Home

Laboratory Manual - ILRI Research Computing

1. 1 GeneJET PCR Purification Kit Instructions http www fermentas com templates files tiny_mce coa_pdf coa_k0701 pdf 79 Purification of PCR products for Sequencing http www biology ualberta ca facilities mbsu uploads sop_pdf Purification_of_P CR_Products_for Sequencing pdf Protocol Online PCR Product Purification http www protocol online org prot Molecular_Biology PCR PCR_Product_Purification index html Combination PEG precipitation and gel purification of PCR products for LiCor Sequencing http www auburn edu santosr protocols PEGTAEProtocol pdf Exonuclease Shrimp Alkaline Phosphatase clean up of PCR products http www nucleics com DNA_sequencing support exonucleasel SAP PCR protocol html Ethanol precipitation of DNA http en wikipedia org wiki Ethanol_precipitation Ethanol precipitation of DNA http www lifetechnologies com content dam LifeTech migration en filelibrary pdf focus par 56415 file dat focus 20volume 207 20issue 204 pdf 80 11 DNA SEQUENCING AN INTRODUCTION The Sequencing Genotyping and Oligonucleotide SegoliP Unit of the BecA ILRI Hub will sequence your PCR products by Sanger Sequencing using an ABI DNA Analyzer Sanger Sequencing adapted from http en wikipedia org wiki Sanger_sequencing cite_note Sanger1977 2 and http www giga ulg ac be jcms c_6176 sanger sequencing big dye Sanger sequencing is a method of DNA sequencing based on the se
2. 5 M NACL To prepare a 5 M NaCl solution Dissolve 292 g of NaCl in 800 mL of sterile deionized water Adjust the volume to 1 liter with water Dispense into 200 mL aliquots in Duran bottles and sterilize by autoclaving Store at room temperature 5M POTASSIUM ACETATE Dissolve 49 07 g potassium acetate in 70 mL sterile deionized water then bring up to volume to 100 mL with sterile deionized water Sterilize by autoclaving for 15 min RNASE A 20 MG ML Dissolve 200 mg of RNAse Sigma R4875 in 10 mL of 10 mM Tris HCl pH 7 5 15 mM NaClina 15 mL Falcon polypropylene tube Heat in a boiling water bath for 15 min then remove from the water bath and allow to cool to room temperature Mix by inverting the tube a few times 102 then centrifuge briefly Dispense into 1 mL aliquots in labeled 1 5 mL Eppendorf tubes and store at 20 C Alternatively purchase RNase solution 10 mg mL DNase and protease free from a biotech company Store at 20 C 20 SDS SODIUM DODECYL SULPHATE Dissolve 50 g of electrophoresis grade SDS in 200 mL of sterile deionized water Heat to 68 C in a water bath and then stir with a magnetic stirrer to dissolve If necessary adjust the pH to 7 2 by adding a few drops of 1 N HCI Adjust the volume to 250 mL with sterile deionized water Store at room temperature Sterilization is not necessary Do not autoclave SDS DTT EXTRACTION BUFFER This recipe is for 50 mL buffer which is sufficient for 100 sam
3. 12 13 14 15 GelRed information http www biotium com product product_info flyer GelRed 20 amp 20GelGreen 20F lyer pdf Mupid exU gel system http www helixxtec com e com Canadian itm00092 htm Mupid ex gel system Manual http www instrument com cn show Literature C98928 pdf How to Make and Run an Agarose Gel DNA Electrophoresis http www youtube com watch v 2UQloYhOowM Qiagen Benchguide http www qiagen com literature benchguide pdf 1017778_ benchguide_chap_1 pdf Agarose Gel Electrophoresis http en wikipedia org wiki Gel_electrophoresis Syngene Ingenius 3 manual http www gellex jp pdf item ingenius_3 InGenius_3_ manual pdf 49 7 POLYMERASE CHAIN REACTION PCR AN INTRODUCTION Adapted from the Promega website e http www promega com resources product guides and selectors protocols and applications guide pcr amplification The polymerase chain reaction PCR is a simple technique that amplifies a DNA template to produce multiple copies of a specific DNA fragment in vitro Traditional methods of cloning a DNA sequence into a vector and replicating it in a living cell often require days or weeks of work but amplification of DNA sequences by PCR requires only hours A typical amplification reaction includes target DNA a thermostable DNA polymerase two oligonucleotide primers deoxynucleotide triphosphates dNTPs reaction buffer and magnesium Once assembled the reaction is p
4. M13 primers will be used for sequencing the rbcL PCR products Store the remaining purified PCR product at 20 C 78 Example 1 8 agarose gel showing PCR products purified by precipitation M GeneRuler 1 kb Plus DNA Ladder 1 4 Purified PCR products Example NanoDrop readout showing concentrations in ng uL of the PCR primers and purified PCR products based on the A260 reading and purity based on the A260 A280 ratio 1 PlateiD well sample 10 260 280 NA Type 2 Primer fas i7783 os 10 2011 4 03PM __37 54 ng ul__ 1 138 0 693 __1 64 ssDNA 33 3 Primer 81__ MwG70 05 10 2011 4 03M 3asajng ui 1 059 0 668 __ 1 58 ssDNA 33 PCR 4 j 5 primer _ D1 mer 05 10 2011 4 23PM 68 67 ng ul_ 2os 1 256 __1 66 ssDNA 33 primers a3 fsrmes os 10 2011 s ospm _ 142ajng ui 2sa7 1s 7 _ 1ssjona so 3 srmo 05 10 2011 sosem 131 9fng ut 2638 1af 1ssjona so ic3_ srwiss os 10 2011 s ospm 121 7 ng ul__ 2 434 1 302 1 87DNA S0_ p3 srmso 05 10 2011 s osem 90 12 ng ul_ 1 802 ossa 1 8310NA 50_ E3 srmss os 10 2011 siospm 114 8 ng ul__ 2296 1 228 __1 87 0NA 50 F3_ samckM 05 10 2011 s o5pm 82 84 ng ul__ 1657 0 882 1 88 NA 50_ PCR products e3 FTass 05 10 2011 s ospm _ s4osfng ui 1 881 oss 1 s9fona so aa Frais os 10 2011 5 08PM 134 5fngjui f 269 1as 1ssjona so ea Fraza 05 20 2013 5 08PM 105 2 ng ul_ 2 104 1 12 189foNA 50 INTERNET RESOURCES AND FURTHER INFORMATION
