Home

GeneChip Expression Analysis Technical Manual

1. EX The scanner is also controlled by Affymetrix Microarray Suite or GCOS The probe array is scanned after the wash protocols are complete Make sure the laser is warmed up prior to scanning by turning it on at least 15 minutes before use if you are using the Agilent GeneArray Scanner or 10 minutes if you are using the GeneChip Scanner 3000 If the probe array was stored at 4 C warm to room temperature before scanning Refer to the Microarray Suite or GCOS online help and the appropriate scanner user s manual for more information on scanning The scanner uses a laser and is equipped with a safety interlock system Defeating the interlock system may result in exposure to hazardous laser light You must have read and be familiar with the operation of the scanner before attempting to scan a probe array Please refer to the Microarray Suite User s Guide P N 08 0081 or to the GeneChip Scanner 3000 quick reference card P N 08 0075 Handling the GeneChip Probe Array EX AFFYMETRIX Before you scan the probe array follow the directions in this section on handling the probe array If necessary clean the glass surface of the probe array with a non abrasive towel or tissue before scanning Do not use alcohol to clean glass Before scanning the probe array cartridge follow this procedure to apply Tough Spots to the probe array cartridge to prevent the leaking of fluids from the cartridge during scanning Apply the spots just
2. Section 2 Eukaryotic Sample and Array Processing 701024 Rev 3 w ui Contents 701024 Rev 3 Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation Chapter 2 Eukaryotic Target Hybridization Chapter 3 Eukaryotic Arrays Washing Staining and Scanning 2 2 3 2 3 3 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing gt de Xx E wu 701025 Rev 6 Section 2 E Eukaryotic Target Preparation 701025 Rev 6 Introduction s eum x IR m by UR oce mM Ned e 2 1 5 Reagents and Materials Required 2 1 7 Total RNA and mRNA Isolation for One Cycle Target Labeling Assay 2 1 9 Isolation of RNA from Yeast 2 1 9 Isolation of RNA from Arabidopsis 2 1 9 Isolation of RNA from Mammalian Cells or Tissues 2 1 10 Precipitation of RNA 2 1 10 Quantification of RNA 2 1 11 Total RNA Isolation for Two Cycle Target Labeling Assay 2 1 12 One Cycle cDNA Synthesis 2 1 13 Step 1 Preparation of Poly A RNA Controls for One Cycle cDNA Synthesis Spike in Controls o uuu 2 1 13 Step 2 First Strand cDNA Synthesis 2 1 16 Step 3 Second Strand cDNA Synthesis 2 1 18 Two Cycle cDNA
3. 3 nM 20X Eukaryotic Hybridization 15 uL 10 uL 5 uL 1 5 5 25 and Controls bioB bioC bioD cre 100 pM respectively Herring Sperm DNA 3 HL 2 HL 1 HL 0 1 mg mL 10 mg mL BSA 3 pL 2 HL 1 HL 0 5 mg mL 50 mg mL 2X Hybridization Buffer 150 uL 100 uL 50 uL 1X DMSO 30 uL 20 uL 10 uL 1096 H20 to final volume of 300 uL to final volume to final volume of 100 uL of 200 uL Final volume 300 uL 200 uL 100 uL Please refer to specific probe array package insert for information on array format Please see Section 2 Chapter 1 for amount of adjusted fragmented cRNA to use when starting from total RNA Note that the addition of DMSO is different from previous recommendations Follow this protocol for best results on arrays when using the GeneChip IVT Labeling Kit IMPOR It is imperative that frozen stocks of 20X GeneChip Eukaryotic Hybridization Controls are heated to 65 C for 5 minutes to completely resuspend the cRNA before aliquotting 2 Equilibrate probe array to room temperature immediately before use v Not It is important to allow the arrays to equilibrate to room temperature completely Specifically if the rubber septa are not equilibrated to room temperature they may be prone to cracking which can lead to leaks 3 Heat the hybridization cocktail to 99 C for 5 minutes in a heat block AFFYMETRIX n 2 2 7 Eukaryotic 2 2 8 SECTION 2 Eukaryotic Sample and Array Processing 4 Meanwhile wet the
4. After the 16 hour incubation at 37 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube The sample is now ready to be purified in Step 5 First Cycle Cleanup of cRNA on page 2 1 26 Alternatively samples may be stored at 20 C for later use AFFYMETRIX ACE 2 1 25 Eukaryotic 2 1 26 SECTION 2 Eukaryotic Sample and Array Processing Step 5 First Cycle Cleanup of cRNA EX Sample Cleanup Module is used for this step Reagents to be Supplied by User m Ethanol 96 100 v v m Ethanol 8096 v v All other components needed for cleanup of cRNA are supplied with the GeneChip Sample Cleanup Module BEFORE STARTING please note VT cRNA Wash Buffer is supplied as a concentrate Before using for the first time add 20 mL of ethanol 96 100 as indicated on the bottle to obtain a working solution and checkmark the box on the left hand side of the bottle label to avoid confusion m VT cRNA Binding Buffer may form a precipitate upon storage If necessary redissolve by warming in a water bath at 30 C and then place the buffer at room temperature m All steps of the protocol should be performed at room temperature During the procedure work without interruption 1 Add 50 uL of RNase free Water to the IVT reaction and mix by vortexing for 3 seconds 2 Add 350 uL IVT cRNA Binding Buffer to the sample and mix by vortexing for 3 seconds 3 Add 250 uL ethanol 96 100
5. to the lysate and mix well by pipetting Do not centrifuge 4 Apply sample 700 uL to the IVT cRNA Cleanup Spin Column sitting in a 2 mL Collection Tube Centrifuge for 15 seconds at gt 8 000 x g 2 10 000 rpm Discard flow through and Collection Tube 5 Transfer the spin column into a new 2 mL Collection Tube supplied Pipet 500 uL IVT cRNA Wash Buffer onto the spin column Centrifuge for 15 seconds at gt 8 000 x g 2 10 000 rpm to wash Discard flow through IVT cRNA Wash Buffer is supplied as a concentrate Ensure that ethanol is added to the IVT cRNA Wash Buffer before use see IMPORTANT note above before starting 6 Pipet 500 uL 80 v v ethanol onto the spin column and centrifuge for 15 seconds at gt 8 000 x g 2 10 000 rpm Discard flow through 7 Open the cap of the spin column and centrifuge for 5 minutes at maximum speed 25 000 x g Discard flow through and Collection Tube Place columns into the centrifuge using every second bucket Position caps over the adjoining bucket so that they are oriented in the opposite direction to the rotation ie if the microcentrifuge rotates in a clockwise direction orient the caps in a counterclockwise direction This avoids damage of the caps Label the collection tubes with the sample name During centrifugation some column caps may break resulting in loss of sample information Centrifugation with open caps allows complete drying of the membrane CHAPTER 1 Eu
6. 10 U uL E coli DNA Polymerase 4 uL 40U 2 UL E coli RNase H 1 uL 2U Final Volume 150 uL Gently tap tube to mix Then briefly spin in a microcentrifuge to remove condensation and incubate at 16 C for 2 hours in a cooling waterbath Add 2 uL 10U 14 DNA Polymerase Return to 16 C for 5 minutes Add 10 uL 0 5M EDTA Proceed to cleanup procedure for cDNA Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 or store at 20 C for later use 2 1 43 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Alternative Protocol for One Cycle cDNA Synthesis from Purified Poly A mRNA This protocol is a supplement to instructions provided in the Invitrogen Life Technologies SuperScript Choice system Please note the following before proceeding m Read all information and instructions that come with reagents and kits m Use the GeneChip T7 Oligo dT Promoter Primer Kit for priming first strand cDNA synthesis in place of the oligo dT or random primers provided with the SuperScript Choice kit The GeneChip T7 Oligo dT Promoter Primer Kit provides high quality HPLC purified T7 Oligo dT Primer which is essential for this reaction m lt is recommended that each step of this protocol is checked by gel electrophoresis T7 Oligo dT Primer 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT 94 3 Step 1 First Strand cDNA Synthesis Starting material High qual
7. 5X 2 Strand Reaction Mix 5X 900 uL 1 E coli DNA Ligase 10 U uL 30 uL 1 E coli DNA Polymerase I 10 U uL 120 uL 1 RNase H 2 U uL 30 uL 1 T4 DNA Polymerase 5 U uL 60 uL 1 EDTA 0 5M 0 5M 300 uL 1 RNase free Water 3 1 mL 1 What is the shelf life of the kit The One Cycle cDNA Synthesis Kit has about 18 months of dating from the date of manufacturing How are the kits shipped and what are the storage conditions The kits are shipped on dry ice and should be stored at 20 C Are the data obtained from the One Cycle cDNA Synthesis Kit concordant with the previous Standard GeneChip Target Labeling Assay The One Cycle cDNA Synthesis Kit is formulated following precisely the standard GeneChip Target Labeling Assay and there is no change to the major reagents used in the protocol Therefore the performance of the assay and data obtained should be highly concordant APPENDIX B FAQs amp Troubleshooting Do you have any data showing that high quality results can be obtained using 1 ug of total RNA as starting material following the One Cycle Target Labeling Assay Extensive analysis was carried out at Affymetrix to examine the sensitivity and reproducibility of the protocol for 1 ug of starting material The results demonstrate comparable cRNA length by Bioanalyzer electrophoresis sensitivity percent Present call and spike ins and reproducibility by Signal correlation call concordance false change compared with using 5 ug of
8. After completing the procedures described in this chapter the scanned probe array image dat file is ready for analysis as explained in the enclosed GeneChip Expression Analysis Data Analysis Fundamentals booklet P N 701190 701033 Rev 5 3 3 3 SECTION 3 Prokaryotic Sample and Array Processing 3 3 4 CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning Reagents and Materials Required AFFYMETRIX al The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part numbers listed are based on U S catalog information For supplier information please refer to the Supplier Reference List in Appendix A of this manual Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 Nuclease free Water Ambion P N 9930 Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 R Phycoerythrin Streptavidin Molecular Probes P N S 866 NaCl 5M RNase free DNase free Ambion P N 9760G PBS pH 72 Invitrogen Life Technologies P N 20012 027 20X SSPE 3 M NaCl 0 2M NaH PO 0 02M EDTA BioWhittaker Molecular Applications Cambrex P N 51214 Goat IgG Reagent Grade Sigma Aldrich P N 5256 Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 Surfact Amps 20 Tween 20 1096 Pierce Chemical P N 28320 Bleach 5 2596 Sodium Hypochlorite
9. Table 2 1 5 Preparation of First Strand Master Mix Component Volume 5X 15 Strand Reaction Mix 4 HL DTT 0 1M 2 uL dNTP 10 mM 1uL Total Volume 7 HL b Mix well by flicking the tube a few times Centrifuge briefly 5 seconds to collect the master mix at the bottom of the tube 3 Transfer 7 uL of First Strand Master Mix to each RNA T7 Oligo dT Primer mix for a final volume of 18 or 19 uL Mix thoroughly by flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and immediately place the tubes at 42 C 4 Incubate for 2 minutes at 42 C 5 Add the appropriate amount of SuperScript II to each RNA sample for a final volume of 20 uL m For 1 to 8 ug of total RNA 1 uL SuperScript Il m For 8 1 to 15 ug of total RNA 2 uL SuperScript II m For every ug of mRNA add 1 uL SuperScript Il m For mRNA quantity less than 1 ug use 1 uL SuperScript Il Mix thoroughly by flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and immediately place the tubes at 42 C 6 Incubate for 1 hour at 42 C then cool the sample for at least 2 minutes at 4 C IMPOR Cooling the samples at 4 C is required before proceeding to the next step Adding the Second Strand Master Mix directly to solutions that are at 42 C will compromise enzyme activity After incubation at 4 C centrifuge the tube briefly 5 seconds to collect th
10. 28 substep 1 for a final volume of 20 uL Mix thoroughly by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and place the tubes at 42 C immediately Incubate for 1 hour at 42 C then cool the sample for at least 2 minutes at 4 C After the incubation at 4 C centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube Add 1 uL of RNase H to each sample for a final volume of 21 uL Mix thoroughly by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and incubate for 20 minutes at 37 C Heat the sample at 95 C for 5 minutes Cool the sample for at least 2 minutes at 4 C then proceed directly to Step 7 Second Cycle Second Strand cDNA Synthesis on page 2 1 30 2 1 29 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 7 Second Cycle Second Strand cDNA Synthesis Two Cycle cDNA Synthesis Kit is used for this step 1 2 2 1 30 The following program can be used as a reference to perform the Second Cycle Second Strand cDNA Synthesis reaction in a thermal cycler For the 16 C incubations turn the heated lid function off If the heated lid function cannot be turned off leave the lid open The 4 C holds are for reagent addition steps 70 C 6 minutes 4 C hold 16 C 2 hours 4 C hold 16 C 10 minutes 4 C hold Add 4 uL of diluted T7 Ol
11. 4 L o 2 T 2 2 lt T Section 5 Appenc List of Controls on GeneChip Probe Arrays Table 5 C 1 Control Genes on GeneChip probe arrays Origin of Control Gene Associated Array Type gn Utility for GeneChip Experiments Affymetrix Organism Name Products Eukaryotic synthetic B2 Oligo Grid alignment Control Oligo B2 P N 900301 also as Arrays part of the Hybridization Control Kit P N 900454 or 900457 E coli bioB Antisense biotinylated cRNA are used as GeneChip Eukaryotic bioC hybridization controls Hybridization Control bioD Kit P N 900454 or P N 7 P1 Bacteriophage cre B subtilis lys Poly A tailed sense RNA can be spiked into GeneChip Eukaryotic phe isolated RNA samples as controls for the labeling Poly A RNA Control thr and hybridization process The spikes can also be Kit P N 900433 dap used to estimate assay sensitivity Prokaryotic synthetic B2 Oligo Grid alignment Control Oligo B2 P N 900301 also as Arrays part of the Hybridization Control Kit P N 900454 or 900457 B subtilis lys Sense RNA can be spiked into purified sample GeneChip Eukaryotic phe RNA as control for the labeling and hybridization Poly A RNA Control thr process The spikes can also be used to estimate Kit P N 900433 dap assay sensitivity 701045 Rev 4 5 C 3 o 2 T 2 2 lt SECTION 5 Appendices 5 C 4
12. 6 2 uL 10 2 uL 7 896 or 096 Fragmented and Labeled cDNA 25 HL Up to 50 uL Up to 50 uL 0 5 70 ug Molecular Biology Grade Water 5 9 uL 42 7 uL Total Volume 80 uL 130 pL 200 uL Please refer to specific probe array package insert for information on array format 2 Equilibrate probe array to room temperature immediately before use It is important to allow the arrays to normalize to room temperature completely Specifically if the rubber septa are not equilibrated to room temperature they may be prone to cracking which leads to leaks 3 Add the indicated amount of hybridization solution mix to the probe array Refer to specific probe array package insert for information on array format It is necessary to use two pipette tips when filling the probe array cartridge one for filling and the second to allow venting of air from the hybridization chamber 4 Place probe array in the hybridization oven set at the temperatures indicated below m Paeruginosa 50 C m E coli Antisense 45 C The hybridization temperature of 50 C is higher than that used for other expression assays The increased hybridization temperature is required due to the high GC content of P aeruginosa 5 Avoidstress to the motor load probe arrays in a balanced configuration around axis Rotate at 60 rpm 6 Hybridize for 16 hours During the latter part of the 16 hour hybridization proceed to Section 3 Chapter 3 Prokaryotic Arrays Washing Staining a
13. 6 to 4 111 Stain Temperature C from 35 C to 25 C iv First Stain Time seconds from 300 to 600 seconds v Second Stain Time seconds from 300 to 600 seconds vi Third Stain Time seconds from 300 to 600 seconds and vii Wash A3 Temperature from 35 C to 30 C e Save the modified fluidics protocol by highlighting FlexMidi euk2v3 or the FlexMidi euk2v3 450 within the Protocol Name window and typing over with an assigned protocol name e g Pae cDNA Click Save The new fluidics protocol should be present in the Protocol drop down list and is used in the subsequent steps Select the name of the newly modified protocol e g Pae cDNA from the Protocol drop down list in the Fluidics Station dialog box Select Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate User s Guide for your GeneChip Fluidics Station 400 or 450 250 CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning Table 3 3 6 Fluidics Scripts Prokaryotic Arrays Format Fluidics Scripts 169 Mini_prok2v1 100 modified FlexMidi_Euk2v3 49 ProkGE_WS2 When using the Fluidics Station 450 or 250 add _450 at the end of the fluidics script s name Table 3 3 7 Fluidics Protocols Post Hyb Wash 1 Mini
14. A s ratio should be approximately 2 0 with ranges between 1 9 to 2 1 considered acceptable We recommend checking the quality of the RNA by running it on an agarose gel prior to starting the assay The rRNA bands should be clear without any obvious smearing patterns from degradation Before starting cDNA synthesis the correct volumes of DEPC treated H 0 and Reverse Transcriptase RT must be determined These volumes will depend on both the concentration and total volume of RNA that is being added to the reaction Use Table 2 1 19 and Table 2 1 20 for variable component calculations Determine the volumes of RNA and SuperScript Il RT required in Table 2 1 19 then calculate the amount of DEPC treated H 0 needed in Step 1 Table 2 1 20 to bring the final First Strand Synthesis volume to 20 uL 3 Users who do not purchase the GeneChip T7 Oligo dT Promoter Primer Kit may be required to obtain a license under U S Patent Nos 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit AFFYMETRIX al 2 1 41 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Table 2 1 19 Reverse Transcriptase Volumes for First Strand cDNA Synthesis Reaction Total RNA hg SuperScript Il RT pL 200 U uL 5 0 to 8 0 1 0 8 1 to 16 0 2 0 16 1 to 20 0 3 0 v Not a The combined volume of RNA DEPC treated H O and SuperScript Il RT should not exceed 11 uL as indicated in Table 2 1 20 Table 2 1 20 F
15. Fluidics Station Priming ensures that the lines of the fluidics station are filled with the appropriate buffers and the fluidics station is ready for running fluidics station protocols Priming should be done m when the fluidics station is first started when wash solutions are changed m before washing if a shutdown has been performed m if the LCD window instructs the user to prime To prime the fluidics station select Protocol in the Fluidics Station dialog box Choose Prime or Prime 450 for the respective modules in the Protocol drop down list Change the intake buffer reservoir A to Non Stringent Wash Buffer and intake buffer reservoir B to Stringent Wash Buffer For MAS click Run for each module to begin priming In GCOS select the All Modules check box then click Run CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Probe Array Wash and Stain AFFYMETRIX After 16 hours of hybridization remove the hybridization cocktail from the probe array and fill the probe array completely with the appropriate volume of Non Stringent Wash Buffer Wash Buffer A as given in Table 2 2 2 on page 2 2 8 If necessary at this point the probe array can be stored at 4 C for up to 3 hours before proceeding with washing and staining Equilibrate the probe array to room temperature before washing and staining This protocol is recommended for use with probe arrays with probe cells of 24 um or smaller This p
16. P N 28320 Miscellaneous Supplies m Sterile RNase free microcentrifuge vials 1 5 mL USA Scientific P N 1415 2600 or equivalent m Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent m Sterile barrier pipette tips and non barrier pipette tips m Tygon Tubing 0 04 inner diameter Cole Parmer P N H 06418 04 m lough Spots Label Dots USA Scientific P N 9185 0000 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Reagent Preparation Wash Buffer A Non Stringent Wash Buffer 6X SSPE 0 01 Tween 20 For 1 000 mL 300 mL of 20X SSPE 1 0 mL of 10 Tween 20 699 mL of water Filter through a 0 2 um filter Wash Buffer B Stringent Wash Buffer 100 mM MES 0 1M Nat 0 01 Tween 20 For 1 000 mL 83 3 mL of 12X MES Stock Buffer see Section 2 Chapter 2 for reagent preparation 5 2 mL of 5M NaCl 1 0 mL of 10 Tween 20 910 5 mL of water Filter through a 0 2 um filter Store at 2 C to 8 C and shield from light 2X Stain Buffer Final 1X concentration 100 mM MES 1M Na 0 05 Tween 20 For 250 mL 41 7 mL of 12X MES Stock Buffer see Section 2 Chapter 2 for reagent preparation 92 5 mL of SM NaCl 2 5 mL of 1096 Tween 20 113 3 mL of water Filter through a 0 2 um filter Store at 2 C to 8 C and shield from light 10 mg mL Goat IgG Stock Resuspend 50 mg in 5 mL of 150 mM NaCI Store at 4 C v Note If a larger volume of the 10 mg mL IgG stock is prepared aliquot
17. Prokaryotic Sample and Array Processing Chapter 1 Prokaryotic Target Preparation 3 1 3 Chapter 2 Prokaryotic Target Hybridization 3 2 3 Chapter 3 Prokaryotic Arrays Washing Staining and Scanning 3 3 3 SECTION 4 Chapter 1 Fluidics Station Maintenance Procedures 4 1 3 Eukaryotic I gt de o E o he 0 FS Maintenance Appendices 17 CONTENTS SECTION 5 Appendices Appendix A Supplier and Reagent Reference List Appendix B FAQs amp Troubleshooting Appendix C List of Controls on GeneChip Probe Arrays 5 A 3 5 B 3 5 C 3 Section I GeneChip Expression Analysis Overview 701022 Rev 2 w ui Contents Section 1 Chapter 1 GeneChip Expression Analysis Overview 1 1 3 701022 Rev 2 SECTION 1 GeneCbip Expression Analysis Overview 701023 Rev 4 Section 1 d GeneChip Expression Analysis Overview Introduction and Objectives 1 1 4 Explanation of GeneChip Probe Arrays 1 1 4 GeneChip Expression Analysis Overview 1 1 5 Precautions 43 4 sore a e Seth hae dedi etes eg 1 1 6 Terminology x sette s Poe beo ran RR s Rs 1 1 7 Interfering Conditions 1 1 7 Instruments f seam n BRE Ro RR UA De x PEE SMS 1 1 7 References PEU 1 1 7 Idmutations 3 oc 4 2a oe eb th eke eo i eee SPA ia 1 1 7 This Chapter Contains m An overv
18. Suite are m Experiment Name m Probe Array Type In GCOS three additional fields are required m Sample Name m Sample Type m Project Sample templates Experiment templates and array barcodes can also be employed in GCOS to standardize and simplify the registration process Please see the GCOS User s Guide for more information The Project Sample Name and Experiment Name fields establish a sample hierarchy that organizes GeneChip gene expression data in GCOS In terms of the organizational structure the Project is at the top of the hierarchy followed by Sample Name and then Experiment Name PROJECT y SAMPLE y EXPERIMENT Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 3 Preparing the Fluidics Station The Fluidics Station 400 or 450 250 is used to wash and stain the probe arrays It is operated using GCOS Microarray Suite Setting Up the Fluidics Station 1 Turn on the Fluidics Station using the toggle switch on the lower left side of the machine Select Run Fluidics from the menu bar gt The Fluidics Station dialog box appears with a drop down list for selecting the experiment name for each of the fluidics station modules A second drop down list is accessed for choosing the Protocol for each of the fluidics station modules Refer to the Fluidics Station User s Guide for instructions on connecting and addressing multiple fluidics stations Priming the
19. THE USE OF THE PARTICULAR PRODUCT S THAT THE USER HAS PURCHASED FROM AFFYMETRIX Patents Products may be covered by one or more of the following patents and or sold under license from Oxford Gene Technology U S Patent Nos 5 445 934 5 744 305 6 261 776 6 291 183 5 700 637 5 945 334 6 346 413 6 399 365 and 6 610 482 and EP 619 321 373 203 and other U S or foreign patents Software products may be covered by one or more of the following patents U S Patent Nos 5 733 729 5 795 716 5 974 164 6 066 454 6 090 555 6 185 561 and 6 188 783 and other U S or foreign patents Fluidics Station products may be covered by U S Patent No 6 114 122 and 6 391 623 6 422 249 and other U S or foreign patents Scanner products may be covered by one or more of the following patents U S Patent Nos 5 578 832 5 631 734 5 834 758 5 936 324 5 981 956 6 025 601 6 141 096 6 171 793 6 185 030 6 201 639 6 207 960 6 218 803 6 225 625 6 252 236 6 335 824 6 403 320 6 407 858 6 472 671 and 6 490 533 and other U S or foreign patents Copyright O1999 2004 Affymetrix Inc All rights reserved Contents 701021 Rev 5 SECTION 1 Overview Chapter 1 GeneChip Expression Analysis Overview 1 1 3 SECTION 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2 1 3 Chapter 2 Eukaryotic Target Hybridization 2 2 3 Chapter 3 Eukaryotic Arrays Washing Staining and Scanning 2 3 3 SECTION 3
20. WRITTEN INSTRUCTIONS PROVIDED THEREWITH THAT BUYER PURCHASES FROM AFFYMETRIX AFX OR ITS AUTHORIZED REPRESENTATIVE THE PURCHASE OF ANY PRODUCT S DOES NOT BY ITSELF CONVEY OR IMPLY THE RIGHT TO USE SUCH PRODUCT S IN COMBINATION WITH ANY OTHER PRODUCT S IN PARTICULAR I NO RIGHT TO MAKE HAVE MADE OR DISTRIBUTE OTHER PROBE ARRAYS IS CONVEYED OR IMPLIED BY THE PROBE ARRAYS II NO RIGHT TO MAKE HAVE MADE IMPORT DISTRIBUTE OR USE PROBE ARRAYS IS CONVEYED OR IMPLIED BY THE INSTRUMENTS OR SOFTWARE AND III NO RIGHT TO USE PROBE ARRAYS IN COMBINATION WITH INSTRUMENTS OR SOFTWARE IS CONVEYED UNLESS ALL COMPONENT PARTS HAVE BEEN PURCHASED FROM AFX OR ITS AUTHORIZED REPRESENTATIVE FURTHERMORE PROBE ARRAYS DELIVERED HEREUNDER ARE LICENSED FOR ONE 1 TIME USE ONLY AND MAY NOT BE REUSED THE PRODUCTS DO NOT HAVE FDA APPROVAL NO PATENT LICENSE IS CONVEYED TO BUYER TO USE AND BUYER AGREES NOT TO USE THE PRODUCTS IN ANY SETTING REQUIRING FDA OR SIMILAR REGULATORY APPROVAL OR EXPLOIT THE PRODUCTS IN ANY MANNER NOT EXPRESSLY AUTHORIZED IN WRITING BY AFX IN ADVANCE PROBE ARRAYS INSTRUMENTS SOFTWARE AND REAGENTS ARE LICENSED FOR RESEARCH USE ONLY AND NOT FOR USE IN DIAGNOSTIC PROCEDURES NO RIGHT TO MAKE HAVE MADE OFFER TO SELL SELL OR IMPORT OLIGONUCLEOTIDE PROBE ARRAYS OR ANY OTHER PRODUCT IN WHICH AFFYMETRIX HAS PATENT RIGHTS IS CONVEYED BY THE SALE OF PROBE ARRAYS INSTRUMENTS SOFTWARE OR REAGENTS HEREUNDER THIS LIMITED LICENSE PERMITS ONLY
21. amount of double stranded cDNA obtained is quite small and it is mixed in with the starting total RNA materials The best way to QC this step is to carry out the subsequent IVT reaction and quantitate the cRNA yield How do I know if my 1 cycle IVT reactions have worked well After the first cycle of amplification it is often possible to quantitate the cRNA yield at this stage Routinely more than 600 ng of cRNA can be obtained from 50 to 100 ng of starting material However it is difficult to use the cRNA yield as the only metric to determine the success of the assay Therefore it may be most informative to combine the results from the I cycle IVT yield with the 2 cycle IVT yield as well as array quality metrics and data on various positive controls to obtain a comprehensive view of how the assay has proceeded In the Two Cycle Target Labeling Assay the 1 cycle cDNA cleanup step is omitted Is there any impact on the data by removing this step In this more streamlined version of the Two Cycle protocol the 1 cycle cDNA cleanup step is removed since the amount of material is very limiting and it has been shown that omitting this step does not affect the final array results In the Two Cycle Target Labeling Assay after the first reaction you are not recommending using the ADJUSTED cRNA yield to estimate the amount of cRNA to be used in the 2 cycle cDNA synthesis reaction Why is this This is because the amount of starting m
22. and store at 20 C until use After the solution has been thawed it should be stored at 4 C Avoid additional freezing and thawing CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Experiment and Fluidics Station Setup Step 1 Defining File Locations Before working with Affymetrix Microarray Suite it is important to define where the program stores and looks for files For GeneChip Operating Software GCOS this step is not necessary Proceed directly to Step 2 Entering Experiment Information 1 Launch Microarray Suite from the workstation and select Tools Defaults File Locations from the menu bar 2 The File Locations window displays the locations of the following files m Probe Information library files mask files m Fluidics Protocols fluidics station scripts m Experiment Data exp dat cel and chp files are all saved to location selected here 3 Verify that all three file locations are set correctly and click OK Contact Affymetrix Technical Support if you have any questions regarding this procedure Step 2 Entering Experiment Information AFFYMETRIX al To wash stain and scan a probe array an experiment must first be registered in GCOS or Microarray Suite Please follow the instructions detailed in the Setting Up an Experiment section of the appropriate GCOS or Microarray Suite User s Guide The fields of information required for registering experiments in Microarray
