Home

User Manual - Thermo Fisher Scientific

1. Item Quantity Catalog no Platinum Tag DNA Polymerase 100 reactions 10966 018 250 reactions 10966 026 500 reactions 10966 034 Taq DNA Polymerase Recombinant 100 units 10342 053 250 units 10342 012 500 units 10342 020 Platinum Taq DNA Polymerase High 100 units 11304 011 Fidelity 500 units 11304 029 One Shot TOP10 Chemically Competent 10 reactions C4040 10 E coli 20 reactions C4040 03 One Shot TOP10 Electrocompetent E coli 10 reactions C4040 50 BL21 Star DE3 One Shot Chemically 20 reactions C6010 03 Competent E coli BL21 Star DE3 pLysS One Shot 20 reactions C6020 03 Chemically Competent E coli BL21 AI One Shot Chemically 20 reactions C6070 03 Competent E coli LB Broth 500 ml 10855 021 LB Agar 500 g 22700 025 Ampicillin 200 mg 11593 019 PureLink HQ Mini Plasmid Purification 100 reactions K2100 01 Kit AcTEV Protease 1 000 units 12575 015 10 000 units 12575 023 Expressway Maxi Cell Free E coli 100 reactions K9900 97 Expression System Expressway NMR Cell Free E coli 5 reactions K9900 99 Expression System continued on next page Accessory Products continued Products to Detect If you have cloned your gene of interest in frame with the N or C terminal 6xHis tag in pEXP5 NT TOPO or pEXP5 CT TOPO respectively you may use an antibody to the appropriate epitope to detect your recombinant fusion protein The table below describes the antibodies available from Invitrogen for d
2. 2 Place the reaction on ice and proceed to Transforming One Shot TOP10 Competent E coli next page Note You may store the TOPO Cloning reaction at 20 C overnight 13 Transforming One Shot TOP10 Competent E coli Introduction Selecting a One Shot Chemical Transformation Protocol Materials Needed Note 14 Once you have performed the TOPO Cloning reaction you will transform your pEXP5 NT TOPO or pEXP5 CT TOPO construct into competent E coli One Shot TOP10 Chemically Competent E coli are included with the kit to facilitate transformation You may also transform electrocompetent cells if desired see page x for ordering information Protocols to transform chemically competent or electrocompetent F coli are provided in this section Two protocols are provided to transform One Shot TOP10 chemically competent E coli Consider the following factors and choose the protocol that best suits your needs If you wish to Then use the maximize the number of transformants clone large PCR products 21000 bp regular chemical transformation protocol page 15 obtain transformants as quickly as rapid chemical transformation possible protocol page 16 Note This procedure is less efficient the total number of transformants obtained may be lower than that obtained with the regular chemical transformation protocol In addition to general microbio
3. One Shot TOP10 Chemically Competent E coli which do not contain T7 RNA polymerase are included with each pEXP5 TOPO TA Expression Kit to serve as a host for stable propagation and maintenance of recombinant plasmids Do not use BL21 derived E coli strains to maintain your expression construct as the presence of T7 RNA polymerase even at basal levels can lead to expression of the gene of interest even in the absence of inducer In general this is not a problem However if the gene of interest is toxic to the E coli host plasmid instability and or cell death results After you have TOPO Cloned your PCR product into the pEXP5 TOPO vector we recommend that you transform characterize and maintain your expression construct in TOP10 cells When you are ready to perform an expression experiment transform your expression construct into a BL21 E coli strain See the next page for more information continued on next page T7 Regulated Expression continued BL21 E coli Strains You may use the BL21 Grodberg and Dunn 1988 Studier and Moffatt 1986 E coli strain or any suitable BL21 derivative as a host to express your recombinant protein Consider the following factors when choosing a suitable BL21 strain to use for expression Ability to induce T7 RNA polymerase expression Use a BL21 derived strain that contains the DE3 bacteriophage lambda lysogen The ADE3 lysogen contains the T7 RNA polymerase under the control
4. Upon receipt store the Item Storage pEXP5 NT TOPO and or pEXP5 CT TOPO Reagents 20 C One Shot TOP10 Chemically Competent E coli 80 C continued on next page vii Kit Contents and Storage continued pEXP5 TOPO The following reagents are supplied with the pEXP5 NT TOPO or pEXP5 Reagents CT TOPO vector Note that the user must supply Tag polymerase Store at 20 C Item Concentration Amount pEXP5 NT TOPO or 5 10 ng ul linearized plasmid DNA in 10 ul pEXP5 CT TOPO vector 50 glycerol TOPO adapted 50 mM Tris HCl pH 7 4 at 25 C 1mM EDTA 1mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM phenol red 10X PCR Buffer 100 mM Tris HCl pH 8 3 at 42 C 100 ul 500 mM KCl 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 10 pl 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 50 ul 0 06 M MgCl Water aed 1ml T7 Forward Primer 0 1 ug ulin TE Buffer pH 8 0 20 ul T7 Reverse Primer 0 1 ug ul in TE Buffer pH 8 0 20 ul pEXP5 NT TOPO kit only T7 Term Reverse Primer 0 1 ug ul in TE Buffer pH 8 0 20 ul pEXP5 CT TOPO kit only Control PCR Primers 0 1 ug ul each in TE Buffer pH 8 0 10 ul Control PCR Template 0 1 ug ul in TE Buffer pH 8 0 10 ul continued on next page viii Genotype of Kit Contents and Storage continued Primer Sequences The table below provides the sequence
5. f 1 TAATACGACT CACTATAGGG AGACACACGA CGGTTTCCCT CTAGAAATAA TTTTGTTTAA CTTTAAGAAG Polyhistidine 6xHis region RBS i i al Lys Gly His His His His His His GAGATACCCT TEST product AAG GGT CAT CAT CAC CAT CAC CAT TGA GTTTAAACTATA TAGAATAAAA CTCTATGGGAIN TTC CCA GTA GTA GTG GTA GTG GTA ACT T7 transcription termination region r GAAGAAACCT TAGCTGAGCA ATAACTAGCA TAACCCCTTG GGGCCTCTAA ACGGGTCTTG AGGGGTTTTT TGCTGAAAGG T7 term reverse priming site AGGAACTATA TCCGGATAAT Producing PCR Products Introduction Materials Supplied by the User Polymerase Mixtures Producing PCR Products 10 Once you have synthesized appropriate PCR primers you may use the primers and a suitable DNA polymerase to produce your PCR product Remember that your PCR product must have single 3 A overhangs You will need the following reagents and equipment for PCR Note dNTPs adjusted to pH 8 are provided in the kit e Taq polymerase or other suitable DNA polymerase Note For improved specificity and higher yields we recommend using Platinum Taq DNA Polymerase available from Invitrogen see page x for ordering information to generate your PCR product e Thermocycler e DNA template and primers to produce the PCR product You may use a polymerase mixture containing Taq polymerase and a proofreading polymerase to produce your PCR product however the mixture must contain a ratio of Taq polymerase
6. Site for product for TOPO Cloning into pEXP5 NT TOPO The sequence of pEXP5 pEXP5 NT TOPO NT TOPO is available for downloading from www invitrogen com or by 1 80 140 201 281 contacting Technical Service page 36 For more information about pEXP5 NT TOPO see pages 30 33 T7 promoter priming site T7 promoter RBS 1 TAATACGACT CACTATAGGG AGACCACAAC GGTTTCCCTC TAGAAATAAT TTTGTTTAAC TTTAAGAAGG AGATATACC HisG epitope Polyhistidine 6xHis region TEV recognition site r 1 f Met Ser Gly Ser His His His His His His Gly Ser Ser Gly Glu Asn Leu Tyr Phe Gln ATG TCT GGT TCT CAT CAT CAT CAT CAT CAT GGT AGC AGC GGC GAA AAC CTG TAT TTT CAG TEV cleavage site T7 transcription termination region Ser Leu r TCC CTT PCR product EAAGGG TGATCCGGCT GCTAACAAAG CCCGAAAGGA AGCTGAGTTG GCTGCTGCCA AGG GAR TTCCC ACTAGGCCGA T7 reverse priming site CCGCTGAGCA ATAACTAGCA TAACCCCTTG GGGCCTCTAA ACGGGTCTTG AGGGGTTTTT TGCTGAAAGG AGGAACTATA nna TCCGGATAAT TOPO Cloning Use the diagram below to help you design PCR primers and produce your PCR Site for product for TOPO Cloning into pEXP5 CT TOPO The sequence of pEXP5 pEXP5 CT TOPO CT TOPO is available for downloading from www invitrogen com or by 1 71 131 211 contacting Technical Service page 36 For more information about pEXP5 CT TOPO see pages 34 35 T7 promoter priming site T7 promoter