5. Tween 20 MgCl2 dNTPs and a gel tracking dye Xylene Cyanol plus a stabilizer sorbitol that maintains full activity for over one month at room temperature and at least two years in a 20 C freezer You simply add your primers template DNA and Nuclease Free Water to a final volume of 20 uL and then run the PCR Note the PreMix contains TOP DNA polymerase not Taq DNA polymerase Top DNA polymerase is a novel thermostable DNA polymerase that is more processive than TAQ DNA polymerase The extension rate of TOP DNA polymerase is gt 3X that of TAQ DNA Polymerase TOP DNA polymerase can be used for a variety of PCR applications including TA cloning and is a robust enzyme for standard PCR It contains no proofreading or 5 3 exonuclease activity Store at 20 C 11 Individual PCR reagents Three Taq DNA polymerases are available in the workshop e Crimson Taq DNA Polymerase 5u uL with 5X Mg free PCR Reaction Buffer NEB M0325L Crimson TAQ Mg free Reaction Buffer contains a density reagent which allows direct loading of PCR products onto a gel In addition Crimson TAQ Mg free Reaction Buffer has a trace amount of a red dye which serves as a colour aid in gel loading and a tracking dye which migrates at about 10 bp on a 1 TBE agarose gel Store at 20 C e FastStart Taq DNA Polymerase 5u uL with 10X Mg free PCR Reaction Buffer Roche 12032929001 This modified recombinant Taq DNA Polymerase is inactive at tempera
6. TTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCGGTGGCTTCTGGGGGTATTCATGTT GGCATATGCCAGCTCTGACCGAAATCTTTGGAGATGATTCCGTATTACAATTTGGTGGAGGAA TTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGTGTGGCTTTAGAAGCCTG GTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCAAAGCAGCT TGCAAATGGAGTGCTGAACTAGCCGCAGCTTGTGAAATATGGAAGGAGATCAAATTTGATGGTT TCAAAGCGATGGATACCATATAA D Q zl H Q H KEY Primers rbcLa fM13 Terasa cca C CCCA rbcLa revM13 cacca cacc TaT Ca Degenerate position R A or G Sequence in RED is the M13 tail A For maize the size of a rbcL PCR product generated using primers with M13 tails is 634 bp The size of the rbcL barcode region yellow is 553 bp 70 INTERNET RESOURCES AND FURTHER INFORMATION 10 11 12 13 14 15 PCR Wikipedia http en wikipedia org wiki Polymerase_chain_reaction PCR Primer Widely used manual from Cold Spring Harbor Press http books google co ke books id IbAcGxyDO6MC amp dq PCR manual amp printsec frontc over amp source in amp hl en amp ei pzHATfKsFsLXrQFf70Z32AwW amp sa X amp oi book_result amp ct result amp resnum 11 amp ved 0CF4Q6AEwCg v onepage amp g amp f false PCR video http www youtube com watch v eEcy9k_KsDI amp feature related Bioneer Accupower PCR PreMix instructions http us bioneer com Protocol AccuPower C2 AE 20PCR 20PreMix pdf Bioneer AccuPower 2010 Brochure http us bioneer com pdf 2010 AccuPower 202010 20Brochure pdf Standard PC
7. acids or bleach to any liquid wastes containing this product is hazardous because this will liberate toxic gases DO NOT ADD acids or bleach to any liquid wastes containing this product Wear gloves e g nitrile gloves and eye protection when handling these products UV TRANSILLUMINATOR Radiation Hazard UV Transilluminators are powerful sources of UV radiation that will cause serious damage to unprotected eyes and skin Wear a UV facemask and gloves for protection 106 ELECTRICAL EQUIPMENT Never use electrical equipment while wearing wet gloves Keep water and buffer away from all electrical connections Do not use an electrical connection if it is wet 107 17 ADDITIONAL INFORMATION 10 11 12 Introduction to Molecular Biology http learn genetics utah edu http learn genetics utah edu content begin dna Molecular Biology web book http www web books com MoBio Free Video lectures Molecular Biology http freevideolectures com Course 2305 Introductory Biology 9 MIT OpenCourseWare Molecular Biology http ocw mit edu courses biology 7 28 molecular biology spring 2005 Course Molecular and Cell Biology C148 001 Spring 2011 http www dnatube com courses berkeleymolcellb Sumanas 2006 The Polymerase Chain Reaction http www sumanasinc com webcontent anisamples molecularbiology pcr html Dolan Learning Center 2006a Gel Electrophoresis http www dnalc org ddnalc rurces
8. damage reduces the length of template molecules Considerations for the correct storage of tissue is concisely summarised by Prendini Hanner and DeSalle https research amnh org amcc pdfs storage_collecting pdf In an effort to minimise the processes of denaturation and degradation preservation methods must aim to maintain the tissue samples at low temperature exclude light and other forms of radiation remove water and oxygen and sterilize against micro organisms These objectives are accomplished by freezing desiccation or the addition of preservative fluids and by storing samples in the dark at constant low temperature 23 DNA PURIFICATION The purpose of DNA purification from the cell is to ensure it performs well in subsequent downstream applications such as PCR microsatellite analysis SNP analysis DNA sequencing etc Ideally the DNA should be free of contamination with protein carbohydrate lipids or other nucleic acid e g DNA free of RNA The initial release of the cellular material is achieved by breaking the cell and nuclear membranes cell lysis Lysis must take place in conditions that will not damage the nucleic acid Following lysis the DNA is purified There are many methods that have been developed for the purification of DNA which reflects the diversity of the sample sources animal plant fungi protozoa bacteria viruses After release of DNA from the cell further purification requires removal