23. array by filling it through one of the septa see Figure 2 2 1 for location of the probe array septa with appropriate volume of 1X Hybridization Buffer using a micropipettor and appropriate tips Table 2 2 2 It is necessary to use two pipette tips when filling the probe array cartridge one for filling and the second to allow venting of air from the hybridization chamber 5 Incubate the probe array filled with 1X Hybridization Buffer at 45 C for 10 minutes with rotation Table 2 2 2 Probe Array Cartridge Volumes Array Hybridization Volume Total Fill Volume 49 Format Standard 200 uL 250 uL 64 Format 200 uL 250 uL 100 Format Midi 130 uL 160 uL 169 Format Mini 80 uL 100 uL 400 Format Micro 80 uL 100 uL 6 Transfer the hybridization cocktail that has been heated at 99 C in step 3 to a 45 C heat block for 5 minutes 7 Spin hybridization cocktail s at maximum speed in a microcentrifuge for 5 minutes to remove any insoluble material from the hybridization mixture 8 Remove the buffer solution from the probe array cartridge and fill with appropriate volume Table 2 2 2 of the clarified hybridization cocktail avoiding any insoluble matter at the bottom of the tube 9 Place probe array into the Hybridization Oven set to 45 C Avoid stress to the motor load probe arrays in a balanced configuration around the axis Rotate at 60 rpm 10 Hybridize for 16 hours During the latter part of the 16 hour hy
24. coli Antisense Genome Array The procedures take approximately 75 and 90 minutes respectively to complete The use of streptavidin in the first part of the stain procedure enhances the overall signal After 16 hours of hybridization remove the hybridization cocktail from the probe array and fill the probe array completely with the appropriate volume of Non Stringent Wash Buffer Wash Buffer A as given in Table 3 3 1 If necessary at this point the probe array can be stored at 4 C for up to 3 hours before proceeding with washing and staining Equilibrate the probe array to room temperature before washing and staining Table 3 3 1 Probe Array Cartridge Volumes Array Hybridization Volume Total Fill Volume 49 Format Standard 200 uL 250 uL 64 Format 200 uL 250 uL 100 Format Midi 130 uL 160 uL 169 Format Mini 80 uL 100 uL 400 Format Micro 80 uL 100 uL Preparing the Staining Reagents 1 Prepare the following stain and wash solutions the day of the procedure The solutions are stable for approximately 6 to 8 hours at 4 C Volumes given are sufficient for one probe array Streptavidin Phycoerythrin SAPE should be stored in the dark at 4 C either foil wrapped or kept in an amber tube Remove SAPE from the refrigerator and tap the tube to mix well before preparing stain solution Do not freeze SAPE Always prepare the SAPE stain solution fresh on the day of use Table 3 3 2 Streptavidin Sol
25. cycle with Wash Wash Buffer A at 25 C Buffer A at 30 C Buffer A at 30 C 2nd Stain Stain the probe array for 10 minutes in Stain the probe array for 5 minutes in Stain the probe array for 10 minutes in antibody solution at 25 C antibody solution at 35 C antibody solution at 25 C 3rd Stain Stain the probe array for 10 minutes in Stain the probe array for 5 minutesin Stain the probe array for 10 minutes in SAPE solution at 25 C SAPE solution at 35 C SAPE solution at 25 C Final 15 cycles of 4 mixes cycle with Wash 15 cycles of 4 mixes cycle with 15 cycles of 4 mixes cycle with Wash Wash Buffer A at 30 C The holding Wash Buffer A at 35 C The holding Buffer A at 35 C The holding temperature is 25 C temperature is 25 C temperature is 25 C Wash Buffer A 2 non stringent wash buffer e Wash Buffer B stringent wash buffer When using the Fluidics Station 450 or 250 add 450 at the end of the fluidics script s name AFFYMETRIX a 2 3 11 Eukaryotic 2 3 12 SECTION 2 Eukaryotic Sample and Array Processing F S 450 Ifyou are using the Fluidics Station 450 250 Washing and Staining the Probe Array 1 In the Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list The Probe Array Type appears automatically In the Protocol drop down list select the appropriate antibody amplification protocol to control the washing and
26. does this kit perform with labeling kits other than those recommended in the Affymetrix protocols We have not tested the performance of this kit extensively with any other kits protocols other than the One and Two Cycle Target Labeling Assays currently recommended by Affymetrix Therefore we are not able to provide any data or support if this kit is used with any other protocols Can this Kit be used with prokaryotic samples and arrays This product was designed and tested for eukaryotic arrays The presence of poly A tails on the transcripts is not relevant to prokaryotic samples Since the eukaryotic and prokaryotic assays are fundamentally different this kit may not provide similar array results with prokaryotic assays Probe sets for all four controls are available on prokaryotic arrays including the E coli antisense and P aeruginosa arrays Adding the Poly A RNA Controls to these samples will also serve as a valuable positive control Follow the instructions in Section 3 Chapter 1 of the Expression Analysis Technical Manual carefully for preparing dilutions for the Prokaryotic Assay Read the entire protocol before starting since the dilutions of the Poly A RNA Control stock may vary depending on the type of prokaryotic arrays used APPENDIX B FAQs amp Troubleshooting Can I use the Signal intensities of the poly A controls as standard curve for transcript abundance quantitation These controls are only designed to provide
27. e Incubate for 6 minutes at 70 C f Cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect the sample at the bottom of the tube 2 Ina separate tube assemble the First Cycle First Strand Master Mix a Prepare sufficient First Cycle First Strand Master Mix for all of the total RNA samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 11 is for a single reaction CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX Table 2 1 11 Preparation of First Cycle First Strand Master Mix Component Volume 5X 15 Strand Reaction Mix 2 0 uL DTT 0 1M 1 0 uL RNase Inhibitor 0 5 uL dNTP 10 mM 0 5 uL SuperScript Il 1 0 uL Total Volume 5 0 uL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube 3 Transfer 5 uL of First Cycle First Strand Master Mix to each total RNA sample T7 Oligo dT Primer Poly A Controls Mix as in Table 2 1 10 from the previous step for a final volume of 10 uL Mix thoroughly by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and immediately place the tubes at 42 C 4 Incubate for 1 hour at 42 C 5 Heatthe sample at 70 C for 10 minutes to inacti
28. is highly dependent on tissue type These reference numbers can be obtained through your own experience or can be found in published literature for example the RNeasy Mini HandBook If you continue to observe significant loss of material on RNeasy columns please contact QIAGEN Technical Support directly APPENDIX B FAQs amp Troubleshooting Sample Cleanup Module Does the GeneChip Sample Cleanup Module generate comparable results relative to the previously recommended phenol chloroform extraction for cDNA purification Highly concordant results have been obtained during our product development process by comparing global array hybridization results obtained from samples cleaned up with both protocols The concordance was determined based on the overall signal intensity as well as the qualitative calls However due to the different mechanisms associated with each cleanup procedure there will be minor differences in the data obtained For example cDNA cleanup column reduces the recovery of fragments of 100 nucleotides or less whereas these fragments are retained in the phenol chloroform method However we do believe these differences are minor in magnitude Customers are encouraged to perform their own comparisons and analysis to determine when to adopt the Sample Cleanup Module into their laboratories The storage condition of this kit has recently been changed What is the change The two columns included in this kit are now reco
29. mRNA transcripts in the sample Complexity can also be expressed as a ratio of molar amounts since 1 mole contains 6 02 x 10 molecules APPENDIX B FAQs amp Troubleshooting AFFYMETRIX al Here are the calculations for the 1 100 000 concentration in terms of complexity ratio for lys when spiked into 5 ug of starting total RNA Calculations for lys Stock concentration of lys 7 6 nM 7 6 nmoles L Total dilution in final input from Product Insert 1 10 000 or 1 20 1 50 1 10 Amount of diluted poly A spike in volume from Product Insert 2 uL 7 6 nmoles L 1 10 000 1 L 1x106 uL 2 uL 1 52 x 10 nmoles Calculations for starting RNA Starting total RNA 5 ug of mRNA in total RNA 2 Starting mRNA 5 ug 0 02 0 1 ug Average transcript length 2 000 bases Average MW of single base 330 g mole Average MW of transcript 2 000 bases 330 g mole base 660 000 g mole 660 000 g mole 1 x 106 ug g 1 mole 1 x 10 nmoles 660 ug nmole 0 1 ug 1 nmole 660 ug 0 000152 nmole 1 52 x 10 nmoles Concentration in Terms of Complexity Ratio Calculation Complexity ratio lys 1 52 x 10 nmoles 1 52 x 10 nmoles 1 x 10 1 x 10 1 100 000 How many reactions does each kit contain Depending on the quantity of the starting material and if the poly A controls are used in the One or Two Cycle Target Labeling Assays the amount of poly A controls used in each sample will vary causing the
30. mix for cRNA samples at a final concentration of 0 5 ug uL Use adjusted cRNA concentration as described in Step 2 Quantification of the cRNA on page 2 1 37 The total volume of the reaction may be scaled up or down dependent on the amount of cRNA to be fragmented Table 2 1 18 Sample Fragmentation Reaction by Array Format Component 49 64 Format 100 Format cRNA 20 ug 1 to 21 uL 15 ug 1 to 21 uL 5X Fragmentation Buffer 8 HL 6 HL RNase free Water variable to 40 uL final volume to 30 HL final volume Total Volume 40 uL 30 uL Please refer to specific probe array package insert for information on array format 2 Incubate at 94 C for 35 minutes Put on ice following the incubation 3 Save an aliquot for analysis on the Bioanalyzer A typical fragmented target is shown in Figure 2 1 7 The standard fragmentation procedure should produce a distribution of RNA fragment sizes from approximately 35 to 200 bases 4 Store undiluted fragmented sample cRNA at 20 C or 70 C for longer term storage until ready to perform the hybridization as described in the Eukaryotic Target Hybridization chapter in Section 2 AFFYMETRIX 2 1 39 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing f 12 5 7 5 E Fluorescence 2 5 cake ii oe AN _ t t t t t t t t t t t t t T 19 2 29 39 A ss se es re Figure 2 1 7 79 se Fragmented cRNA Bioanalyzer electropherogram for f
31. number of reactions contained in the kit to vary as well In addition it is related to the number of samples being processed at the same time since the Poly A Control Stock needs to be diluted serially before adding to the sample The intermediate dilutions should be prepared fresh each time and therefore depending on the number of samples to be labeled at the same time the amount of Poly A Control Stock used may vary Our rough estimation is that each kit is sufficient for approximately 100 reactions Where can I find the protocol for diluting the Poly A Control Stock before adding to the samples Detailed protocols for performing the serial dilutions of the Poly A Control Stock for the One and Two Cycle Target Labeling Assays as well as example data can be found in Section 2 Chapter 1 of the GeneChip Expression Analysis Technical Manual At what temperature should the kit be stored The recommended storage temperature of the kit is 20 C If possible storing the poly A controls at 80 C will help ensure the kit s long term stability 5 B 7 Appendices 5 B 8 SECTION 5 Appendices What is the shelf life of the kit The kit s shelf life is 15 months from the date of manufacturing We will continue to perform real time stability studies and anticipate extending the shelf life as we accumulate more real time data How do I evaluate the sensitivity and efficiency of the labeling reaction based on the Poly A Controls Firs
32. numbers listed are based on U S catalog information For supplier information please refer to the Supplier Reference List in Appendix A of this manual Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 Herring Sperm DNA Promega Corporation P N D1811 Control Oligo B2 3 nM Affymetrix P N 900301 can be ordered separately NaCl 5M RNase free DNase free Ambion P N 9760G MES hydrate SigmaUltra Sigma Aldrich P N M5287 MES Sodium Salt Sigma Aldrich P N M5057 EDTA Disodium Salt 0 5M solution 100 mL Sigma Aldrich P N E7889 Miscellaneous Reagents m Tough Spots Label Dots USA Scientific P N 9185 optional 10096 DMSO Sigma Aldrich P N D2650 Surfact Amps 20 Tween 20 1096 Pierce Chemical P N 28320 Miscellaneous Supplies Hybridization Oven 640 Affymetrix P N 800138 110V or 800139 220V Sterile RNase free microcentrifuge vials 1 5 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips 3 2 9 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation 12X MES Stock Buffer 1 22M MES 0 89M Na For 1 000 mL 64 61g of MES hydrate 193 3g of MES Sodium Salt 800 mL of Molecular Biology Grade water Mix and ad
33. of Poly A RNA Controls in Samples Poly A RNA Spike Final Concentration ratio of copy number lys 1 100 000 phe 1 50 000 thr 1 25 000 dap 1 6 667 The controls are then amplified and labeled together with the samples Examining the hybridization intensities of these controls on GeneChip arrays helps to monitor the labeling process independently from the quality of the starting RNA samples Typical GeneChip array results from these poly A spike in controls are shown in Figure 2 1 3 For Drosophila Genome Arrays P N 900335 and 900336 and Yeast Genome S98 Arrays P N 900256 and 900285 the 3 AFFX r2 Bs probe sets are not available Note that the data shown here may not be representative of those obtained using the previous generation AFFX Spike in transcript name X probe sets on the GeneChip arrays listed above 1 Users who do not purchase this Kit may be required to obtain a license under U S Patent Nos 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit AFFYMETRIX Co 2 1 13 Eukaryotic 2 1 14 SECTION 2 Eukaryotic Sample and Array Processing Recommende 1200 gt 800 7 c g 400 D o 0 t t t t t t t 1 50 000 1 16 667 1 10 000 1 7 142 1 25 000 1 12 500 1 8 333 1 6 250 Relative Ratio Figure 2 1 3 Poly A RNA spikes amplified using 5 ug of a complex human HeLa total RNA sample Labeled target was hybridized onto a GeneChip Huma
34. prok2v1 10 cycles of 2 mixes cycle with Wash Buffer A at 30 C FlexMidi_euk2v3P 10 cycles of 2 mixes cycle with Wash Buffer A at 30 C Modified FlexMidi_euk2v3 for P aeruginosa Array 10 cycles of 2 mixes cycle with Wash Buffer A at 25 C ProkGE_WS2 10 cycles of 2 mixes cycle with Wash Buffer A at 25 C Post Hyb 4 cycles of 15 mixes cycle with Wash Buffer B at 6 cycles of 15 mixes cycle with Wash Buffer B at 50 C 4 cycles of 15 mixes cycle with Wash Buffer B at 50 C 4 cycles of 15 mixes cycle with Wash Buffer B at Wash 2 6 45 C Stain the probe array for Stain the probe array for Stain the probe array for 600 Stain the probe array for st 300 seconds in 300 seconds in SAPE seconds in Streptavidin Solution 600 seconds in 1 Stain Streptavidin Solution Mix Solution Mix at 35 C Mix at 25 C Streptavidin Solution Mix at 35 C at 25 C Post Stain 10 cycles of 4 mixes cycle 10 cycles of 4 mixes cycle 10 cycles of 4 mixes cycle with 10 cycles of 4 mixes cycle with Wash Buffer A at with Wash Buffer A at 30 C Wash Buffer A at 30 C with Wash Buffer A at Wash o o 30 C 30 C Stain the probe array for Stain the probe array for Stain the probe array for 600 Stain the probe array for gnd Stain 300 seconds in Antibody 300 seconds in Antibody seconds in Antibody Solution 600 seconds in Antibody Solution Mix at 35 C Solution Mix at 35 C Mix at 25 C Solution Mix at 25 C Stain the probe
35. refer to the Supplier Reference List in Appendix A of this manual m Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 m Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 m Herring Sperm DNA Promega Corporation P N D1811 m GeneChip Eukaryotic Hybridization Control Kit Affymetrix P N 900454 30 reactions or P N 900457 150 reactions contains Control cRNA and Control Oligo B2 m Control Oligo B2 3 nM Affymetrix P N 900301 can be ordered separately m 5M NaCI RNase free DNase free Ambion P N 9760G m MES hydrate SigmaUltra Sigma Aldrich P N M5287 m MES Sodium Salt Sigma Aldrich P N M5057 m EDTA Disodium Salt 0 5M solution 100 mL Sigma Aldrich P N E7889 DMSO Sigma Aldrich P N D5879 m Surfact Amps 20 Tween 20 10 Pierce Chemical P N 28320 Miscellaneous Supplies m Hybridization Oven 640 Affymetrix P N 800138 110V or 800139 220V m sterile RNase free microcentrifuge vials 1 5 mL USA Scientific P N 1415 2600 or equivalent m Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent m Sterile barrier pipette tips and non barrier pipette tips m Heatblock 2 2 5 Eukaryotic 2 2 6 SECTION 2 Eukaryotic Sample and Array Processing Reagent Preparation 12X MES Stock Buffer 1 22M MES 0 89M Na For 1 000 mL 64 61g of MES hydrate 193 3g of MES Sodium Salt 800 mL of Molecular B
36. staining of the probe array format being used Table 2 3 3 and Table 2 3 4 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate Fluidics Station User s Guide or Quick Reference Card P N 08 0093 for the FS 450 250 fluidics stations Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is in the down or eject position When finished verify that the cartridge lever is returned to the up or engaged position Remove any microcentrifuge vial remaining in the sample holder of the fluidics station module s being used If prompted to Load Vials 1 2 3 place the three experiment sample vials the microcentrifuge vials into the sample holders 1 2 and 3 on the fluidics station m Place one vial containing 600 HL of streptavidin phycoerythrin SAPE solution in sample holder 1 m Place one vial containing 600 uL of anti streptavidin biotinylated antibody solution in sample holder 2 Place one vial containing 600 HL of streptavidin phycoerythrin SAPE solution in sample holder 3 m Press down on the needle lever to snap needles into position and to start the run The run begins The Fluidics Station dialog box at the workstation terminal and the LCD w
37. to Final Wash in Table 2 3 5 4 Toreturnto the default values for the protocol selected click the Defaults button 5 Afterall the protocol conditions are modified as desired change the name of the edited protocol in the Protocol Name box Il CAUT If the protocol is saved without entering a new Protocol Name the original protocol parameters will be overwritten 6 Click Save then close the dialog box Enter 0 zero for hybridization time if hybridization step is not required Likewise enter 0 zero for the stain time if staining is not required Enter 0 zero for the number of wash cycles if a wash solution is not required Section 3 Prokaryotic Sample and Array Processing 701029 Rev 4 w ui Contents 701029 Rev 4 Section 3 Prokaryotic Sample and Array Processing Chapter 1 Prokaryotic Target Preparation 3 1 3 Chapter 2 Prokaryotic Target Hybridization 3 2 3 Chapter 3 Prokaryotic Arrays Washing Staining and Scanning 3 3 3 I gt de E o he 0 SECTION 3 Prokaryotic Sample and Array Processing a 5 gt ra X x a 701030 Rev 5 Section 3 E Prokaryotic Target Preparation Reagents and Materials Required 3 1 5 Reagent Pr paration i e e RAS E are eme ete 3 1 6 Total RNA Isolation vita domu Roo eR we MW REO LAUR UE eget e 3 1 7 cDNA Synth sis 5 usc A AS 3 1 8 Step 1
38. total RNA as starting material In addition the Change calls analyzing two different samples were also highly consistent within the assay For large scale studies involving many different samples it is still advisable to normalize the starting materials and always use the same starting quantity to obtain the most direct and reliable comparison analysis results Two Cycle cDNA Synthesis Kit AFFYMETRIX What components does the GeneChip Two Cycle cDNA Synthesis Kit contain The Two Cycle cDNA Synthesis Kit contains all necessary reagents see the following table to carry out the two cycles of cDNA synthesis for thirty samples Note that the reagents for the intermediary in vitro transcription IVT amplification using un labeled ribonucleotides between the two cDNA synthesis reactions is not included in the kit The Ambion MEGAscript T7 Kit is recommended Component Name Concentration Volume Quantity T7 Oligo dT Primer 50 uM 50 uM 120 uL 1 5X 15 Strand Reaction Mix 5X 180 uL 1 DTT 0 1M 0 1M 90 uL 1 dNTP 10 mM 10 mM 200 uL 1 SuperScript Il 200 U uL 60 uL 1 RNase Inhibitor 40 U uL 45 uL 1 5X 2nd Strand Reaction Mix 5X 900 uL 1 Random Primers 3 ug uL 60 uL 1 MgCl 1M 1M 60 uL 1 E coli DNA Polymerase 10 U uL 200 uL 1 RNase H 2 U uL 55 uL 1 T4 DNA Polymerase 5 U uL 60 uL 1 RNase free Water 9 5 mL 1 What is the shelf life of the kit The Two Cycle cDNA Synthesis Kit has a
39. uL Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 3 Incubate for 2 hours at 16 C 4 Add 2 uL of T4 DNA Polymerase to each sample and incubate for 5 minutes at 16 C 5 After incubation with T4 DNA Polymerase add 10 uL of EDTA 0 5M and proceed to Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 Do not leave the reactions at 4 C for long periods of time CHAPTER 1 Eukaryotic Target Preparation Two Cycle cDNA Synthesis Step 1 Preparation of Poly A RNA Controls for Two Cycle cDNA Synthesis Spike in Controls Eukaryotic Poly A RNA Control Kit is used for this step Designed specifically to provide exogenous positive controls to monitor the entire eukaryotic target labeling process a set of poly A RNA controls are supplied in the GeneChip Eukaryotic Poly A RNA Control Kit Each eukaryotic GeneChip probe array contains probe sets for several B subtilis genes that are absent in eukaryotic samples ys phe thr and dap These poly A RNA controls are in vitro synthesized and the polyadenylated transcripts for these B subtilis genes are pre mixed at staggered concentrations The concentrated Poly A Control Stock can be diluted with the Poly A Control Dil Buffer and spiked directly into the RNA samples to achieve the final concentrations referred to as a ratio of copy number summar
40. visualize and helps reduce the chance of losing the pellet during washing steps The pellet paint does not appear to affect the outcome of subsequent steps in this protocol however it can contribute to the absorbance at 260 nm when quantifying the mRNA m Glycogen Addition of 0 5 to 1 uL of glycogen 5 mg mL to nucleic acid precipitations aids in visualization of the pellet and may increase recovery The glycogen does not appear to affect the outcome of subsequent steps in this protocol Quantification of RNA Quantify RNA yield by spectrophotometric analysis using the convention that 1 absorbance unit at 260 nm equals 40 ug mL RNA m he absorbance should be checked at 260 and 280 nm for determination of sample concentration and purity m he Azgo Azgo ratio should be close to 2 0 for pure RNA ratios between 1 9 and 2 1 are acceptable m Integrity of total RNA samples can also be assessed qualitatively on an Agilent 2100 Bioanalyzer Refer to Figure 2 1 2 for an example of good quality total RNA sample AFFYMETRIX AN 2 1 11 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Fluorescence Time seconds Figure 2 1 2 Electropherogram from the Agilent 2100 Bioanalyzer for HeLa Total RNA For a high quality total RNA sample two well defined peaks corresponding to the 18S and 28S ribosomal RNAs should be observed similar to a denaturing agarose gel with ratios approaching 2 1 for t
41. you are using the FS 450 250 connect one end of the plastic tubing to each of the three needles The proper technique is to press down on the cartridge lever until the needles extend a convenient distance from the module then slip the tube on as you hold the cartridge lever down with the free hand as shown in Figure 4 1 2 Take care not to bend or break the needles If you are using the Fluidics Station 400 If you are using the FS 400 connect one end of the plastic tubing to each needle at the bottom of each module Figure 4 1 2 Inserting tubes on the needles Take care not to break or bend the needles ES Maintenance SECTION 4 Fluidics Station Maintenance Procedures 8 Insert the other ends into 0 52546 sodium hypochlorite solution at least 500 mL for all four modules as shown in Figure 4 1 3 v Note Remove cartridges before you start the bleach protocol Figure 4 1 3 The tubes extending from the modules to the bleach bottle Note that the probe array cartridges must be removed before the protocol can begin 4 1 10 CHAPTER 1 Fluidics Station Maintenance Procedures 9 Ensure that all the tube ends remain immersed in the bleach solution by tamping down on the tubes using a dowel or similar object as shown in Figure 4 1 4 Figure 4 1 4 Tamp down on the tubes to ensure that the ends remain immersed in the solution v Note For ease of handling band the tubes together using a rubber band AFFYME
42. 00 or the GeneArray Scanner ENGAGE washblock and proceed to Probe Array Scan on page 3 3 17 If you do not scan the arrays right away keep the probe arrays at 4 C and in the dark until ready for scanning If there are no more samples to hybridize shut down the fluidics station following the procedure outlined in the section Shutting Down the Fluidics Station on page 3 3 19 For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 3 3 9 If bubbles are present Return the probe array to the probe array holder Latch the probe array holder by gently pushing it up until a light click is heard Engage the washblock by firmly pushing up on the cartridge lever to the ENGAGE position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished the LCD window displays EJECT CARTRIDGE again remove the probe array and inspect it again for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 3 3 17 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash Buffer A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning Probe Array Scan
43. 1 j AAAAA 3 3 LLLLLLLLLLE UUUUU 5 Two Cycle sn nti IS 2nd cycle 2 4 strand 4 P d T7 Oligo dT Primer 25h SI Kit cDNA synthesis 3 TTTTT mm 5 VOUS 5 1 T 1 1 j AAAAA DE 3 3 00000 TTTTT NEN 5 8 Products Used Sample Cleanup of double stranded cDNA 0 5 hours Cs p of double str y 5 hour Module Bs Biotinylated Biotin labeling of antisense cRNA n ida 4 hours Ribonucleotide 1 IVT A Analog overnight Labeling Kit 9 9 9 L 3 JILL U UU UU s Cleanup of biotinylated cRNA 0 5 hours Sample p au 4 Cleanup 1 Module Fragmentation 4 1 hour Hybridization controls E 4 u Hybridization 16 hours Streptavidin phycoerythrin Biotinylated anti streptavidin antibody Washing Staining 1 5 hours Legend Scanning 12 minutes T T T T T RNA DNA NEN T7 promoter Biotin U Pseudouridine Figure 2 1 1 GeneChip Eukaryotic Labeling Assays for Expression Analysis 2 1 6 CHAPTER 1 Eukaryotic Target Preparation Reagents and Materials Required EX AFFYMETRIX al The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part numbers listed are based on U S catalog information For supplier information please refer to the Supplier Reference List in Appendix A of this manual Do not store enzymes in a frost free freezer Total RNA Isolation m TRizol Reagent Invitrogen Life Technologies P N 15596 018 m RN
44. 1 ug to 15 ug or mRNA 0 2 ug to 2 pg is first reverse transcribed using a T7 Oligo dT Promoter Primer in the first strand cDNA synthesis reaction Following RNase H mediated second strand cDNA synthesis the double stranded cDNA is purified and serves as a template in the subsequent in vitro transcription IVT reaction The IVT reaction is carried out in the presence of T7 RNA Polymerase and a biotinylated nucleotide analog ribonucleotide mix for complementary RNA cRNA amplification and biotin labeling The biotinylated cRNA targets are then cleaned up fragmented and hybridized to GeneChip expression arrays For smaller amounts of starting total RNA in the range of 10 ng to 100 ng an additional cycle of cDNA synthesis and IVT amplification is required to obtain sufficient amounts of labeled cRNA target for analysis with arrays The Two Cycle Eukaryotic Target Labeling Assay experimental outline is also represented in Figure 2 1 1 After cDNA synthesis in the first cycle an unlabeled ribonucleotide mix is used in the first cycle of IVT amplification The unlabeled cRNA is then reverse transcribed in the first strand cDNA synthesis step of the second cycle using random primers Subsequently the T7 Oligo dT Promoter Primer is used in the second strand cDNA synthesis to generate double stranded cDNA template containing T7 promoter sequences The resulting double stranded cDNA is then amplified and labeled using a biotinylated nucleotide analog rib