7. T7 forward priming site bases 1 20 Ribosome binding site RBS bases 69 74 TOPO recognition site 1 bases 77 81 TOPO recognition site 2 bases 82 86 Polyhistidine 6xHis region bases 88 105 T7 term reverse priming site bases 205 227 T7 transcription terminator bases 143 227 bla promoter bases 339 437 Ampicillin resistance gene bases 438 1298 pUC origin 1443 2116 continued on next page 34 Map and Features of pEXP5 CT TOPO continued Features of pEXP5 CT TOPO 2685 bp contains the following elements All features have pEXP5 CT TOPO been functionally tested Feature Benefit T7 promoter Allows high level expression of your recombinant protein in the Expressway Cell Free E coli Expression System or in E coli strains expressing the T7 RNA polymerase T7 forward priming site Allows sequencing in the sense orientation Ribosome binding site RBS Optimally spaced from the initiation ATG for efficient translation of the PCR product TOPO Cloning site Allows rapid cloning of your Tag amplified PCR product C terminal polyhistidine 6xHis tag Allows detection of the recombinant fusion protein with an Anti His C term Antibody and purification with metal chelating resin i e ProBond or Ni NTA T7 transcription terminator Sequence from bacteriophage T7 that allows efficient transcription termination T7 reverse priming site Allows sequencing of the insert bla pro
8. a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license
9. coli Expression System or in E coli e Ribosome binding site RBS optimally spaced from the initiation ATG in the N terminal tag for efficient translation of the recombinant fusion protein pEXP5 NT TOPO only e N terminal or C terminal fusion tags for detection and purification of recombinant fusion proteins choice of tag varies depending on the particular vector see above e Tobacco Etch Virus TEV recognition site for cleavage of the N terminal peptide from your recombinant fusion protein pEXP5 NT TOPO only e TOPO Cloning site for rapid and efficient cloning of Taq amplified PCR products see the next page for more information e Ampicillin resistance gene for selection in E coli e pUC origin for high copy replication and maintenance of the plasmid in E coli continued on next page Overview continued How TOPO Cloning Works The Expressway Cell Free E coli Expression Systems The pEXP5 NT TOPO and pEXP5 CT TOPO vectors are supplied linearized with e Single 3 thymidine T overhangs for TA Cloning e Topoisomerase I covalently bound to the vector referred to as activated vector Taq polymerase has a non template dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in each kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vec
10. Bacterial Genetics A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria Plainview New York Cold Spring Harbor Laboratory Press Nayak S Li L and Lee J 2003 Enhanced TEV Protease Extends Enzyme Stability for Long Term Activity Focus 25 3 12 14 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Studier F W and Moffatt B A 1986 Use of Bacteriophage T7 RNA Polymerase to Direct Selective High Level Expression of Cloned Genes J Mol Biol 189 113 130 Studier F W Rosenberg A H Dunn J J and Dubendorff J W 1990 Use of T7 RNA Polymerase to Direct Expression of Cloned Genes Meth Enzymol 185 60 89 2005 2006 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 40 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
11. Modulation of Non Templated Nucleotide Addition by Tag DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Carrington J C and Dougherty W G 1988 A Viral Cleavage Site Cassette Identification of Amino Acid Sequences Required for Tobacco Etch Virus Polyprotein Processing Proc Natl Acad Sci USA 85 3391 3395 Dougherty W G Carrington J C Cary S M and Parks T D 1988 Biochemical and Mutational Analysis of a Plant Virus Polyprotein Cleavage Site EMBO J 7 1281 1287 Dougherty W G Cary S M and Parks T D 1989 Molecular Genetic Analysis of a Plant Virus Polyprotein Cleavage Site A Model Virology 171 356 364 Gold L 1988 Posttranscriptional Regulatory Mechanisms in Escherichia coli Ann Rev Biochem 57 199 233 Grodberg J and Dunn J J 1988 ompT Encodes the Escherichia coli Outer Membrane Protease that Cleaves T7 RNA Polymerase During Purification J Bacteriol 170 1245 1253 Innis M A Gelfand D H Sninsky J J and White T S 1990 PCR Protocols A Guide to Methods and Applications Academic Press San Diego CA Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Miller J H 1992 A Short Course in
12. One Shot competent cells using the protocol on page 15 The cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band Addition of 3 A Overhangs Post Amplification Introduction Direct cloning of DNA amplified by proofreading polymerases into TOPO TA Cloning vectors is often difficult because proofreading polymerases remove the 3 A overhangs necessary for TA Cloning Invitrogen has developed a simple method to clone these blunt ended fragments Before Starting You will need the following items e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3M sodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional Procedure This is just one method for adding 3 adenines Other protocols may be suitable 1 After amplification with a proofreading polymerase place vials on ice and add 0 7 1 unit of Tag polymerase per tube Mix well It is not necessary to change the buffer A sufficient number of PCR products will retain the 3 A overhangs 2 Incubate at 72 C for 8 10 minutes do not cycle 3 Place on ice and use immediately in the TOPO Cloning reaction Note If you plan to store your sample overnight before proceeding with TOPO Cloning extract your sample with an equal volume of phenol chloroform to remove the polymerases Ethanol precipitate the DNA and resuspend
13. Spread 10 50 ul of each transformation mix onto LB plates containing 100 pg ml ampicillin When plating small volumes add 20 ul of S O C Medium to ensure even spreading Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies 5 Incubate overnight at 37 C The vector PCR insert reaction should produce hundreds of colonies Greater than 85 of these will contain the 750 bp insert when analyzed by Aval digestion The table below lists the expected digestion patterns for inserts cloned in either direction Vector Restriction Expected Digestion Pattern bp Enzyme pEXP5 NT TOPO Aval Orientation 1 2811 bp and 683 bp Orientation 2 3386 bp and 108 bp Empty Vector 2745 bp pEXP5 CT TOPO Aval Orientation 1 3326 bp and 107 bp Orientation 2 2751 bp and 683 bp Empty Vector 2685 bp The vector only reaction should yield very few colonies lt 15 of the vector PCR insert plate pUC19 plasmid is included to check the transformation efficiency of the One Shot TOP10 competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 using the protocol on page 15 Plate 10 ul of the transformation mixture plus 20 ul of S O C Medium on LB plates containing 100 ug ml ampicillin Transformation efficiency should be 2 1 x 10 cfu ug DNA Gel Purifying PCR Products Introduction Note Using the S N A P Gel Purificatio
14. Template 100 ng lul 10X PCR Buffer 5 ul dNTP Mix 0 5 ul Control PCR Primers 0 1 ug ul each 1 ul Water 41 5 ul Taq polymerase 1 U ul 1 ul Total volume 50 ul Overlay with 70 ul 1 drop of mineral oil if required Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 55 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 750 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page continued on next page 25 Performing the Control Reactions continued Control TOPO Using the control PCR product produced on the previous page and the Cloning Reactions pEXP5 NT TOPO or pEXP5 CT TOPO vector set up two 6 ul TOPO Cloning What You Should See Transformation Control 26 reactions as described below 1 Set up control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Water 4ul 3 ul Salt Solution 1g 1u Control PCR Product u lu TOPO vector lul 1 pl Total volume 6 ul 6 ul 2 Incubate at room temperature for 5 minutes and place on ice 3 Transform 2 ul of each reaction into separate vials of One Shot TOP10 competent cells using the procedure on page 15 4
15. beyond 5 minutes Including salt in the TOPO Cloning reaction allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see page x for ordering information e If you are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed on the next page e If you are transforming electrocompetent E coli the amount of salt in the TOPO Cloning reaction must be reduced to 50 mM NaCl 2 5 mM MgCl to prevent arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use the Dilute Salt Solution to set up the TOPO Cloning reaction as directed on the next page continued on next page Setting Up the TOPO Cloning Reaction continued Materials Needed You should have the following materials on hand before beginning e Your PCR product freshly prepared e pEXP5 NT TOPO or pEX
