E-myco plus user manual
Contents
1. MgCl 1 5 mM Mycoplasma Primers Set Internal Control 8 MOP dissolved in DMSO Dried under iNtRON s instruction Overview of Mycoplasma Detection Cel count gt Optional PROTOCOL B Cell boiling method in J 7 95 C 10min PROTOCOL A Genomic DNA method Template DNA extraction using i genomic CTB DNA Extraction Mini Kit Cat No 17341 for Mycoplasma detection g v P o ww G ji Y s a Y i 4 Use as ONA template i i y Ww ad y hd uM iy ty a ey Discard J e Myco plus Mycoplasma PCR Detection Kit 2 a 1 tube 20 ul D W 1 as negative control 2 tube 1 ul DNA 19 ul D W d PCR Reaction J Detection on agarose gel J optional UV irradiation 10 min a J Discard the PCR product tube ms TECHNICAL INFORMATION contribute to signal differences in your experiments PROTOCOL A Using the genomic DNA extraction kit e This e Myco plus Mycoplasma PCR Detection Kit offers a sensitive means to detect Mycoplasma contamination in cell lines Under optimal conditions templates derived from supernatants of an infected cell culture will yield a maximum signal in the PCR whereas an uninfected cell line will yield no PCR products Undoubtedly there will be variations in cell numbers infection amount and templates that may It is recommended to use the cultured cells for 3 6 days after sub culturing as a sample for Mycoplasma det2. homogeneously resuspended 4 Extract the genomic DNA from the harvested cell We recommend to use the i genomic CTB DNA Extraction Mini Kit Cat No 17431 in genomic DNA extraction The quantity and quality of template DNA used in Mycoplasma detection is important for reliable and acceptable analysis 5 Add the genomic DNA purified using the i genomic CTB DNA Extraction Mini Kit Cat No 17431 to each tube of e Myco plus Mycoplasma PCR Detection Kit as a template and then add sterile water to fill the reaction mix up to 20 ul Note Appropriate amounts of template DNA in a sample 1 50 ng 6 After sample mixing perform PCR according to the following procedure Note We recommend to perform one negative control reaction with sterile water as a template We also recommend to perform positive control reaction with 0 1 1 ul of control DNA solution PCR Condition Initial denaturation Denaturation Annealing Extension Final extension 7 For analysis by electrophoresis use 5 ul of PCR reaction mixture 8 PCR products should be discarded after UV irradiation 10 min to prevent cross contamination Note Cross contamination is a common problem with PCR Please discard the PCR products after UV irradiation 365 nm to prevent cross contamination Optional PROTOCOL B Using the Boiling Extract Method Prepare cell suspensions from the test cell culture in a 1 5 ml tube Then count cell numbers by general counting m
3. verecundum M vulturii wenyonii M yeatsii M zalophi M zalophidermidis Mycoplasma sp Saate lycoplasmasp Z61 Mycoplasma sp SF12 Mycoplasma sp 07SH h Mycoplasma sp 07SH p Mycoplasma sp 10T3 lycoplasmasp 1074 Mycoplasmasp 11CL2 Mycoplasma sp 1220 Mycoplasma sp 13CL Mycoplasma sp 15CL2 lycoplasma sp 237 AT Mycoplasma sp 2F1AT Mycoplasma sp 34CL Mycoplasma sp 39CL Mycoplasma sp 50587 lycoplasma sp 8790CV Mycoplasma sp 94630 Mycoplasma sp A1802T Mycoplasma sp ARNO Mycoplasma sp bovine group 7 lycoplasma sp C3T Mycoplasma sp China 1 Mycoplasma sp CSL 4779 Mycoplasma sp CSL 7518 lung Mycoplasma sp VJC358 lycoplasma sp HRC689 Mycoplasma sp 1S2505 Mycoplasma sp M1 Mycoplasma sp M200 2 Mycoplasma sp M209 7 lycoplasma sp M209 8 Mycoplasma sp M221 9 Mycoplasma sp M222 2 Mycoplasma sp M222 5 Mycoplasma sp M26 capricolum subsp M capricolum subsp Mycoplasma sp M hyopneumoniae Mycoplasma sp capripneumoni capripneumoniae ovine caprine serogroup 11 strain J ATCC 25934 feline hemotropic Switzerland coplasma sp Saatc Mycoplasma sp SF9 lesoplasma entomophilum Mesoplasma florum Mesoplasma lactucae piroplasma apis Spiroplasma citri Spiroplasma CN 5 Spiroplasma DU 1 Spiroplasma DW 1 piroplasma gladiatoris Spiroplasma mirum Spiroplasma MQ 1 Spiroplasma taiwanense PARTIAL SEQUENCES OF MAJOR CONTAMINANTS IN CELL CULTURE The following sequences are partial sequences of major contaminant in general cell cu