45. 16 hour incubation The hybridization process is described in the respective sections for the different probe array types AFFYMETRIX AM 1 1 5 Overview SECTION 1 GeneChip Expression Analysis Overview Step 3 Fluidics Station Setup Specific experimental information is defined using Affymetrix Microarray Suite or GeneChip Operating Software GCOS on a PC compatible workstation The probe array type sample description and comments are entered and saved with a unique experiment name The fluidics station is then prepared for use by priming with the appropriate buffers For more information on the fluidics station refer to the Fluidics Station User s Guide Step 4 Probe Array Washing and Staining Immediately following hybridization the probe array undergoes an automated washing and staining protocol on the fluidics station Step 5 Probe Array Scan Once the probe array has been hybridized washed and stained it is scanned Each workstation running Affymetrix Microarray Suite or GCOS can control one scanner The software defines the probe cells and computes an intensity for each cell Each complete probe array image is stored in a separate data file identified by the experiment name and is saved with a data image file dat extension Review the scanner user s manual for safety precautions and for more information on using the scanner Step 6 Data Analysis Precautions The dat image is analyzed for probe i
46. 2 8 000 x g 2 10 000 rpm Discard flow through Reload the spin column with the remaining mixture and centrifuge as above Discard flow through and Collection Tube Transfer spin column into a new 2 mL Collection Tube supplied Pipet 750 uL of the cDNA Wash Buffer onto the spin column Centrifuge for 1 minute at gt 8 000 x g 2 10 000 rpm Discard flow through cDNA Wash Buffer is supplied as a concentrate Ensure that ethanol is added to the cDNA Wash Buffer before use see IMPORTANT note above before starting Open the cap of the spin column and centrifuge for 5 minutes at maximum speed 25 000 x g Discard flow through and Collection Tube Label the collection tubes with the sample name During centrifugation some column caps may break resulting in loss of sample information Place columns into the centrifuge using every second bucket Position caps over the adjoining bucket so that they are oriented in the opposite direction to the rotation CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX i e if the microcentrifuge rotates in a clockwise direction orient the caps in a counterclockwise direction This avoids damage of the caps Centrifugation with open caps allows complete drying of the membrane Transfer spin column into a 1 5 mL Collection Tube and pipet 14 uL of cDNA Elution Buffer directly onto the spin column membrane Incubate for 1 minute at room temperature and centrifuge 1 minute at maximum s
47. 371 1 Poly A RNA Control Kit Affymetrix P N 900433 1 Hybridization Control Kit Affymetrix P N 900454 EGAscript High Yield Transcription Kit Ambion Inc P N 1334 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Miscellaneous Reagents 10X TBE Cambrex P N 50843 Absolute ethanol stored at 20 C for RNA precipitation store ethanol at room temperature for use with the GeneChip Sample Cleanup Module 8096 ethanol stored at 20 C for RNA precipitation store ethanol at room temperature for use with the GeneChip Sample Cleanup Module SYBR Green Cambrex P N 50523 or Molecular Probes P N 7586 optional Pellet Paint Novagen P N 69049 3 optional Glycogen Ambion P N 9510 optional 3M Sodium Acetate NaOAc Sigma Aldrich P N 7899 Ethidium Bromide Sigma Aldrich P N E8751 1N NaOH 1N HCI Miscellaneous Supplies Sterile RNase free microcentrifuge vials 1 5 mL USA Scientific P N 1415 2600 or equivalent m Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier RNase free pipette tips Tips must be pointed not rounded for efficient use with the probe arrays Beveled pipette tips may cause damage to the array septa and cause leakage Mini agarose gel electrophoresis unit with appropriate buffers UV spectrophotometer Bioanalyzer Non stick RNase free microfuge tubes 0 5 mL and 1 5 mL Ambion P N12350 and P N 12450 respectively Alternative P
48. Control Dil Buffer to prepare the Second Dilution 1 50 CHAPTER 1 Eukaryotic Target Preparation 4 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 5 Add 2 uL of the Second Dilution to 18 uL of Poly A Control Dil Buffer to prepare the Third Dilution 1 10 6 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 7 Add 2 pL of this Third Dilution to 5 ug of sample total RNA v Note The First Dilution of the poly A RNA controls can be stored up to six weeks in a non frost free freezer at 20 C and frozen thawed up to eight times AFFYMETRIX Pi 2 1 15 Eukaryotic 2 1 16 SECTION 2 Eukaryotic Sample and Array Processing Step 2 First Strand cDNA Synthesis One Cycle cDNA Synthesis Kit is used for this step 1 Briefly spin down all tubes in the Kit before using the reagents 2 Perform all of the incubations in thermal cyclers The following program can be used as a reference to perform the first strand cDNA synthesis reaction in a thermal cycler the 4 C holds are for reagent addition steps 70 C 10 minutes 4 C hold 42 C 2 minutes 42 C 1 hour 4 C hold 1 Mix RNA sample diluted poly A RNA controls and T7 Oligo dT Primer Table 2 1 3 RNA T7 Oligo dT Primer Mix Preparation for 1 to 8 ug of total RNA or 0 2 to 1 ug of MRNA Component Volume Sample RNA variable Diluted poly A RNA controls 2 HL T7 Oligo dT Primer 50 uM 2 HL
49. E Again remove the probe array and inspect it for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 3 3 17 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash Buffer A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity If you are using the Fluidics Station 400 Washing and Staining the Probe Array 1 Inthe Fluidics Station dialog box on the workstation select the correct experiment name in the drop down Experiment list The probe array type will appear automatically 2 Inthe Protocol drop down list select the appropriate antibody amplification protocol to control the washing and staining of the probe array format being used Table 3 3 6 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions on the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the Fluidics Station 400 User s Guide Fluidics Station 400 Video In Service CD P N 900374 or Quick Reference Card P N 08 0072 4 Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is in the EJECT position When finished verify that the cartridge lever is returned to the ENGAGE position 5 Remov
50. GENE EXPRESSION MONITORING GeneChip Expression Analysis Technical Manual For Research Use Only Not for use in diagnostic procedures AFFYMETRIX 701021 Rev 5 a Trademarks Affymetrix GeneChip EAST AMC y 4 O HuSNP GenFlex Jaguar MicroDB NetAffx CustomExpress Flying Objective Tools To Take You As Far As Your Vision and The Way Ahead are trademarks owned or used by Affymetrix Inc GeneArray is a registered U S trademark of Agilent Technologies Inc Enzo is a registered trademark of Enzo Biochem Inc and BioArray is a trademark of Enzo Biochem Inc QIAGEN is a registered trademark of QIAGEN GmbH Hilden Germany Limited License EXCEPT AS EXPRESSLY SET FORTH HEREIN NO RIGHT TO COPY MODIFY DISTRIBUTE MAKE DERIVATIVE WORKS OF PUBLICLY DISPLAY MAKE HAVE MADE OFFER TO SELL SELL USE OR IMPORT PROBE ARRAYS OR ANY OTHER PRODUCT IS CONVEYED OR IMPLIED WITH THE PROBE ARRAYS INSTRUMENTS SOFTWARE REAGENTS OR ANY OTHER ITEMS PROVIDED HEREUNDER EXCEPT FOR CERTAIN ARRAYS AND REAGENTS DESIGNATED AS ANALYTE SPECIFIC REAGENTS SEE APPLICABLE PACKAGE INSERT WHICH ARE LICENSED FOR USE AS ANALYTE SPECIFIC REAGENTS OR RESEARCH USE ALL PRODUCTS INCLUDING THE PROBE ARRAYS INSTRUMENTS SOFTWARE AND REAGENTS DELIVERED HEREUNDER ARE LICENSED TO BUYER FOR RESEARCH USE ONLY THIS LIMITED LICENSE PERMITS ONLY THE USE BY BUYER OF THE PARTICULAR PRODUCT S IN ACCORDANCE WITH THE
51. Labeling Reagent Affymetrix P N 900542 to label the 3 termini of the fragmentation products 1 Prepare the following reaction mix Table 3 1 5 Terminal Label Reaction Components Volume 5X Reaction Buffer 10 uL GeneChip DNA Labeling Reagent 75 mM 2 HL Terminal Deoxynucleotidyl Transferase 2 HL Fragmentation CDNA Product Up to 20 HL H20 16 uL Total Volume 50 pL 2 Incubate the reaction at 37 C for 60 minutes 3 Stop the reaction by adding 2 uL of 0 5M EDTA 4 The target is ready to be hybridized onto probe arrays as described in Section 3 Chapter 2 Prokaryotic Target Hybridization Alternatively it may be stored at 20 C for later use To estimate the labeling efficiency a gel shift assay can be performed see below In general greater than 90 of the fragments should be labeled and therefore shifted Gel Shift Assay The efficiency of the labeling procedure can be assessed using the following procedure This quality control protocol prevents hybridizing poorly labeled target onto the probe array The addition of biotin residues is monitored in a gel shift assay where the fragments are incubated with avidin prior to electrophoresis The nucleic acids are then detected by staining as shown in the gel photograph Figure 3 1 2 The procedure takes approximately 90 minutes to complete The absence of a shift pattern indicates poor biotin labeling The problem should be addressed before proceedi
52. Mix thoroughly and spin down to collect the liquid at the bottom of the tube c Add 2 uL of the First Dilution to 38 uL of Poly A Control Dil Buffer to prepare the Second Dilution 1 20 d Mix thoroughly and spin down to collect the liquid at the bottom of the tube e Add 2 uL of this Second Dilution to the total RNA as indicated in Table 3 1 2 The First Dilution of the poly A RNA controls can be stored up to six weeks in a non frost free freezer at 20 C and frozen thawed up to eight times CHAPTER 1 Prokaryotic Target Preparation Step 2 cDNA Synthesis AFFYMETRIX a 1 Prepare the following mixture for primer annealing Table 3 1 2 Primer Hybridization Mix Components Volume Final Concentration Total RNA 10 ug 0 33 ug uL 75 ng uL Random Primers 10 uL 25 ng uL Diluted poly A RNA controls 2 HL Variable Nuclease free HO Up to 30 0 uL Total Volume 30 uL The random primers supplied by Invitrogen Life Technologies are oligodeoxynucleotides composed mainly of hexamers Random primers of different length or GC content have been successfully applied to the procedure 2 Incubate the RNA Primer mix at the following temperatures 70 C for 10 minutes m 25 C for 10 minutes m Chill to 4 C 3 Prepare the reaction mix for cDNA synthesis Briefly centrifuge the reaction tube to collect sample at the bottom and add the cDNA synthesis mix from Table 3 1 3 to the RNA primer hybridization mix T
53. NA in studies where the data are intended to be directly compared Can I compare GeneChip array data from samples labeled with Enzo to those labeled with the new GeneChip IVT Labeling Kit It is not recommended to change labeling protocols in the middle of a study Comparisons between the two kits have shown comparable array data with respect to intra assay reproducibility and sensitivity However differences between the methods do exist and depending on a user s individual applications and data analysis criteria customers are encouraged to perform their own evaluation to make the final determination about whether or not they can directly compare the data Why have you modified the hybridization cocktail composition by including 10 DMSO and changed the Fluidics Scripts Since the labeling molecules are different between the two protocols optimized hybridization cocktail and Fluidics Scripts have been developed to be compatible with the new IVT Labeling Kit These instructions should be followed closely in order to obtain the best results on GeneChip arrays APPENDIX B FAQs amp Troubleshooting How can I get the modified fluidics scripts that are compatible with the new kit The new fluidics script EukGE WS2v5 uses higher wash stringency for the higher density 11 um feature size 49 and 64 format arrays It can be downloaded from the Affymetrix web site at the following link www affymetrix com support technical fluidics_scripts af
54. One or Two Cycle Target Labeling protocols How do I know if the kit is working well without hybridizing my targets to GeneChip arrays A linearized plasmid DNA is included in this kit as a positive control Using this as template users can test the transcriptional activity of the kit components Following the protocol outlined in the Expression Analysis Technical Manual the control can be used to track yield and consistency of product size generated by the kit a distinct band of approximately 2 kb How do the labels in the GeneChip IVT Labeling Kit work The IVT Labeling Kit contains a proprietary biotinylated nucleotide analog patent pending This analog is incorporated in the T7 RNA Polymerase mediated IVT amplification and labeling reaction as a pseudouridine reagent to generate cRNA targets The recommended starting amount of total RNA for the One Cycle protocol has been reduced from 5 ug to 1 ug Do you have any data to support that the procedure works well with the reduced amount of starting material Studies were conducted at Affymetrix to compare the data obtained from 1 ug vs 5 ug of starting total RNA and the array results were highly concordant with respect to detection sensitivity percent Present call and reproducibility Signal correlation Absolute call concordance However subtle differences were observed Therefore for best comparability of results it is generally recommended to use the same amount of starting R
55. Preparation of Poly A RNA Controls 3 1 8 Step 2 cDNA Synthesis css Rede XE oS a e 3 1 9 Step3 Remoyalof RNA sn E EGG LG 3 1 10 Step 4 Purification and Quantitation of cDNA 3 1 10 cDNA Fragmentation 3 1 11 Terminal tabels ls sk mos E Sa edens AAA 3 1 12 This Chapter Contains This chapter describes the assay procedures recommended for use with the GeneChip P aeruginosa Genome Array and the GeneChip E coli Antisense Genome Array The assay utilizes reverse transcriptase and random hexamer primers to produce DNA complementary to the RNA The cDNA products are then fragmented by DNase I and labeled with terminal transferase and biotinylated GeneChip DNA Labeling Reagent at the 3 termini o E o gt a o x a This protocol is presented as a recommendation only and has not been validated by Affymetrix 701030 Rev 5 3 1 3 SECTION 3 Prokaryotic Sample and Array Processing Target Labeling for Prokaryotic GeneChip9 Antisense Arrays 1 2 5 RNA 3 RNA Extraction xd 111111 Random priming cDNA synthesis ynhes E 11111111111 1 0 RNA degradation with NaOH cDNA column purification v 1 1 1 1 1 3 cDNA 5 cDNA fragmentation and terminal labeling with biotinylated GeneChip9 DNA Labeling Reagent 5 3 5 3 DI 5 3 Legend I I RNA Ol DNA Biotin CHAPTER 1 Pro
56. RNase free Water variable Total Volume 12 uL Table 2 1 4 RNA T7 Oligo dT Primer Mix Preparation for 8 1 to 15 ug of total RNA or gt 1 ug of mRNA Component Volume Sample RNA variable Diluted poly A RNA controls 2 HL T7 Oligo dT Primer 50 uM 2 HL RNase free Water variable Total Volume 11 pL a Place total RNA 1 ug to 15 ug or mRNA sample 0 2 ug to 2 ug in a 0 2 mL PCR tube b Add2 uL of the appropriately diluted poly A RNA controls See Step 1 Preparation of Poly A RNA Controls for One Cycle cDNA Synthesis Spike in Controls on page 2 1 13 c Add 2 uL of 50 uM T7 Oligo dT Primer d Add RNase free Water to a final volume of 11 or 12 uL see Table 2 1 3 and Table 2 1 4 e Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube CHAPTER 1 Eukaryotic Target Preparation f Incubate the reaction for 10 minutes at 70 C g Cool the sample at 4 C for at least 2 minutes h Centrifuge the tube briefly 5 seconds to collect the sample at the bottom of the tube 2 Ina separate tube assemble the First Strand Master Mix a Prepare sufficient First Strand Master Mix for all of the RNA samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 5 is for a single reaction
57. Select the experiment name that corresponds to the probe array to be scanned A previously run experiment can also be selected by using the Include Scanned Experiments option box After selecting this option previously scanned experiments appear in the drop down list By default for the GeneArray Scanner only after selecting the experiment the number 2 is displayed in the Number of Scans box to perform the recommended 2X image scan For the GeneChip Scanner 3000 only one scan is required Once the experiment has been selected click the Start button A dialog box prompts you to load an array into the scanner If you are using the GeneArray Scanner click the Options button to check for the correct pixel value and wavelength of the laser beam m Pixel value 3 um m Wavelength 570 nm If you are using the GeneChip Scanner 3000 pixel resolution and wavelength are preset and cannot be changed CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Open the sample door on the scanner and insert the probe array into the holder Do not force the probe array into the holder Close the sample door of the scanner Click OK in the Start Scanner dialog box The scanner begins scanning the probe array and acquiring data When Scan in Progress is selected from the View menu the probe array image appears on the screen as the scan progresses Shutting Down the Fluidics Station 1 AFFYMETRIX al After rem
58. Synthesis 2 1 19 Step 1 Preparation of Poly A RNA Controls for Two Cycle cDNA Synthesis Spike in Controls 2 1 19 Step 2 First Cycle First Strand cDNA Synthesis o o 2 1 22 Step 3 First Cycle Second Strand cDNA Synthesis 2 1 24 Step 4 First Cycle IVT Amplification of cRNA 2 1 25 Step 5 First Cycle Cleanup of cRNA 2 1 26 Step 6 Second Cycle First Strand cDNA Synthesis 2 1 28 Step 7 Second Cycle Second Strand cDNA Synthesis 2 1 30 Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays ees 2 1 32 Synthesis of Biotin Labeled cRNA for Both the One Cycle and Two Cycle Target Labeling Assays 2 1 34 Cleanup and Quantification of Biotin Labeled cRNA 2 1 36 Step 1 Cleanup of Biotin Labeled cRNA 2 1 36 Step 2 Quantification of the CRNA 2 1 37 Step 3 Checking Unfragmented Samples by Gel Electrophoresis 2 1 38 Fragmenting the cRNA for Target Preparation 2 1 39 Alternative Protocol for One Cycle cDNA Synthesis from Total RNA 2 1 41 Step 1 First Strand cDNA Synthesis 2 1 41 Step 2 Second Strand cDNA Synthesis 2 1 43 o E gt a o 5 SECTION 2 E
59. TRIX 4 1 11 ES Maintenance SECTION 4 Fluidics Station Maintenance Procedures 10 Remove any probe array cartridges and engage the washblock as shown in Figure 4 1 5 The fluidics station will begin the protocol begin to empty the lines and perform three cleaning cycles of 10 rinses each using bleach solution CRCR Figure 4 1 5 Remove probe array cartridges and pull up on the cartridge lever to engage the washblock and begin the protocol 11 When the fluidics station LCD window displays Remove Tube from Needles carefully remove tubing from each module needle by pushing the tubing down with your fingers while holding the needle with the other gt IMPORT Do not pull the tube outwards as this may bend and possibly damage the needle in the process 12 Load empty microcentrifuge vials onto each module The fluidics station will empty the lines and run three cycles with three rinses each In addition the fluidics station will rinse the needle 20 times twice using distilled water then bring the temperature back to 25 C and drain the lines with air 13 The LCD display will read CLEANING DONE 4 1 12 CHAPTER 1 Fluidics Station Maintenance Procedures Monthly Fluidics Station Decontamination Protocol To maintain your Fluidics Station in the best possible working condition we recommend that the following decontamination protocol be performed on your fluidics station at least once a month in addit
60. VWR Scientific P N 37001 060 or equivalent ImmunoPure Streptavidin Pierce Chemical P N 21125 Miscellaneous Supplies Sterile RNase free microcentrifuge vials 1 5 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips Tygon Tubing 0 04 inner diameter Cole Parmer P N H 06418 04 Tough Spots Label Dots USA Scientific P N 9185 0000 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation Wash Buffer A Non Stringent Wash Buffer 6X SSPE 0 01 Tween 20 For 1 000 mL 300 mL of 20X SSPE 1 0 mL of 10 Tween 20 699 mL of water Filter through a 0 2 um filter Store at room temperature Wash Buffer B Stringent Wash Buffer 100 mM MES 0 1M Na 0 01 Tween 20 For 1 000 mL 83 3 mL of 12 X MES Stock Buffer see Section 3 Chapter 2 for reagent preparation 5 2 mL of 5M NaCl 1 0 mL of 1096 Tween 20 910 5 mL of water Filter through a 0 2 um filter Store at 2 C to 8 C and shield from light 2X Stain Buffer final 1X concentration 100 mM MES 1M Nat 0 05 Tween 20 For 250 mL 41 7 mL of 12X MES Stock Buffer see Section 3 Chapter 2 92 5 mL of 5M NaCl 2 5 mL of 1096 Tween 20 113 3 mL of water Filter through a 0 2 um filter Store at 2 C to 8 C and shield from light CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning AFFYMETRI
61. X 10 mg mL Goat IgG Stock Resuspend 50 mg in 5 mL 150 mM NaCl Store at 4 C If a larger volume of the 10 mg mL IgG stock is prepared aliquot and store at 20 C until use After the solution has been thawed it should be stored at 4 C Avoid additional freezing and thawing 1 mg mL Streptavidin Stock Resuspend 5 mg in 5 mL of PBS Store at 4 C Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Experiment and Fluidics Station Setup Step 1 Defining File Locations Before working with Affymetrix Microarray Suite it is important to define where the program stores and looks for files For GeneChip Operating Software GCOS this step is not necessary Proceed directly to Step 2 Entering Experiment Information 1 Launch Microarray Suite from the workstation and select Tools gt Defaults File Locations from the menu bar The File Locations window displays the locations of the following files m Probe Information library files mask files m Fluidics Protocols fluidics station scripts m Experiment Data exp dat cel and chp files are all saved to location selected here 2 Verify that all three file locations are set correctly and click OK Contact Affymetrix Technical Support if you have any questions regarding this procedure Step 2 Entering Experiment Information To wash stain and scan a probe array an experiment must first be registered in GCOS or Microarray Suite Please follow t
62. a qualitative assessment on efficiency of the labeling assays and NOT for the purpose of serving as a generic quantitative standard curve The Poly A Control Dil Buffer comes in one big bottle of 3 8 mL and it is inconvenient to freeze thaw each time since it freezes when stored at 20 C What do you recommend and can you change the packaging so the buffer comes in smaller aliquots Since the number of samples processed each time may vary drastically at different customer sites we have decided to provide the Dil Buffer in one bottle Upon receipt users are encouraged to thaw the buffer and then aliquot it in more convenient volumes for long term storage based on their own usage rate What is in the Poly A Control Dil Buffer The Dil Buffer has been formulated specifically for diluting the poly A controls to ensure stability and consistent performance Do not substitute the Dil Buffer with any other buffer when carrying out the dilutions Do you have any specific recommendation on the type of Non Stick Tubes to use for diluting the Poly A RNA Control Stock The following tubes were used at Affymetrix during product development of this Poly A RNA Control Kit and we have not tested any other tubes at this time m Non stick RNase free 0 5 mL microfuge tubes Ambion cat 12350 m Non stick RNase free 1 5 mL microfuge tubes Ambion cat 12450 Can I purchase the Poly A Control Stock and the Poly A Control Dil Buffer separately The Con
63. able 3 1 3 cDNA Synthesis Components Components Volume Final Concentration RNA Primer hybridization mix 30 uL from previous step 5X 15 Strand Buffer 12 uL 1X 100 mM DTT 6 uL 10 mM 10 mM dNTPs 3 HL 0 5 mM SUPERaseeln 20 U uL 15 uL 0 5 U pL SuperScript Il 200 U uL 75 HL 25 U uL Total Volume 60 uL 4 Incubate the reaction at the following temperatures m 25 C for 10 minutes m 37 C for 60 minutes m 42 C for 60 minutes m Inactivate SuperScript Il at 70 C for 10 minutes m Chill to 4 C 3 1 9 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Step 3 Removal of RNA 1 Add 20 uL of IN NaOH and incubate at 65 C for 30 minutes 2 Add 20 uL of IN HCI to neutralize Step 4 Purification and Quantitation of cDNA 1 Use MinElute PCR Purification Columns to clean up the cDNA synthesis product for detailed protocol see MinElute PCR Purification Kit Protocols provided by the supplier Elute the product with 12 uL of EB Buffer supplied with the kit The average volume of eluate is 11 uL from 12 uL of EB Buffer 2 Quantify the purified cDNA product by 260 nm absorbance 1 0 A unit 33 ug mL of single stranded DNA v Note Typical yields of cDNA are 3 to 7 ug A minimum of 1 5 ug of cDNA is required for subsequent procedures to obtain sufficient material to hybridize onto the array and to perform necessary quality control experiments 3 1 10 CHAPTER 1 Prokaryotic Target P
64. and middle portion M of the transcript have also been selected for certain housekeeping genes including GAPDH and P Actin Signal intensity ratio of the 3 probe set over the 5 probe set is often referred to as the 3 5 ratio This ratio gives an indication of the integrity of your starting RNA efficiency of first strand cDNA synthesis and or in vitro transcription of cRNA The signal of each probe set reflects the sequence of the probes and their hybridization properties A 1 1 molar ratio of the 3 to 5 transcript regions will not necessarily give a signal ratio of 1 There is no single threshold cutoff to assess sample quality for all of the diverse organisms and tissues This is due to the presence of different isoforms of these housekeeping genes and their different expression patterns in various tissues and organisms Although we routinely refer to a threshold ratio of less than 3 for the most common tissues such as mammalian liver and brain this may not be applicable to all situations It may be more appropriate to document the 3 5 ratios within a particular study and flag the results that deviate therefore representing an unusual sample that deserves further investigation 5 B 19 Appendices 5 B 20 SECTION 5 Appendices Can results from different laboratories and different times be compared with each other directly and how do you control the variables in this type of experiment Array results can potentially be compare
65. array for Stain the probe array for Stain the probe array for 600 Stain the probe array for 3rd Stain 300 seconds in SAPE 300 seconds in SAPE seconds in SAPE Solution Mix at 600 seconds in SAPE Solution Mix at 35 C Solution Mix at 35 C 25 C Solution Mix at 25 C 15 cycles of 4 mixes cycle 15 cycles of 4 mixes cycle 15 cycles of 4 mixes cycle with 15 cycles of 4 mixes cycle Final with Wash Buffer A at with Wash Buffer A at Wash Buffer A at 30 C The with Wash Buffer A at Wash 35 C The holding 35 C The holding holding temperature is 25 C 30 C The holding temperature is 25 C temperature is 25 C temperature is 25 C a Mini_prok2v1_450 ot the FS 450 250 b FlexMidi_Euk2v3_450 for the FS 450 250 c ProkGE_WS2_450 AFFYMETRIX a or the FS 450 250 3 3 13 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing FS 450 If you are using the Fluidics Station 450 250 Washing and Staining the Probe Array 1 Inthe Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list The Probe Array Type appears automatically 2 Inthe Protocol drop down list select the appropriate antibody amplification protocol to control the washing and staining of the probe array format being used Table 3 3 6 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the flu
66. aterial is rather small in the Two Cycle Target Labeling Assay and the amount of cRNA to be used in the 2 d cycle does not have to be precise to make it successful For simplification purposes we are recommending using the actual cRNA as an estimation at this step APPENDIX B FAQs amp Troubleshooting IVT Labeling Kit AFFYMETRIX Co What does the GeneChip IVT Labeling Kit contain The IVT Labeling Kit contains all necessary reagents see the following table to perform thirty in vitro transcription IVT reactions from double stranded cDNA templates The template cDNA containing the T7 promoter sequence can be obtained following either the One or Two Cycle cDNA Synthesis protocols Component Name Quantity Volume 10X IVT Labeling Buffer 1 120 uL IVT Labeling Enzyme Mix 1 120 uL IVT Labeling NTP Mix 1 360 uL 3 Labeling Control 0 5 ug uL 1 10 uL RNase free Water 1 910 uL Why are you recommending the overnight incubation for the IVT reaction There are two major benefits for this change in protocol One benefit is that it provides the option for starting with as little as 1 hg of total RNA using just the standard One Cycle Labeling protocol The other benefit is that it incorporates a more convenient and efficient experimental workflow Previously IVT was carried out with 4 5 hours of incubation on the second day of a standard One Cycle Target Labeling protocol This made the procedure on the second day rat