16. e Gel purify your PCR product Cloning large pool of PCR products or a toxic gene Increase the incubation time of the TOPO reaction from 5 minutes to 30 minutes continued on next page Troubleshooting continued TOPO Cloning Reaction and Transformation continued Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies continued PCR product does not contain sufficient 3 A overhangs even though you used Taq polymerase e Increase the final extension time to ensure that all 3 ends are adenylated e Tag polymerase is most efficient at adding a non template 3 A next to a C and less efficient at adding a nontemplate 3 A next to another A You may have to re design your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 Large number of incorrect inserts cloned PCR cloning artifacts e Gel purify your PCR product to remove primer dimers and smaller PCR products e Optimize your PCR conditions e Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot TOP10 competent E coli stored incorrectly Store One Shot TOP10 competent E coli at 80 C If you are using another E coli strai
17. in LB medium containing 100 ug ml ampicillin Grow at 37 C with shaking until the ODsoo reaches 0 6 1 0 3 Inoculate 10 ml of fresh LB medium containing 100 ug ml ampicillin to an OD of 0 05 0 1 and grow at 37 C until the culture reaches mid log phase OD600 is 0 5 0 8 4 Split the culture into two 5 ml cultures Add inducer to one of the cultures You will now have two cultures one induced one uninduced 5 Remove a 500 ul aliquot from each culture centrifuge at maximum speed in a microcentrifuge for 30 seconds and aspirate the supernatant 6 Freeze the cell pellets at 20 C These are the zero time point samples 7 Continue to incubate the cultures at 37 C with shaking Take time points for each culture every hour for 4 to 6 hours 8 For each time point remove 500 ul from the induced and uninduced cultures and process as described in Steps 5 and 6 Proceed to Analyzing Samples below Once you have finished your pilot expression analyze the samples you have collected using SDS PAGE Before starting prepare a polyacrylamide gel or use one of the pre cast polyacrylamide gels available from Invitrogen see the next page 1 Thaw the samples Steps 6 8 above and resuspend each cell pellet in 80 ul of 1X SDS PAGE sample buffer 2 Boil 5 minutes and centrifuge briefly Load 5 10 ul of each sample on a polyacrylamide gel and electrophorese Save your samples by storing them at 20 C continued on next p
18. is available from Invitrogen for use as a positive control for detection of fusion proteins containing a HisG or C terminal 6xHis epitope The ready to use WesternBreeze Chromo genic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemilumi nescence methods For more information refer to www invitrogen com or call Technical Service see page 36 Expression of your protein with the N or C terminal tags in pEXP5 NT TOPO or pEXP5 CT TOPO respectively will increase the size of your recombinant protein The table below lists the increase in the molecular weight of your recombinant fusion protein that you should see from the particular tag in each vector Be sure to account for any additional amino acids between the tag and your fusion protein Vector Peptide Tag Expected Size Increase kDa pEXP5 NT TOPO N terminal 2 5 kDa pEXP5 CT TOPO C terminal 1 1 kDa The presence of the N terminal or C terminal polyhistidine 6xHis tag in your recombinant fusion protein allows use of a metal chelating resin such as ProBond or Ni NTA to purify your fusion protein ProBond and Ni NTA are available from Invitrogen see page xi for ordering information Refer to the manual included with each product for instructions to purify your 6xHis tagged fusion protein Note Other metal chelating resins and purification methods are suitabl
19. proofreading polymerase in excess of 10 1 to ensure the presence of 3 A overhangs on the PCR product We recommend using Platinum Tag DNA Polymerase High Fidelity available from Invitrogen see page x for ordering information If you use polymerase mixtures that do not have enough Taq polymerase or a proofreading polymerase only you may add 3 A overhangs to your PCR product using the method on page 29 1 Set up the following 50 ul PCR reaction Use less DNA if you are using plasmid DNA as a template and more DNA if you are using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension step at 72 C after the last cycle to ensure that all PCR products are full length and 3 adenylated DNA Template 10 100 ng 10X PCR Buffer 5 pl dNTP Mix 50 mM 0 5 ul PCR primers 100 200 ng each 1 uM each Water add to a final volume of 49 ul Tag Polymerase 1 U ul 1ul Total volume 50 ul 2 Use agarose gel electrophoresis to verify the quality of your PCR product You should see a single discrete band of the correct size If you do not see a single band refer to the Note on the next page continued on next page Producing PCR Products continued Note If you do not obtain a single discrete band from your PCR try the following Optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit available f
20. to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany 37 Purchaser Notification continued Limited Use Label License No 30 T7 Expression System 38 The composition and or use of this product may be claimed in U S Patent No 5 693 489 licensed to Invitrogen Corporation by Brookhaven Science Associates LLC The T7 expression system is based on technology developed at Brookhaven National Laboratory under contract with the U S Department of Energy and is the subject of patents and patent applications assigned to Brookhaven Science Associates LLC BSA By provisions of the Distribution License Agreement granted to Invitrogen covering said patents and patent applications Invitrogen grants you a non exclusive sub license under patents assigned to BSA for the use of this technology including the enclosed materials based upon the following conditions 1 these materials are to be used for non com
21. xii Overview Introduction Features of the Vectors Introduction The pEXP5 NT TOPO and pEXP5 CT TOPO TA Expression Kits provide a highly efficient five minute one step cloning strategy TOPO Cloning for the direct insertion of Taq polymerase amplified PCR products into a plasmid vector for T7 based high level expression of recombinant fusion proteins in the Expressway Cell Free E coli Expression System or for inducible expression in E coli No ligase post PCR procedures or PCR primers containing special additional sequences are required to generate the expression construct A choice of kits allows you to fuse your gene of interest to an N terminal or C terminal tag for easy detection and purification of recombinant fusion proteins see table below Vector Fusion Peptide Fusion Tag Benefit pEXP5 NT TOPO N terminal 6xHis TEV Cleavable detection and recognition site purification tag pEXP5 CT TOPO C terminal 6xHis Detection and purification tag For more information about TOPO Cloning and how it works see the next page For more information about the Expressway Cell Free E coli Expression System or T7 based expression in E coli see pages 2 and 3 respectively Features of the pEXP5 NT TOPO and pEXP5 CT TOPO vectors include e Bacteriophage T7 promoter for high level inducible expression of the recombinant protein of interest in the Expressway Cell Free E
22. E coli strains available from Invitrogen e g BL21 AT BL21 Star DE3 or BL21 Star DE3 pLysS as a host for your pEXP5 NT TOPO or pEXP5 CT TOPO construct For more information about the BL21 AT BL21 Star DE3 and BL21 Star DE3 pLyssS strains see page 5 or the manual for each strain All manuals are available for downloading from www invitrogen com or by contacting Technical Service page 36 If you use a BL21 derived F coli strain for expression you will transform the cells and induce expression of your recombinant protein with IPTG For guidelines to transform E coli and perform expression studies see the Appendix pages 30 31 continued on next page 19 Expression and Analysis continued Detecting Recombinant Fusion Proteins Note Purifying Recombinant Fusion Proteins 20 You may detect expression of your recombinant fusion protein by Western blot analysis using antibodies against the appropriate epitope available from Invitrogen see table below and page xi for ordering information or an antibody to your protein of interest Vector Epitope Antibody pEXP5 NT TOPO HisG HHHHHHG e Anti HisG Antibody e Anti HisG HRP Antibody e Anti HisG AP Antibody pEXP5 CT TOPO C terminal 6xHis e Anti His C term Antibody HHHHH COOH e Anti His C term HRP Antibody e Anti His C term AP Antibody TM In addition the Positope Control Protein Catalog no R900 50