4. cloacale M coccoides M collis M columbinasale M columbinum columborale M conjunctivae M corogypsi M cottewii M cricetuli erocodyli M cynos M dispar M edwardii M elephantis equigenitalium M equirhinis M erythrodidelphis M falconis M fastidiosum faucium M felifaucium M feliminutum M felis M fermentans flocculare M gallinaceum M gallinarum M gallisepticum M gallopavonis gateae M genitalium M genitalium G37 M glycophilum M gypis haemocanis M haemofelis M haemolama M haemomuris M hominis ycoplasma sp Ms01 Mycoplasma sp Ms02 Mycoplasma sp Ms03 M hyopneumoniae strain 232 Mycoplasma sp PG50 hyopneumoniae strain7448 M insons M hyorhinis M lagogenitalium M imitans hyosynoviae M indiense M iguanae M iowae M iners leocaptivus M leonicaptivi M leopharyngis M lipofaciens M lipophilum microti M moatsii M mobile M molare M monodon muris M mustelae M mycoides M mycoides subsp capri M mycoides subsp mycoides LC mycoides subsp mycoides SC M mycoides sunspr capri M neurolyticum M opalescens M orale ovipneumoniae M oxoniensis M penetrans M phocicerebrale M phocidae phocirhinis Ms5pirum M pneumoniae M primatum M pullorum pulmonis M putrefaciens M salivarium M simbae M spermatophilum maculosum M meleagridis M sphenisci M spumans M sturni Sualvi M subdolum M suis M synoviae M synoviae strain 53 testudineum Mrtestudinis M timone M
5. is not a problem of the product Check the quality or concentration of template gt If the PCR reaction is inhibited by impurities included in DNA preparation the use of 3 diluted DNA as a template may be helpful Whereas the signals of sample control app 570 bp length and internal control app 3 160 bp length are shown if the target band is not shown it indicates that the sample is not infected by Mycoplasma Check a PCR machine The problem can be caused by the PCR machine Please check the temperature and make sure to check that the machine is working properly 2 No internal control band e Check template concentration Competition can occur by using high concentrated DNA template Please repeat the PCR with a diluted template If the concentration of template is above 50 ng the signal of internal control may be disappeared by competition with the template It does not cause any problem because the signal of sample control app 570 bp Fig 3 Result of determining minimal required cell number per test To determine the minimal required cell number M fermentans infected K562 cells were grown inf pure culture serially diluted and tested The result indicates that the detection limit with this kit is 15 cells per test diluted DNA as a template may be helpful If there is no internal control band please length can function as a internal control e Check the quality of template possibili
6. 1 Prepare the cultured cell according to 1a or 1b 1a Cells grown in suspension Transfer the culture fluid into 15 ml or 50 ml of centrifuge tube and pellet the culture by centrifugation for 5 min at 3 000 rpm Remove the supernatant completely and wash the pellet with PBS or fresh media Then resuspend the washed cell pellet in appropriate volume of PBS or fresh media 1b Cells grown in monolayer Cells grown in monolayer can be detached from culture flask or plate by either Trypsinization or 2 Using a cell scraper 1 To Trypsinize cells Remove the medium and wash the cells with preheated at 37 C PBS Then aspirate the PBS and add trypsin solution After cells have become detached from culture flask or dish collect and wash the cells with PBS then resuspend the washed cell pellet in appropriate volume of PBS or fresh media 2 Using a cell scrape detach cells from culture flask or dish Collect and wash the cells with PBS then resuspend the washed cell pellet in appropriate volume of PBS or fresh media 2 Determinate the cell number using cell counter eg hemocytometer and transfer the appropriate number of cells 1 3 x 10 cells to a new 1 5 ml micro centrifuge tube 3 Pellet the cell by centrifugation for 1 min at 13 000 rpm and discard the supernatant Resuspend the cell pellet with the remaining medium by finger tapping or vortexing Note In order to ensure efficient lysis it is essential that the cell pellet are