67. based on the following recommendation Table 3 1 1 Serial Dilutions of Poly A RNA Control Stock Array Format Serial Dilutions Spike in Volume First Second 169 Format Mini 1 20 1 16 2 HL 100 Format Midi 1 20 1 20 2 HL 49 Format Standard 1 20 1 13 2 l Please refer to specific probe array package insert for information on array format Avoid pipetting solutions less than 2 uL in volume to maintain precision and consistency when preparing the dilutions The Poly A RNA Control Stock contains in vitro synthesized polyadenylated transcripts for B subtilis genes that are pre mixed at staggered concentrations The concentrations of the spikes in the stock solution are ys 7 6 nM phe 15 2 nM thr 30 4 nM and dap 114 0 nM Following the recommended dilutions as shown above the final concentrations of the spikes in the hybridization cocktail Table 3 2 1 are lys 0 256 pM phe 0 511 pM thr 1 022 pM and dap 3 833 pM We strongly recommend using control transcripts to monitor the assay sensitivity and performance Probe sets for these control genes from B subtilis have been tiled on the GeneChip P aeruginosa Genome Array and E coli Antisense Genome Array For example to prepare the poly A RNA dilutions for a 100 format array Use non stick RNase free microfuge tubes to prepare all of the dilutions a Add 2 uL of the Poly A RNA Control Stock to 38 uL of Poly A Control Dil Buffer for the First Dilution 1 20 b
68. be a valid representation of the realigned image data Microarray Suite GCOS automatically detects this situation either on initial reopening of the readjusted dat file or during the analysis process Once the readjusted dat file is opened the cel file is automatically created The user does not need to carry out any overt steps to accomplish this 5 B 21 Appendices 5 B 22 SECTION 5 Appendices How do I add additional probe sets in the rpt file Use the Report Settings dialog on the shortcut menu in Microarray Suite GCOS to open the Expression Report You may add any probe sets desired by simply typing in the probe set name s you wish to add this can also be accomplished by cutting and pasting from a text file Keep in mind that the probe set name must be entered exactly as it appears in the analysis file including the suffixes such as 12345 s at Why can I not analyze data files stored on a CD Files in CD ROM format are copied to the hard drive in read only mode MAS requires this attribute to be removed To do this open Windows Explorer and select the file s you copied from the CD Click the right mouse button and select Properties Clear the Read only check box near the bottom of the Properties screen and click OK In order for data from a CD to be analyzed in GCOS the data files must first be imported into the GCOS database using either GCOS Manager or GCOS Batch Importer If the data is backed up as a CAB file
69. before scanning Do not use them in the hyb process 1 Onthebackof the probe array cartridge clean excess fluid from around septa 2 Carefully apply one Tough Spot to each of the two septa Press to ensure that the spots remain flat If the Tough Spots do not apply smoothly that is if you observe bumps bubbles tears or curled edges do not attempt to smooth out the spot Remove the spot and apply a new spot See Figure 3 3 1 3 3 17 Prokaryotic 3 3 18 SECTION 3 Prokaryotic Sample and Array Processing Figure 3 3 1 Applying Tough Spots M to the probe array cartridge 3 Insert the cartridge into the scanner and test the autofocus to ensure that the Tough Spots do not interfere with the focus If you observe a focus error message remove the spot and apply a new spot Ensure that the spots lie flat Scanning the Probe Array Select Run Scanner from the menu bar Alternatively click the Start Scan icon in the tool bar The Scanner dialog box appears with a drop down list of experiments that have not been run Select the experiment name that corresponds to the probe array to be scanned A previously run experiment can also be selected by using the Include Scanned Experiments option box After selecting this option previously scanned experiments appear in the drop down list By default for the Agilent GeneArray Scanner only after selecting the experiment the number 2 is displayed in the Number of Scan
70. bleshooting Data Analysis AFFYMETRIX I have observed on occasion that multiple _at probe sets are mapped to the same gene but give different expression results How do I reconcile the difference There are various reasons why this happens With increasing knowledge of the genome the unique probe sets _at probe sets that were initially designed may turn out to represent subclusters that have collapsed into a single cluster in a later design Therefore it may seem that multiple unique _at probe sets now correspond to a single gene Different results from the probe sets could be observed due to the following reasons 1 They represent splice variants or may cross hybridize to different members that belong to a highly similar gene family or transcripts with different poly A sites 2 One probe set is more 5 than the other 3 One probe set is better designed than the other In these cases it is important to use the resources available on the NetAffx Analysis Center www affymetrix com to understand if any of the above scenarios apply Other expression analysis techniques may also be used to confirm which probe set reflects the transcript level more accurately What 3 5 ratio for control genes for example GAPDH and f Actin should I anticipate to obtain on GeneChip probe arrays In addition to the conventional probe sets designed to be within the most 3 600 bases of a transcript additional probe sets in the 5 region
71. bout 18 months of dating from the date of manufacturing How are the kits shipped and what is the storage condition The kits are shipped on dry ice and should be stored at 20 C 5 B 11 Appendices 5 B 12 SECTION 5 Appendices Are the data obtained following the Small Sample Target Labeling vII SSTLvII comparable to those obtained using the Two Cycle cDNA Synthesis Kit The array results are highly comparable with respect to cRNA length and yield percent Present call rate Signal intensity value 3 5 ratios false change analysis and poly A RNA control spike performance However since the protocol has been modified see detail below it is recommended NOT to compare data obtained from the two protocols directly What are the major differences and improvements comparing the new Two Cycle cDNA Synthesis Kit with the Affymetrix Small Sample Target Labeling Version II Protocol The Two Cycle cDNA Synthesis Kit was developed primarily based on SSTLvII with some additional optimization focusing on a more streamlined procedure More information on these changes is summarized as follows m The new Two Cycle cDNA Synthesis Kit protocol utilizes larger reaction volume for the 1stcycle cDNA synthesis step allowing more flexibility in the starting material concentration and reducing potential pipetting variations m he new Two Cycle cDNA Synthesis Kit protocol eliminates the cDNA cleanup step in the 1 cycle increasing ease o
72. bridization proceed to Section 2 Chapter 3 to prepare reagents required immediately after completion of hybridization Plastic cartridge _ Notch Septa Front Probe array on glass substrate Figure 2 2 1 GeneChip Probe Array gt de Xx E wu 701028 Rev 5 Section 2 E A Eukaryotic Arrays Washing Staining and Scanning Reagents and Materials Required 2 3 5 Reagent Preparation 2 3 6 El Experiment and Fluidics Station Setup 2 3 7 E Step 1 Defining File Locations 2 94 ET Step 2 Entering Experiment Information 2 3 7 Step 3 Preparing the Fluidics Station o o o 2 3 8 Probe Array Wash and Stain 2 3 9 Probe Array Scans is ehe ROUES e m Eu MS 2 3 15 Handling the GeneChip Probe Array 2 3 15 Scanning the Probe Array 2 3 16 Shutting Down the Fluidics Station 2 3 17 Customizing the Protocol 2 3 18 This Chapter Contains m Instructions for using the Fluidics Station 400 and 450 250 to automate the washing and staining of eukaryotic GeneChip expression probe arrays m Instructions for scanning probe arrays using the GeneArray Scanner or the GeneChip Scan
73. cipitation of RNA Total RNA It is not necessary to precipitate total RNA following isolation or cleanup with the RNeasy Mini Kit Adjust elution volumes from the RNeasy column to prepare for cDNA synthesis based upon expected RNA yields from your experiment Ethanol precipitation is required following TRIzol isolation and hot phenol extraction methods see methods on page 2 1 11 for details Poly A mRNA Most poly A mRNA isolation procedures will result in dilution of RNA It is necessary to concentrate mRNA prior to the cDNA synthesis CHAPTER 1 Eukaryotic Target Preparation Precipitation Procedure 1 Add 1 10 volume 3M NaOAc pH 5 2 and 2 5 volumes ethanol 2 Mixand incubate at 20 C for at least 1 hour 3 Centrifuge at gt 12 000 x g in a microcentrifuge for 20 minutes at 4 C 4 Wash pellet twice with 80 ethanol 5 Air dry pellet Check for dryness before proceeding 6 Resuspend pellet in DEPC treated H O The appropriate volume for resuspension depends on the expected yield and the amount of RNA required for the cDNA synthesis Please read ahead to the cDNA synthesis protocol in order to determine the appropriate resuspension volume at this step Addition of Carrier to Ethanol Precipitations Adding carrier material has been shown to improve the RNA yield of precipitation reactions m Pellet Paint Addition of 0 5 uL of Pellet Paint per tube to nucleic acid precipitations makes the nucleic acid pellet easier to
74. ct Information 5 A 5 Reagents and Materials Quick List for Hybridization and Staining 5 A 6 o 2 T 2 2 lt 701043 Rev 4 5 A 3 SECTION 5 Appendices Affymetrix Technical Support Affymetrix provides technical support via phone or e mail To contact Affymetrix Technical Support Affymetrix Inc 3380 Central Expressway Santa Clara CA 95051 USA Tel 1 888 362 2447 1 888 DNA CHIP Fax 1 408 731 5441 E mail support 2 affymetrix com Affymetrix UK Ltd Voyager Mercury Park Wycombe Lane Wooburn Green High Wycombe HP10 OHH United Kingdom Tel 44 0 1628 552550 Fax 44 0 1628 552585 E mail supporteurope affymetrix com Affymetrix Japan K K Mita NN Bldg 16 F 4 1 23 Shiba Minato ku Tokyo 108 0014 Japan Tel 81 0 3 5730 8200 Fax 81 0 3 5730 8201 E mail supportjapan affymetrix com www affymetrix com 5 A 4 APPENDIX A Supplier and Reagent Reference List Supplier Contact Information Supplier Web Site Ambion www ambion com Amersham Biosciences www amershambiosciences com Amresco www amresco inc com BD Biosciences www bdbiosciences com BioWhittaker Molecular Applications Cambrex www cambrex com Brinkmann Instruments www brinkmann com Cole Parmer www coleparmer com Corning Life Sciences www corning com lifesciences CLONTECH www bdbiosciences com clont
75. d cRNA targets are prepared and hybridized onto GeneChip expression arrays The resultant Signal intensities for the poly A RNA controls serve as sensitive indicators of the efficiency of the labeling reaction 5 B 5 Appendices 5 B 6 SECTION 5 Appendices Poly A RNA Final Concentration in Controls Samples lys 1 100 000 phe 1 50 000 thr 1 25 000 dap 1 6 667 Concentrations are defined as the number of copies of a particular poly A RNA control to the total number of poly A RNA molecules in the complex sample Volume Components 16 uL Poly A Control Stock 3 8 mL Poly A Control Dil Buffer What are the assumptions you have used in estimating the concentrations in terms of complexity ratio of these control transcripts in a sample The concentrations in terms of complexity ratios are calculated based on the following assumptions m Average transcript length 2 000 bases m Average MW of a single base 330 g mole m MRNA constitutes approximately 2 of the total RNA sample Based on these assumptions how did you calculate the concentrations in terms of complexity ratios from the starting concentrations of the poly A RNA controls in the Poly A Control Stock The concentrations of the poly A RNA controls in the stock solution are as follows lys 7 6 nM phe 15 2 nM thr 30 4 nM dap 114 0 nM A complexity ratio is the ratio of the number of copies of poly A control transcript to the total number of
76. d directly However it is important to check the following important elements before doing so m Experimental design strategy should be the same at various sites m Identical target labeling protocols should be followed and yields from cDNA and IVT reactions should be within the same range as specified for that study m Same algorithm parameters are used m Similar results from 3 5 ratios background noise and scaling factors Check arrays for scratches and even hybridization staining Comparability of results obtained from different operators should be evaluated before including their results in the same study Affymetrix Microarray Suite MAS is on the C drive which is low on space How can I create more room on the hard drive The library and data files can be moved to another drive then deleted from the C drive After moving the files remember to change your library file default settings in MAS to the appropriate directory by clicking on the Tools tab and then select Defaults in the drop down menu then File locations tab in the Defaults window These instructions do not apply for GeneChip Operating Software GCOS To free up space on workstations running GCOS it is important to routinely create backup CAB files of the data using GCOS Administrator and move these backup files to alternative storage media The data files can then be archived or deleted using GCOS Manager Please review the appropriate sections of th
77. d for choosing the Protocol for each of the four fluidics station modules Refer to the appropriate GeneChip Fluidics Station User s Guide for instructions on connecting and addressing multiple fluidics stations Priming the Fluidics Station Priming ensures that the lines of the fluidics station are filled with the appropriate buffers and the fluidics station is ready for running fluidics station protocols Priming should be done m When the fluidics station is first started m Vhen wash solutions are changed m Before washing if a shutdown has been performed m f the LCD window instructs the user to prime Select Protocol in the Fluidics Station dialog box Choose Prime or Prime_450 for the respective modules in the Protocol drop down list Change the intake buffer reservoir A to Non stringent Wash Buffer and intake buffer reservoir B to Stringent Wash Buffer For MAS click Run for each module to begin priming In GCOS select the All Modules check box then click Run Prokaryotic 3 3 10 SECTION 3 Prokaryotic Sample and Array Processing Probe Array Wash and Stain Following hybridization the wash and stain procedures are carried out by the Fluidics Station A modified FlexMidi euk2v3 fluidics script FlexMidi euk2v3 450 if you are using the FS 450 is used for the GeneChip P aeruginosa Genome Array and the ProkGE WS2 fluidics script ProkGE WS2 450 if you are using the FS 450 is used for the GeneChip
78. d target was hybridized onto a GeneChip Human Genome U133 Plus 2 0 Array Signal intensities of the 3 AFFX r2 Bs probe set of the control transcripts were obtained using GeneChip Operating Software version 1 1 1 and the average values from the triplicate experiments were plotted The Poly A RNA Control Stock and Poly A Control Dil Buffer are provided with the kit to prepare the appropriate serial dilutions based on Table 2 1 8 This is a guideline when 10 50 or 100 ng of total RNA is used as starting material For other intermediate starting sample amounts calculations are needed in order to perform the appropriate dilutions to arrive at the same proportionate final concentration of the spike in controls in the samples IMPOR m The dilution scheme outlined below is different from the previous protocol developed for the Small Sample Target Labeling vll Closely adhere to the recommendation below to obtain the desired final concentrations of the controls m Use non stick RNase free microfuge tubes to prepare the dilutions Table 2 1 8 Serial Dilutions of Poly A RNA Control Stock Starting Serial Dilutions Volume to Add Amount of into 50 uM T7 Total RNA Second Third Oligo dT Primer 10 ng 1 20 1 50 1 50 1 10 2uL 50 ng 1 20 1 50 1 50 2 2 100 ng 1 20 1 50 1 50 ZuL Recommend Avoid pipetting solutions less than 2 uL in volume to maintain precision and consistency when preparing the dilutions For example to
79. dures below for specific arrays 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station when using the Fluidics Station 400 If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate User s Guide for your GeneChip Fluidics Station 400 or 450 250 3 3 11 Prokaryotic 3 3 12 SECTION 3 Prokaryotic Sample and Array Processing Table 3 3 5 Modification of FlexMidi_euk2v3 for GeneChip P aeruginosa Array GeneChip aeurginosa Genome Array requires a modification to the FlexMidi euk2v3 or the FlexMidi euk2v3 450 protocol See below for details The FlexMidi euk2v3 or the FlexMidi euk2v3 450 fluidics protocol must be modified Please follow the instructions carefully to make the modifications Additionally it is highly recommended that you save your new P aeruginosa fluidics protocol under a different name to avoid confusion Modify and save the fluidics protocol for the assay a Modify the fluidics protocol by using Tools gt Edit Protocol drop down list and selecting FlexMidi euk2v3 or the FlexMidi euk2v3 450 within the Protocol Name window b Change the following parameters Enter the new parameters by highlighting the default values and typing in the new values 1 Wash A1 Temperature from 30 C to 25 C 11 Number of Wash B Cycles from
80. e GCOS User s Guide for details What is the difference between scaling and normalization when I scale or normalize my data to all genes on the array With scaling you select an arbitrary target intensity and scale the average intensity of all genes minus the highest 2 and lowest 2 Signal values on each array within a data set to that number This enables you to compare multiple arrays within a data set The scaling factor remains the same for a particular array as long as you use the same arbitrary target intensity for scaling Scaling can be performed independent of the comparison analysis On the other hand normalization can only be done when performing a comparison analysis It compares an experimental array with a baseline array and normalizes the average intensity of all genes minus the highest 2 and lowest 2 Signal values of the experimental array to the corresponding average intensity of the baseline array when running a comparison analysis in MAS The normalization factor for a particular array changes when you change the comparison baseline array How important is it to evaluate the value of the Scaling Factor between different arrays Scaling Factor is the multiplication factor applied to each Signal value on an array A Scaling Factor of 1 0 indicates that the average array intensity is equal to the Target Intensity Scaling Factors will vary across different samples and there are no set guidelines for any particular sample t
81. e any microcentrifuge tube remaining in the sample holder of the fluidics station module s being used 6 Place a microcentrifuge tube containing the streptavidin solution into the sample holder making sure that the metal sampling needle is in the tube with its tip near the bottom gt The Fluidics Station dialog box and the LCD window display the status of the washing and staining as they progress 7 When the LCD window indicates replace the microcentrifuge vial containing the streptavidin stain with a microcentrifuge vial containing antibody stain solution into the Prokaryotic 3 3 16 SECTION 3 Prokaryotic Sample and Array Processing sample holder making sure that the metal sampling needle is in the vial with its tip near the bottom When the LCD window indicates replace the microcentrifuge vial containing antibody solution with the microcentrifuge vial containing the streptavidin phycoerythrin SAPE solution When the protocol is complete the LCD window displays the message EJECT CARTRIDGE 10 Remove microcentrifuge vial containing stain and replace with an empty microcentrifuge tube 11 Remove the probe arrays from the fluidics station modules by first moving the cartridge lever to the EJECT position 12 Check the probe array window for large bubbles or air pockets m f bubbles are present refer to Table 3 3 9 m f the probe array has no large bubbles it is ready to scan on the GeneChip Scanner 30
82. e reaction at the bottom of the tube and immediately proceed to Step 3 Second Strand cDNA Synthesis AFFYMETRIX KY 2 1 17 Eukaryotic 2 1 18 SECTION 2 Eukaryotic Sample and Array Processing Step 3 Second Strand cDNA Synthesis One Cycle cDNA Synthesis Kit is used for this step The following program can be used as a reference to perform the second strand cDNA synthesis reaction in a thermal cycler 16 C 2 hours 4 C hold 16 C 5 minutes 4 C hold 1 In a separate tube assemble Second Strand Master Mix It is recommended to prepare Second Strand Master Mix immediately before use a Prepare sufficient Second Strand Master Mix for all of the samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 6 is for a single reaction Table 2 1 6 Preparation of Second Strand Master Mix Component Volume RNase free Water 91 uL 5X 2 9 Strand Reaction Mix 30 uL dNTP 10 mM 3 HL E coli DNA ligase 1 HL E coli DNA Polymerase 4 HL RNase H 1 HL Total Volume 130 uL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube 2 Add 130 uL of Second Strand Master Mix to each first strand synthesis sample from Step 2 First Strand cDNA Synthesis for a total volume of 150
83. e supplied with the GeneChip Sample Cleanup Module Step 1 Cleanup of Biotin Labeled cRNA D IMPOR BEFORE STARTING please note m tis essential to remove unincorporated NTPs so that the concentration and purity of cRNA can be accurately determined by 260 nm absorbance m DO NOT extract biotin labeled RNA with phenol chloroform The biotin will cause some of the RNA to partition into the organic phase This will result in low yields m Save an aliquot of the unpurified IVT product for analysis by gel electrophoresis VT cRNA Wash Buffer is supplied as a concentrate Before using for the first time add 20 mL of ethanol 96 100 as indicated on the bottle to obtain a working solution and checkmark the box on the left hand side of the bottle label to avoid confusion m VT cRNA Binding Buffer may form a precipitate upon storage If necessary redissolve by warming in a water bath at 30 C and then place the buffer at room temperature m All steps of the protocol should be performed at room temperature During the procedure work without interruption 1 Add 60 uL of RNase free Water to the IVT reaction and mix by vortexing for 3 seconds 2 Add 350 uL IVT cRNA Binding Buffer to the sample and mix by vortexing for 3 seconds 3 Add 250 uL ethanol 96 100 to the lysate and mix well by pipetting Do not centrifuge 4 Apply sample 700 uL to the IVT cRNA Cleanup Spin Column sitting in a 2 mL Collection Tube Centrifuge f
84. easy Mini Kit QIAGEN P N 74104 Poly A mRNA Isolation Oligotex Direct mRNA Kit isolation of mRNA from whole cells OIAGEN P N 72012 72022 or 72041 Oligotex mRNA Kit isolation of mRNA from total RNA QIAGEN P N 70022 70042 or 70061 m OlAshredder OIAGEN P N 79654 Required only for use with OIAGEN Oligotex Direct Kit m DEPC Treated Water Ambion P N 9920 One Cycle Target Labeling m One Cycle Target Labeling and Control Reagents Affymetrix P N 900493 A convenient package containing all required labeling and control reagents to perform 30 one cycle labeling reactions Each of these components may be ordered individually described below as well as in this complete kit Contains 1 IVT Labeling Kit Affymetrix P N 900449 1 One Cycle cDNA Synthesis Kit Affymetrix P N 900431 1 Sample Cleanup Module Affymetrix P N 900371 1 Poly A RNA Control Kit Affymetrix P N 900433 1 Hybridization Control Kit Affymetrix P N 900454 Two Cycle Target Labeling m Two Cycle Target Labeling and Control Reagents Affymetrix P N 900494 A convenient package containing required labeling and control reagents to perform 30 two cycle labeling reactions Each of these components may be ordered individually described below as well as in this complete kit Contains n M 1 IVT Labeling Kit Affymetrix P N 900449 1 Two Cycle cDNA Synthesis Kit Affymetrix P N 900432 2 Sample Cleanup Modules Affymetrix P N 900
85. ech Epicentre Technologies www epicentre com Eppendorf www eppendorf com Invitrogen Life Technologies www invitrogen com Millipore Corp www millipore com Molecular Probes www probes com New England Biolabs www neb com Novagen www emdbiosciences com Pierce Chemical www piercenet com Promega Corporation www promega com Proligo www gensetoligos com QIAGEN www qiagen com Rainin www rainin com Roche Diagnostics www roche applied science com Sigma Aldrich www sigma aldrich com USA Scientific www usascientific com Vector Laboratories www vectorlabs com VWR Scientific Products WWW VWrsp com AFFYMETRIX a 5 A 5 Appendices SECTION 5 Appendices Reagents and Materials Quick List for Hybridization and Staining Volume per Rxn Reagent Vendor P N Volume in Kit Rxns per Kit Hybridization Cocktail Following quantities are for 49 Format Standard Arrays see Table 2 2 1 for details on other array formats GeneChip Eukaryotic Affymetrix 900454 or a 30 Hybridization Control Kit 900457 150 Herring Sperm DNA Promega D1811 3 HL 1 mL 333 BSA Invitrogen 15561 020 3 uL 3 mL 3 X 1 1 000 2x Hybridization Buffer 150 uL 50 mL 333 Mol Bio or DEPC Water a us E DMSO 100 Sigma Aldrich D5879 Stain Reagents Following quantities are for the Antibody Amplificati
86. echnologies P N EC62252 m Sucrose Gel Loading Dye 5X Amresco P N E 274 m 10X TBE Running Buffer m SYBR Gold Molecular Probes P N S 11494 10 bp and 100 bp DNA ladder Invitrogen Life Technologies P N 10821 015 and 15628 019 respectively m immunoPure NeutrAvidin Pierce Chemical P N 31000 m 1M Tris pH 70 Ambion P N 9850G m PBS pH 72 Invitrogen Life Technologies P N 20012 027 AFFYMETRIX AM 3 1 5 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation 75 ng uL Random Primers For 1000 uL 25 uL of 3 ug uL Random Primers 975 uL of Nuclease free H O Store at 20 C in a non frost free freezer 2 mg mL NeutrAvidin Resuspend 10 mg NeutrAvidin in 5 mL PBS solution Store at 4 C CHAPTER 1 Prokaryotic Target Preparation Total RNA Isolation AFFYMETRIX al As starting material for the cDNA synthesis procedure total RNA can be isolated by using standard procedures for bacterial RNA isolation or various commercial RNA isolation kits For Pseudomonas aeruginosa and E coli we have successfully used the QIAGEN RNeasy Mini Purification Kit Caution should be used to minimize chromosomal DNA contamination during the isolation due to the high sensitivity of the assay It is suggested that no more than 1 X 10 cells are applied to a single purification column Also use the lysozyme at a concentration of 1 mg mL and not the recommended 400 ug mL Additional DNase I
87. ed as desired change the name of the edited protocol in the Protocol Name box AUT If the protocol is saved without entering a new Protocol Name the original protocol parameters will be overwritten 6 Click Save then close the dialog box Enter 0 zero for hybridization time if hybridization step is not required Likewise enter 0 zero for the stain time if staining is not required Enter 0 zero for the number of wash cycles if a wash step is not required Section 4 Fluidics Station Maintenance Procedures 701040 Rev 2 w eig Contents Section 4 Chapter 1 Fluidics Station Maintenance Procedures 4 1 3 m E 0 Ls 701040 Rev 2 SECTION 4 Fluidics Station Maintenance Procedures o 3 5 5 7 701041 Rev 4 Section 4 E Fluidics Station Maintenance Procedures Reagents and Materials Required 4 1 5 Weekly Fluidics Station Cleanout 4 1 7 Bl achProt cols tp ses Cais card deed ge a a ec e dod 4 1 7 Monthly Fluidics Station Decontamination Protocol 4 1 13 This Section Contains m A weekly fluidics station bleach protocol m A monthly fluidics station decontamination protocol m E u LE 701041 Rev 4 SECTION 4 Fluidics Station Maintenance Procedures CHAPTER 1 Fluidic
88. eling Various QC protocols described in the Expression Analysis Technical Manual can be employed at different stopping points of the assay For example gel electrophoresis after cDNA synthesis if using poly A mRNA as starting material after cRNA synthesis and after fragmentation is helpful in estimating quantity and size 5 B 3 a 2 T o 2 2 lt 5 B 4 SECTION 5 Appendices distribution Spectrophotometric measurements are also important after CRNA synthesis Low cRNA yield can be a sensitive indicator of problematic labeling procedures and or starting material You may also want to experiment with using real time PCR analysis on housekeeping genes after each of these reactions to monitor the efficiency of each step 3 GeneChip array image and basic data analysis Routine QC parameters to monitor include visual array inspection B2 signal intensity of poly A RNA and Hybridization controls background scaling factor noise 3 5 GAPDH and B Actin ratios and Present calls Reference the GeneChip Expression Analysis Data Analysis Fundamentals P N 701190 for more detailed information Can I hybridize samples to an array from a species other than the organism for which the array was designed Affymetrix has not validated the use of GeneChip expression arrays with alternate species Although there may be high homology between different species the sequence differences may be sufficient to interfere with hybridi