23. Invitrogen pEXP5 NT TOPOe and pEXP5 CT TOPOe TA Expression Kits Five minute TOPOe Cloning of Tag polymerase amplified PCR products into vectors for high level expression in the Expressway Cell Free E coli Expression System or in E coli Catalog nos V960 05 V960 06 K9900 96 and K9900 98 Version B K w0 25 0807 A Limited Use Label License covers this product see Purchaser Notification By use of this product you accept the terms and conditions of the Limited Use Label License ii Table of Contents Tableiof Contents con emm eL e e o eet ik eme et nee item eit tis iii TOPO Cloning Procedure for Experienced DSersc s une ee v Kit Contents and Storage etie eee tet irte ee fei e eerie iiber e Pese foe ehe Ae te Hehe en estesa ione vii Accessory Products nun eis aie then nalanin ted ebd netiis diee fe ate I hee x INntroduclionn ana ee 1 Overview ne Renata e de teer e t cree t iere dE E dr pde t iere id 1 I7 Regulated EXpEeSSIOD dcn retient a ect tedio beein 3 Experimental Outlines icem aed ea eisdem tisse seien Re aia 6 Lil po ro aia iaeia 7 Desigtung PER Primers enik n ee ied rem deni el ed sn e i he de i ee ee etes 7 Producing PCR Products 22 222 222 e n RH RR RS REG RR HI HERR ERR 10 Setting Up the TOPOP Cloning Resten u aaa to avira cute aan 12 Transforming One shor TOP10 Competent E coli an 14 Analyzing Transformants 5i a si RR Reine iii nei dne ert t eat
24. P5 CT TOPO vector supplied with the kit keep at 20 C until use e Salt Solution supplied with the kit or Dilute Salt Solution as appropriate e Water supplied with the kit Performing the Use the procedure below to perform the TOPO Cloning reaction Set up the TOPO Cloning TOPO Cloning reaction using the reagents in the order shown and depending on Reaction whether you plan to transform chemically competent E coli or electrocompetent E coli Note The red color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution 1 ul Dilute Salt Solution lul Water add to a final volume of 5 ul add to a final volume of 5 ul TOPO vector 1 pl 1 pl Final volume 6 ul 6 ul Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield a sufficient number of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time may yield more colonies
25. PCR 100 ug ml ampicillin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using Invitrogen s PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 3 Analyze the plasmids by restriction analysis sequencing or PCR to confirm the presence and correct orientation of the insert Once you have identified the correct clone s you may sequence your construct to confirm that your gene is cloned in the correct orientation and in frame with the appropriate N or C terminal tag Use the sequencing primers supplied with the kit to help you sequence your insert see table For the location of the priming sites in pEXP5 NT TOPO or pEXP5 CT TOPO see the diagrams on page 9 Vector Forward Primer Reverse Primer pEXP5 NT TOPO T7 forward T7 reverse pEXP5 CT TOPO T7 forward T7 term reverse You may analyze positive transformants using PCR For PCR primers use a combination of the Forward sequencing primer or the Reverse sequencing primer and a primer that hybridizes within your insert You will have to determine the amplification conditions If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The protocol below is provided for your convenience Other protocols are suitable Materials N
26. Pick 10 colonies for analysis see Analyzing Transformants page 17 continued on next page 15 Transforming One Shot TOP10 Competent E coli continued Rapid One Shot Chemical Transformation Protocol One Shot Electroporation Protocol N ho 7 o Non N 16 Use the alternative protocol below to rapidly transform One Shot TOP10 chemically competent E coli Before beginning make sure to pre warm LB agar plates containing 100 ug ml ampicillin at 37 C for 30 minutes 1 Add 4 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 13 into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 minutes Spread 50 ul of cells on a prewarmed selective plate and incubate overnight at 37 C An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Transformants page 17 Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the One Shot TOP10 chemically competent cells for electroporation 1 Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 13 into a sterile microcentrifuge tube containing 50 ul of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Transfer the cells to a 0 1 cm cuvette Electr
27. age Expressing Recombinant Protein in E coli continued Polyacrylamide Gel Electrophoresis Analyzing Samples To facilitate separation and visualization of your recombinant fusion protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein see www invitrogen com or call Technical Service page 36 To determine the success of your expression experiment you may want to perform the following types of analyses Other types of analyses are suitable e Stain the polyacrylamide gel with Coomassie Brilliant Blue R 250 stain and look for a band of increasing intensity in the expected size range for the recombinant protein Use the uninduced culture as a negative control e Perform a western blot to confirm that the overexpressed band is your desired protein see page 20 Once you have obtained a suitable amount of recombinant fusion protein you may purify the recombinant protein see page 20 and remove the N terminal tag pEXP5 NT TOPO expressed proteins only see page 21 Coomassie Brilliant Blue R is a registered trademark of Imperial Chemical Industries PLC 31 Ma
28. arranty 36 MSDSs are available on our Web site at www invitrogen com On the home page click on Support and then Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover a
29. bers K9900 96 and K9900 98 are also supplied with the Expressway Maxi Cell Free E coli Expression System and the Expressway NMR Cell Free E coli Expression System respectively For a detailed description of the components included with the Expressway Maxi or Expressway NMR Cell Free E coli Expression Systems and their use refer to the manual included with each kit For a description of the components included with the pEXP5 TOPO TA Expression Kits see the rest of this section Product Amount Catalog no pEXP5 NT TOPO TA Expression Kit 10 reactions V960 05 pEXP5 CT TOPO TA Expression Kit 10 reactions V960 06 Expressway Maxi Cell Free E coli Expression System with 1 kit K9900 96 pEXP5 NT TOPO and pEXP5 CT TOPO Expressway NMR Cell Free E coli Expression System 1 kit K9900 98 with pEXP5 NT TOPO and pEXP5 CT TOPO System Kit The Expressway Cell Free E coli Expression Systems include the following Components components For a detailed description of the contents of the pEXP5 TOPO TA Expression Kits see pages viii ix Catalog no Components V960 05 V960 06 K9900 96 K9900 98 pEXP5 NT TOPO TA Expression Kit Y Y Y pEXP5 CT TOPO TA Expression Kit Y Y Y Expressway Maxi Cell Free E coli Expression Y System Expressway NMR Cell Free E coli Expression Y System Shipping Storage components as detailed below Each pEXP5 TOPO TA Expression Kit is shipped on dry ice
30. e continued on next page Expression and Analysis continued Cleavage of the N terminal Tag in pEXP5 NT TOPO Obtaining TEV Protease The pEXP5 NT TOPO vector contains a Tobacco Etch Virus TEV recognition site Carrington and Dougherty 1988 Dougherty et al 1988 to allow removal of the N terminal tag from your recombinant fusion protein using TEV protease if desired Cleavage with TEV protease generates nearly native protein since only 2 amino acids will remain at the N terminus of your protein assuming that the first codon of your protein directly follows the TOPO Cloning site see diagram on page 9 for reference For highly efficient TEV protease directed cleavage we recommend using AcTEV Protease available from Invitrogen Catalog nos 12575 015 and 12575 023 AcTEV Protease is an enhanced form of TEV protease that is highly site specific active and more stable than native TEV protease Nayak et al 2003 Following digestion ACTEV Protease may be easily removed from the cleavage reaction by affinity chromatography using the 6xHis tag at the N terminus of the protease For instructions and guidelines to perform AcTEV Protease directed cleavage refer to the manual included with the product The manual is also available from www invitrogen com or by contacting Technical Service page 36 21 Troubleshooting TOPO Cloning Reaction and Transformation 22 pages 25 26 in parallel wit