9. electrophoresis html Dolan Learning Center 2006b Polymerase Chain Reaction http www dnalc org ddnalc rurces pcr html Generation Challenge Programme GCP Capacity building corner http www generationcp org sp5 Guide to pH Measurement http www alliancets com site files 408 29497 109873 159912 Guide_to_ pH Mea surement pdf Qiagen Benchguide http www qiagen com literature benchguide default aspx Jean Michel Claverie Cedric Notredame Bioinformatics For Dummies 2nd Edition http www dummies com store product Bioinformatics For Dummies 2nd Edition productCd 0470089857 html http www amazon co uk Bioinformatics Dummies Jean Michel Claverie dp 0470089857 Bioinformatics for Dummies Downloads http www dummies com store product Bioinformatics For Dummies 2nd Edition productCd 0470089857 navid 322494 descCd DOWNLOAD html 108 13 14 15 16 17 BecA ILRI Hub http hub africabiosciences org Inqaba Biotec www inqababiotec co za F amp S Scientific www fnscientific com Merck Millipore www merckmillipore com Roche www roche applied science com 109 18 ABBREVIATIONS bp BPB CTAB DNA dNTPs DTT EDTA gDNA kbp PCR PVP40 RNase SDS Taq pol TBE Tris base pair Bromophenol Blue cetyltrimethyl ammonium bromide deoxyribonucleic acid deoxynucleotide triphosphates dithiothreitol ethylenediaminetetraacetic acid genomic DNA kilobase pair po
10. length of the gel 21 Document the gel with the gel doc system A specific rocL PCR product is 634 bp 22 Store PCR products at 20 C Example 1 8 agarose gel of maize rbcL PCR products generated with Bioneer PreMix tubes M 1 2 3 4 5 6 rbcL PCR product 634 bp M GeneRuler 1 kb Plus DNA ruler 1 6 rubcL maize PCR product 66 RBCL PCR USING INDIVIDUAL PCR REAGENTS TITRATING MGCL2 e PCR is very sensitive and prone to cross contamination e Work as cleanly as possible e Use filtered pipette tips throughout e Always wear disposable gloves e g nitrile gloves Change gloves frequently METHOD 1 On ice thaw primers rbcLa fM13 and rbcLa revM13 2 uM each 10X or 5X Taq Buffer 10 mM dNTP Mix and 25mM MgCl Once thawed flick the tubes to mix contents then microfuge briefly Keep on ice 2 Remove the DNA polymerase from the freezer and microfuge briefly to settle the contents and then keep on ice 3 Label eight 0 5 mL Eppendorf tubes M1 MB8 Put in a rack at room temperature Add the following to the tubes Reagent M1 M2 Nuclease Free 18 16 14 12 10 8 6 4 Water uL 25 mM MgCl uL 2 4 6 8 10 12 14 16 e PCR 0 5 1 1 5 2 2 5 3 3 5 4 4 Cap the tubes Mix by flicking and microfuge briefly Then leave at room temperature 67 5 Toa labeled 0 5 mL Eppendorf tube on ice add the following to prepare a PCR Master Mix This is sufficient for 10 reactions each wi
11. mass molarity and molarity for acids and bases are given below 1 Solution Dilution Calculator The solution dilution calculator tool calculates the volume of stock concentrate to add to achieve a specified volume and concentration The calculator uses the formula MiV1 M2V2 where 1 represents the concentrated conditions i e stock solution Molarity and volume and 2 represents the diluted conditions i e desired volume and Molarity http www sigmaaldrich com chemistry stockroom reagents learning center technical library solution dilution calculator html 2 Mass Molarity Calculator The mass molarity calculator tool calculates the mass of compound required to achieve a specific molar concentration and volume http www sigmaaldrich com chemistry stockroom reagents learning center technical library mass molarity calculator html 3 Molarity calculator for an acid or base solution The molarity calculator tool provides lab ready directions describing how to prepare an acid or base solution of specified Molarity M or Normality N from a concentrated acid or base solution http www sigmaaldrich com chemistry stockroom reagents learning center technical library molarity calculator html INTERNET RESOURCES AND FURTHER INFORMATION 1 Molarity http en wikipedia org wiki Concentration Molarity http www youtube com watch v MHOpNcvfsm8 2 Scientific notation http en wikipedia org wiki Scientific_no
12. sample 1 Cap tubes and return to ice 10 To each of tubes 11 12 13 14 15 add 2 uL 40 ng purified gDNA from plant sample 2 Cap tubes and return to ice 11 To each of tubes 8 16 add 2 uL 40 ng ve control gDNA Cap tubes and return to ice These are your positive controls 12 Place your tubes in the rack provided below along with all PCR tubes from your group 64 13 Place a lid on the rack Vortex to dissolve the dried PreMix blue pellet by holding the rack with the tubes on the vortexer for a few seconds below 14 Spin the rack tubes in a plate centrifuge at 2500 rpm for 2 min at room temp Ensure the centrifuge is balanced before use below 65 15 Perform PCR of samples in an ABI GeneAmp 9700 Thermocycler with heated lid or equivalent PCR machine with the following amplification program 16 At the end of the amplification program put the PCR tubes on ice 17 Label 16 x 0 5 mL Eppendorf tubes with numbers 1 to 16 and add 3 uL 2X DNA Gel Loading Buffer to each tube 18 After the PCR has completed add 3 uL of PCR products to the tubes containing 2X DNA Gel Loading Buffer Use a clean pipette tip for each PCR product 19 Electrophorese on a 1 8 agarose gel with GelRed Include a DNA ladder in an outside lane of each row 20 Run the gel at 50 100 V in 0 5X TBE buffer until the Bromophenol Blue has migrated 2 3 the length of the gel or the Orange G has migrated 3 4 the
13. so it is important to consider both 93 A low A260 A230 ratio may be the result of e Carbohydrate carryover often a problem with plants e Residual phenol from nucleic acid extraction e Residual guanidine often used in column based kits e Glycogen used for precipitation A high A260 A230 ratio may be the result of e Making a blank measurement on a dirty pedestal e Using an inappropriate solution for the Blank measurement The blank solution should be the same pH and of a similar ionic strength as the sample solution Example Using water for the Blank measurement for samples dissolved in TE may result in low 260 230 ratios 260 280 RATIOS Abnormal 260 280 ratios usually indicate that the sample is either contaminated by protein or a reagent such as phenol or that there was an issue with the measurement A low A260 A280 ratio may be caused by e Residual phenol or other reagent associated with the extraction protocol e Avery low concentration lt 10 ng uL of nucleic acid High 260 280 purity ratios are not indicative of an issue Although purity ratios and spectral profiles are important indicators of sample quality the best indicator of DNA or RNA quality is functionality in the downstream application of interest If the purity ratio is significantly higher than expected it is best to review the spectral profile as a primary means of troubleshooting It is important to note that there are occasions when the purity