89. ent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 12 is for a single reaction Table 2 1 12 Preparation of First Cycle Second Strand Master Mix Component Volume RNase free Water 4 8 uL Freshly diluted MgClo 175 mM 4 0 uL dNTP 10 mM 0 4 uL E coli DNA Polymerase I 0 6 uL RNase H 0 2 uL Total Volume 10 0 uL Make a fresh dilution of the MgCl each time Mix 2 uL of MgClo 1M with 112 uL of RNase free Water b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube 2 Add 10 uL of the First Cycle Second Strand Master Mix to each sample from Step 2 First Cycle First Strand cDNA Synthesis reaction for a total volume of 20 uL Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 3 Incubate for 2 hours at 16 C then 10 minutes at 75 C and cool the sample at least 2 minutes at 4 C Turn the heated lid function off only for the 16 C incubation After the 2 minute incubation at 4 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube Proceed to Step 4 First Cycle IVT Amplification of cRNA on page 2 1 25 v Note No cDNA cleanup is required at this step 2 1 24 CHAPTER 1 Eukaryotic Target Preparation Ste
90. es that you have previously characterized using the One Cycle Standard Protocol This way you will be starting with materials of good quality and you already know what results to anticipate Follow common laboratory practices that minimize RNase contamination and use caution at each step to prevent sample loss APPENDIX B FAQs amp Troubleshooting AFFYMETRIX al Does this Two Cycle cDNA Synthesis Kit protocol work well on partially degraded RNA samples No Similar to previous recommendations for the standard protocol and SSTLvII the Two Cycle Target Labeling Assay also requires high quality total RNA as starting material Most commonly customers assess OD 469 299 ratios together with electrophoretic analysis results when sufficient material is available When sample quantity is limiting the combination of RiboGreen for quantitation and Bioanalyzer for quality assessment has worked quite well To better distinguish whether the starting material quality has affected the target labeling process it is recommended to use the GeneChip Eukaryotic Poly A RNA Control Kit and spike the positive controls into the starting materials for efficient troubleshooting How does your Two Cycle cDNA Synthesis Kit protocol perform compared with other commercially available alternative target labeling kits GeneChip assays are an integrated part of the complete system solution and are the only reagent kits developed and fully validated on GeneChi
91. esult in reduction in signal intensity of 10 20 with each scan of the GeneArray Scanner and 3 5 with each scan of the GeneChip Scanner 3000 Therefore subsequent scans will not give signals equivalent to the initial scan How often do I need to do maintenance on the fluidics station With normal use e g 20 arrays module week we recommend the following schedule every week the needle bleaching protocol i e Bleach fluidics protocol should be performed on a monthly basis the full fluidics bleaching protocol i e Monthly Decontamination protocol should be performed and the peristaltic pump tubing replaced Please refer to Section 4 Fluidics Station Maintenance Procedures for more detail AFFYMETRIX AM 5 B 17 Appendices 5 B 18 SECTION 5 Appendices What fluidics script should I use The appropriate fluidics script is specific to the array format and the organism eukaryotic or prokaryotic the type of labeling reagents used to prepare the cRNA target and the model of Fluidics Station being used Scripts for FS 450 and FS 250 are identified by a 450 suffix Information on the array format and appropriate script is contained in the package insert that comes with each array package Please refer to the reference table available from the Affymetrix web site for the appropriate fluidics script to be used for your experiment www affymetrix com support technical fluidics_scripts affx Is there a possibil
92. f use m The GeneChip Sample Cleanup Module is used for all cDNA and cRNA cleanup steps replacing all previously recommended precipitation or speed vacuum protocols Overnight incubations are recommended for both IVT steps following the 19 and 2nd cycle cDNA synthesis reducing the total target labeling time to 2 days Can you compare the data from the Two Cycle Target Labeling Assay directly with the One Cycle Target Labeling Assay Although there is good agreement between the two protocols with respect to Present Absent calls the absolute Signal values of individual probe sets may still differ It is not recommended to perform direct comparisons of Signal data obtained using different protocols I have never performed any small sample target labeling before Do you have any suggestions for incorporating the Two Cycle cDNA Synthesis Kit into our routine GeneChip microarray analysis The basic principles of the Two Cycle Target Labeling Assay are very similar to the One Cycle Standard Protocol and many of the steps involved may look familiar However since it does require manipulation of very small amounts of materials in the 1 cycle even the most experienced GeneChip microarray users may not obtain ideal data when using the Two Cycle Target Labeling Assay the first time Therefore it is suggested that users first read the entire protocol very carefully including all notes and tips and then practice initially with diluted sampl
93. first pressing down the cartridge lever to the eject position 9 Liftup on the needle lever to disengage the needles from the microcentrifuge vials Remove the three microcentrifuge vials from the needle holders 10 Check the probe array window for large bubbles or air pockets m f bubbles are present refer to Table 3 3 8 m f the probe array has no large bubbles it is ready to scan on the GeneArray Scanner or the GeneChip Scanner 3000 Pull up on the cartridge lever to close the washblock and proceed to Probe Array Scan on page 3 3 17 3 3 14 CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning FS 400 AFFYMETRIX 11 If there are no more samples to hybridize shut down the fluidics station following the procedure in Shutting Down the Fluidics Station on page 3 3 19 12 Keep the probe arrays at 4 C and in the dark until ready for scanning 13 Lift up on the cartridge lever to close the washblock For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 3 3 8 If bubbles are present Return the probe array to the probe array holder Engage the washblock by gently pushing up on the cartridge lever to the engage position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished the LCD window will display EJECT CARTRIDG
94. fx The 49 and 64 format 18 um feature size arrays will continue to use the existing fluidics script EukGE WS2v4 The current fluidics script for the 100 format arrays Midi euk2 already uses the same degree of stringency and therefore remains unchanged for use with the IVT Labeling Kit What is the storage condition of the IVT Labeling Kit The kit should be stored at 20 C What end user license will be provided with the new Labeling Reagent Affymetrix will provide an end user license with the kit allowing customers freedom of operation for all research use applications Hybridization Washing and Staining What happens if the hybridization time is extended beyond 16 hours The standard gene expression hybridization time is 16 hours at 45 C At high temperatures or with longer incubation times the sample will evaporate Loss of sample is undesirable for several reasons m Low volume of hybridization solution in the probe array can lead to dry spots that will show up as uneven hybridization and thus compromise data m Sample loss compromises the possibility of repeating the experiment with the identical sample m Sample evaporation can lead to changes in the salt concentration of the solution which can affect the stringency conditions for hybridization How many times can I scan an array before the data is affected It is always best to capture the data on the initial scan Scanning bleaches the fluorophore and will r
95. he 28S to 18S bands Total RNA Isolation for Two Cycle Target Labeling Assay Several commercial kits and protocols are currently available for total RNA isolation from small samples tissues biopsies LCM samples etc Select the one that is suitable for processing of your samples and follow the vendor recommended procedures closely since high quality and high integrity starting material is essential for the success of the assay 2 1 12 CHAPTER 1 Eukaryotic Target Preparation One Cycle cDNA Synthesis Step 1 Preparation of Poly A RNA Controls for One Cycle cDNA Synthesis Spike in Controls Eukaryotic Poly A RNA Control Kit is used for this step Designed specifically to provide exogenous positive controls to monitor the entire eukaryotic target labeling process a set of poly A RNA controls is supplied in the GeneChip Eukaryotic Poly A RNA Control Kit Each eukaryotic GeneChip probe array contains probe sets for several B subtilis genes that are absent in eukaryotic samples ys phe thr and dap These poly A RNA controls are in vitro synthesized and the polyadenylated transcripts for the B subtilis genes are pre mixed at staggered concentrations The concentrated Poly A Control Stock can be diluted with the Poly A Control Dil Buffer and spiked directly into RNA samples to achieve the final concentrations referred to as a ratio of copy number summarized below in Table 2 1 1 Table 2 1 1 Final Concentrations
96. he cartridge lever is in the EJECT position When finished verify that the cartridge lever is returned to the ENGAGE position 6 Remove any microcentrifuge vials remaining in the sample holder of the fluidics station module s being used 7 When the LCD window indicates place the microcentrifuge vial containing 600 uL of streptavidin phycoerythrin SAPE stain solution into the sample holder Verify that the metal sampling needle is in the vial with its tip near the bottom 8 When the LCD window indicates replace the microcentrifuge vial containing the streptavidin phycoerythrin SAPE stain solution with a microcentrifuge vial containing antibody stain solution into the sample holder making sure that the metal sampling needle is in the vial with its tip near the bottom Eukaryotic 2 3 14 SECTION 2 Eukaryotic Sample and Array Processing When the LCD window indicates replace the microcentrifuge vial containing the antibody stain solution with a microcentrifuge vial containing 600 uL of streptavidin phycoerythrin SAPE stain solution into the sample holder Verify that the metal sampling needle is in the vial with its tip near the bottom The Fluidics Station dialog box and the LCD window display the status of the washing and staining as they progress When the wash is complete the LCD window displays the message EJECT CARTRIDGE 10 At the end of the run or at the appropriate prompt remove microcentrifuge vial conta
97. he fluidics station in distilled water Run the Prime protocol Fluidics Station 400 or the Prime 450 protocol Fluidics Station 450 250 with wash lines in distilled water instead of wash buffers A and B Run the Shutdown protocol Fluidics Station 400 or the Shutdown 450 protocol Fluidics Station 450 250 with wash lines in distilled water Run the Prime protocol Fluidics Station 400 or the Prime 450 protocol Fluidics Station 450 250 with wash lines in distilled water instead of wash buffers A and B Run the Shutdown protocol Fluidics Station 400 or the Shutdown 450 protocol Fluidics Station 450 250 with distilled water At the end of each step the fluidics station will indicate a ready status The fluidics station should not be used until this entire procedure steps 1 11 is complete 4 1 13 ES Maintenance SECTION 4 Fluidics Station Maintenance Procedures 4 1 14 Section 5 Appendices 701042 Rev 3 p ui Contents Section 5 Appendices Appendix A Supplier and Reagent Reference List 5 A 3 Appendix B FAQs amp Troubleshooting 5 B 3 Appendix C List of Controls on GeneChip Probe Arrays 5 C 3 o 2 T 2 2 701042 Rev 3 SECTION 5 Appendices 701043 Rev 4 L 2 T 2 2 Section 5 Append X 4 Supplier and Reagent Reference List Affymetrix Technical Support 5 A 4 Supplier Conta
98. he instructions detailed in the Setting Up an Experiment section of the appropriate GCOS or Microarray Suite User s Guide The fields of information required for registering experiments in Microarray Suite are m Experiment Name m Probe Array Type In GCOS three additional fields are required m Sample Name m Sample Type m Project Sample templates Experiment templates and array barcodes can also be employed in GCOS to standardize and simplify the registration process Please see the GCOS User s Guide for more information The Project Sample Name and Experiment Name fields establish a sample hierarchy that organizes GeneChip gene expression data in GCOS In terms of the organizational structure the Project is at the top of the hierarchy followed by Sample Name and then Experiment Name PROJECT V SAMPLE V EXPERIMENT CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning Step 3 Preparing the Fluidics Station AFFYMETRIX The Fluidics Station 400 or 450 250 is used to wash and stain the probe arrays It is operated using GCOS Microarray Suite Setting Up the Fluidics Station 1 Turn on the Fluidics Station using the switch on the lower left side of the machine Select Run Fluidics from the menu bar The Fluidics Station dialog box appears with a drop down list for selecting the experiment name for each of the fluidics station modules A second list is accesse
99. he nucleotide size distribution for 400 ng E Fa 30 f 1 25 pu e 1 5 20 e o S 15 2 ir 10 N Bu STRA c 54 69 14 19 84 4 59 HA j u 29 Time seconds Hi 14 Biotin labeled cRNA from Two Cycle cDNA Synthesis Kit Bioanalyzer electropherogram for labeled cRNA from Figure 2 1 6 HeLa total RNA using the Two Cycle Kit This electropherogram displays the nucleotide size distribution for 400 ng of labeled cRNA resulting from two rounds of amplification The average size is approximately 850 nt 2 1 38 CHAPTER 1 Eukaryotic Target Preparation Fragmenting the cRNA for Target Preparation Sample Cleanup Module is used for this step Fragmentation of cRNA target before hybridization onto GeneChip probe arrays has been shown to be critical in obtaining optimal assay sensitivity Affymetrix recommends that the cRNA used in the fragmentation procedure be sufficiently concentrated to maintain a small volume during the procedure This will minimize the amount of magnesium in the final hybridization cocktail Fragment an appropriate amount of cRNA for hybridization cocktail preparation and gel analysis refer to the Eukaryotic Target Hybridization chapter in Section 2 1 The Fragmentation Buffer has been optimized to break down full length cRNA to 35 to 200 base fragments by metal induced hydrolysis The following table shows suggested fragmentation reaction
100. her hectic since users typically performed the cRNA cleanup 30 minutes and fragmentation 1 hour after the IVT in order to hybridize their samples on the arrays overnight In order to make the workflow more flexible the new GeneChip IVT Labeling Kit provides a general guideline of using an overnight incubation However for customers who prefer the previous protocol they have the option to spike in additional T7 RNA Polymerase Ambion P N 2085 as described in the product insert to reduce the IVT reaction time to 4 5 hours Should I be concerned about getting shorter cRNA targets because of the overnight IVT incubation It has been shown using gel electrophoresis that the length of the cRNA products change only slightly with increasing IVT reaction time In addition array results generated after increasing the length of IVT incubation are highly concordant with shorter incubation times and show little or no detectable difference Does this IVT Labeling Kit work for both the One and Two Cycle Target Labeling protocols This kit has been tested to be compatible with both the One and Two Cycle Target Labeling protocols to be used in the last step of amplification and biotin labeling 5 B 15 Appendices 5 B 16 SECTION 5 Appendices What is the typical cRNA yield of the IVT Labeling Kit Using this IVT Labeling Kit over 30 ug of biotinylated cRNA is usually generated from high quality materials following the recommended
101. idics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate Fluidics Station User s Guide or Quick Reference Card P N 08 0093 for the FS 450 250 fluidics stations 4 Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is down or in the eject position When finished verify that the cartridge lever is returned to the up or engaged position 5 Remove any microcentrifuge vial s remaining in the sample holder of the fluidics station module s being used 6 If prompted to Load Vials 1 2 3 place the three experiment sample vials the microcentrifuge vials into the sample holders 1 2 and 3 on the fluidics station a Place one vial containing streptavidin solution in sample holder 1 b Place one vial containing the anti streptavidin biotinylated antibody solution in sample holder 2 c Place one vial containing the streptavidin phycoerythrin SAPE solution in sample holder 3 d Press down on the needle lever to snap needles into position and to start the run The run begins The Fluidics Station dialog box at the workstation terminal and the LCD window display the status of the washing and staining as the protocol progresses 7 When the protocol is complete the LCD window displays the message EJECT CARTRIDGE 8 Remove the probe arrays from the fluidics station modules by
102. iew of GeneChip Expression Analysis m Asummary of the procedures covered in the remainder of the manual 701023 Rev 4 1 1 3 SECTION 1 GeneChip Expression Analysis Overview Introduction and Objectives Welcome to the Affymetrix GeneChip Expression Analysis Technical Manual This manual is a technical guide for using GeneChip expression analysis probe arrays All protocols included in this manual have been used successfully by scientists at Affymetrix or have been recommended by our collaborators during the development of particular products The field of mRNA gene expression monitoring is rapidly evolving and periodic technical updates to this manual will reflect the newest protocols and information for using GeneChip probe arrays This manual applies to all GeneChip expression products As an Affymetrix GeneChip user your feedback is welcome Please contact our technical support team with any input on how we can improve this resource Explanation of GeneChip Probe Arrays GeneChip probe arrays are manufactured using technology that combines photolithography and combinatorial chemistry Up to 1 3 million different oligonucleotide probes are synthesized on each array Each oligonucleotide is located in a specific area on the array called a probe cell Each probe cell contains hundreds of thousands to millions of copies of a given oligonucleotide Probe arrays are manufactured in a series of cycles Initially a glass sub
103. igo dT Primer to each sample Make a fresh dilution of the T7 Oligo dT Primer final concentration 5 uM Mix 2 uL of T7 Oligo dT Primer 50 uM with 18 uL of RNase free Water Add 4 uL of diluted T7 Oligo dT Primer to the sample from Step 6 Second Cycle First Strand cDNA Synthesis substep 6 on page 2 1 29 for a final volume of 25 uL Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube Incubate for 6 minutes at 70 C Cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect sample at the bottom of the tube Cooling the samples at 4 C is required before proceeding to the next step Adding the Second Strand Master Mix directly to solutions that are at 70 C will compromise enzyme activity It is recommended to prepare the Second Cycle Second Strand Master Mix immediately before use In a separate tube assemble the Second Cycle Second Strand Master Mix Prepare sufficient Second Cycle Second Strand Master Mix for all of the samples When there are more than two samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 15 is for a single reaction CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX LJ al Table 2 1 15 Preparation of Second Cycle Second Strand Master Mix Compone
104. indow display the status of the washing and staining as they progress At the end of the run or at the appropriate prompt remove the microcentrifuge vials and replace with three empty microcentrifuge vials Remove the probe arrays from the fluidics station modules by first pressing down the cartridge lever to the eject position Check the probe array window for large bubbles or air pockets m f bubbles are present proceed to Table 2 3 6 m f the probe array has no large bubbles it is ready to scan on the GeneArray Scanner or the GeneChip Scanner 3000 Pull up on the cartridge lever to engage washblock and proceed to Probe Array Scan on page 2 3 15 If you do not scan the arrays right away keep the probe arrays at 4 C and in the dark until ready for scanning CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning VESTO S 400 AFFYMETRIX If there are no more samples to hybridize shut down the fluidics station following the procedure outlined in the section Shutting Down the Fluidics Station on page 2 3 17 For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 2 3 6 If Bubbles are Present Return the probe array to the probe array holder Engage the washblock by gently pushing up on the cartridge lever to the engaged or closed position The fluidics station will drain the probe array and then fi
105. ining solution from light Prepare a new batch of stain at least once a week 11 After the gel is complete break open cartridge and stain the gel in 1X SYBR Gold for 10 minutes 12 Place the gel on the UV light box and produce an image following standard procedure Be sure to use the appropriate filter for SYBR Gold 3 1 13 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing 3 1 14 a 5 gt ra X x a 701032 Rev 5 Section 3 E Prokaryotic Target Hybridization 701032 Rev 5 Reagents and Materials Required 3 2 5 Reagent Preparations i uoo cese aa i OA EET ERRORS E 3 2 6 Prokaryotic Target Hybridization 3 2 7 This Chapter Contains This chapter contains detailed steps for preparing the hybridization mix and instructions for hybridizing the target mix to the GeneChip P aeruginosa Genome Array and GeneChip E coli Antisense Genome Array The hybridized probe array is then ready for washing staining and scanning as detailed in Section 3 Chapter 3 3 2 3 I gt de E o he 0 SECTION 3 Prokaryotic Sample and Array Processing 3 2 4 CHAPTER 2 Prokaryotic Target Hybridization Reagents and Materials Required AFFYMETRIX al The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part
106. ining stain and replace with an empty microcentrifuge vial 11 Remove the probe arrays from the fluidics station modules by first moving the probe array holder lever to the EJECT position 12 Check the probe array window for large bubbles or air pockets m If bubbles are present proceed to Table 2 3 7 If the probe array has no large bubbles it is ready to scan on the GeneChip Scanner 3000 or GeneArray Scanner ENGAGE wash block and proceed to Probe Array Scan on page 2 3 15 If you do not scan the arrays right away keep the probe arrays at 4 C and in the dark until ready for scanning If there are no more samples to hybridize shut down the fluidics station following the procedure outlined in the section Shutting Down the Fluidics Station on page 2 3 17 For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 2 3 7 If Bubbles are Present Return the probe array to the probe array holder Latch the probe array holder by gently pushing it up until a light click is heard Engage the wash block by firmly pushing up on the cartridge lever to the ENGAGE position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished the LCD window displays EJECT CARTRIDGE again remove the probe array and inspect it again for bubbles If no bubbles are prese
107. iology Grade water Mix and adjust volume to 1 000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 um filter Do not autoclave Store at 2 0 to 8 C and shield from light Discard solution if yellow 2X Hybridization Buffer Final 1X concentration is 100 mM MES 1M Na 20 mM EDTA 0 0196 Tween 20 For 50 mL 8 3 mL of 12X MES Stock Buffer 17 7 mL of 5M NaCl 4 0 mL of 0 5M EDTA 0 1 mL of 1096 Tween 20 19 9 mL of water Store at 2 C to 8 C and shield from light CHAPTER 2 Eukaryotic Target Hybridization Eukaryotic Target Hybridization Please refer to the table below for the necessary amount of cRNA required for appropriate probe array format These recipes take into account that it is necessary to make extra hybridization cocktail due to a small loss of volume 10 20 uL during each hybridization 1 Mix the following for each target scaling up volumes for hybridization to multiple probe arrays IMPOR If using the GeneChip IVT Labeling Kit to prepare the target a final concentration of 10 DMSO needs to be added in the hybridization cocktail for optimal results Table 2 2 1 Hybridization Cocktail for Single Probe Array DOonef 49 Format Standard 100 Format 169 Format Mini Array Final P 64 Format Array Midi Array 400 Format Micro Array Concentration Fragmented cRNA 15 ug 10 ug 5 ug 0 05 ug uL Control Oligonucleotide B2 5 HL 3 3 uL 1 7 uL 50 pM
108. ion to the weekly cleaning described above The protocol requires approximately 2 hours to run This protocol ensures that all of the tubing associated with the station is kept thoroughly clean Keeping this tubing as clean as possible ensures that array images will be optimized and high quality results will be obtained 11 AFFYMETRIX al Prepare 2 liters of 0 525 sodium hypochlorite solution using distilled water Mix well Place all three wash lines of the fluidics station in 1 liter of 0 525 sodium hypochlorite solution Run the Prime protocol Fluidics Station 400 or the Prime_450 protocol Fluidics Station 450 250 on all four modules with wash lines in 0 525 sodium hypochlorite solution instead of wash buffers A and B Run the Shutdown protocol Fluidics Station 400 or the Shutdown 450 Fluidics Station 450 250 on all four modules with wash lines in 0 52596 sodium hypochlorite solution instead of distilled water Follow Bleach Protocol as described on page 4 1 7 with the following change in Step 3 place the three wash lines of the fluidics station in 1 liter of 0 525 sodium hypochlorite solution instead of distilled water Change intake tubing and peristaltic tubing if required as described in the Fluidics Station 400 User s Guide or the Fluidics Station 450 250 User s Guide Run the Bleach protocol Fluidics Station 400 or the Bleach 450 protocol Fluidics Station 450 250 with three wash lines of t
109. irst Strand cDNA Synthesis Components Reagents in Reaction Volum iio or abi 5 or Amount in Reaction 1 Primer Hybridization DEPC treated H5O variable for final reaction volume of 20 uL Incubate at 70 C for 10 minutes T7 Oligo dT Primer 50 uM 2 HL 100 pmol Quick spin and put on ice RNA variable 5 0 to 20 ug 5 0 to 20 ug 2 Temperature Adjustment 5X First Strand cDNA buffer 4 HL 1X Add to the above tube and mix well 0 1M DTT 2 HL 10 mM DTT Incubate at 42 C for 2 minutes 10 mM dNTP mix 1 HL 500 uM each 3 First Strand Synthesis SuperScript RT variable See Table 2 1 19 200U to 600U Add to the above tube and mix well 200 U uL Incubate at 42 C for 1 hour Total Volume 20 uL v Not The above incubations have been changed from the SuperScript protocols and are i done at 42 C 2 1 42 CHAPTER 1 Eukaryotic Target Preparation Step 2 Second Strand cDNA Synthesis AFFYMETRIX Co 1 Place First Strand reactions on ice Centrifuge briefly to bring down condensation on sides of tube 2 Addto the First Strand synthesis tube the reagents listed in the following Second Strand Final Reaction Composition Table Table 2 1 21 Table 2 1 21 Second Strand Final Reaction Composition Final Concentration or Component Volume Amount in Reaction DEPC treated water 91 uL 5X Second Strand Reaction Buffer 30 uL 1X 10 mM dNTP mix 3 HL 200 uM each 10 U uL E coli DNA Ligase 1 uL 10U
110. ity of contaminating the fluidics station with RNase when gene expression and genotyping applications are being performed on a shared station It is extremely important to change the vials each time a sample is removed or loaded onto a probe array This prevents cross contamination as well as sample loss RNase contamination is not an issue with gene expression applications due to the fact that the cRNA sample is fragmented prior to hybridization and is removed prior to array processing on the fluidics station I have a bubble in the array How do I get rid of it After the final wash on the fluidics station if the door is still open place the array in the probe array holder and close the door The fluidics module will automatically run a drain and fill protocol with buffer A If one cycle does not remove the bubble repeat the process and try again If this doesn t work or the door has already been closed manually drain the array and refill with buffer A What are the safe stopping points in the assay It is safe to stop work after each of the major steps in the sample preparation process second strand cDNA synthesis IVT fragmentation or after preparing the hybridization cocktail If possible work with extracted RNA samples immediately rather than freezing them Although it is common practice to use stored frozen RNA samples in the process eliminating freeze thaws will most likely yield higher quality cRNA APPENDIX B FAQs amp Trou