31. eeded PCR SuperMix High Fidelity Invitrogen Catalog no 10790 020 Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of PCR SuperMix High Fidelity into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick5 colonies and resuspend them individually in 50 ul of the PCR cocktail from Step 1 above Incubate reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases Amplify for 20 to 30 cycles For the final extension incubate at 72 C for 10 minutes Store at 4 C nn ap Visualize by agarose gel electrophoresis continued on next page 17 Analyzing Transformants continued Long Term Storage 18 Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colonies on an LB plate containing 100 ug ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 100 pg ml ampicillin 3 Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Expression and Analysis Introduction Plasmid Preparation Using the Expressway Cell Free E coli Expression System BL21 E coli Expression Strain Performing Expression
32. etection The amount of antibody supplied is sufficient for 25 western blots Recombinant Fusion Proteins Products to Purify Recombinant Fusion Proteins Antibody 1997 HHHHHH COOH Product Epitope Catalog no Anti HisG Antibody Detects the N terminal R940 25 Anti HisG HRP Antibody Polyhistidine 6xHis tag R941 25 followed by glycine Anti HisG AP Antibody HHHHHHG R942 25 Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP polyhistidine 6xHis tag R931 25 Antibody requires the free carboxyl group for detection Lindner et al Anti His C term AP R932 25 If you clone your gene of interest in frame with the N terminal or C terminal 6xHis tag in pEXP5 NT TOPO or pEXP5 CT TOPO respectively you may purify your recombinant fusion protein using one of Invitrogen s metal chelating resins See the table below for ordering information Product Quantity Catalog no ProBond Nickel Chelating Resin 50 ml R801 01 150 ml R801 15 ProBond Purification System 6 purifications K850 01 ProBond Purification System with 1 kit K853 01 Anti His C term HRP Antibody Ni NTA Agarose 10 ml R901 01 25 ml R901 15 100 ml R901 10 Ni NTA Purification System 6 purifications K950 01 Ni NTA Purification System with 1 kit K953 01 Anti His C term HRP Antibody Polypropylene Columns empty 50 R640 50 xi
33. ffer Centrifuge for 1 minute at full speed in a microcentrifuge and discard the flow through Repeat Step 7 Elute the purified PCR product in 40 ul of TE or sterile water Use 4 ul for the TOPO Cloning reaction and proceed as described on page 13 An even easier method is to simply cut out the gel slice containing your PCR product place it on top of the S N A P column bed and centrifuge at full speed for 10 seconds Use 1 2 ul of the flow through in the TOPO Cloning reaction see page 13 Be sure to make the gel slice as small as possible for best results continued on next page 27 Gel Purifying PCR Products continued Low Melt Agarose Method Note 28 If you prefer to use low melt agarose use the procedure below Note that gel purification will result in a dilution of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 13 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 ul directly into
34. for 30 minutes see Important Note below Thaw on ice one vial of One Shot cells for each transformation If you are performing the rapid chemical transformation protocol it is essential that you prewarm your LB plates containing 100 ug ml ampicillin prior to spreading Use the following protocol to transform One Shot TOP10 chemically competent E coli 1 og RO Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 13 into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down Note If you are transforming the pUC19 control plasmid use 10 pg 1 ul Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C Medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction should produce several hundred colonies
35. frame redesign your PCR primers Incorrect antibody used for detection Use an antibody to your protein or one of the antibodies listed on page xi as appropriate Low expression of recombinant protein Gene of interest is toxic to E coli Note Evidence of toxicity includes loss of plasmid or slow growth relative to a control e Transform your expression construct into an E coli strain in which 17 RNA polymerase expression is tightly regulated e g BL21 AI see page 5 e Transform your expression construct into a BL21 strain containing pLysS or pLysE e g BL21 Star DE3 pLysS see page 5 e Transform the BL21 E coli strain then perform the expression at room temperature rather than 37 C Appendix Performing the Control Reactions Introduction Before Starting Producing the Control PCR Product We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product using reagents included in the kit and using it directly in a TOPO cloning reaction For each transformation prepare two LB plates containing 100 ug ml ampicillin Use the procedure below to produce the 750 bp control PCR product using Taq polymerase 1 Ina0 5 ml microcentrifuge tube set up the following 50 ul PCR Reagent Amount Control DNA
36. ghtly regulated expression of recombinant protein thus making it ideal for use to express toxic proteins All BL21 derived E coli cells available from Invitrogen are supplied chemically competent in One Shot format for fast easy and efficient transformation For more information about any of these strains see www invitrogen com or contact Technical Service page 36 E coli Strain Features Benefit Catalog no BL21 AI Carries T7 RNA polymerase gene under the Tight regulation C6070 03 control of the araBAD promoter allowing and high level tightly regulated inducible expression of T7 expression of toxic RNA polymerase proteins BL21 Star DE3 e Carries a mutated RNase E gene Extremely high C6010 03 rne131 allowing increased mRNA expression of non stability and higher protein yields toxic proteins e Contains the ADE3 lysogen allowing IPTG inducible expression of T7 RNA polymerase BL21 Star DE3 pLysS e Carries a mutated RNase E gene High expression of C6020 03 rne131 allowing increased mRNA proteins that are stability and higher protein yields slightly growth e Contains the ADE3 lysogen allowing inhibitive to E coli IPTG inducible expression of T7 RNA polymerase e Contains the pLysS plasmid reducing basal expression of T7 driven genes Experimental Outline Flow Chart The flow chart below describes the general steps required to produce and TOPO Clone your Tag amplif
37. h your samples The table below lists some potential problems and possible solutions that may help you troubleshoot the TOPO Cloning and transformation reactions To help evaluate your results we recommend that you perform the control reactions see Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies Incomplete extension during PCR Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Excess or overly dilute PCR product used in the TOPO Cloning reaction Reduce or concentrate the amount of PCR product PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Used a proofreading poly merase or a Tag proofreading polymerase mixture for PCR e Use Tag polymerase or another DNA polymerase that leaves 3 A overhangs to produce your PCR product e Add 3 A overhangs to your blunt PCR product by incubating with Taq poly merase see page 29 Large PCR product e Increase the amount of PCR product used in the TOPO Cloning reaction e Increase the incubation time of the TOPO Cloning reaction from 5 minutes to 30 minutes e Gel purify the PCR product to remove primer dimers and other artifacts PCR reaction contains artifacts i e does not run as a single band on an agarose gel Optimize your PCR conditions
38. ied PCR product into pEXP5 NT TOPO or pEXP5 CT TOPO Produce your PCR product TOPO Cloning Reaction Mix together PCR product and pEXP5 TOPO vector Incubate 5 minutes at room temperature Transform into TOP10 E coli cells Select and analyze colonies Choose a positive transformant and isolate plasmid DNA Express the protein of interest in one of the Expressway Cell Free E coli Expression Systems or by transforming an appropriate BL21 E coli strain Methods Designing PCR Primers Introduction Before using the pEXP5 NT TOPO or pEXP5 CT TOPO TA Expression Kit you must first design PCR primers and produce your PCR product Use the guidelines and diagrams provided in this section to help you design PCR primers Cloning into pEXP5 NT TOPO allows expression of your recombinant protein fused to an pEXP5 NT TOPO N terminal peptide containing a polyhistidine 6xHis tag and a TEV recognition site The 6xHis tag enables detection of the recombinant protein with an Anti HisG Antibody and purification using metal chelating resin The TEV recognition site allows removal of the N terminal tag using TEV Protease Consider the following when designing your PCR primers Refer to the diagram on page 7 for more help If you wish to Then Include the N terminal 6xHis tag Design the forward PCR primer to place the gene of interest in frame with the N terminal tag Note