14. to cool the solution sufficiently could deform the stand and gel tray Cooling can be done more rapidly under a running cold water tap with continuous gentle swirling so it cools evenly The gel is at the correct temperature for pouring when the bottle can just be held comfortably Note excessive cooling will lead to the gel solidifying in the bottle if this happens then you must re melt by reheating in a microwave and then cool again to 55 60 C Avoid vigorous swirling to prevent introducing bubbles into the molten gel 5 Add 3 75 uL GelRed to 125 mL agarose solution Swirl gently to mix to give an even solution but avoid introducing air bubbles 6 Pour an appropriate volume of melted agarose into the casting tray fitted with a sample comb The correct volume to use in a gel cast will be indicated in the manufacturers instructions For the Mupid ex gel kit about 30 mL of solution is required to yield a gel4 mm thick in small size trays half gel and about 60 mL of solution is required in large size trays whole gel 43 For the alternative casting system below pour approximately 12 5 mL gel into the small gels and 25 mL gel in the large gels Bubbles on the surface of the gel can be removed by pricking with a syringe needle or pipette tip Alternatively they can be moved to the edge of the gel with a syringe needle or a pipette tip Any unused gel in the Duran bottle can be stored at room temperature for later
15. to the internet for bioinformatics analysis but the skills to apply the technologies to agricultural research are largely lacking This training workshop seeks to address the skills gap in basic molecular biology and bioinformatics to increase the capacity of African scientists and institutions to conduct biosciences research and to develop and deliver new technologies for agriculture The main target group for this workshop is researchers at NARS in east and central Africa who are actively engaged in biosciences research and who need the skills to address technology gaps in their own research programs SCOPE OF THE IMBB TRAINING WORKSHOP IMBB is an intensive 2 week training workshop consisting of lectures and hands on training in DNA purification polymerase chain reaction PCR DNA sequencing and bioinformatics Participants also experience the research discovery process whereby potentially novel DNA sequences acquired by each participant are analyzed during the bioinformatics sessions Experts in molecular biology and bioinformatics from the BecA ILRI Hub and regional partner research institutions will give training WORKSHOP OBJECTIVES To give agricultural biosciences researchers from east and central Africa the working knowledge of basic molecular biology and bioinformatics that can be applied to address technology gaps in their own agricultural research programmes and that can be disseminated to other researchers at their ho
16. with a return to 94 95 C for denaturation The thermostable DNA polymerase most commonly used in PCR is Taq DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated It is often abbreviated to Taq Pol or simply Taq 50 5 E43 sequence Genomic DNA 3 5 z r O Denaturation Heat briefly y to separate DNA PCR image from scienceblogs com http scienceblogs com insolence 2007 06 the_autism_omnibus_the_difference_betwee php 51 8 PCR AMPLIFICATION OF THE CYTOCHROME C OXIDASE SUBUNIT 1 CO1 GENE FOR DNA BARCODING OF ANIMALS INTRODUCTION DNA BARCODING Adapted from e http sciencetranslation wordpress com 2009 11 14 genetics dna barcoding e http phe rockefeller edu barcode docs TenReasonsBarcoding pdf e http en wikipedia org wiki DNA_barcoding A DNA barcode is a short DNA sequence taken from standardized portions of the genome and is used to identify species Barcodes can be obtained reasonably quickly and cheaply especially through PCR Since Linnaeus biologists have used distinguishing features in taxonomic keys to apply binomial species names e g Homo sapiens From insects to birds evidence now shows that short DNA sequences from a uniform locality on genomes can be a genetic distinguishing feature Just as a Linnaean binomial species name is an abbreviated label for the morphology of a species the short sequence is an abbre
17. 0 mL of TE 1 mix 1 mL of 1 M Tris HCl pH 8 0 and 20 uL of 0 5 M EDTA pH 8 0 and sterile deionized water to 100 mL Sterilise by autoclaving Dispense 10 mL aliquots in labeled universal tubes and store at room temperature 1 Universal tubes e g 30 mL polystyrene tube from Sterilin 128B 1 M TRIS HCL PH 8 Dissolve 121 1 g of Tris base in 800 mL of deionized water Adjust the pH to 8 0 by adding approximately 42 mL of concentrated HCI Allow the solution to cool to room temperature before making final adjustments to the pH Adjust the volume of the solution to 1 liter with deionized water Dispense into 4 x 250 mL aliquots in clean 250 mL Duran bottles and sterilize by autoclaving If the 1 M solution has a yellow colour discard it and obtain Tris of better quality Note the pH of Tris solutions is temperature dependent and decreases approx 0 03 pH units for each 1 C increase in temperature For example a 0 05 M solution has pH values of 9 5 8 9 and 8 6 at 5 C 25 C and 37 C respectively WATER There are different grades of water used in the Workshop e Tap water e Deionized Water water deionized ona Milli Q system see http en wikipedia org wiki Milli Q 104 Sterile deionized water water deionized on a Milli Q system then autoclaved to sterilize Nuclease Free Water ultrapure DNase RNase Free water This is supplied in many molecular biology kits or can be purchased separately 105 16 CAUTIONS
