53 H1 T2xL contains 2 copies of Tet repressor in Promoter Normalized expression levels 1600 DOX DOX ies Ep53 siRNA 1200 DOX DOX 1000 Oso lt 600 400 200 0 T T T T c T x a 2 gt 8 x x F 5x Ex A Io FX FX o So Sa O Q ga 2a 5 2 IA zo v D 5 5 5o g gg Qa Fig 8 Detection of mature siRNA expression from cell culture experiments Page 16 ver 4 150511 www systembio com QuantiMir RT Kit IV Troubleshooting Problem No PCR bands or qPCR signals using user designed Forward Primer with QuantiMir cDNA templates Too many PCR bands using user designed Forward Primer with QuantiMir cDNA templates Signals in qPCR negative contr
21. rofile all Known microRNAs including minor star forms for Human or Mouse Sanger miRBase 100 updated 20 complete profiles with QuantiMir kit included miR SnaREs Cat RA7xxA 1 RA8xxA 1 Epitope tagged microRNA processing factors to enrich samples for microRNAs and other small RNAs Human and Mouse Argonautes Pasha and Dicer constructs available Lenti miRs Cat PMIRHxxA 1 Over express microRNA precursors using lentivectors miRZips Cat MZIPxxA 1 Permanent microRNA knockdown using RNAi lentivectors with anti sense microRNAs 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Global MicroRNA Amplification Kit Cat RA400A 1 Simple amplification kit allows cDNA amplification for RT PCR and microarray studies from as little as 50 ng of starting total RNA Full Spectrum Complete Transcriptome RNA Amplification Kit Cat RA101A 1 The Full Spectrum RNA Amplification Kit provides an inexpensive method to amplify reverse transcribed RNA in a sequence independent unbiased and uniform manner with better representation of 5 end of MRNA sequences This approach maintains the relative levels of each transcript in the starting mRNA samples even when using starting amounts of RNA as low as 5ng or when using heavily degraded RNA Full Spectrum MultiStart Primers for T7 IVT Cat RA300A 2 Extract more data from your RNA than currently available primers in
22. ure conditions Se Estimated Time Remaining hh mm ca Heak 1 50 C 2 min _Bisornect statue S r 2 95 C 10 min Ue are 3 95 C 15 sec A 4 60 C 1 min Thermal Profile Auto Increment Ramp Rate 40 cycles of steps 3 Reps T Ree 1 ere a and 4 data read at zi 60 C 15 sec Step gold rectangle e 700 AddCycle AddHold Add Step Add Dissociation Stage I Help Settings Sample Volume ul 30 Run Mode Standard 7500 7 Data Collection Stage 3 Step 2 60 0 1 00 gj An additional recommendation is to include a melt analysis after the qPCR run to assess the Tm of the PCR amplicon to verify the specificity of the amplification reaction Refer to the User Manual for your specific instrument to conduct the melt analysis and the data analyses of the amplification plots and Cycle Threshold Ct calculations In general Cycle thresholds should be set within the exponential phase of the amplification plots with software automatic baseline settings 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual lll Quality Control and Sample Data A Sensitivity Tests The QuantiMir cDNAs were synthesized using decreasing amounts of total starting RNA input from a pool of Human Brain Heart Kidney Placenta and Testes RNAs Real time quantitative qPCR assays were performed with Forward primers spe
Download Pdf Manuals
Related Search