39. in E coli Once you have obtained purified plasmid DNA of your pEXP5 NT TOPO or pEXP5 CT TOPO expression construct you may express your recombinant fusion protein by e Performing a cell free protein synthesis reaction using one of the Expressway Cell Free E coli Expression Systems e g Expressway Maxi or NMR Cell Free E coli Expression System e Transforming a suitable BL21 E coli strain General guidelines are provided in this section You may prepare plasmid DNA using your method of choice We recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 or the S N A P MidiPrep Kit Catalog no K1910 01 available from Invitrogen Your pEXP5 NT TOPO or pEXP5 CT TOPO expression construct provides an optimal template for recombinant protein production in one of the Expressway Cell Free E coli Expression Systems e g Expressway Maxi or NMR Cell Free E coli Expression Systems To synthesize and analyze your recombinant fusion protein from pEXP5 NT TOPO or pEXP5 CT TOPO using one of the Expressway Cell Free E coli Expression Systems refer to the manual supplied with the kit you are using Manuals are also available for downloading from www invitrogen com or by contacting Technical Service page 36 To facilitate expression of your recombinant fusion protein in E coli you must use a strain that permits expression of T7 regulated genes We recommend using one of the BL21
40. in TE buffer using the starting volume of the PCR reaction You may also gel purify your PCR product after amplification with a proofreading polymerase After purification add Tag polymerase buffer dATP and 0 5 unit of Tag polymerase Incubate the reaction for 10 15 minutes at 72 C and use in the TOPO Cloning reaction Note 29 Expressing Recombinant Protein in E coli Introduction Expression Guidelines Preparing Samples 30 Follow the guidelines provided in this section or your own protocol to express your recombinant fusion protein from your pEXP5 NT TOPO or pEXP5 CT TOPO construct in E coli You will need purified plasmid DNA of your expression construct and a suitable BL21 derived E coli strain Since each recombinant protein has different characteristics that may affect expression levels we recommend performing a time course experiment to determine the conditions needed for optimal expression of your recombinant protein Follow these general guidelines to perform expression your recombinant fusion protein These guidelines assume that you are using a BL21 derived E coli strain in which the expression of T7 RNA polymerase is inducible 1 Transform your pEXP5 NT TOPO or pEXP5 CT TOPO expression construct into suitable competent BL21 derived E coli see the manual supplied with the cells for instructions to perform transformation 2 Select an appropriate transformant and initiate a culture
41. logical supplies i e plates spreaders you will need the following reagents and equipment e TOPO Cloning reaction from Step 2 previous page e One Shot TOP10 chemically competent E coli supplied with the kit e S OC Medium supplied with the kit e pUC19 positive control to verify transformation efficiency if desired e 42 C water bath or electroporator with cuvettes optional e 15 ml sterile snap cap plastic culture tubes for electroporation only e LBplates containing 100 ug ml ampicillin two for each transformation e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned into the vector Sequencing primers are included in the kit to allow you to sequence across an insert in the TOPO Cloning site to confirm orientation and reading frame continued on next page Transforming One Shot TOP10 Competent E coli continued Preparing for Transformation Important One Shot TOP10 Chemical Transformation Protocol For each transformation you will need one vial of One Shot competent cells and two selective plates Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli Warm the vial of S O C Medium to room temperature Warm LB plates containing 100 pg ml ampicillin at 37 C
42. mercial re search purposes only A separate license under patents owned by BSA is required for any commercial use including the use of these materials for research purposes or production purposes by any commercial entity Information about commercial license may be obtained from The Office of Technology Transfer Brookhaven National Laboratory Bldg 475D P O Box 5000 Upton New York 11973 5000 Phone 516 344 7134 2 No materials that contain the cloned copy of the T7 gene 1 the gene for T7 RNA polymerase may be distributed further to third parties outside of your laboratory unless the recipient receives a copy of this sub license and agrees to be bound by its terms This limitation applies to strains BL21 DE3 BL21 DE3 pLysS and BL21 DE3 pLysE CE6 BL21 SI Competent Cells and any derivatives that are made of them You may refuse this sub license by returning this product unused in which case Invitrogen accept return of the product with a full refund By keeping or using this product you agree to be bound by the terms of this license Product Qualification Introduction pEXP5 NT and pEXP5 CT Vectors TOPO Cloning Efficiency Primers One Shot TOP10 Chemically Competent E coli This section describes the criteria used to qualify the components of the pEXP5 NT TOPO and the pEXP5 CT TOPO TA Expression Kits Prior to adaptation with topoisomerase I the parental supercoiled pEXP5 NT and pEXP5 CT vectors are q
43. moter Allows expression of the ampicillin resistance gene in E coli Ampicillin resistance gene lactamase Allows selection of the plasmid in E coli pUC origin of replication ori Allows high copy replication and maintenance in E coli 35 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech _service invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com Material Data Safety Sheets MSDSs Limited W
44. n follow the manufacturer s instructions Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the transformation mixture for 1 hour at 37 C before plating Insufficient amount of E coli plated Increase the amount of E coli plated Transformants plated on selective plates containing the wrong antibiotic Use the appropriate antibiotic for selection continued on next page 23 Troubleshooting continued Cell Free Expression Prokaryotic Expression 24 If you are using an Expressway Cell Free E coli Expression System to express your recombinant protein and need assistance to troubleshoot your expression experiment refer to the manual supplied with the product If you are using another cell free system follow manufacturer s instructions and recommendations If you are using a BL21 derived E coli strain as a host to express your recombinant protein refer to the table below for general solutions to troubleshoot your expression experiment For solutions related to specific features of each BL21 derived E coli strain see the manual supplied with the strain Problem Reason Solution No expression of recombinant protein Gene of interest not in frame with the epitope tag Sequence your construct to verify if the insert is cloned in frame with the epitope tag If not in
45. n Kit Quick S N A P Method Smearing multiple banding primer dimer artifacts or large PCR products gt 3 kb may necessitate gel purification If you wish to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Three simple protocols are provided below The cloning efficiency may decrease with purification of the PCR product e g PCR product too dilute You may wish to optimize your PCR to produce a single band see Producing PCR Products page 10 TM The S N A P Gel Purification Kit available from Invitrogen Catalog no K1999 25 allows you to rapidly purify PCR products from regular agarose gels 1 Electrophorese amplification reaction on a 1 to 5 regular TAE agarose gel Note Do not use TBE to prepare agarose gels Borate interferes with the sodium iodide step below 2 Cutoutthe gel slice containing the PCR product and melt it at 65 C in 2 volumes of the 6 M sodium iodide solution 3 Add 1 5 volumes Binding Buffer Load solution no more than 1 ml at a time from Step 3 onto a S N A P column Centrifuge for 1 minute at 3000 x g in a microcentrifuge and discard the supernatant If you have solution remaining from Step 3 repeat Step 4 Add 900 ul of the Final Wash Bu