18. 16 Your purified genomic DNA gDNA samples from muscle tissues diluted to 10 ng uL Store at 20 C 17 Positive ve control gDNA 10 ng L Store at 20 C 18 ABI GeneAmp 9700 PCR thermocycler or equivalent 54 CO1 PCR USING BIONEER ACCUPOWER PCR PREMIX KIT TUBES e PCR is very sensitive and prone to cross contamination e Work as cleanly as possible e Use filtered pipette tips throughout e Always wear disposable gloves e g nitrile gloves Change gloves frequently METHOD Thaw CO1 primers VF1d_t1 and VR1d_t1 2 uM each and DNA samples on ice Flick the tubes to mix then microfuge briefly Return to ice Prepare a water primer mix To a 0 5 mL Eppendorf tube on ice add the following Reagent Volume Final conc in the PCR Nuclease Free Water 280 uL Primer VF1d_t1 2 uM 40 uL 0 20 uM Primer VR1d_t1 2 uM 40 uL 0 20 uM Total 360 uL This is sufficient for 20 reactions Cap the tube mix by flicking a few times then microfuge briefly Store on ice Take two strips of 8 Bioneer Premix tubes from the freezer Label the strips of tubes using a fine black marker pen with numbers 1 to 16 SU O S Add 18 uL water primer mix to each of the 16 tubes Cap tubes and put in a rack at room temperature 5 To tubes 1 2 9 10 add 2 uL Nuclease Free Water Cap tubes and return to ice These are your negative controls 6 To each of tubes 3 4 5 6 7 add 2 uL 20 ng purified gDNA from m
19. 22 474 481 http www biotechniques com multimedia archive 00010 97223st01_10678a pdf 2 NanoDrop homepage www NanoDrop com 95 NanoDrop User s Manual http www icmb utexas edu core DNA Information_Sheets NanoDrop nd 1000 v3_2 users manual pdf NanoDrop 1000 Spectrophotometer User s manual http www NanoDrop com Library nd 1000 v3 7 users manual 8 5x11 pdf 1042 TECHNICAL BULLETIN NanoDrop Spectrophotometers Assessment of Nucleic Acid Purity http www NanoDrop com Library T042 NanoDrop Spectrophotometers Nucleic Acid Purity Ratios pdf Using a spectrophotometer to quantitate DNA and RNA http www mc vanderbilt edu root pdfs mclaughlin_lab dna_and_rna_with_a_spectr ophotometer pdf NanoDrop Microvolume Quantitation of Nucleic Acids movie http www jove com index Details stp ID 2565 96 14 GENOMIC DNA EXTRACTION FROM PLANTS MODIFIED DELLAPORTA METHOD This method was adapted from Dellaporta SL Wood J and Hicks JB 1983 A plant minipreparation version II Plant Mol Biol Rep 1 19 20 EQUIPMENT AND MATERIALS 1 Nitrile gloves 2 Refrigerated and non refrigerated microcentrifuges 3 0 5 mL and 1 5 mL Eppendorf tubes 4 Eppendorf tube micro pestles 5 Scissors and forceps 6 Household bleach 10 diluted in tap water 7 Shaking water bath at 65 C 8 Water bath at 37 C 9 SDS DTT Extraction Buffer Store at room temperature Pre warm to 65 C before use 10 Chloro
20. 6 17 18 19 De Groot GA During HJ Maas JW Schneider H Vogel JC Erkens RH 2011 Use of rbcL and trnL F as a two locus DNA barcode for identification of NW European ferns an ecological perspective PLoS One 2011 Jan 26 6 1 e16371 http www plosone org article info 3Adoi 2F10 1371 2Fjournal pone 0016371 Muturi et al 2011 Tracking the feeding patterns of tsetse flies Glossina Genus by analysis of bloodmeals using mitochondrial cytochromes genes PloS One Volume 6 Issue 2 17284 http www ploscollections org article info 3Adoi 2F10 1371 2Fjournal pone 001728 4 jsessionid 5D15A043BB293DOFF4ECD628F4A83405 ambra01 Kevin S Burgess et al 2011 Discriminating plant species in a local temperate flora using the rocL matK DNA barcode Methods in Ecology and Evolution 2 4 333 http onlinelibrary wiley com store 10 1111 j 2041 210X 2011 00092 x asset j 2041 210X 2011 00092 x pdf jsessionid 17CC5829E793CDC240655F68223C78F1 f01t01 gt v 1 amp t hujtpg2r amp s 3c58d1d9ed965ed8985 716783f9dfdc67a6fe73a Cold Spring Harbor DNA Barcoding 101 http www dnabarcoding101 org 72 10 PURIFICATION OF PCR PRODUCTS INTRODUCTION Adapted from http www fermentas com templates files tiny_mce coa_pdf coa_k0701 pdf PCR products must be purified or processed before they can be used in downstream applications such as DNA sequencing ligation and cloning There are many suitable methods available incl
21. CATAGGAATGGTATGAGCCA TACTATCAATTGGATTCCTAGGCTTCATTGTTTGAGCCCACCACATATT TACAGTAGGGATAGA CGTAGACACCCGAGCATACTTCACATCCGCTACCATAATCATCGCCATCCCCACCGGCATTAAA GTATTCAGCTGACTAGCAACACTGCACGGAGGGACAAT TAAATGAGACCCCCCAATATTATGAG CCCTAGGATTTATCTTCCTCTTCACAATCGGAGGCCTAACAGGCATTGTCCTAGCAAACTCCTC CCTAGACATTGCCCTACACGATACCTACTACGTGGTAGCCCACTTCCACTACGTCCTCTCAATA GGTGCCGTCTTCGCTATCCTAGCAGGATTCACTCACTGATTCCCCCTATTTACAGGCTACACCC TGCACCCCACATGAGCCAAAGCACACT TCGGAGTCATAT TCACAGGAGTGAACCTAACCTTCTT CCCCCAACACTTCCTAGGCCTAGCTGGTATACCACGACGATACTCCGACTACCCAGATACATAC ACCCTATGAAATACCATATCCTCCATCGGCTCCCTAATCTCCATAACTGCCGTAATCATACTAA TATTTATTATCTGAGAAGCCTTCGCATCAAAACGAAAGGCCCTACAACCAGAACTAACCGCCAC CAACATTGAATGAATCCACGGCTGCCCACCCCCATACCACACCTTCGAAGAACCAGCCTTCGTC CAAGTACAAGAAAGG Key Primer Vid t1 GHEKNCCANCCNCRARGAYARYGG Primer VRid 1 TAGACTICTGGGTGGCCRAARAAYCA R A G Y C T The size of a PCR product with primers VF1d_t1 and VR1d_t1 is 709 bp The size of the barcoding region in blue is 658 bp 9 PCR OF THE RIBULOSE 1 5 BISPHOSPHATE CARBOXYLASE OXYGENASE LARGE SUBUNIT RBCL FOR DNA BARCODING OF PLANTS INTRODUCTION DNA BARCODING DNA barcoding is the use of short DNA sequences of standard segment s of the genome for species identification These DNA barcode sequences can be obtained reasonably quickly and cheaply especially through PCR The ribulose 1 5 bisphosphate carboxylase oxygenase large subunit gene rbcL and the Maturase K gene mat