7. DNA Marker Ong 100ng 50ng 25ng 12 5ng 6 3ng 3 2ng Lane 7 8 9 10 11 12 13 14 15 gDNA 16ng 800pg 400pg 200pg 100pg 50pg 25pg 12 5pg 6 25 pg 2 Minimal cell number required 14 dilution MN1 23 4 5 6 7 8 9 10 11 12 13 14 15 lt Sample control app 570 bp Target app 260 b r EAG az 160 bp Lane M N 1 2 3 4 5 6 Cell number 100 bp DNA Marker 0 2 5x105 1 25x10 6 25x104 3 12x104 1 56x104 7 8x103 Lane T 8 9 10 11 12 13 14 15 Cell number 3 9x10 1 9x10 9x102 4 8x102 2 4x102 120 60 30 15 3 Minimal Mycoplasma concentration detected 1 diluti Fig 4 Result of determining minimal PHYLOGENETIC ANALYSIS Gee A required concentration of ged M primatum MN12345 6 7 8 91011 12 13 14 15 Mycoplasma per test r M agalactiae To determine minimal required concentration of oe aida Mycoplasma M fermentans was selected as 0 E M spermatophilum model Mycoplasma species M fermentanswas dC ie T Daa enoi serially diluted for PCR detection a ee C a E ee ee lt a a r a a ener h i o a late A E apo 160 bp The result indicates that the detection limit es oo r with this kit is 20 cfu ml as a Mycoplasma M simbae M phocirhinis M zalophidermi dis M canimucosale A E N S M li pof aciens concentration in culture broth Lane M N 1 2 3 4 5 6 M columbinasale Copy number 100 bp DNA Marker 0 3 4x105 1 7x105 8 25x104 4 12x104 2 06x104 1 03x104 fo Tee Lane 7 8 9 10 11 12 13 14 15 M meleagridis M hyopharyng
8. DW 6 Heat the samples for 10 min and vortex for 5 10 sec Then centrifuge for 2 min at 13 000 rpm with a tabletop centrifuge at room temperature 7 Transfer an aliquot of the heated supernatant to a fresh tube This supernatant will be used as the template in the PCR Detection Kit and then add 10 ul of sterile water 9 After sample mixing perform PCR reaction according to the procedure presented in protocol A Note We recommend that you perform one negative control reaction with sterile water as a template 10 For analysis by electrophoresis use 5 pl of PCR reaction mixture 11 PCR products should be discarded after UV irradiation 10 min to prevent cross contamination Note Cross contamination is a common problem with PCR Please discard the PCR products after UV irradiation 365 nm to prevent cross contamination EXPECTABLE DATA Examination of Mycoplasma Infection M123 4 6 lt Sample control app 570 bp E Fa Target app 260 bp 4 Internal control app 160 bp Fig 1 Exemplary Data Mycoplasma Test case description Contamination Optimal Free Optimal Template amount 1 50ng 1 50ng gt 50 ng Excess template gt 50 ng Small amount of template 1 ng Free Excess template Contamination Contamination TECHNICAL GUIDE TROUBLESHOOTING GUIDE No Target band in positive reaction Check internal control band If internal controlbandsis seen PCR has been performed properly it
9. For research purpose only Not for use in diagnostic procedures for clinical purposes For IN VITRO USE ONLY e Myco pus Mycoplasma PCR Detection Kit ISO 9001 14001 Certified Company Cat No 25234 96 Tests for 20 ulrxn DESCRIPTION e Mycoplasma is a genus of bacteria which lack a cell wall Without a cell wall they are unaffected by many common antibiotics such as penicillin or other beta lactam antibiotics that target cell wall synthesis They can be parasitic or saprotrophic Several species are pathogenic in humans including M pneumoniae and M genitalium Mycoplasma species are often found in research laboratories as contaminants in cell culture Mycoplasmal cell culture contamination occurs due to contamination from individuals or contaminated cell culture medium ingredients conventional microscope Mycoplasmas may induce cellular changes including chromosome aberrations changes in metabolism and cell growth Severe Mycoplasma infections may destroy a cell line Several methods for the detection of Mycoplasmas have been published The testing required by the regulatory authorities is seeding in culture agar and liquid media This test is complicated time consuming about 3 5 weeks and some Mycoplasma species are difficult to detect with this method In recent years the disadvantages of these methods have been acknowledged such as sensitivity specificity and long and complex procedures