46. n error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Tech nology Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Use of the pEXP5 NT TOPO or pEXP5 CT TOPO TA Expression Kit is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its compon ents or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing
47. of the lacUV5 promoter allowing expression of T7 RNA polymerase to be induced by isopropyl B D thiogalactoside IPTG Expressing a slightly toxic or toxic gene Use a BL21 derived strain that expresses T7 RNA polymerase in a tightly regulated manner e g BL21 AT Alternatively use a BL21 derived strain containing the pLysS or pLysE plasmid The pLysS and pLysE plasmids express varying levels of T7 lysozyme which binds to 17 RNA polymerase and inhibits transcription BL21 strains that contain the pLysS or pLysE plasmids exhibit reduced basal levels of T7 RNA polymerase enabling expression of slightly toxic or toxic genes respectively Protein yield desired To express the highest levels of recombinant protein use a BL21 derived strain that helps prevent mRNA degradation e g BL21 Star or one that does not contain the pLysS or pLysE plasmid For recommended BL21 derived strains available from Invitrogen see the next page continued on next page T7 Regulated Expression continued Recommended BL21 Strains Many BL21 derived strains are available from Invitrogen for expression of recombinant proteins from pEXP5 NT TOPO or pEXP5 CT TOPO Choose one of the following recommended BL21 derived strains depending on your needs If you are expressing your recombinant protein for the first time and are uncertain about its effect on the cells i e toxicity we recommend using the BL21 AT E coli strain This strain allows ti
48. og no K9900 98 Cell Free E coli Expression Systems but each System is also available separately from Invitrogen see page x for ordering information TM For more information about the Expressway Maxi or NMR Cell Free E coli Expression Systems refer to the manual for each product Manuals are included with Catalog nos K9900 96 and K9900 98 but are also available for downloading from www invitrogen com or by contacting Technical Service page 36 T7 Regulated Expression The Basis of T7 Regulated Expression Use of TOP10 Cells The pEXP5 NT TOPO and pEXP5 CT TOPO vectors allow expression of your gene of interest in E coli under the control of the strong bacteriophage T7 promoter In bacteriophage T7 the T7 promoter drives expression of gene 10 10 T7 RNA polymerase specifically recognizes this promoter To express the gene of interest in E coli you may use a bacterial host that expresses T7 RNA polymerase or infect the cell with phage expressing T7 RNA polymerase We generally use a BL21 derived E coli strain as the host for the expression construct These strains express T7 RNA polymerase in a regulated manner thus facilitating regulated expression of the gene of interest Many BL21 derived strains are available from Invitrogen For more information about some of the options available see the next page For more information about T7 based expression systems see published references Studier et al 1990
49. on with an Anti His C term Antibody and purification of the recombinant protein using metal chelating resin Consider the following when designing your PCR primers Refer to the diagram on page 8 for more help Note For maximal expression of native protein design the forward PCR primer to place the initiation ATG codon of the desired protein 6 10 base pairs from the RBS Gold 1988 Miller 1992 This ensures the optimal spacing necessary for proper translation to occur If you wish to Then Express your protein Design the forward PCR primer such that the first 3 nt with a native of the PCR product encode the initiation ATG codon of N terminus using the your protein vector encoded RBS Include the C terminal Design the reverse PCR primer to remove the native 6xHis tag stop codon in the gene of interest and preserve the reading frame through the C terminal tag Not include the Include the native sequence encoding the stop codon C terminal 6xHis tag in the reverse PCR primer or make sure the stop codon is upstream from the reverse PCR primer binding site When synthesizing PCR primers do not add 5 phosphates to the primers as this Important will prevent the synthesized PCR product from ligating into the pEXP5 NT TOPO or pEXP5 CT TOPO vector continued on next page Designing PCR Primers continued TOPO Cloning Use the diagram below to help you design PCR primers and produce your PCR
50. oporate your samples using your own protocol and your electroporator Note If you have problems with arcing see recommendation below Immediately add 250 ul of room temperature S O C Medium Transfer the solution to a 15 ml snap cap tube i e Falcon and shake for at least 1 hour at 37 C to allow expression of the ampicillin resistance gene Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C Medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Transformants page 17 To prevent arcing of your samples during electroporation the volume of cells should be between 50 and 80 ul 0 1 cm cuvettes or 100 to 200 ul 0 2 cm cuvettes If you experience arcing during transformation try one of the following suggestions Reduce the voltage normally used to charge your electroporator by 10 Reduce the pulse length by reducing the load resistance to 100 ohms Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation Analyzing Transformants Analyzing Positive 1 Pick 10 colonies and culture them overnight in LB or SOB medium containing Clones Sequencing Analyzing Transformants by
51. p and Features of pEXP5 NT TOPO pEXP5 NT TOPO The figure below shows the features of the pEXP5 NT TOPO vector The Map complete sequence of pEXP5 NT TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 36 CCCTT JES cj 6 67 Comments for pEXP5 NT TOPO 2745 nucleotides T7 promoter bases 1 17 T7 forward priming site bases 1 20 Ribosome binding site RBS bases 68 73 Initiation ATG bases 80 82 Polyhistidine 6xHis region bases 92 109 HisG epitope bases 92 112 TEV recognition site bases 122 142 TOPO recognition site 1 bases 141 145 TOPO recognition site 2 bases 146 150 T7 reverse priming site bases 198 217 T7 transcription terminator bases 159 287 bla promoter bases 399 497 Ampicillin resistance gene bases 498 1358 pUC origin 1503 2176 continued on next page 32 Map and Features of pEXP5 NT TOPO continued Features of pEXP5 NT TOPO pEXP5 NT TOPO 2745 bp contains the following elements All features have been functionally tested Feature Benefit T7 promoter Allows high level expression of your recombinant protein in the Expressway Cell Free E coli Expression System or in E coli strains expressing the T7 RNA polymerase T7 forward priming site Allows sequencing in the sense orientation Ribosome binding site RBS Optimally spaced from the initiation ATG for efficient
52. rom Invitrogen Catalog no K1220 01 incorporates many of the recommendations found in this reference For more information refer to www invitrogen com or contact Technical Service see page 36 Gel purify your fragment using one of the methods on pages 27 28 Take care to avoid sources of nuclease contamination 11 Setting Up the TOPO Cloning Reaction Introduction Note Using Salt Solution in the TOPO Cloning Reaction 12 Once you have produced the desired PCR product you are ready to TOPO Clone it into the pEXP5 NT TOPO or pEXP5 CT TOPO vector and transform the recombinant vector into One Shot TOP10 competent E coli You should have everything you need set up and ready to use to ensure that you obtain the best possible results We suggest that you read this section and the section entitled Transforming One Shot TOP10 Competent E coli pages 14 16 before beginning If this is the first time you have TOPO Cloned perform the control reactions on pages 25 26 in parallel with your samples We have found that including salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction can increase the number of transformants 2 to 3 fold In addition incubating the reaction mixture for greater than 5 minutes in the presence of salt can also increase the number of transformants This is in contrast to earlier experiments without salt where the number of transformants decreases as the incubation time increases