22. CHLOROFORM Chloroform CHCI is irritating to the skin eyes mucous membranes and respiratory tract It is a carcinogen and may damage the liver and kidneys It is also volatile Avoid breathing the vapours Wear appropriate gloves e g nitrile gloves and safety glasses and always use in a chemical fume hood SDS SDS sodium dodecyl sulphate is toxic an irritant and poses a risk of severe damage to the eyes It may be harmful by inhalation ingestion or skin absorption Wear appropriate gloves e g nitrile gloves and safety goggles Do not breathe in the dust PURELINK GENOMIC LYSIS BINDING BUFFER AND WASH BUFFER 1 contains guanidine hydrochloride Guanidine hydrochloride is extremely hazardous in case of ingestion Harmful in case of skin contact irritant and eye contact irritant Redness watering and itching characterize inflammation of the eye Skin inflammation is characterized by itching scaling reddening or occasionally blistering Contact with acids or bleach to any liquid wastes containing these products is hazardous because it will liberate toxic gases DO NOT ADD acids or bleach to any liquid wastes containing this product Wear gloves and eye protection when handling these products BINDING BUFFER IN THE GENEJET PCR PURIFICATION KIT contains guanidinium thiocyanate Wear gloves and eye protection when handling the Binding Buffer It is harmful by inhalation in contact with skin eyes or if swallowed Contact with
23. GATAAGTTGAACAAGTA CGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTACGGT AGAGCGTGTTATGAGTGTCT GTCAT GTTTCCTG rbcLa revM13 KEY Primers rbcLa fM13 TGTAAAACGACGGCCAGTATGTCACCACAAACAGAGACTAAAGC rbcLa revM13 CAGGAAACAGCTATGAC AAI Degenerate positions R AorG Sequence in RED is the M13 tail Predicted restriction endonuclease sites in Zea mays rbcL PCR product Recognition Length Overhang Number of Positions in sequence site bases sites agct 4 Blunt 6 61 153 181 190 322 624 Haelll ggcc 4 Blunt 1 13 Hhal gcgc 4 3 1 412 ccgg 4 5 1 97 Msel ttaa 4 5 3 56 68 539 Sau3A gatc 4 5 3 249 300 426 88 Example 2 agarose gel electrophoresis of digested CO1 PCR products Hpall Haelll M 1A 2A 3A 4A 5A UC UC 1A 2A 3A 4A 5A M UC CO1 PCR products from unknown animals 1A 5A digested with Hpall and Haelll UC uncut CO1 PCR product M 1Kb Plus DNA ladder Note that Hpall gives different restriction patterns with each sample indicating that the sequence of CO1 is different for each of the samples This can be confirmed with sequence analysis bioinformatics of the CO1 DNA sequences INTERNET RESOURCES AND FURTHER INFORMATION 1 Thermo Scientific Fermentas FastDigest Restriction Enzymes http www fermentas com templates files tiny_mce media_pdf FastDigest_6p_broch ure pdf 2 Restriction enzymes http en wikipedia org wik
24. K from the plastid genome are recommended as the standard barcode regions for higher land plants based on assessments of sequence quality and levels of species discrimination CBOL Plant Working Group 2009 Burgess et al 2011 In the Workshop we will use DNA barcoding of the rbcL gene to illustrate the power of PCR DNA sequencing and bioinformatics EQUIPMENT AND MATERIALS 1 rbcL primers 2 uM each in Nuclease Free Water a rbcLa forM13 TGTAAAACGACGGCCAGTATGTCACCACAAACAGAGACTAAAGC b rbcLa revM13 CAGGAAACAGCTATGACGTAAAATCAAGTCCACCRCG Primers were obtained from Bioneer Underlined sequences are M13 tails that are included in the primers to facilitate DNA sequencing of the rbcL PCR products Your plant gDNA sample 20 ng L ve control gDNA 20 ng uL Vortexer Nitrile gloves Plate centrifuge Microfuge Ice bucket and ice OMONAUR WH Pipettes and filtered tips 10 0 5 mL and 1 5 mL Eppendorf tubes 11 0 2 mL PCR tubes 12 Tube racks 62 13 Bioneer Accupower PCR PreMiix 20 uL kit Bioneer K 2016 See above for details Store at 20 C 14 Individual PCR reagents 15 16 17 18 a Three Taq DNA polymerases are available in the workshop 1 11 Crimson TAQ DNA Polymerase 5u uL with 5X Mg free PCR Reaction Buffer NEB M0325L Crimson TAQ Mg free Reaction Buffer contains a density reagent which allows direct loading of PCR products onto a gel In addition Crimson TAQ Mg fr
25. M EDTA using stocks of 1 M Tris and 0 5 M EDTA Tris Ci x Vi Cf x Vf 1000 x Vi 10 x 100 so Vi 10 x 100 1000 1 mL EDTA Ci x Vi Cf x Vf 500 x Vi 1x 100 so Vi 1 x 100 500 0 2 mL Therefore take 1 mL of 1 M Tris and 0 2 mL 0 5 M EDTA and mix with 98 8 mL water Check your result Does it make sense Example 2 How do you prepare 250 mL of buffer containing 100 mM Tris and 10 mM NaCl using stocks of 0 5 M Tris and 0 1 M NaCl Tris Ci x Vi Cf x Vf 500 x Vi 100 x 250 so Vi 100 x 250 500 50 mL NaCl Ci x Vi Cf x Vf 100 x Vi 10 x 250 so Vi 10 x 250 100 25 mL Therefore mix 50 mL of 0 5 M Tris 25 mL 0 1 M NaCl and 175 mL water Check your result Does it make sense Example 3 have a 10 solution of NaCl in a tube and would like to make 65 mL of a 7 NaCl solution What do do Ci x Vi Cf x Vf 10x Vi 7x65 Vi 7 x 65 10 45 5 mL Therefore take 45 5 mL of 10 NaCl stock and mix with 19 5 mL of water Check your result Does it make sense 19 SIMPLE DILUTION A simple dilution is one in which a unit volume of a liquid material of interest is combined with an appropriate volume of a solvent liquid to achieve the desired concentration The dilution factor is the total number of unit volumes in which your material will be dissolved The diluted material must then be thoroughly mixed to achieve the true dilution For example for a 1 5 dilution combine 1 unit vol