10. GATACCCTGGTAGTCCACGCCGTAAACGATGAGAACTAAGTOTTGGGCAAA AGGTCAGTGCTGCAGTTAACGCATTAAGTTCTCCGCCTGAGTAGTACGT As anearobium SC TTAGATACCCTAGTAGTCCACGCCGTAAACGT TGAGGACCAGGTGTEGGGOGCAT ACE TCGGCECCACAGE TAACGCATIGAGTCCTCCGCCTGGGTACTACG Mycoplasma 182 Spiroplasma 9 Consensus GGATTAGATACCCT GTAGTCCACGCCGTAAACGATGATCA TAAGTGTCGOGTGG ATCAG TC GTGC GCAGCTAACGCATTAAt TGATCCGCCTGAGTAGTATGCTCGC 24 2 20 15 10 5 i Nucleotide Substitutions x100 a Distributed by j AC SCIENTIFIC T 0505 550 5600 F 0505 550 5660 ww abcscientific com info abcscientific com Tel 818 835 0590 e Myco plus Mycoplasma PCR Detection Kit
11. and use of PCR for the detection of contaminations in cell cultures has become increasingly widespread e Myco plus Mycoplasma PCR Detection Kit greatly simplify testing and detection of Mycoplasma contamination in cell cultures With PCR testing reliable results are obtained within a few hours since the presence of contaminant Mycoplasmas can be easily and sensitively detected by simply verifying the bands of amplified DNA fragments after gel electrophoresis The e Myco plus Mycoplasma PCR Detection has been shown to be a highly sensitive specific and rapid method for the detection of Mycoplasmas contamination in cell cultures species there are some differences in the sequences of 16S rRNA gene between certain Mycoplasma species and the other species Specific primers set of e Myco plus Mycoplasma PCR Detection Kit was designed from DNA sequences that are coding for highly conserved 16S rRNA with considering above point Thus e Myco plus Mycoplasma PCR Detection Kit can be used in the detection of more broad range of Mycoplasma species compared with any other commercially available PCR based Mycoplasma detection kit without interfering with animal or bacterial DNA An internal control of this product was constructed to identify false negative results in each reaction The internal control was designed in such a way that the primers set was used to amplify the internal control and target DNA which we
12. ar M flocculare M_ovipneumoniae M hyorhinis M vulturii M moatsii M sualvi M mobile M agassizii M cheloniae M pulmonis Asteroleplasma_anaerobium A modicum Acholeplasma_morum M feliminutum Acholeplasma_granularum Acholeplasma_laidlawi Acholeplasma_oculi A bact oclasticum A varium A _abactoclasticum Movis M_wenyonii M haemolama M suis M erythrodi delphis Haemobartonella_canis Haemobartonella_felis M coccoides M haemomuris M cavipharyngis M fastidiosum M insons M imitans M gallisepticum M testudinis M pirum M genitalium M pneumoniae M iowae M muris Molis M pen trans U_urealyticum M yeatsii M cott ewii M putrefaciens M putrefaciens M capricolum M mycoides M monodon M ellychnium Entom oplasma_lucivorax Entomoplasma_luminosum Entomoplasma_somnilux S_taiwanense S_apis Entomoplasma_melaleuc ae Mes oplasma_lactucae S citri S mirum M Ovi pneumoniae itomoplasma lucivorax Entomoplasmaluminosum Entomoplasma melaleucae Entomoplasma somnilux Entoplasma ellychniae adleri Meagalactiae M agalactiae strain PG2 M agassizii M alkalescens alligatoris M alvi M amphoriforme M anatis M anseris arginini M arthritidis M auris M bovigenitalium M bovirhinis bovis M bovoculi M buccale M buteonis M californicum canadense M canimucosale M canis M capricolum M capricolum subsp capricolum hyopharyngis M hyopneumoniae M caviae M cavipharyngis M citelli