111. ity poly A mRNA 0 2 ug to 2 0 ug v Note When using the GeneChip Sample Cleanup Module for the cDNA and IVT cRNA cleanup steps there is a potential risk of overloading the columns if greater than the recommended amount of starting material is used Before starting cDNA synthesis the correct volumes of DEPC treated H 0 and Reverse Transcriptase RT must be determined These volumes will depend on both the concentration and total volume of mRNA that is being added to the reaction For every ug of mRNA you will need to add 1 uL of SuperScript II RT 200 U uL For mRNA quantity ug use 1 uL of SuperScript II RT Synthesis reactions should be done in a polypropylene tube RNase free gt IMPOR Use Table 2 1 22 for variable component calculations Determine volumes of mRNA i and SuperScript Il RT required and then calculate the amount of DEPC treated H O needed in the Primer Hybridization Mix step to bring the final First Strand Synthesis reaction volume to 20 uL 4 Users who do not purchase the GeneChip T7 Oligo dT Promoter Primer Kit may be required to obtain a license under U S Patent Nos 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit 2 1 44 CHAPTER 1 Eukaryotic Target Preparation Table 2 1 22 First Strand cDNA Synthesis Components 1 Primer Hybridization Reagents in Reaction DEPC treated H20 variable for final reaction volume of 20 uL Final Concentratio
112. ized below Table 2 1 7 Final Concentrations of Poly A RNA Controls in Samples Final Concentration Poly A RNA Spike ratio of copy number lys 1 100 000 phe 1 50 000 thr 1 25 000 dap 1 6 667 The controls are then amplified and labeled together with the samples Examining the hybridization intensities of these controls on GeneChip arrays helps to monitor the labeling process independently from the quality of the starting RNA samples Typical GeneChip array results from these poly A Spike in Controls are shown in Figure 2 1 4 v Note For Drosophila Genome Arrays P N 900335 and 900336 and Yeast Genome S98 Arrays P N 900256 and 900285 the 3 AFFX r2 Bs probe sets are not available Note that the data shown here may not be representative of those obtained using the previous generation AFFX Spike in transcript name X probe sets on the GeneChip arrays listed above 2 Users who do not purchase this Kit may be required to obtain a license under U S Patent Nos 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit AFFYMETRIX Co 2 1 19 Eukaryotic 2 1 20 SECTION 2 Eukaryotic Sample and Array Processing 6000 gt 4000 0 c g 2000 2 o 04 T t f t t t 1 50 000 1 16 667 1 10 000 1 7 142 1 25 000 1 12 500 1 8 333 1 6 250 Relative Ratio Figure 2 1 4 Poly A RNA spikes amplified using 10 ng of a complex human brain total RNA sample Labele
113. just volume to 1 000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 um filter gt IMPORT Do not autoclave store at 2 C to 8 C and shield from light Discard solution if yellow 2X Hybridization Buffer 50 mL Final 1X concentration is 100mM MES 1M Nat 20 mM EDTA 0 01 Tween 20 For 50 mL 8 3 mL of 12X MES Stock Buffer 17 7 mL of 5M NaCl 4 0 mL of 0 5M EDTA 0 1 mL of 10 Tween 20 19 9 mL of water Store at 2 C to 8 C and shield from light 3 2 6 CHAPTER 2 Prokaryotic Target Hybridization Prokaryotic Target Hybridization AFFYMETRIX After determining that the fragmented cDNA is labeled with biotin prepare the hybridization solution mix The minimum amount of cDNA product required for target hybridization is 1 ug The solution is stable for approximately 6 to 8 hours at 4 C The following protocol can be used for freshly prepared or frozen hybridization cocktail Re use of prokaryotic sample has not been thoroughly tested and therefore is not recommended 1 Prepare the following hybridization solution mix Table 3 2 1 Hybridization Cocktail for Single Probe Array Components 169 Format 100 Format 49 Format Final Mini Midi Standard Concentration 2X Hybridization Buffer 40 uL 65 uL 100 uL 1X 3 nM B2 Control Oligo 13 uL 2 2 HL 3 3 HL 50 pM 10 mg mL Herring Sperm DNA 0 8 uL 13 uL 2 0 HL 0 1 mg mL 50 mg mL BSA 0 8 uL 1 3 uL 2 0 uL 0 5 mg mL 100 DMSO
114. karyotic Target Preparation AFFYMETRIX al Transfer spin column into a new 1 5 mL Collection Tube supplied and pipet 13 uL of RNase free Water directly onto the spin column membrane Ensure that the water is dispensed directly onto the membrane Centrifuge 1 minute at maximum speed lt 25 000 x g to elute The average volume of eluate is 11 uL from 13 uL RNase free Water To determine cRNA yield for samples starting with 50 ng or higher remove 2 uL of the cRNA and add 78 uL of water to measure the absorbance at 260 nm Use 600 ng of cRNA in the following Step 6 Second Cycle First Strand cDNA Synthesis Reaction For starting material less than 50 ng or if the yield is less than 600 ng use the entire eluate for the Second Cycle First Strand cDNA Synthesis Reaction Samples can be stored at 20 C for later use or proceed to Step 6 Second Cycle First Strand cDNA Synthesis described next 2 1 27 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 6 Second Cycle First Strand cDNA Synthesis Two Cycle cDNA Synthesis Kit is used for this step v Not The following program can be used as a reference to perform the Second Cycle First Strand cDNA synthesis reaction in a thermal cycler the 4 C holds are for reagent addition steps 70 C 10 minutes 4 C hold 42 C 1 hour 4 C hold 37 C 20 minutes 95 C 5 minutes 4 0 hold 1 Mix cRNA and diluted random primers a Make a fresh dilutio
115. karyotic Target Preparation Reagents and Materials Required The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part numbers listed are based on U S catalog information For supplier information please refer to the Supplier Reference List in Appendix A of this manual Labeling m dNTP Invitrogen Life Technologies P N 18427 013 m Random Primers 3 ug uL Invitrogen Life Technologies P N 48190 011 m GeneChip Eukaryotic Poly A RNA Control Kit Affymetrix P N 900433 m SuperScript IIM Reverse Transcriptase Invitrogen Life Technologies P N 18064 071 m SUPERaseeln M Ambion P N 2696 m Nuclease free Water Ambion P N 9930 NaOH 1N solution VWR Scientific Products P N MK469360 m HCI 1N solution VWR Scientific Products P N MK638860 m MinElute PCR Purification Kit QIAGEN P N 28004 m 10X One PhorAll Buffer Amersham Biosciences P N 27 0901 02 m Deoxyribonuclease DNase 1 Amersham Biosciences P N 27 0514 01 GeneChip DNA Labeling Reagent Affymetrix P N 900542 m Terminal Deoxynucleotidyl Transferase Promega P N M1875 m EDTA 0 5M pH 8 0 Invitrogen Life Technologies P N 15575 020 m Non stick RNase free microfuge tubes 0 5 mL and 1 5 mL Ambion P N 12350 and P N 12450 respectively Gel Shift Assay m Novex XCell SureLock Mini Cell Invitrogen Life Technologies P N 1 m 4 20 TBE Gel 1 0 mm 12 well Invitrogen Life T
116. l RNA 50 of the cDNA reaction is added to the IVT giving a yield of 50 ug cRNA Therefore adjusted cRNA yield 50 ug cRNA 10 ug total RNA 0 5 cDNA reaction 45 0 ug Use adjusted yield in Fragmenting the cRNA for Target Preparation on page 2 1 39 Please refer to the Eukaryotic Target Hybridization chapter in Section 2 for the amount of cRNA required for one array hybridization experiment The amount varies depending on the array format Please refer to the specific probe array package insert for information on the array format Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 3 Checking Unfragmented Samples by Gel Electrophoresis Gel electrophoresis of the IVT product is done to estimate the yield and size distribution of labeled transcripts The following are examples of typical cRNA products examined on an Agilent 2100 Bioanalyzer 20 0 17 5 T 15 0 12 5 j D 2 10 0 A j 5 M 4 75 UN sy 5 0 UN Mm y 25 i Le U CRM M 0 0 Pr NIIT MENS er es ra n ara P e HA I 31 4 29 34 39 4t 49 se 59 64 69 14 719 Time seconds 24 Figure 2 1 5 of labeled cRNA resulting from one round of amplification The average size is approximately 1580 nt Biotin labeled cRNA from One Cycle cDNA Synthesis Kit Bioanalyzer electropherogram for labeled cRNA from HeLa total RNA using the One Cycle Kit This electropherogram displays t
117. ll it with a fresh volume of the last wash buffer used When it is finished the LCD window will display EJECT CARTRIDGE Again remove the probe array and inspect it for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 2 3 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash Buffer A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity If you are using the Fluidics Station 400 Washing and Staining the Probe Array 1 Inthe Fluidics Station dialog box on the workstation select the correct experiment name in the drop down Experiment list The probe array type will appear automatically 2 Inthe Protocol drop down list select the appropriate antibody amplification protocol to control the washing and staining of the probe array format being used Table 2 3 3 and Table 2 3 4 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions on the LCD window on the fluidics station 4 If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the Fluidics Station 400 User s Guide Fluidics Station 400 Video In Service CD P N 900374 or Quick Reference Card P N 08 0072 5 Insert the appropriate probe array into the designated module of the fluidics station while t
118. mmended to be stored at 2 8 C compared with previously recommended storage at room temperature Should I store the rest of the kit components i e the buffers at the lower temperature as well The buffers can be stored at either room temperature or 2 8 C However if the entire kit is kept at refrigerated temperatures the buffers should be warmed up to room temperature before use and all buffers should be checked to make sure that any possible precipitation in the buffer is completely dissolved What happens if the recommended storage condition is not followed The cDNA Cleanup Columns may age faster than the indicated expiration date The expired columns may lead to reduced yield and recovery of cDNA at the cleanup step Poly A RNA Control Kit AFFYMETRIX al What is this kit used for This kit contains exogenous spike in poly A transcripts designed specifically for GeneChip expression profiling as m internal positive controls for both the One and Two Cycle Target Labeling Assays m a convenient way to monitor the success of the entire labeling process independent from the starting material quality m an evaluation of the assay sensitivity dynamic range of amplification as well as data consistency What components are in each kit Four independent poly A RNA controls are provided conveniently in a pre mixed stock solution at staggered concentrations After spiking directly into eukaryotic RNA samples labele
119. n or Amount in Reaction Incubate at 70 C for 10 minutes T7 Oligo dT Primer 50 uM 2 HL 100 pmol Quick spin and put on ice mRNA variable 0 2 to 2 ug 0 2 to 2 ug 2 Temperature Adjustment 5X First Strand cDNA buffer 4 uL 1X Add to the above tube and mix well 0 1M DTT 2 uL 10 mM Incubate at 37 C for 2 minutes 10 mM dNTP mix 1 HL 500 uM each 3 First Strand Synthesis Add to the above tube and mix well Incubate at 37 C for 1 hour SuperScript Il RT variable 200 U uL 1 uL per ug mRNA 200U to 400U Total Volume Step 2 Second Strand cDNA Synthesis AFFYMETRIX 20 HL Place First Strand reactions on ice Centrifuge briefly to bring down condensation on Add to the First Strand synthesis tube the reagents listed in the following Second Strand Final Reaction Composition Table Table 2 1 23 1 sides of tube 2 Table 2 1 23 Second Strand Final Reaction Composition Final Concentration or Component Volume Amount in Reaction DEPC treated water 91 uL 5X Second Strand Reaction Buffer 30 uL 1X 10 mM dNTP mix 3 HL 200 uM each 10 U uL E coli DNA Ligase 1 uL 10U 10 U uL E coli DNA Polymerase 4 uL 40U 2 U uL E coli RNase H 1 HL 2U Final Volume 150 uL 9p ow R Gently tap tube to mix Then briefly spin in a microcentrifuge to remove condensation and incubate at 16 C for 2 hours in a cooling waterbath Add 2 uL 10 U T4 DNA Polymerase Return to 16 C for 5 minute
120. n Genome U133A 2 0 Array Signal intensities of the 3 AFFX r2 Bs probe set of the control transcripts were obtained using GeneChip Operating Software version 1 1 1 and the average values from the triplicate experiments were plotted The Poly A RNA Control Stock and Poly A Control Dil Buffer are provided with the kit to prepare the appropriate serial dilutions based on Table 2 1 2 This is a guideline when 1 5 or 10 ug of total RNA or 0 2 ug of mRNA is used as starting material For starting sample amounts other than those listed here calculations are needed in order to perform the appropriate dilutions to arrive at the same proportionate final concentration of the spike in controls in the samples Use non stick RNase free microfuge tubes to prepare all of the dilutions Table 2 1 2 Serial Dilutions of Poly A RNA Control Stock Starting Amount Serial Dilutions Spike in Volume Total RNA mRNA First Second Third 1 ug 1 20 1 50 1 50 2 HL 5 ug 1 20 1 50 1 10 2yL 10 ug 0 2 ug 1 20 1 50 1 5 2 HL Avoid pipetting solutions less than 2 uL in volume to maintain precision and consistency when preparing the dilutions For example to prepare the poly A RNA dilutions for 5 ug of total RNA 1 Add 2 uL of the Poly A Control Stock to 38 uL of Poly A Control Dil Buffer for the First Dilution 1 20 2 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 3 Add 2 uL of the First Dilution to 98 uL of Poly A
121. n of the Random Primers final concentration 0 2 ug uL Mix 2 uL of Random Primers 3 ug uL with 28 uL RNase free Water b Add 2 uL of diluted random primers to purified cRNA from Step 5 First Cycle Cleanup of cRNA substep 9 on page 2 1 27 and add RNase free Water for a final volume of 11 uL c Incubate for 10 minutes at 70 C d Cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect the sample at the bottom of the tube 2 Ina separate tube assemble the Second Cycle First Strand Master Mix a Prepare sufficient Second Cycle First Strand Master Mix for all of the samples When there are more than two samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 14 is for a single reaction Table 2 1 14 Preparation of Second Cycle First Strand Master Mix Component Volume 5X 1 Strand Reaction Mix 4 HL DTT 0 1M 2 HL RNase Inhibitor 1 HL dNTP 10 mM 1 uL SuperScript Il 1 uL Total Volume 9 uL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube 2 1 28 CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX al Transfer 9 uL of Second Cycle First Strand Master Mix to each cRNA random primer sample from Step 6 Second Cycle First Strand cDNA Synthesis on page 2 1
122. n the fluidics protocols need to be modified Modification of protocols must be done before downloading the protocol to the fluidics station Protocol changes will not affect runs in progress For more specific instructions refer to the Microarray Suite GCOS online help 1 Select Tools Edit Protocol from the menu bar 2 Inthe Edit Protocol dialog box under Protocol Name click the arrow to open a list of protocols Click the protocol to be changed gt The name of the protocol is displayed in the Protocol Name text box The conditions for that protocol are displayed on the right side of the Edit Protocol dialog box 3 Select the items to be changed and input the new parameters as needed keeping parameters within the ranges shown below in Table 3 3 10 Table 3 3 10 Valid Ranges for Wash Stain Parameters Wash Temperature for A1 B A2 or A3 C 15 to 50 Number of Wash Cycles for A1 B A2 or A3 0 to 99 Mixes Wash Cycle for A1 B A2 or A3 1 to 99 Stain Time seconds 0 to 86 399 Stain Temperature C 15 to 50 Holding Temperature C 15 to 50 e Wash A1 corresponds to Post Hyb Wash 1 in Table 3 3 7 Wash B corresponds to Post Hyb Wash 2 in Table 3 3 7 Wash A2 corresponds to Post Stain Wash in Table 3 3 7 Wash A3 corresponds to Final Wash in Table 3 3 7 4 To return to the default values for the protocol selected click the Defaults button 5 Once all the protocol conditions are modifi
123. nce Procedures for further detail 2 3 17 Eukaryotic 2 3 18 SECTION 2 Eukaryotic Sample and Array Processing Customizing the Protocol There may be times when the fluidics protocols need to be modified Modification of protocols must be done before downloading the protocol to the fluidics station Protocol changes will not affect runs in progress For more specific instructions refer to the Microarray Suite GCOS online help 1 Select Tools Edit Protocol from the menu bar The Edit Protocol dialog box appears 2 Select the protocol to be changed from the Protocol Name drop down list The name of the protocol is displayed in the Protocol Name box The conditions for that protocol are displayed on the right side of the Edit Protocol dialog box 3 Select the items to be changed and input the new parameters as needed keeping the parameters within the ranges shown below in Table 2 3 8 Table 2 3 8 Valid Ranges for Wash Stain Parameters Parameter Valid Range Wash Temperature for A1 B A2 or A3 C 5 to 50 Number of Wash Cycles for A1 B A2 or A3 0 to 99 Mixes Wash cycle for A1 B A2 or A3 to 99 Stain Time seconds 0 to 86399 Stain Temperature C 5 to 50 Holding Temperature C 5 to 50 Wash A1 corresponds to Post Hyb wash 1 in Table 2 3 5 Wash B corresponds to Post Hyb wash 2 in Table 2 3 5 Wash A2 corresponds to Post Stain Wash in Table 2 3 5 Wash A3 corresponds
124. nd Scanning to prepare reagents required immediately after completion of hybridization 3 2 7 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing 3 2 8 a 5 gt ra X x a 701033 Rev 5 Section 3 E Prokaryotic Arrays Washing Staining and Scanning Reagents and Materials Required 3 3 5 Reagent Preparation 3 3 6 Experiment and Fluidics Station Setup 3 3 8 Step 1 Defining File Locations 3 3 8 Step 2 Entering Experiment Information 3 3 8 Step 3 Preparing the Fluidics Station 3 3 9 Probe Array Wash and Stain 3 3 10 Probe Array Scan wc ages Rh GR ROUES GR Rd osx mg ES 3 3 17 Handling the GeneChip Probe Array 3 3 17 Scanning the Probe Array 3 3 18 Shutting Down the Fluidics Station 3 3 19 Customizing the Protocol 3 3 20 o E o gt a o x a This Chapter Contains m Instructions for using the Fluidics Station 400 or 450 250 to automate the washing and staining of GeneChip P aeruginosa and GeneChip E coli Antisense Genome Arrays m Instructions for scanning probe arrays using the GeneArray Scanner or the GeneChip Scanner 3000
125. ner 3000 After completing the procedures described in this chapter the scanned probe array image dat file is ready for analysis as explained in the enclosed GeneChip Expression Analysis Data Analysis Fundamentals booklet P N 701190 701028 Rev 5 2 3 3 SECTION 2 Eukaryotic Sample and Array Processing 2 3 4 CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Reagents and Materials Required AFFYMETRIX al The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part numbers listed are based on U S catalog information For supplier information please refer to the Supplier Reference List in Appendix A of this manual m Vater Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 m Distilled water Invitrogen Life Technologies P N 15230 147 Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 m R Phycoerythrin Streptavidin Molecular Probes P N S 866 m 5M NaCl RNase free DNase free Ambion P N 9760G m PBS pH 72 Invitrogen Life Technologies P N 20012 027 20X SSPE 3M NaCl 0 2M NaH PO 0 02M EDTA BioWhittaker Molecular Applications Cambrex P N 51214 m Goat IgG Reagent Grade Sigma Aldrich P N 5256 m Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 m Surfact Amps 20 Tween 20 1096 Pierce Chemical
126. ng to the hybridization step CHAPTER 1 Prokaryotic Target Preparation AFFYMETRIX al 1 2345 6 Lane 1 10 bp Ladder Lane 2 amp 4 Fragmented and labeled CDNA from P aeruginosa Lane 3 amp 5 Fragmented and labeled CDNA from P aeruginosa with avidin Lane 6 100 bp Ladder Figure 3 1 2 Gel shift for monitoring P aeruginosa target labeling efficiency Notice that the majority of the avidin conjugated product in both lanes 3 and 5 is highlighted as a bright band towards the top of the gel Prepare a NeutrAvidin solution of 2 mg mL in PBS Place a 4 to 20 TBE gel into the gel holder and load system with 1X TBE Buffer For each sample to be tested remove two 150 to 200 ng aliquots of fragmented and biotinylated sample to fresh tubes Add 5 pL of 2 mg mL NeutrAvidin to one of the two tubes for each sample tested Mix and incubate at room temperature for 5 minutes Add loading dye to all samples to a final concentration of 1X loading dye Prepare 10 bp and 100 bp DNA ladders 1 uL ladder 7 uL water 2 uL loading dye for each lane Carefully load samples and two ladders on gel Each well can hold a maximum of 20 uL Run the gel at 150 volts until the front dye red almost reaches the bottom The electrophoresis takes approximately 1 hour 10 While the gel is running prepare at least 100 mL of a 1X solution of SYBR Gold for staining SYBR Gold is light sensitive Therefore use caution and shield the sta
127. nt it is ready to scan Proceed to Probe Array Scan on page 2 3 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash Buffer A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Probe Array Scan The scanner is also controlled by Affymetrix Microarray Suite or GCOS The probe array is scanned after the wash protocols are complete Make sure the laser is warmed up prior to scanning by turning it on at least 15 minutes before use if you are using the Agilent GeneArray Scanner or 10 minutes if you are using the Affymetrix GeneChip Scanner 3000 If probe array was stored at 4 C warm to room temperature before scanning Refer to the Microarray Suite or GCOS online help and the appropriate scanner user s manual for more information on scanning The scanner uses a laser and is equipped with a safety interlock system Defeating the interlock system may result in exposure to hazardous laser light You must have read and be familiar with the operation of the scanner before attempting to scan a probe array Please refer to the Microarray Suite User s Guide P N 08 0081 or to the GeneChip Scanner 3000 quick reference card P N 08 0075 Handling the GeneChip Probe Array EX AFFYMETRIX Before you scan the probe array follow the direc
128. nt Volume RNase free Water 88 uL 5X 2nd Strand Reaction Mix 30 uL dNTP 10 mM 3 HL E coli DNA Polymerase 4 uL Total Volume 125 uL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the master mix at the bottom of the tube 3 Add 125 uL of the Second Cycle Second Strand Master Mix to each sample from Step 7 Second Cycle Second Strand cDNA Synthesis substep 1 for a total volume of 150 uL Gently flick the tube a few times to mix then centrifuge briefly 5 seconds to collect the reaction at the bottom of tube 4 Incubate for 2 hours at 16 C 5 Add 2 uL of T4 DNA Polymerase to the samples for a final volume of 152 uL Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 6 Incubate for 10 minutes at 16 C then cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect sample at the bottom of the tube After the incubation at 4 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube Proceed to Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 Alternatively immediately freeze the sample at 20 C for later use Do not leave the reaction at 4 C for long periods of time 2 1 31 Eukaryotic 2 1 32 SECTION 2 Eukaryotic Sample and Array Processing Cleanup of D
129. nt Volume T7 Oligo dT Primer 50 uM 2 HL Diluted Poly A RNA controls See Table 2 1 8 2 HL RNase free Water 16 uL Total Volume 20 uL 2 1 21 Eukaryotic 2 1 22 SECTION 2 Eukaryotic Sample and Array Processing Step 2 First Cycle First Strand cDNA Synthesis Two Cycle cDNA Synthesis Kit is used for this step 1 Briefly spin down all tubes in the Kit before using the reagents 2 Perform all of the incubations in thermal cyclers The following program can be used as a reference to perform the First Cycle First Strand cDNA synthesis reaction in a thermal cycler the 4 C holds are for reagent addition steps 70 C 6 minutes 4 C hold 42 C 1 hour 70 C 10 minutes 4 C hold 1 Mix total RNA sample and the T7 Oligo dT Primer Poly A Controls Mix Table 2 1 10 Preparation of Total RNA Sample T7 Oligo dT Primer Poly A Controls Mix Component Volume Total RNA sample variable 10 100 ng T7 Oligo dT Primer Poly A Controls Mix 2 HL RNase free Water variable Total Volume 5 pL a Place total RNA sample 10 to 100 ng in a 0 2 mL PCR tube b Add2 uL of the T7 Oligo dT Primer Poly A Controls Mix See Step 1 Preparation of Poly A RNA Controls for Two Cycle cDNA Synthesis Spike in Controls on page 2 1 19 e Add RNase free Water to a final volume of 5 uL d Gently flick the tube a few times to mix then centrifuge the tubes briefly 5 seconds to collect the solution at the bottom of the tube
130. ntensities results are reported in tabular and graphical formats Information on data analysis is provided in the enclosed GeneChip Expression Analysis Data Analysis Fundamentals booklet P N 701190 WARN 1 FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES 2 Avoid microbial contamination which may cause erroneous results All biological specimens and materials with which they come into contact should be handled as if capable of transmitting infection and disposed of with proper precautions in accordance with federal state and local regulations This includes adherence to the OSHA Bloodborne Pathogens Standard 29 CFR 1910 1030 for blood derived and other samples governed by this act Never pipet by mouth Avoid specimen contact with skin and mucous membranes 3 Exercise standard precautions when obtaining handling and disposing of potentially carcinogenic reagents 4 Exercise care to avoid cross contamination of samples during all steps of this procedure as this may lead to erroneous results 5 Use powder free gloves whenever possible to minimize introduction of powder particles into sample or probe array cartridges CHAPTER 1 GeneChip Expression Analysis Overview Terminology Probes The oligonucleotides on the surface of the probe arrays are called probes because they probe or interrogate the sample Target The target is the labeled nucleic acid that is being interrogated It is hybridi
131. ntrol for the IVT components in the kit 3 Carefully mix the reagents and collect the mixture at the bottom of the tube by brief 5 seconds microcentrifugation 4 Incubate at 37 C for 16 hours To prevent condensation that may result from water bath style incubators incubations are best performed in oven incubators for even temperature distribution or in a thermal cycler Overnight IVT reaction time has been shown to maximize the labeled cRNA yield with high quality array results Alternatively if a shorter incubation time 4 hours is desired 1 uL 200 units of cloned T7 RNA polymerase can be purchased directly from Ambion P N 2085 can be added to each reaction and has been shown to produce adequate labeled cRNA yield within 4 hours The two different incubation protocols generate comparable array results and users are encouraged to choose the procedure that best fits their experimental schedule and process flow 5 Store labeled cRNA at 20 C or 70 C if not purifying immediately Alternatively proceed to Cleanup and Quantification of Biotin Labeled cRNA on page 2 1 36 2 1 35 Eukaryotic 2 1 36 SECTION 2 Eukaryotic Sample and Array Processing Cleanup and Quantification of Biotin Labeled cRNA Sample Cleanup Module is used for cleaning up the biotin labeled cRNA Reagents to be Supplied by User m Ethanol 96 100 v v m Ethanol 8096 v v All other components needed for cleanup of biotin labeled cRNA ar
132. o as Present over 70 of the time Which RNA isolation method do you recommend for the Two Cycle Target Labeling Assay Different tissue types may have different requirements for RNA extraction Several commercial kits and protocols are currently available for total RNA isolation from small samples tissues biopsies LCM samples etc Select the one that is most suitable for the processing of your samples and follow the vendor recommended procedures closely Assess the quality and integrity of obtained total RNA samples carefully by gel electrophoresis or Bioanalyzer before starting the GeneChip target labeling protocol 5 B 13 Appendices 5 B 14 SECTION 5 Appendices If I have only between 100 ng and 1 ug of total RNA which protocol would you recommend the One Cycle or the Two Cycle Target Labeling Assay Since it is recommended to choose one protocol consistently for all samples to be compared within the same study the procedure you choose may depend on the amount of RNA obtained from the majority of the samples you plan on including in the entire study If most of the samples fall into the 100 ng to 1 ug range it is reasonable to use the Two Cycle Target Labeling Assay for the whole set of experiments How do I know if my 1 cycle cDNA synthesis reaction has worked well It is challenging to assess the success of the cDNA synthesis reaction and this applies to both the One Cycle and Two Cycle protocols This is because the