26. NANODROP SPECTROPHOTOMETRY OF GENOMIC DNA See Chapter 13 for instructions on using the NanoDrop The NanoDrop is a cuvette free spectrophotometer that uses only 1 2 uL to measure nucleic acid concentration and purity 1 Blank the NanoDrop with 1 5 uL of diluent used for your genomic DNA sample 2 Perform a spectral measurement with 1 5 uL of your sample 3 Once you have determined the concentration of your sample dilute an aliquot of the DNA with Nuclease Free Water in a labeled 0 5 mL Eppendorf tube to give 50 uL of 10 ng DNA wL 4 Store both the undiluted and diluted genomic DNA at 20 C 29 Example 0 8 agarose gel of high quality genomic DNA extracted from Cape Buffalo muscle using a PureLink kit M 1 M GeneRuler1 kb Plus DNA Ladder 1 Cape Buffalo genomic DNA gDNA INTERNET RESOURCES AND FURTHER INFORMATION 1 Information on other methods of DNA purification http www promega com resources product guides and selectors protocols and applications guide dna purification 2 Animal sample FTA protocols http www qiagen com hb qiacardftaspots_en 3 FTA general information http www whatman com References 51613 20FTA 20Cards 20Data 20Sheet 281 29 pdf 4 How silica spin columns work http bitesizebio com articles how silica spin column dna and rna preps work 5 Qiagen Genomic DNA Purification Technical hints applications and protocols Link 6 Promega DNA Purification http www promega com me
27. NEJET e NOTE Prior to the initial use of the GeneJET PCR Purification Kit dilute the concentrated Wash Buffer with ethanol 96 100 To 9 mL of concentrated Wash Buffer add 45 mL of ethanol Mix thoroughly Store at room temperature e Binding Buffer in the GeneJET PCR Purification Kit contains guanidinium thiocyanate Wear gloves e g nitrile gloves and eye protection when handling the Binding Buffer It is harmful by inhalation in contact with skin eyes or if swallowed Contact of guanidinium thiocyanate with acids or bleach liberates toxic gases DO NOT ADD acids or bleach to any liquid wastes containing this product 1 Combine PCR products to be purified in a 1 5 mL Eppendorf tube Measure the volume of your combined PCR products using a P200 pipette and the appropriate tip 3 Add an equal volume of Binding Buffer to the PCR products e g for 100 uL of PCR product add 100 uL of Binding Buffer Mix thoroughly by flicking and inverting the tube several times Microfuge briefly 4 Transfer the mixture to the GeneJET purification column Microfuge for 1 min at 13 000 rpm Discard the flow through 5 Add 700 uL of Wash Buffer previously diluted with the ethanol as described above to the GeneJET purification column Let it stand for 1 min Microfuge for 1 min at 13 000 rpm at room temperature Discard the flow through and place the purification column back into the collection tube 6 Centrifuge the empty GeneJET purification colum
28. R protocols http www protocol online org prot Molecular_Biology PCR Standard_PCR index htm PCR Amplification Promega overview of different PCR applications http www promega com resources product guides and selectors protocols and applications guide pcr amplification Roux 2009 Optimization and Troubleshooting in PCR http cshprotocols cshlp org content 2009 4 pdb ip66 full pdf html CO1 The ideal barcoding gene http www biotechlearn org nz themes barcoding life the_ideal_barcoding gene DNA barcoding Wikipedia http en wikipedia org wiki DNA_barcoding What is DNA barcoding http www barcodeoflife org content about what dna barcoding Barcode of Life Outreach Materials http www barcodeoflife org content resources outreach materials Barcoding animal life cytochrome c oxidase subunit 1 divergences among closely related species http rspb royalsocietypublishing org content 270 Suppl_1 S96 full pdf CBOL Plant Working Group 2009 A DNA barcode for land plants Proc Natl Acad Sci USA 106 12794 12797 http www pnas org content 106 31 12794 full Bafeel et al 2012 Ribulose 1 5 biphosphate carboxylase rbcL gene sequence and random amplification of polymorphic DNA RAPD profile of regionally endangered tree species Coptosperma graveolens subsp arabicum S Moore Degreef Plant Omics 5 3 285 290 http www pomics com bakir_5 3 2012 285 290 pdf 71 1
29. TTCTCCTCCTTGCA TCATCCACAGTAGAAG ISAGCAGGTACAGGATGAACCGTGTACCCACCCCTGGCTGGTAATT TAGCCCACCOMERSAGETT CAGTAGACCTGGCCATCTTCTCTCTTCACCTAGCAGGTGTGTCATC CATCCTAGGTGCAATCAACTTCATCACAACAGCCATTAACATAAAACCGCCCGCCCTTTCACAA TACCAAACTCCCCTCTTCGTATIECGTACTTATTACH EGTTCTACTCCTCCTCTCACTCC CAGTCCTTGCTGCTGGCATCACCATGCTACTAACA MMIGAAACCTAAACACCACATTCTTCGA CCCCC MEBIAGGAGGTGACCCAGTCCTATACCAACACCTCTTCHGAERGBTIGGGCCHESGAGAA CNA VR1d_t1 KEY Primers Degenerate positions R A or G Y Cor T Predicted restriction endonuclease sites in Bird strike CO1 PCR product Enzyme Recognition Length Overhang Number of Positions in site bases sites sequence Alul AGCT 4 Blunt 4 79 280 399 552 Haelll GGCC 4 Blunt 3 103 414 696 Hhal GCGC 4 3 1 48 CCGG 4 y 4 55 337 394 646 Msel TTAA 4 5 2 36 484 SSA GaTc 4 5 2 534 611 87 Example Zea mays rbcL PCR product sequence showing positions of the primers with M13 tails rbcLa fM13 TGTAAAACGACGGEGAGT AAGTGTTGGATTTAAMGEEG GTGTTAAGGATTATAAATTGACTTACTACACC IAGTACGAAACCAAGGATACTGATATCTT GGCAGCATTCCGAGTAACTCCTCM GECGGGGTTCCGCCTGAAGAAGCAGGAGEEGCAGT GCGGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTT GTT ACAAAGGACGATGCTATCACATCGAGCCCGTTCCTGGGGACCCAGBMEBAATATATCTGTTATGT NGGTTATCCATTAGACCTATTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGT AACGTATTTGGTTTCAAAGCCTTACGEGETCTACGTTTGGAGHMBBTACGAATTCCCCCTGCTT ATTCAAAAACTTTCCAAGGTCCGCCTCACGGTATCCAAGTTGAAAGG