13. e K562 cell M fermentans infected more than 15 cells e K562 gDNA M fermentans infected more than 6 25 pg e Concentration of Mycoplasma in the case with M fermentans more than 20 cfu ml Sample Control Detection e Human Mammalian specific DNA sequence app 570 bp length Sample control gene is detectable from above 1 ng of template DNA Internal Control Detection e Artificial gene derived from human TNFa gene app 160 bp length Internal control can serve the tools checking any problems that may arise during amplification The signal of internal control is mostly appeared But if the amount of template added is too high above 50 ng the signal of internal control may be weaken or disappeared by competition with template DNA Experimental Data 1 Minimal amount of genomic DNA detectable dilution M N 1 23 4 5 6 7 8 9 10 11 12 13 14 15 lt Sample control app 570 bp Target app 260 bp lt Internal control app 160 bp Fig 2 Result of determining minimal required amount of genomic DNA per test To determine the minimal required amount of genomic DNA genomic DNA was isolated from a pure culture of M fermentans infected K562 cells using i genomic CTB DNA Extraction Mini Kit Cat No 17431 The isolated genomic DNA was serially diluted for PCR detection The result indicates that the detection limit with this kit is 6 3 pg of genomic DNA per test Lane M N 1 2 3 4 5 6 gDNA 100 bp
14. ection You may not detect efficiently Mycoplasma infection when you use the cells that are not or shortly cultivated The PCR conditions were optimized to obtain the highest level of sensitivity of target gene detection So the internal control band or sample control band may be sometimes disappeared depending on the efficiency of target gene amplification The efficiency of the target gene amplification is dependent upon the amount of template DNA added to the reaction Please refer the following table to show the dependency Amount of template DNA 1 50 ng of template DNA above 50 ng of template DNA below 1 ng of template DNA 6 3 pg of template DNA The amount of template DNA is depend on the extent of Mycoplasma infection Optimal conditions Three bands are appeared Masking point of internal control band Ending point of sample control band Limit of sensitivity in target gene amplification The efficiency of PCR amplification is varied by the extent of Mycoplasma infection Strong Mycoplasma infections are detected in_a little as 10 100 cell equivalents while weak infections require cell equivalents in the 5 000 50 000 cell range So we recommend to perform PCR reaction with several samples prepared from several cell numbers Please refer to Fig 3 If you want to do g notyping excise the target band from the agarose gel then isolate the DNA fragment using a gel extraction kit eg MEGA spin Agarose
15. ethods You need at least 5x10 cells per test Note 1 Harvest adherent cells with trypsin EDTA solution using standard techniques Pipette 1 ml of TE treated adherent cells Generally with suspension cells such as K562 you need not treat with TE solution We recommend that you count the cells You should prepare at least 5x104 cells per test see Technical Guide gt 50 000 cells are needed to complete this protocol Note 2 Strong Mycoplasma infections are detected in a little as 20 100 cells while weak infections require cells over 50 000 cells You can dilute the template according to the infection rates you suspect We recommend that you perform the PCR reaction after preparing serial dilutions of the straight supernatant to obtain optimal results 2 Transfer the counted cells over 5x104 cells to a 1 5 ml tube Spin the tube in ay centrifuge for 10 15 seconds Carefully decant the supernatant 3 3 Resuspend the cells in 1 ml of sterile PBS or DPBS solution for washing 3 4 Spin the tube in a centrifuge for 10 15 seconds Carefully decant the supernatant Note Optional Repeat this washing step once more T 0505 550 5600 F 0505 550 5660 Optional PROTOCOL B Using the Boiling Extract Method continued 5 Resuspend the cell pellets in 100 ul of sterile PBS or DPBS solution Note If you want the best result use of PBS solution is better than Tris 10 mM pH 8 5 TE 10 mM Tris 0 1 mM EDTA or autoclaved