53. s 17 Expression and Anal ysis ssoi ia ro ete Soot ek seele bt un eid Nie 19 MFOUDIESNOGUNG siisisaieeiniveleniatiaiunanaadtuinjesnieinsandiusasauonehinnadsaiaecdmeinaiaetausaupreboneainenneiaeranes 22 ADDODOD naar 25 Performing the Control Reactions eneee anane de ted sane nich aan use 25 Gel Purifying PCR Products tete ungenau Pee Le iile eret he 27 Addition of 3 A Overhangs Post Amplification eesssenennessenennnnnennnnnenennnesenennannnn 29 Expressing Recombinant Protein in E coli sse nennen 30 Map and Features of pEXP5SNT DOPQ iuueni a al 32 M p and Features Gf PEXPSCT TOP One nanan eh ap Greta 34 Technical Service one die egt eee mde dated eed 36 Purchaser Notification noH ERR RAD m 37 Product Qualification 3 5 neon enda i E E eden e TEE UI 40 R fererices n edet De ede pae RI ERE de ER dios tie be epe aede b de ei eta 41 iii iv TOPO Cloning Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced users of the TOPO Cloning procedure If you are performing the TOPO Cloning procedure for the first time we recommend that you follow the detailed protocols provided in the manual Step Action Produce PCR product Produce PCR products using Taq polymerase and your own protocol End the PCR reaction with a final 7 to 30 minute extension step Perform the TOPO 1 Set up one of the following TOPO Cloning reactions
54. s of the primers included with the kits Primer Sequence pmoles Supplied T7 Forward 5 TAATACGACTCACTATAGGG 3 327 17 Reverse 5 TAGTTATTGCTCAGCGGTGG 3 325 T7 Term Reverse 5 ATCCGGATATAGTICCICCTTIC 3 434 The following reagents are included with the One Shot TOP10 Chemically Competent E coli kit Transformation efficiency is 1 x 10 cfu ug plasmid DNA Store at 80 C 0 5 mM EDTA pH 8 Reagent Composition Amount S O C Medium 2 Tryptone 6ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCb 10 mM MgSO 20 mM glucose TOP10 cells 11 x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 ul F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL StrF endA1 nupG ix Accessory Products Introduction Additional Products The products listed in this section may be used with the pEXP5 NT TOPO or pEXP5 CT TOPO TA Expression Kit For more information refer to our Web site www invitrogen com or call Technical Service see page 36 Some of the reagents supplied in the pEXP5 NT TOPO or pEXP5 CT TOPO TA Expression Kit and other reagents suitable for use with the kits are available separately from Invitrogen Ordering information for these reagents is provided below Note Other reagent quantities may be available
55. that e A Shine Dalgarno ribosome binding site RBS is included upstream of the initiation ATG in the N terminal tag and is optimally spaced to facilitate proper translation e At least two non native amino acids will be present between the TEV cleavage site and the start of your gene Recommendation If you plan to use the expression construct as a template for cell free protein synthesis in the Expressway Cell Free E coli Expression System design the forward PCR primer such that the first 3 nt of the PCR product encode the ATG initiation codon of your protein This minimizes the number of non native amino acids added to the N terminus of your gene and maximizes the yield of recombinant protein obtained Express your protein with a native N terminus i e without the N terminal tag Design the forward PCR primer to include the following e A stop codon to terminate the N terminal tag e A second RBS e g AGGAGA 6 10 base pairs 5 of the initiation ATG codon of your protein When designing the reverse PCR primer be sure to include a stop codon in the reverse primer or design the reverse PCR primer to hybridize downstream of the native stop codon continued on next page Designing PCR Primers continued Cloning into pEXP5 CT TOPO allows expression of your recombinant protein fused to a pEXP5 CT TOPO C terminal peptide containing a polyhistidine 6xHis tag The 6xHis tag enables detecti
56. tor Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites CCCTT and cleaves the phosphodiester backbone in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Topoisomerase t ond um CCCTT ENAGGG GGGAFA PCR Product fTCCC HO A Topoisomerase The Expressway Maxi and NMR Cell Free E coli Expression Systems facilitate T7 based in vitro transcription and translation of target DNA to protein in a single tube The System uses an optimized E coli extract a reaction buffer containing an ATP regenerating system amino acids and an optimized Feed Buffer to facilitate production of recombinant protein in 3 6 hours without the need for specialized equipment The recombinant protein produced is suitable for use in downstream structural proteomics applications including x ray crystallography mass spectrometry and NMR spectroscopy The pEXP5 NT TOPO and pEXP5 CT TOPO TA Expression Kits are supplied with the Expressway Maxi Catalog no K9900 96 or Expressway NMR Catal
57. translation of the PCR product Initiation ATG Allows translation initiation of the recombinant fusion protein N terminal polyhistidine 6xHis tag Allows detection of the recombinant fusion protein with an Anti HisG Antibody and purification with metal chelating resin i e ProBond or Ni NTA TEV recognition site Glu X X Tyr X Gln Ser Allows removal of the N terminal tag from your recombinant fusion protein using TEV protease Carrington and Dougherty 1988 Dougherty et al 1988 Dougherty et al 1989 TOPO Cloning site Allows rapid cloning of your Taq amplified PCR product T7 transcription terminator Sequence from bacteriophage T7 that allows efficient transcription termination T7 reverse priming site Allows sequencing of the insert bla promoter Allows expression of the ampicillin resistance gene in E coli Ampicillin resistance gene B lactamase Allows selection of the plasmid in E coli pUC origin of replication ori Allows high copy replication and maintenance in E coli 33 Map and Features of pEXP5 CT TOPO pEXP5 CT TOPO The figure below shows the features of the pEXP5 CT TOPO vector The Map complete sequence of pEXP5 CT TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 36 Comments for pEXP5 CT TOPO 2685 nucleotides T7 promoter bases 1 17
58. ualified by restriction enzyme digestion to verify identity and structure After adaptation with topoisomerase I each lot of pEXP5 NT TOPO or pEXP5 CT TOPO vector is functionally qualified using the control reagents included in the kit Under conditions described on pages 25 26 a 750 bp control PCR product is amplified TOPO Cloned into the appropriate pEXP5 TOPO vector and transformed into the One Shot TOP10 chemically competent E coli included with the kit Each lot of vector should yield greater than 85 cloning efficiency Primers are lot qualified by DNA sequencing experiments using the dideoxy chain termination technique One Shot TOP10 chemically competent cells are tested for transformation efficiency using the control plasmid included in the kit Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be greater than 1 x 10 cfu ug plasmid DNA In addition untransformed cells are tested for the appropriate antibiotic sensitivity and lack of phage contamination 39 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Brownstein M J Carpten J D and Smith J R 1996
59. using the reagents in the Cloning Reaction order shown For electroporation dilute Salt Solution 4 fold to prepare Dilute Salt Solution Reagent Chemical Transformation Electroporation Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution Tul Dilute Salt Solution Tul Water to a final volume of 5 ul to a final volume of 5 pl TOPO Vector 1ul 1 pl Total volume 6 ul 6 ul 2 Mix gently and incubate for 5 minutes at room temperature 3 Place on ice and proceed to transform One Shot chemically competent E coli below Transform One Shot 1 For each transformation thaw one vial of One Shot E coli cells on ice Chemically Competent 2 Add 2 ul of the TOPO Cloning reaction into a vial of One Shot chemically E coli competent E coli and mix gently 3 Incubate on ice for 5 to 30 minutes 4 Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tube to ice 5 Add 250 ul of room temperature S O C Medium 6 Incubate at 37 C for 1 hour with shaking 7 Spread 10 50 ul of bacterial culture on a prewarmed LB agar plate containing 100 ug ml ampicillin and incubate overnight at 37 C Control Reaction We recommend using the Control PCR Template and the Control PCR Primers included with the kit to perform the control reaction See the protocol on pages 25 26 for instructions vi Kit Contents and Storage Types of Kits This manual is supplied with the following products Catalog num

User Manual - Thermo Fisher Scientific

Contents

Download Pdf Manuals

Related Search

Related Contents