133. o see above for low cRNA yield AFFYMETRIX a 5 B 23 Appendices 5 B 24 SECTION 5 Appendices Problem Likely Cause Image Array Quality continued Solution Leaking septa Leaking septa are most often created during the array filling with a pipette Be sure to use pipette tips without a beveled end When filling the arrays be careful to push the pipette tip straight through the septum and maintain a constant perpendicular angle during filling and draining of the array MAS Software Problems In Microarray Suite MAS received the error message Could not find the cif file The default path for the library files in MAS is incorrect Set the correct path for the library files The library files for those specific arrays are not installed on the computer Install the library files for that array making sure to check the box appropriate for that array during the installation process The probe array type is missing from the pull down menu when creating an exp file The default path for the library files in MAS is incorrect Set the correct path for the library files The library files for those specific arrays are not installed on the computer Install the library files for that array making sure to check the box appropriate for that array during the installation process The fluidics protocols are missing from the pull down menu in the Fluidics c
134. on Staining Protocol 2x Stain Buffer 900 uL 250 mL 277 DI water ca ux 806 4 uL a x BSA Invitrogen 15561 020 72 uL 3 mL 3 X 1 41 Streptavidin Phycoerythrin Molecular S 866 12 uL 1mL 83 SAPE Probes Goat IgG Sigma Aldrich 15256 6 uL 1 mL 166 Biotinylated Antibody Vector Labs BA 0500 3 6 uL 1mL 277 1 The GeneChip Eukaryotic Hybridization Control Kit contains 20x Eukaryotic Hybridization Controls and Oligo B2 2 Total Bovine Serum Albumin BSA used for hybridization and stain reagents is 75 uL Each order of BSA contains 3 mL so each order is sufficient for 40 samples 3 See page 2 2 6 for 50 mL preparation 4 See page 2 3 6 for 250 mL preparation 5 A 6 701044 Rev 4 L 2 T 2 2 Section 5 Appendix FAQs amp Troubleshooting FAQs This section contains frequently asked questions related to GeneChip expression analysis Sample Preparation 701044 Rev 4 What is the minimum amount of total RNA I can use for each microarray experiment Two protocols have been developed that are optimized for different amounts of starting materials For 1 to 15 ug of total RNA or 0 2 to 2 ug of poly A RNA the One Cycle Target Labeling Assay is recommended For smaller amounts of total RNA from 10 ng to 100 ng follow the Two Cycle Target Labeling Assay Detailed procedures are described in the Expression Analysis Technical Manual Follow the instruction
135. ons in Section 1 The quality of the RNA is essential to the overall success of the analysis Since the most appropriate protocol for the isolation of RNA can be source dependent we recommend using a protocol that has been established for the tissues or cells being used In the absence of an established protocol using one of the commercially available kits designed for RNA isolation is suggested When using a commercial kit follow the manufacturer s instructions for RNA isolation Isolation of RNA from Yeast Total RNA Good quality total RNA has been isolated successfully from yeast cells using a hot phenol protocol described by Schmitt et al Nucl Acids Res 18 3091 3092 1990 Poly A mRNA Affymetrix recommends first purifying total RNA from yeast cells before isolating poly A mRNA from total RNA Good quality mRNA has been successfully isolated from total RNA using QIAGEN s Oligotex mRNA Kit A single round of poly A mRNA selection provides mRNA of sufficient purity and yield to use as a template for cDNA synthesis Two rounds of poly A mRNA selection will result in significantly reduced yield and are not generally recommended Isolation of RNA from Arabidopsis AFFYMETRIX al Total RNA TRIzol Reagent from Invitrogen Life Technologies has been used to isolate total RNA from Arabidopsis Follow the instructions provided by the supplier and when necessary use the steps outlined specifically for samples with high starch and
136. ontrol window The default path for the protocol files in MAS is incorrect Check that the location of the fluidics files on the hard drive corresponds to the default protocol path in MAS The library files are not installed on the computer Install the library files making sure the protocols are in the same directory as the default path set in MAS After putting the computer on the network the probe array descriptions are not available and a SOL error message appears When networking computers the name of the computer is often changed to correspond to an organization s standard conventions This results in a breakdown of the connection between MAS and the Microsoft Data Engine MSDE After the computer is renamed uninstall MAS and MSDE and reinstall MAS Microarray Suite is on the C drive and it s filling up The library and protocol files can be moved or dragged to another larger drive Remember to change the default path for the library and protocol files in MAS and modify this path for each log in name In addition GeneChip data should always be stored locally on the largest available drive on the workstation The gene descriptions show up for some users and not for others This is a result of different security settings between users and administrators of the workstation Call Affymetrix Technical Support for information on how to change the registry to correct this 701045 Rev
137. onucleotide mix in the second IVT reaction The labeled cRNA is then cleaned up fragmented and hybridized to GeneChip expression arrays Alternative One Cycle cDNA Synthesis protocols are also included at the end of this chapter for reference Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing GeneChip Eukaryotic Target Labeling Assays for Expression Analysis One Cycle Target Labeling Two Cycle Target Labeling for 1 15 ug total RNA or 0 2 2 ug mRNA for 10 100 ng total RNA Approximate gw Total RNA Sample ExperimentTime STTTTTTTTTTT AAAAA 3 PA Poly A RNA 4 A Poly A RNA Controls L QE Approximate Control addition Products x 5 Used Total RNA Sample ExperimentTime euis inia 4 T 15 hours dd SETTLE DETERS 9 AAAAA 3 TAM Poly A RNA x Poly A RNA Controls 300000000000 TTTTT 8 5 Two Cycle L Control addition 18 cycle 2nd strand 4 hours Synthesis x T7 Oligo dT Primer SONA TT ARA A 15 strand 3 TTTTT M5 15h TTTTTTTTTTT E cDNA synthesis eS 300000000000 TTTTT m5 TT 5TTTTTTTTTTTAAAAA 3 Un labeled 1 y owoo 0 7 ms meyde invito Overnight Synthesis ED SLLLLLLLLLLL UUUUU 5 ran cDNA synthesis y Cit 1 cycle Cleanup of Sample antisense RNA cRNA Go noue Cleanup STU TU U AAAAA mum 3 Uas sf ngugnnnnmnnngrrrrr mmms 2 4 cycle 1 strand Random 15h J Li cDNA synthesis x Primers SOUS 5 1 T T
138. or 15 seconds at gt 8 000 x g 10 000 rpm Discard flow through and Collection Tube 5 Transfer the spin column into a new 2 mL Collection Tube supplied Pipet 500 uL IVT cRNA Wash Buffer onto the spin column Centrifuge for 15 seconds at gt 8 000 x g 2 10 000 rpm to wash Discard flow through v Note IVT cRNA Wash Buffer is supplied as a concentrate Ensure that ethanol is added to i the IVT cRNA Wash Buffer before use see IMPORTANT note above before starting 6 Pipet 500 uL 80 v v ethanol onto the spin column and centrifuge for 15 seconds at 2 8 000 x g 2 10 000 rpm Discard flow through 7 Open the cap of the spin column and centrifuge for 5 minutes at maximum speed lt 25 000 x g Discard flow through and Collection Tube CHAPTER 1 Eukaryotic Target Preparation 10 Place columns into the centrifuge using every second bucket Position caps over the adjoining bucket so that they are oriented in the opposite direction to the rotation ie if the microcentrifuge rotates in a clockwise direction orient the caps in a counterclockwise direction This avoids damage of the caps Label the collection tubes with the sample name During centrifugation some column caps may break resulting in loss of sample information Centrifugation with open caps allows complete drying of the membrane Transfer spin column into a new 1 5 mL Collection Tube supplied and pipet 11 uL of RNase free Water directly onto the spin col
139. or high lipid content Poly A mRNA Arabidopsis poly A mRNA has been successfully isolated using QIAGEN s Oligotex products However other standard isolation products are likely to be adequate Eukaryotic 2 1 10 SECTION 2 Eukaryotic Sample and Array Processing Isolation of RNA from Mammalian Cells or Tissues PIT Total RNA High quality total RNA has been successfully isolated from mammalian cells such as cultured cells and lymphocytes using the RNeasy Mini Kit from QIAGEN If mammalian tissue is used as the source of RNA it is recommended to isolate total RNA with a commercial reagent such as TRIzol If going directly from TRlzol isolated total RNA to cDNA synthesis it may be beneficial to perform a second cleanup on the total RNA before starting After the ethanol precipitation step in the TRIzol extraction procedure perform a cleanup using the QIAGEN RNeasy Mini Kit Much better yields of labeled cRNA are obtained from the in vitro transcription labeling reaction when this second cleanup is performed Poly A mRNA Good quality mRNA has been successfully isolated from mammalian cells such as cultured cells and lymphocytes using QIAGEN s Oligotex Direct mRNA kit and from total RNA using the Oligotex mRNA kit If mammalian tissue is used as the source of mRNA total RNA should be first purified using a commercial reagent such as TRIzol and then using a poly A mRNA isolation procedure or a commercial kit Pre
140. or quality template Check starting material quality Loss in enzyme activity Repeat IVT Reaction assembled on ice Spermidine in the Repeat IVT 10X IVT Labeling Buffer can lead to precipitation of the template cDNA Reaction temperature is not set appropriately Repeat IVT Image Array Quality Low or absent Oligo B2 hybridization Addition of control Oligo B2 and hybridization washing or staining Make sure that the Control Oligo B2 has been added to the hybridization cocktail at the correct concentration Also check the makeup of the hybridization buffer the stain solution and hybridization temperature Dim Corners In need of fluidics maintenance Bleach the fluidics as recommended and change the peristaltic pump tubing If the problem persists call Affymetrix Technical Support Dim Arrays Hybridization problems Check the signal from control Oligo B2 to see if the signals are also weak If it appears to be a hybridization issue check all hybridization reagents and equipment settings before running another assay Test arrays can be useful for troubleshooting this issue Sample preparation problems Re check each of the quality control procedures recommended in the manual such as absorbance measurement and running an aliquot on gel to ensure that there is no significant loss of sample during target preparation due to manipulation of the sample or RNase contamination Als
141. ouble Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays EX pem Sample Cleanup Module is used for cleaning up the double stranded cDNA Reagents to be Supplied by User m Ethanol 96 100 v v All other components needed for cleanup of double stranded cDNA are supplied with the GeneChip Sample Cleanup Module BEFORE STARTING please note cDNA Wash Buffer is supplied as a concentrate Before using for the first time add 24 mL of ethanol 96 100 as indicated on the bottle to obtain a working solution and checkmark the box on the left hand side of the bottle label to avoid confusion m All steps of the protocol should be performed at room temperature During the procedure work without interruption f cDNA synthesis was performed in a reaction tube smaller than 1 5 mL transfer the reaction mixture into a 1 5 or 2 mL microfuge tube not supplied prior to addition of cDNA Binding Buffer Add 600 uL of cDNA Binding Buffer to the double stranded cDNA synthesis preparation Mix by vortexing for 3 seconds Check that the color of the mixture is yellow similar to cDNA Binding Buffer without the cDNA synthesis reaction If the color of the mixture is orange or violet add 10 uL of 3M sodium acetate pH 5 0 and mix The color of the mixture will turn to yellow Apply 500 uL of the sample to the cDNA Cleanup Spin Column sitting in a 2 mL Collection Tube supplied and centrifuge for 1 minute at
142. oving a probe array from the probe array holder the LCD window displays the message ENGAGE WASHBLOCK If you are using the FS 400 latch the probe array holder by gently pushing up until a light click is heard Engage the washblock by firmly pushing up on the cartridge lever to the ENGAGE position If you are using the FS 450 gently lift up the cartridge lever to engage or close the washblock The fluidics station automatically performs a Cleanout procedure The LCD window indicates the progress of the Cleanout procedure When the fluidics station LCD window indicates REMOVE VIALS the Cleanout procedure is complete Remove the sample microcentrifuge vial s from the sample holder s If no other hybridizations are to be performed place wash lines into a bottle filled with deionized water Choose Shutdown or Shutdown_450 for all modules from the drop down Protocol list in the Fluidics Station dialog box Click the Run button for all modules The Shutdown protocol is critical to instrument reliability Refer to the appropriate Fluidics Station User s Guide for more information After Shutdown protocol is complete flip the ON OFF switch of the fluidics station to the OFF position To maintain the cleanliness of the fluidics station and obtain the highest quality image and data possible a weekly bleach protocol and a monthly decontamination protocol are highly recommended Please refer to Section 4 Fluidics Station Maintena
143. p 4 First Cycle IVT Amplification of cRNA MEGAscript T7 Kit Ambion Inc is used for this step v Not a The following program can be used as a reference to perform the First cycle IVT Amplification of cRNA reaction in a thermal cycler 37 C 16 hours 4 C hold 1 In a separate tube assemble the First Cycle IVT Master Mix at room temperature a Prepare sufficient First Cycle IVT Master Mix for all of the samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 13 is for a single reaction Table 2 1 13 Preparation of First Cycle IVT Master Mix Component Volume 10X Reaction Buffer 5 HL ATP Solution 5 HL CTP Solution 5 HL UTP Solution 5 uL GTP Solution 5 HL Enzyme Mix 5 HL Total Volume 30 uL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube 2 Transfer 30 uL of First Cycle IVT Master Mix to each cDNA sample At room temperature add 30 uL of the First Cycle VT Master Mix to each 20 uL of cDNA sample from Step 3 First Cycle Second Strand cDNA Synthesis on page 2 1 24 for a final volume of 50 uL Gently flick the tube a few times to mix then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 3 Incubate for 16 hours at 37 C
144. p brand arrays With a thorough understanding of the performance characteristics of the GeneChip reagent kits on GeneChip arrays users should have more confidence in obtaining meaningful results Affymetrix has been very diligent in investigating alternative target labeling protocols to ensure that researchers have access to the most robust and standardized assays when running GeneChip arrays Affymetrix believes that the current set of GeneChip reagents are the most optimized solutions and can help customers extract the most reproducible and reliable data on GeneChip arrays Affymetrix will continue to research alternative procedures to evolve the assay for improved ease of use and more streamlined assays What is the detection sensitivity of the Two Cycle Target Labeling Assay One way to assess the assay sensitivity is to monitor the global array metric of percent Present calls From the same high quality starting material the Two Cycle Target Labeling Assay demonstrates highly comparable percent Present calls as the results generated from the One Cycle Target Labeling Assay Another way to estimate the detection sensitivity is to use poly A RNA spike in controls Following the recommended protocol included in the GeneChip Eukaryotic Poly A RNA Control Kit the Two Cycle cDNA Synthesis Kit generally amplifies the samples sufficiently to detect the 3 Probe Set of lys the transcript with the lowest concentration at 1 100 000 complexity rati
145. peed lt 25 000 x g to elute Ensure that the cDNA Elution Buffer is dispensed directly onto the membrane The average volume of eluate is 12 uL from 14 uL Elution Buffer We do not recommend RNase treatment of the cDNA prior to the in vitro transcription and labeling reaction the carry over ribosomal RNA does not seem to inhibit the reaction We do not recommend gel analysis or spectrophotometric quantitation for cDNA prepared from total RNA This is due to the presence of other nucleic acid species in the sample that can interfere with the results After cleanup please proceed to Synthesis of Biotin Labeled cRNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 34 2 1 33 Eukaryotic 2 1 34 SECTION 2 Eukaryotic Sample and Array Processing Synthesis of Biotin Labeled cRNA for Both the One Cycle and Two Cycle Target Labeling Assays GeneChip IVT Labeling Kit is used for this step This kit is only used for the IVT labeling step for generating biotin labeled cRNA For the IVT amplification step using unlabeled ribonucleotides in the First Cycle of the Two Cycle cDNA Synthesis Procedure a separate kit is recommended MEGAscript T7 Kit Ambion Inc Use only nuclease free water buffers and pipette tips Store all reagents in a 20 C freezer that is not self defrosting Prior to use centrifuge all reagents briefly to ensure that the solution is collected at the bottom of the tube The Target H
146. plicable to GCOS In order to reduce the number of experiments that appear in the GCOS file window use the Filters function in the Tools menu Please review the appropriate section of the GCOS User s Guide for details on applying filters APPENDIX B FAQs amp Troubleshooting Experimental Design Which is greater sample or assay variability Sample variability which arises mainly from biological heterogeneity is certainly higher than assay variability and has been estimated to be at least 10 fold greater We recommend that researchers run multiple samples per data point to account for sample to sample variability In addition carefully design the experiment in order to minimize potential variation associated with the samples Troubleshooting Problem Sample Quality Likely Cause Solution High 3 5 ratio Most often caused by degradation of the RNA during the isolation process Start with a fresh sample and minimize the possibility of RNase activity Look for the presence of Ribosomal RNA bands on a non denaturing agarose gel Low cRNA yield Low RNA quality which interferes with reverse transcription and subsequent labeling It sometimes helps to do a TRIzol based isolation followed by cleanup with an RNeasy column For samples with a high lipid content such as brain use procedures to reduce the lipid content prior to the reverse transcription reaction Target Labeling Low yield Po
147. prepare the poly A RNA dilutions for 10 ng of total RNA 1 Add 2 uL of the Poly A Control Stock to 38 uL of Poly A Control Dil Buffer to prepare the First Dilution 1 20 2 Mix thoroughly and spin down to collect the liquid at the bottom of the tube CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX a 3 Add 2 uL of the First Dilution to 98 uL of Poly A Control Dil Buffer to prepare the Second Dilution 1 50 4 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 5 Add 2 uL of the Second Dilution to 98 uL of Poly A Control Dil Buffer to prepare the Third Dilution 1 50 6 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 7 Add 2 uL of the Third Dilution to 18 uL of Poly A Control Dil Buffer to prepare the Fourth Dilution 1 10 8 Use the Fourth Dilution to prepare the solution described next The first dilution of the poly A RNA controls 1 20 can be stored in a non frost free freezer at 20 C up to six weeks and frozen thawed up to eight times Preparation of T7 Oligo dT Primer Poly A Controls Mix Prepare a fresh dilution of the T7 Oligo dT Primer from 50 uM to 5 uM The diluted poly A RNA controls should be added to the concentrated T7 Oligo dT Primer as follows using a non stick RNase free microfuge tube The following recipe is sufficient for 10 samples Table 2 1 9 Preparation of T7 Oligo dT Primer Poly A Controls Mix Compone
148. ptimized Sections 2 and 3 provide detailed protocols for target preparation hybridization array washing and staining for eukaryotic and prokaryotic arrays respectively Please refer to the sections in this manual for detailed protocols appropriate for your arrays Step 1 Target Preparation This manual describes procedures for preparing biotinylated target from purified eukaryotic and prokaryotic RNA samples suitable for hybridization to GeneChip expression probe arrays These procedures are recommendations only For more information on these procedures please contact Affymetrix Technical Support at 1 888 DNA CHIP 44 0 1628 552550 in Europe or 81 0 3 5730 8200 in Japan For eukaryotic samples using protocols in this manual Section 2 double stranded cDNA is synthesized from total RNA or purified poly A messenger RNA isolated from tissue or cells An in vitro transcription IVT reaction is then done to produce biotin labeled cRNA from the cDNA The cRNA is fragmented before hybridization For prokaryotic samples Section 3 describes a detailed protocol to isolate total RNA followed by reverse transcription with random hexamers to produce cDNA After fragmentation by DNase I the cDNA is end labeled with biotin by terminal transferase Step 2 Target Hybridization A hybridization cocktail is prepared including the fragmented target probe array controls BSA and herring sperm DNA It is then hybridized to the probe array during a
149. ragmented labeled cRNA from HeLa total RNA This electropherogram displays the nucleotide size distribution for 150 ng of fragmented labeled cRNA resulting from one round of amplification The average size is approximately 100 nt 2 1 40 CHAPTER 1 Eukaryotic Target Preparation Alternative Protocol for One Cycle cDNA Synthesis from Total RNA This protocol is a supplement to instructions provided in the Invitrogen Life Technologies SuperScript Choice system Please note the following before proceeding m Read all information and instructions that come with reagents and kits m Use the GeneChip T7 Oligo dT Promoter Primer Kit for priming first strand cDNA synthesis in place of the oligo dT or random primers provided with the SuperScript Choice kit The GeneChip T7 Oligo dT Promoter Primer Kit provides high quality HPLC purified T7 Oligo dT Primer which is essential for this reaction T7 Oligo dT Primer 5 GGCCAGTGA ATTGTA ATACGACTCACTATAGGGAGGCGG dT 3 Step 1 First Strand cDNA Synthesis IMPORT Starting material High quality total RNA 5 0 ug 20 0 ug When using the GeneChip Sample Cleanup Module for the cDNA and IVT cRNA cleanup steps there is a potential risk of overloading the columns if greater than the recommended amount of starting material is used After purification the RNA concentration is determined by absorbance at 260 nm on a spectrophotometer one absorbance unit 40 ug mL RNA The A 4
150. reparation cDNA Fragmentation AFFYMETRIX 1 Prepare the following reaction mix Table 3 1 4 Fragmentation Reaction Components Volume Concentration 10X One PhorAll Buffer 2 HL 1X cDNA 10 uL DNase see note below XuL 0 6 U ug of cDNA Nuclease free HO Up to 20 uL Total Volume 20 HL Use all remaining cDNA purified from the previous step in this reaction Do not proceed if the yield is lower than 1 5 ug Dilute DNase to 0 6 U uL in 1X One Phor All Buffer Prepare fresh dilution each time immediately before use It is anticipated that DNase enzyme activity may vary from lot to lot A titration assay is strongly recommended for each new lot of enzyme to determine the dosage of the DNase unit of DNase I per ug of cDNA to be used in the fragmentation reaction 0 6U for each ug of cDNA can be used as a starting point for the titration 2 Incubate the reaction at 37 C for 10 minutes 3 Inactivate DNase I at 98 C for 10 minutes 4 The fragmented cDNA is applied directly to the terminal labeling reaction Alternatively the material can be stored at 20 C for later use To examine the fragmentation result load 200 ng of the product on a 4 to 20 acrylamide gel and stain with SYBR Gold The majority of the fragmented cDNA should be in the 50 to 200 base pairs range 3 1 11 Prokaryotic 3 1 12 SECTION 3 Prokaryotic Sample and Array Processing Terminal Labeling Use GeneChip DNA
151. rocedure takes approximately 90 minutes to complete Preparing the Staining Reagents Prepare the following reagents Volumes given are sufficient for one probe array SAPE Stain Solution Streptavidin Phycoerythrin SAPE should be stored in the dark at 4 C either foil wrapped or kept in an amber tube Remove SAPE from the refrigerator and tap the tube to mix well before preparing stain solution Do not freeze SAPE Always prepare the SAPE stain solution fresh on the day of use Table 2 3 1 SAPE Solution Mix Components Volume Final Concentration 2X Stain Buffer 600 0 uL 1X 50 mg mL BSA 48 0 uL 2 mg mL 1 mg mL Streptavidin Phycoerythrin SAPE 12 0 uL 10 ug mL DI H20 540 0 uL Total Volume 1200 uL Mix well and divide into two aliquots of 600 uL each to be used for stains 1 and 3 Eukaryotic 2 3 10 SECTION 2 Eukaryotic Sample and Array Processing Antibody Solution Table 2 3 2 Antibody Solution Mix Components Volume Final Concentration 2X Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 10 mg mL Goat IgG Stock 6 0 uL 0 1 mg mL 0 5 mg mL biotinylated antibody 3 6 uL 3 ug mL DI H20 266 4 uL Total Volume 600 uL Table 2 3 3 Fluidics Scripts for 11 um Feature Size Eukaryotic Arrays Format Using GeneChip IVT Labeling Kit EukGE WS2v5 EukGE WS2v5 Midi euk2v3 Mini euk2v3 Micro 1v1 Using all other labeling kits EukGE WS2v4 EukGE WS2v4 Midi euk2v3 Mini euk2
152. rotocol for One Cycle cDNA Synthesis GeneChip T7 Oligo dT Promoter Primer Kit 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT 3 50 uM HPLC purified Affymetrix P N 900375 SuperScript Il Invitrogen Life Technologies P N 18064 014 or SuperScript Choice System for cDNA Synthesis Invitrogen Life Technologies P N 18090 019 SuperScript Choice System contains in addition to SuperScript Il Reverse Transcriptase other reagents for cDNA synthesis However not all components provided in the Choice System are used in the GeneChip cDNA synthesis protocol E coli DNA Ligase Invitrogen Life Technologies P N 18052 019 E coli DNA Polymerase Invitrogen Life Technologies P N 18010 025 E coli RNaseH Invitrogen Life Technologies P N 18021 071 T4 DNA Polymerase Invitrogen Life Technologies P N 18005 025 5X Second strand buffer Invitrogen Life Technologies P N 10812 014 10 mM dNTP Invitrogen Life Technologies P N 18427 013 0 5M EDTA CHAPTER 1 Eukaryotic Target Preparation Total RNA and mRNA Isolation for One Cycle Target Labeling Assay Protocols are provided for preparing labeled cRNA from either total RNA or purified poly A mRNA It was found that results obtained from samples prepared by both of these methods are similar but not identical Therefore to get the best results it is suggested to only compare samples prepared using the same type of RNA material Please review precautions and interfering conditi
153. s Add 10 uL 0 5M EDTA Proceed to cleanup procedure for cDNA Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 or store at 20 C for later use 2 1 45 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing 2 1 46 gt de Xx E wu 701027 Rev 5 Section 2 E Eukaryotic Target Hybridization 701027 Rev 5 Reagents and Materials Required 2 2 5 Reagent Pr paration x m pco pk e uq OU ETE ERES ETE 2 2 6 2 2 7 Eukaryotic Target Hybridization This Chapter Contains m Detailed steps for preparing the eukaryotic hybridization mix containing labeled target and control cRNA m Instructions for hybridizing the target mix to a eukaryotic GeneChip probe array After completing the procedures described in this chapter the hybridized probe array is ready for washing staining and scanning as detailed in Section 2 Chapter 3 2 2 3 E o gt re o Xx 5 ul SECTION 2 Eukaryotic Sample and Array Processing 2 2 4 CHAPTER 2 Eukaryotic Target Hybridization Reagents and Materials Required AFFYMETRIX al The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part numbers listed are based on U S catalog information For supplier information please