16. gel DNA ExtractionKit Cat No 17183 MEGAquick spin PGR amp Agarose Gel DNA Extraction Kit Cat No 17282 TRIPLE CHECKING SYSTEM lt Sample control app 570 bp Targetband app 260 bp ternal control app 160 bp e Sample control a parameter indicating the appropriateness in sample preparation e Target band a parameter of Mycoplasma infection e Internal control a parameter checking any problems that may arise during amplification PROTOCOL You can use this protocol just for detecting the contamination of Mycoplasma However if you want to perform genotyping for the detailed determination of species please purify the genomic DNA of suspected Mycoplasma infected cells using our i genomic CTB DNA Extraction Mini Kit Cat No 17341 TECHNICAL TIP work area is clean prior to starting the assay setup CEECEET gt Use clean disposable gloves when performing the assay and make sure that the 2 Keep your reagents and PCR mixture tubes on a cold block during reaction setup 3 Use positive displacement pipettes 4 The amplification and detection areas should be physically separated i e do not use the same bench area to set up the PCR reactions and run your gels CAUTIONS e DO NOT expose to UV irradiation which activates 8 MOP if you want to determine the detailed species of Mycoplasma by DNA sequencing analysis e Myco plus Mycoplasma PCR Detection Kit
17. is Copy number 51x108 25x103 1 28x103 64x102 3 2x102 161 80 40 CC eect Miiopnium ls phenis ci JE acai SPECIES DETERMINATION BY SEQUENCING ANALYSIS ee M leocaptivus e The sequences of PCR products have slight differences among species You can determine approximately the Mil Mycoplasma species by sequencing analysis with the following primer Please refer to the phylogenetic tee on the ffs Msyrovae right side For more detailed species analysis you should perform additional sequencing with your designed primers Moriostull e We provide only the Forward primer sequence Please synthesize the primer and then use it in general sequencing Mecumbaale e Nucleotide sequence of the sequencing primer Mogens 5 GGA TTA GAT ACC CTG GTA GTC CAC G 3 Mayet Note The PCR primers set included in this kit differs from the above sequencing primer We do not list the ff Sree Morea sequences of primers comprising the PCR priters set containedin this kit E U L Meaagentaln M gateae DETECTABLE MYCOPLASMA STRAINS 8 Genus 209 Species Hn ews E a Hakala A choleplasmagranularum Acholeplasma laidlawii Acholeplasma modicum Acholeplasma morum Acholeplasma oculi es eels j M equithinis M falconis M anseris M cloacale Myc oplasa_faucium M orale M timone M buccale M salivarium M arthritidis M s ubdolum M hyos ynoviae M hominis M gypis M zalophi M collis M neurolyticum M lagogenitalium M molare M iguanae M disp
18. lture or pathogenic Mycoplasma strains You can determine the species by sequencing analysis 10 20 30 40 50 60 70 80 90 100 110 1 1 L I 1 n j 1 j L 1 L t 1 1 1 M pneumoniae SGATTAGATACEETACTAGTCCAE ACCC TAAACGAT Acs TACTAc cTOTCGGcE cBATECcETEGOTAcTOAAG TTAACACATTAAGTATCTE CETGCOTAGTAC M arginini GGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATCATTA GTCGGTGGAG AGTTCACTGACGCAGCTAACGCATTAAATGATCCOCCTGAGTAGTATGCTCG GGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATCATTA GTCGGTGGGA G CCACTGACGCAGCTAACGCATTAAATGATCCGCCTGAGTAGTATGCCCGCA M faucium GGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGATCATTA GTCGGTGGAA AA CTACTGACGCAGCTAACGCATTAAATGATCCGCCTGAGTAGTATGCTCGC M hyorhinis GGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGATCATTA GTTGGTGGAATAATTTCACTAACGCAGCTAACGLGTTAAATGATCCGCCTGAGTAGTATGCT M fermentans 6GATTAGATACCETGGTAGTCCACGCCCTAAACGATGATCATTA GCTGATGGGG AACTCATCEGCGCAGC TAACGCAT TAAATGATCCGCCTGAGTAGTACGTTCS U urealyticum ATTAGATACCCTAGTAGTCCACACCOTAAACGATCATCATTAAATGTEGGCTCGAAGCAG TCGOTGTTGTAGCTAACGCATTAAATGATSTGCCTGCGTAGTAC Me lactucae GGATTAGATACCCTAGTAGTCTACGCCGTAAACGATGAGTACTAAGTOTCOGACT A AGTTCGGTGCTOCAGCTAACGCATTAAGTACTCCOCCTGAGTAGTATGCT aa GGATTAGATACCCTAGTAGTCCACGCCGTAAACGTTGAGTACTAAGTOTCOGACTTA AGTTCGOGTGCTGCAGCTAACGCATTAAGTACTCCGCCTGAGTAGTATGC E lucivorax GGATTAGATACCCTAGTAGTCCACGCCGTAAACGATGAGTACTAAGTGTCGGGGATT TCCTCGGTGCTGCAGCTAACGCATTAAGTACTCCGOCCTGAGTAGTATGC A laidlawii GGATTA
19. re differentiated by Size Furthermore the sample control was provided with this kit for using in verifying the effectiveness of template DNA So You may easily check your sample preparation In addition the use of 8 methoxypsoralen 8 MOP was adopted in this kit 8 MOR is known to intercalate into double stranded nucleic acids and form a covalent inter strand crosslink after photo activation by incident light at wavelength 320 400 nm soNt is helpful to prevent cross contamination by PCR products from earlier experiments components for PCR except for template DNA Polymerase dNTPs PCR Buffer primers set 8 MOP and internal control So you can just add your templates and perform the PCR reaction CHARACTERISTICS e Premix Type This e Myco splas Mycoplasma PCR Detection Kit contains all the components for the PCR reaction Youjust adda template and DW e Wide Range of Detectable Mycoplasmas You can detect not only five common cell culture infecting species of mycoplasma but also other various species of Mycoplasma over 8 genus 209 species See Technical Guide e Internal Control Internal control embedded in the product prevents misjudgment that possibly arises from an erroneous PCR test e Sample Control You can verify easily the effectiveness of template gDNA by checking the amplification from sample control e Species Determination You can determine the species of Mycoplasma by seq
20. ty of contamination with PCR inhibitors If the PCR reaction is inhibited by impurities included in DNA preparation the use of inquire with our technical support staff e Check the storage condition of product 3 3 No sample control band e Check template concentration Sometimes the sample control band may disappeared when the concentration of DNA template is below 1 ng Check the quantity of DNA template and adjust the amount of DNA template in 20 ul PCR reaction to be above 1 ng e Check the source of template The primers set included in this kit can amplify a mammalian specific DNA sequence If the template source is not mammalian cell eg Plant bacteria or Mycoplasma culture the amplification of sample control does not occur 4 Presence of amplified product in the negative control 8 Add 10 ul of the template to each tube of e Myco plus Mycoplasma PCR e Check contamination of D W D W can be contaminated Perform PCR again with fresh sterile water e Check contamination of lab instruments and other environments We recommend that you use filter tips to reduce contamination and that you use a pipette after sterilization All procedures should be done in sterilized conditions 3 5 Poor resolution on agarose gel We recommend to use a 1 5 2 agarose gel We recommend that electrophoresis is performed for 40 min at 100 V 14 cm using a 6 cm long 2 agarose gel DETECTION LIMITS Target Gene Detection
21. uencing the amplified PCR products e Elimination of Cross Contamination 8 MOP prevents cross contamination by PCR products APPLICATIONS e The kit is used for the detection of Mycoplasma species that are most commonly encountered in cell culture including M arginini M fermentans M hyorhinis M orale and Acholeplasma laidlawii Furthermore a most kinds of mycoplasmas can be detected easily See Technical Guide This kit is covered by patents owned by Abbott Molecular Inc US Pat No 5 851 767 and its foreign counterparts Mycoplasma cells are physically small lt 1 um and are difficult to detect with a Though the gene sequences for 46S rRNA are very similar in most Mycoplasma Each tube of the e Myco plus Mycoplasma PCR Detection Kit contains all the KIT CONTENTS and STORAGE Label Contain e Myco plus Mycoplasma PCR Detection Kit 96 Tubes Control DNA 30 ul 20 ng ul genomic DNA from M fermentans infected K562 Hl g l DNase RNase free Distilled Water 2 ml Store at 20 C e Myco plus Mycoplasma PCR Detection Kit is a novel vacuum dried premix type This product has a stable shelf life of a minimum of 1 year when stored at 20 C and unopened container REACTION TUBE COMPONENT e PCR Reaction volume 20 ul reaction e Myco plus Mycoplasma PCR Detection Kit DNA Polymerase 2 5U Chemical Stabilizer 1x Loading Buffer 1x dNTPs 250 mM each Tris HCI pH 8 3 10 mM KCI 50 mM
Download Pdf Manuals
Related Search