154. s Station Maintenance Procedures Reagents and Materials Required The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part numbers listed are based on U S catalog information For supplier information please refer to the Supplier Reference List in Appendix A of this manual m Bleach 5 2596 Sodium Hypochlorite VWR Scientific P N 37001 060 or equivalent m Tygon Tubing 0 04 inner diameter Cole Parmer P N H 06418 04 AFFYMETRIX al ES Maintenance SECTION 4 Fluidics Station Maintenance Procedures CHAPTER 1 Fluidics Station Maintenance Procedures Weekly Fluidics Station Cleanout Bleach Protocol FS 450 AFFYMETRIX al A cleaning protocol is recommended for fluidics station maintenance if the antibody staining procedure is used Choose Bleach or Bleach 450 for all modules from the drop down list in the Fluidics Station dialog box Click the Run button for all modules and follow LCD instructions This protocol is designed to eliminate any residual SAPE antibody complex that may be present in the fluidics station tubing and needles We recommend running this protocol at least once a week 1 Prepare I liter of 0 525 sodium hypochlorite solution using distilled water Shake well Each fluidics station with four modules requires at least 500 mL of the 0 525 sodium hypochlorite solution 2 Cuttubing If
155. s box to perform the recommended 2X image scan For the GeneChip Scanner 3000 only one scan is required Once the experiment has been selected click the Start button A dialog box prompts you to load a sample into the scanner If you are using the GeneArray Scanner click the Options button to check for the correct pixel value and wavelength of the laser beam m Pixel value 3 um m Wavelength 570 nm If you are using the GeneChip Scanner 3000 pixel resolution and wavelength are preset and cannot be changed CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning 7 Open the sample door on the scanner and insert the probe array into the holder Do not force the probe array into the holder Close the sample door of the scanner If you are using the GeneChip Scanner 3000 do not attempt to close the door by hand The door closes automatically through the User Interface when start scan is selected or the scanner goes into stand by mode Click OK in the Start Scanner dialog box The scanner begins scanning the probe array and acquiring data When Scan in Progress is Selected from the View menu the probe array image appears on the screen as the scan progresses Shutting Down the Fluidics Station 1 AFFYMETRIX al After removing a probe array from the probe array holder the LCD window displays the message ENGAGE WASHBLOCK If you are using the FS 400 latch the probe array holder by gently pushing
156. s carefully for optimal results What is the least amount of labeled eukaryotic cRNA target I can put on an array You should always use the recommended quantity of cRNA described in this manual Please refer to Table 2 2 1 for detailed instructions on the amount of cRNA needed for different array formats Although there is a tolerance for some variation in quantity we have found that hybridization of significantly less cRNA results in reduced sensitivity particularly for low copy transcripts How long can I store my eukaryotic cRNA target in the hybridization cocktail after its first hybridization Assuming no RNase contamination the fragmented cRNA targets in the hybridization cocktail can be stored for at least five months at 80 C without significant loss of signal intensity The fact that the cRNA is fragmented prior to hybridization reduces the effects of any subsequent degradation What parameters should I use to QC my GeneChip probe array data Quality assessments are critical in obtaining highly reproducible GeneChip probe array results QC procedures should be performed at various key checkpoints 1 RNA sample quality As described in the Expression Analysis Technical Manual the quality of starting RNA is very important Ratio of 260 280 absorbance values as well as appearance of samples by gel electrophoresis or Bioanalyzer Total RNA assay are suggested methods to detect any degradation of your RNA samples 2 Target lab
157. strate is coated with linkers containing photolabile protecting groups Then a mask is applied that exposes selected portions of the probe array to ultraviolet light Illumination removes the photolabile protecting groups enabling selective nucleoside phosphoramidite addition only at the previously exposed sites Next a different mask is applied and the cycle of illumination and chemical coupling is performed again By repeating this cycle a specific set of oligonucleotide probes is synthesized with each probe type in a known location The completed probe arrays are packaged into cartridges During the laboratory procedure described in this manual biotin labeled RNA or DNA fragments referred to as the target are hybridized to the probe array The hybridized probe array is stained with streptavidin phycoerythrin conjugate and scanned by the GeneChip Scanner 3000 or the GeneArray Scanner The amount of light emitted at 570 nm is proportional to the bound target at each location on the probe array CHAPTER 1 GeneChip Expression Analysis Overview GeneChip Expression Analysis Overview The following major steps outline GeneChip expression analysis 1 Target Preparation 2 Target Hybridization 3 Fluidics Station Setup 4 Probe Array Washing and Staining 5 Probe Array Scan 6 Data Analysis Due to the differences in the RNA species between eukaryotic and prokaryotic organisms different target labeling protocols have been o
158. t examine the Present call rate of the 3 probe set of the poly A RNA control transcripts Following the recommended dilutions all four poly A RNA controls should be routinely called as Present in a One Cycle Target Labeling Assay The poly A RNA control present at the lowest concentration lys is expected to be called as Present gt 70 percent of the time for the Two Cycle Target Labeling Assay and the other three controls should be routinely called as Present Next the relative Signal intensities of the four transcripts should also be checked such that they follow the same order of increasing poly A RNA control concentration as expected Should I anticipate the same results using the poly A controls with all eukaryotic GeneChip expression arrays The Signal intensity representative data globally scaled shown in the Expression Analysis Technical Manual are typical results for the most current probe design from Affymetrix 3 AFFX r2 Bs These probe sets are available on catalog arrays including the GeneChip Human Genome U133 Mouse 430 and Rat 230 arrays However with previous generations of probe sets the Signal values observed may vary from the current ones Nevertheless utilization of these controls still serves as a good indicator of the experimental process quality low end sensitivity and assay dynamic range Some of the arrays that have the older probe sets include the Drosophila Genome Array and Yeast Genome S98 Array How
159. the data must be restored using GCOS Administrator Please review the appropriate sections of the GCOS User s Guide for details on importing and restoring data How can the mismatch probe cell have a higher intensity than its corresponding perfect match probe cell There could be a number of causes for this It is possible that this probe sequence has high homology with another unknown sequence resulting in a high mismatch to perfect match ratio Another possibility is a mutation or set of mutations in the sequence of the target transcript which causes specific binding to the Mismatch Regardless of the cause the built in redundancy using multiple probe pairs to represent a single sequence on the probe array mitigates any significant impact on the final interpretation of the data There are too many files showing in the file window in Microarray Suite What can I do By placing files for projects in their own directories and changing the default settings for data in Microarray Suite appropriately you can manage large numbers of files In addition with the Windows 2000 operating system users can specify their own directory defaults in Microarray Suite while logging on and create their own directories for data To do so each user should have a unique logon name and organize files in subdirectories for example by project user date or lab Each user can then set the data default to a subdirectory of choice These instructions are not ap
160. these substances are fluorescing at 570 nm the detection wavelength This nonspecific binding causes a low signal to noise ratio SNR meaning that genes for transcripts present at very low levels in the sample may be incorrectly called as Absent High background creates an overall loss of sensitivity in the experiment What are masks Masks are rarely used features in MAS There are three types of mask files Image mask files You may want to use an image mask if there is a large visible aberration on an image You define the image mask based on the physical location of the image Probe pairs included in the mask are excluded from the analysis Image masks are associated with a given dat cel file and cannot be used on other images Probe mask files Probe masks are defined by the probe set and probe pair number Probe pairs included in this type of probe mask are excluded from the analysis when the probe mask is used Probe masks can be applied across a data set A second type of probe mask defines a select group of probe sets that can be used in normalization or scaling For detailed descriptions of mask files please refer to Affymetrix Microarray Suite User s Guide P N 701099 or the Affymetrix GeneChip Operating Software User s Guide P N 701439 If I realign the grid how do I create a new cel file If manual adjustment of the grid is necessary the corresponding cel file present at the time of adjustment will no longer
161. tions in this section on handling the probe array If necessary clean the glass surface of the probe array with a non abrasive towel or tissue before scanning Do not use alcohol to clean glass Before scanning the probe array cartridge apply Tough Spots to each of the two septa on the probe array cartridge to prevent the leaking of fluids from the cartridge during scanning Apply the spots just before scanning Do not use them in the hyb process 1 Onthebackof the probe array cartridge clean excess fluid from around septa 2 Carefully apply one Tough Spots to each of the two septa Press to ensure that the spots remain flat If the Tough Spots do not apply smoothly that is if you observe bumps bubbles tears or curled edges do not attempt to smooth out the spot Remove the spot and apply a new spot See Figure 2 3 1 2 3 15 Eukaryotic 2 3 16 SECTION 2 Eukaryotic Sample and Array Processing Figure 2 3 1 Applying Tough Spots M to the probe array cartridge 3 Insert the cartridge into the scanner and test the autofocus to ensure that the Tough Spots do not interfere with the focus If you observe a focus error message remove the spot and apply a new spot Ensure that the spots lie flat Scanning the Probe Array Select Run Scanner from the menu bar Alternatively click the Start Scan icon in the tool bar The Scanner dialog box appears with a drop down list of experiments that have not been run
162. treatment may be required to eliminate DNA contamination when the bacterial culture is grown at high density After purification RNA concentration is determined by absorbance at 260 nm on a spectrophotometer 1 absorbance unit 40 ug mL RNA The A 4 A s ratio should be approximately 2 0 with ranges between 1 8 to 2 1 considered acceptable We recommend checking the quality of RNA by running it on an agarose gel prior to starting the assay The 23S and 16S rRNA bands should be clear without any obvious smears Any indication of the presence of chromosomal DNA contamination high molecular weight bands or smears on the gel would require additional DNase treatment before proceeding to cDNA synthesis Lane 1 1 ug Sample 1 Lane 2 1 ug Sample 2 Lane 3 1 ug Sample 3 Lane 4 RNA Size Markers 23S rRNA 16S rRNA Figure 3 1 1 Typical RNA preparation from E coli Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing cDNA Synthesis The following protocol starts with 10 ug of total RNA Incubations are performed in a thermal cycler The integrity of total RNA is essential for the success of the assay Exercise precautions and follow standard laboratory procedures when handling RNA samples Step 1 Preparation of Poly A RNA Controls pem The Poly A RNA Control Stock and Poly A Control Dil Buffer are provided with the Poly A RNA Control Kit P N 900433 to prepare the appropriate serial dilutions
163. trol Stock and the Dilution Buffer are packaged in the same kit to provide convenience to customers Currently they cannot be purchased as separate products Can I purchase one or all of the four poly A controls separately These four controls are only available as a pre mixed cocktail with the defined concentrations and relative ratios This combination of concentrations has been tested to provide qualitative information on both sensitivity and dynamic range of the labeling assay Providing these controls in a pre mixed format increases ease of use and reduces the number of manual dilution steps AFFYMETRIX AVC 5 B 9 Appendices 5 B 10 SECTION 5 Appendices One Cycle cDNA Synthesis Kit What components does the GeneChip One Cycle cDNA Synthesis Kit contain The One Cycle cDNA Synthesis Kit contains all necessary reagents see the following table to carry out the cDNA synthesis reaction for thirty samples in a standard assay for GeneChip arrays From total RNA starting materials 1 ug to 15 ug using this kit sufficient double stranded cDNA can be synthesized purified on the cDNA Cleanup Column and used as template in the subsequent in vitro transcription labeling reaction Component Name Concentration Volume Quantity T7 Oligo dT Primer 50 uM 50 uM 120 uL 1 5X 15 Strand Reaction Mix 5X 120 HL 1 DTT 0 1M 0 1M 60 uL 1 dNTP 10 mM 10 mM 120 uL 1 SuperScript Il 200 U uL 60 uL 1
164. ukaryotic Sample and Array Processing Alternative Protocol for One Cycle cDNA Synthesis from Purified Poly A mRNA 2 1 44 Step 1 First Strand cDNA Synthesis 2 1 44 Step 2 Second Strand cDNA Synthesis This Chapter Contains m Complete One Cycle Target Labeling Assay with 1 to 15 ug of total RNA or 0 2 to 2 ug of poly A mRNA m Complete Two Cycle Target Labeling Assay with 10 to 100 ng of total RNA CHAPTER 1 Eukaryotic Target Preparation Introduction AFFYMETRIX Co This chapter describes the assay procedures recommended for eukaryotic target labeling in expression analysis using GeneChip brand probe arrays Following the protocols and using high quality starting materials a sufficient amount of biotin labeled cRNA target can be obtained for hybridization to at least two arrays in parallel The reagents and protocols have been developed and optimized specifically for use with the GeneChip system Depending on the amount of starting material two procedures are described in detail in this manual Use the following table to select the most appropriate labeling protocol for your samples Total RNA as Starting Material mRNA as Starting Material Protocol 1 ug 15 ug 0 2 ug 2 ug One Cycle Target Labeling 10 ng 100 ng N A Two Cycle Target Labeling The One Cycle Eukaryotic Target Labeling Assay experimental outline is represented in Figure 2 1 1 Total RNA
165. umn membrane Ensure that the water is dispensed directly onto the membrane Centrifuge 1 minute at maximum speed lt 25 000 x g to elute Pipet 10 uL of RNase free Water directly onto the spin column membrane Ensure that the water is dispensed directly onto the membrane Centrifuge 1 minute at maximum speed x 25 000 x g to elute For subsequent photometric quantification of the purified cRNA we recommend dilution of the eluate between 1 100 fold and 1 200 fold Store cRNA at 20 C or 70 C if not quantitated immediately Alternatively proceed to Step 2 Quantification of the cRNA Step 2 Quantification of the cRNA AFFYMETRIX al Use spectrophotometric analysis to determine the cRNA yield Apply the convention that 1 absorbance unit at 260 nm equals 40 ug mL RNA m Check the absorbance at 260 nm and 280 nm to determine sample concentration and purity m Maintain the Azg0 Azgo ratio close to 2 0 for pure RNA ratios between 1 9 and 2 1 are acceptable For quantification of cRNA when using total RNA as starting material an adjusted cRNA yield must be calculated to reflect carryover of unlabeled total RNA Using an estimate of 10046 carryover use the formula below to determine adjusted cRNA yield adjusted cRNA yield RNA total RNA y RNA amount of cCRNA measured after IVT ug total RNA starting amount of total RNA ug y fraction of cDNA reaction used in IVT Example Starting with 10 ug tota
166. up until a light click is heard Engage the washblock by firmly pushing up on the cartridge lever to the ENGAGE position If you are using the FS 450 gently lift up the cartridge lever to engage or close the washblock The fluidics station automatically performs a Cleanout procedure The LCD window indicates the progress of the Cleanout procedure When the fluidics station LCD window indicates REMOVE VIALS the Cleanout procedure is complete Remove the sample microcentrifuge vial s from the sample holder s If no other hybridizations are to be performed place wash lines into a bottle filled with deionized water Select Shutdown or Shutdown_450 for all modules from the drop down Protocol list in the Fluidics Station dialog box Click the Run button for all modules The Shutdown protocol is critical to instrument reliability Refer to the appropriate Fluidics Station User s Guide for more information After Shutdown protocol is complete flip the ON OFF switch of the fluidics station to the OFF position To maintain the cleanliness of the fluidics station and obtain the highest quality image and data possible a weekly bleach protocol and a monthly decontamination protocol are highly recommended Please refer to Section 4 Fluidics Station Maintenance Procedures for further detail 3 3 19 Prokaryotic 3 3 20 SECTION 3 Prokaryotic Sample and Array Processing Customizing the Protocol There may be times whe
167. ution Mix Vial 1 Components Volume Final Concentration 2X Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 1 mg mL Streptavidin 6 0 uL 10 ug mL Nuclease free H50 270 0 uL Total Volume 600 pL CHAPTER 3 Prokaryotic Arrays Washing Staining and Scanning AFFYMETRIX Co Table 3 3 3 Antibody Solution Mix Vial 2 Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 10 mg mL Normal Goat IgG 6 0 uL 0 1 mg mL 0 5 mg mL Anti streptavidin Antibody biotinylated 6 0 uL 5 ug mL Nuclease free H 0 264 0 HL Total Volume 600 pL Table 3 3 4 SAPE Solution Mix Vial 3 Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 1 mg mL Streptavidin Phycoerythrin 6 0 uL 10 ug mL Nuclease free H20 270 0 uL Total Volume 600 pL 2 Inthe Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list The probe array type will appear automatically Array Fluidics Protocol m GeneChip coli Genome 2 0 Array Mini prok2v1 if using FS 450 Mini prok2v1 450 m GeneChip E coli Antisense Genome Array ProkGE WS2 if using FS 450 ProkGE WS2_450 m GeneChip P aeruginosa Genome Array Modified FlexMidi_euk2v3 See Table 3 3 5 If using FS 450 FlexMidi_euk2v3_450 Fluidics protocols are specific to array format and content Follow proce
168. v3 Micro 1v1 When using the Fluidics Station 450 or 250 add _450 at the end of the fluidics script s name Table 2 3 4 Fluidics Scripts for 2 18 um Feature Size Eukaryotic Arrays Format Using GeneChip IVT Labeling Kit EukGE WS2v4 4 Midi euk2v3 Mini euk2v3 Micro 1v1 Using all other labeling kits EukGE WS2v4 EukGE WS2v4 Midi euk2v3 Mini euk2v3 Micro 1v1 When using the Fluidics Station 450 or 250 add _450 at the end of the fluidics script s name CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Table 2 3 5 Fluidics Protocols Antibody Amplification for Eukaryotic Targets protocols for the Fluidics Station 450 250 will have 450 as a suffix EukGE WS2v4 EukGE WS2v5 Midi_euk2 Micro_1 Mini_euk2 Post Hyb 10 cycles of 2 mixes cycle with Wash 10 cycles of 2 mixes cycle with Wash 10 cycles of 2 mixes cycle with Wash Wash 1 Buffer A at 25 C Buffer A at 30 C Buffer A at 25 C Post Hyb 4 cycles of 15 mixes cycle with Wash 6 cycles of 15 mixes cycle with 8 cycles of 15 mixes cycle with Wash Wash 2 Buffer B at 50 C Wash Buffer B at 50 C Buffer B at 50 C Stain Stain the probe array for 10 minutes in Stain the probe array for 5 minutes in Stain the probe array for 10 minutes in SAPE solution at 25 C SAPE solution at 35 C SAPE solution at 25 C Post Stain 10 cycles of 4 mixes cycle with Wash 10 cycles of 4 mixes cycle with Wash 10 cycles of 4 mixes
169. vate the RT enzyme then cool the sample for at least 2 minutes at 4 C After the 2 minute incubation at 4 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube and immediately proceed to Step 3 First Cycle Second Strand cDNA Synthesis on page 2 1 24 Cooling the sample at 4 C is required before proceeding to the next step Adding the First Cycle Second Strand Master Mix directly to solutions that are at 70 C will compromise enzyme activity 2 1 23 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 3 First Cycle Second Strand cDNA Synthesis Two Cycle cDNA Synthesis Kit is used for this step v Note The following program can be used as a reference to perform the First cycle Second strand cDNA synthesis reaction in a thermal cycler For the 16 C incubation turn the heated lid function off If the heated lid function cannot be turned off leave the lid open Use the heated lid for the 75 C incubation 16 C 2 hours 75 C 10 minutes 4 C hold 1 Inaseparate tube assemble the First Cycle Second Strand Master Mix Recommend It is recommended to prepare this First Cycle Second Strand Master Mix immediately before use Prepare this First Cycle Second Strand Master Mix for at least 4 reactions at one time for easier and more accurate pipetting a Prepare sufficient First Cycle Second Strand Master Mix for all samples When there are more than 2 samples it is prud
170. ybridizations and Array Washing protocols have been optimized specifically for this IVT Labeling Protocol Closely follow the recommendations described below for maximum array performance 1 Use the following table to determine the amount of cDNA used for each IVT reaction following the cDNA cleanup step Table 2 1 16 IVT Reaction Set Up Starting Material Volume of cDNA to use in IVT Total RNA 10 to 100 ng all 12 uL 1 0 to 8 0 ug all 12 uL 8 1 to 15 ug 6 uL mRNA 0 2 to 0 5 ug all 12 uL 0 6 to 1 0 ug 9uL 1 to 2 0 ug 6 uL 2 Transfer the needed amount of template cDNA to RNase free microfuge tubes and add the following reaction components in the order indicated in the table below If more than one IVT reaction is to be performed a master mix can be prepared by multiplying the reagent volumes by the number of reactions Do not assemble the reaction on ice since spermidine in the 10X IVT Labeling Buffer can lead to precipitation of the template cDNA CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX Table 2 1 17 IVT Reaction Template cDNA variable see Table 2 1 16 RNase free Water variable to give a final reaction volume of 40 uL 10X IVT Labeling Buffer 4 HL IVT Labeling NTP Mix 12 HL IVT Labeling Enzyme Mix 4 uL Total Volume 40 uL 0 5 to 1 ug of the 3 Labeling Control can be used in place of the template cDNA sample in this reaction as a positive co
171. you are using the Fluidics Station 450 250 If you are using the FS 450 or FS 250 cut three pieces of tubing with each piece at least 2 5 3 feet in length Tygon tubing 0 04 for each module of each fluidics station for a total of 6 tubes for the FS 250 or 12 tubes for the FS 450 These can be reused for subsequent BLEACH runs ES Maintenance SECTION 4 Fluidics Station Maintenance Procedures FS 400 If you are using the Fluidics Station 400 If you are using the FS 400 cut four pieces of tubing at least 2 5 3 feet in length 3 Place all three wash lines these are not the tubing on the needles but the supply lines from the reagent bottles on the side of the station of each fluidics station in 1 liter of distilled water v Note The BLEACH protocol requires at least 550 mL of distilled water 4 Choose Fluidics from the Run menu Alternatively click the down arrow Protocol list on the toolbar 5 Choose Bleach or Bleach 450 for the respective modules in the Protocol drop down list 6 Disengage the washblock for each module by pressing down on the cartridge lever Figure 4 1 1 Washblocks disengaged with cartridge levers down Figure 4 1 1 Disengaged washblocks showing cartridge levers in the down position v Note Temperature will ramp up to 50 C CHAPTER 1 Fluidics Station Maintenance Procedures AFFYMETRIX 7 Connect tubing to needles If you are using the Fluidics Station 450 250 If
172. ype However if they differ by too much within a set of experiments approximately 3 fold or more this indicates wide variation in the dat files Therefore the analyzed data in the chp file should be treated with caution APPENDIX B FAQs amp Troubleshooting AFFYMETRIX al Should I always anticipate the hybridization controls bioB bioC bioD and cre to be called as Present The four transcripts are added to the hybridization cocktail at staggered concentrations At 1 5 pM bioB is at the detection limit for most expression arrays and is anticipated to be called Present at least 70 of the time In contrast the other controls should be called Present all of the time with increasing Signal values bioC bioD and cre respectively Absent calls or relatively low Signal values indicate a potential problem with the hybridization reaction or subsequent washing and staining steps Check to see if the hybridization cocktail was prepared correctly if the recommended hybridization temperature and Fluidics Protocol were used and make sure the SAPE staining solution did not deteriorate Other than qualitative calls and Signal values the 3 5 ratio data for these controls are not as informative since they do not relate to the quality of the samples and data What does high background mean A high background implies that impurities such as cell debris and salts are binding to the probe array in a nonspecific manner and that
173. zation and more importantly data interpretation However some customers have explored this approach The following publication is an example of this type of study Please note that this reference is listed for the convenience of our customers and is not endorsed or supported by Affymetrix Kayo T Allison D B Weindruch R Prolla T A Influences of aging and caloric restriction on the transcriptional profile of skeletal muscles from rhesus monkeys Proceedings of the National Academy of Sciences of the USA 98 5093 5098 2001 When I follow your recommended protocol of isolating total RNA from mammalian tissues first using TRIzol reagents then with RNeasy columns I sometimes see a reduced recovery off the RNeasy columns TRIzol reagents and RNeasy columns are based on very different principles for nucleic acids purification RNeasy columns exclude certain contaminants that may give rise to a falsely higher spectrophotometric reading including carried over phenol and transcripts shorter than 200 nucleotides in length These shorter transcripts include the SS rRNA and tRNA molecules that may account for 10 or more of the total RNA isolated To verify that the RNA of interest has been cleaned up efficiently during column purification it may be helpful to run aliquots of your samples on a gel or perform some gene specific real time PCR quantitation In addition you can estimate how much total RNA you anticipate to recover since the yield
174. zed to the probes on the array Probe Cell Specific areas on the probe array that contain oligonucleotides of a specific sequence Interfering Conditions CAUTIC Instruments Wear powder free gloves throughout procedure Take steps to minimize the introduction of exogenous nucleases Water used in the protocols below is molecular biology grade nuclease free Proper storage and handling of reagents and samples is essential for robust performance All laboratory equipment used to prepare the target during this procedure should be calibrated and carefully maintained to ensure accuracy as incorrect measurement of reagents may affect the outcome of the procedure References The Affymetrix GeneChip Expression Analysis Technical Manual is designed for use in a system consisting of a Fluidics Station a Hybridization Oven 640 and a Scanner Limitations 1 Sambrook J Fritsch E F Maniatis T Molecular Cloning A Laboratory Manual v 1 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY p 21 52 1989 2 See www affymetrix com for current GeneChip technology references EX AFFYMETRIX m The results of the assay are dependent upon the quality of the input RNA subsequent proper handling of nucleic acids and other reagents m The results should be evaluated by a qualified individual Do not store enzymes in a frost free freezer Overview SECTION 1 GeneChip Expression Analysis Overview

GeneChip Expression Analysis Technical Manual

Contents

Download Pdf Manuals

Related Search

Related Contents