30. YT Applied Molecular Genetics Laboratory Third Edition Mexico D F CIMMYT http www google co ke search q CIMMYT 2005 Laboratory Protocols 3A CIM MYT Applied Molecular Genetics Laboratory Third Edition Mexico 2C D F 3A CIMMYT amp ie utf 8 amp o0e utf 8 amp aq t amp rls org mozilla en US official amp client firefox a 4 Plant DNA extraction method http www protocol online org prot Molecular_Biology DNA DNA_Extraction_Purification DNA_Extractio n_from_Plants index html 5 Plant genomic DNA extraction using CTAB http www cilr ug edu au Userlmages File Plant 20Genomic 20DNA 20Extractio n 20by 20CTAB 20_2 Fiona pdf 6 FTA protocols for plant samples http www4 ncsu edu rgfranks research protocols FTA 20cards 20protocols BD 36 05 20 20Applying 20and 20Preparing 20Plant 20Samples 200n 20FTA 20Cards pdf DNA Extraction procedures http labs medmicro wisc edu mcfall ngai papers 2002nish3 pdf Clarke 2009 Cetyltrimethyl Ammonium Bromide CTAB DNA Miniprep for Plant DNA Isolation Cold Spring Harb Protoc doi 10 1101 pdb prot5177 http cshprotocols cshlp org content 2009 3 pdb prot5177 abstract 37 6 AGAROSE GEL ELECTROPHORESIS INTRODUCTION Adapted from e http www docstoc com docs 23538647 Agarose Gel Electrophoresis e http www biotium com product product_info Newproduct GelRed_GelGreen asp e http cibt bio cornell edu workshops_and_summer_programs 0708a
31. a A E EE E EES ESAS a 38 Eg ipmentand material Siera ee nisa i E E ta detva ca SEE i du aE E E ERREA eash 39 Method enoti siie aieeaii aan iii i ai ni EE anA aan eon dation AE AE E i e ia 42 Preparing agarose gels 0 8 1 8 2 ccsssccssssceceesececseeeeeceeneeecseaaececseeeceeaaeeeceesaeceeseeecseaeeeeseeaeeess 42 Casting thea garOSe Bel ics cccecncestedcsmnwens e i E E E A eE i causal tal tad Causey ATENE EAE NAR 42 Loading the DNA samples onto the gel ccccccccccccsssssssseeeeceececsenseaeseeecesseeeaeseeecesceeesasseseescessesasaaeaeeeesees 46 Running the gel electrophoresis ccccecsessscecececsesseaeeeseceececseseeaeceeeceseeseesessesececeeseaaseeseescesseseeaaeeeeeesees 47 Viewing and photographing the gel with the UV transilluminator Gel Doc system ccccsssececeeeeseenes 48 Cleaning the gel EQUIPMENT otaa aai a i aadi ia a aaa araia iiae a suavicde aiii aiii 48 Internet resources and further INfOLMATION ccscccsccccccecceseseeensnaseasseseccssesnsesesusaaesssecescesesesensaaaaasseeseeess 48 7 Polymerase Chain Reaction PCR An introduction sssssesesessssssoosssesessoooosssssesssoooosssessesoooosssesssso 50 8 PCR amplification of the cytochrome c oxidase subunit 1 CO1 gene for DNA barcoding of animals EEEREN EEE E NEA PSA OA E E E E OAE OAE AE E E NE AA 52 Introduction DNA BArCcOding sssssscssssscccsecesessnenssnasessecesceseseeesesaeaaesesecessesesssesaesaessseessceseenessaaaaassesssen
32. am 0 000000000001 g I Note w is often written as u Conversion Factors Molarity 1x10 M 1 mM millimolar 0 001 M 1x10 M 1 uM micromolar 0 000001 M 1x10 M 1 nM nanomolar 0 000000001 M 1x107 M 1 pM picomolar 0 000000000001 M CONCENTRATION e Concentration is the amount of a substance in a specific volume or sometimes mass of a solution or mixture e The substance that is dissolved is called the solute and the liquid is called the solvent Remember concentration and amounts are NOT synonymous e Amount is how much of a substance is present e g 4 grams 1 mole e Concentration is a ratio with a numerator amount and a denominator usually volume e g 25 g NaCl per litre water where the NaCl is the solute and water is the solvent THE M WORDS MOLE MOLAR MOLARITY e Mole symbol mol A name for 6 022 x 10 particles of something e g a chemical A mole of a chemical has a mass equal to the molecular weight or formula weight in grams e Molar symbol M The concentration in moles per litre of a solution A one molar solution contains 1 mole of a substance in 1 litre 1 L It is abbreviated M For example one molar is written 1 M 16 e Molarity Molarity is the number of moles of a chemical in 1 L of solution and is thus a unit of concentration A 1 Molar 1 M solution is equivalent to one molecular weight or formula weight MW or FW g mole o
33. ange to a dry that no air is drawn up tip t 11 DISPENSE LIQUID Hold the micropipette so that the end of the tip is inside the vessel you want to deliver it to When delivering smaller volumes into another liquid you may need to put the end of the tip beneath the surface of the liquid remember to change the tip afterwards if you do this to prevent contaminating the stock solution For smaller volumes you may also need to hold the tip against the side of the container Push the plunger down to Position 2 If you wish to mix two liquids together or resuspend a centrifuged pellet release to Position 1 and push to Position 2 a few times to draw up and expel the mixed liquids To remove the last drop of liquid from the tip push down to Position 3 If delivering into a liquid remove the tip from the liquid before releasing the plunger Release the plunger and allow it to return to Position 1 4 CHANGING THE VOLUME Some micropipettes deliver fixed volumes however the majority are adjustable Each brand uses a Slightly different method to do this Gilsons have an adjustable wheel others have a locking mechanism and turning the plunger adjusts the volume All have a readout that tells you how much is being delivered and a range of volumes that can be dispensed Trying to dispense less than the lower value of the range will result in inaccurate measurements Trying to dispense over the upper range will completely fill t
34. anism is sampled DNA is extracted a small region of DNA the Barcode DNA is PCR amplified ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAA TTGCTCCCCTACTACGTGCTATATGCGCTTACGA TCGTACGAAGATTTATAGAATGCTGEcTACcTccT The PCR product is sequenced CCCTTATTCGATAACTAGCTCGATTATAGCTACA Sequenced DNA is compared with sequences in a barcode database to identify the organism WORKSHOP PLAN Workshop plan Purify DNA _ Analyse DNA Nanodrop Gel Analyse PCR products Gel Analyse purified PCR product Nanodrop Gel Bioinformatics Learning molecular biology and bioinformatics through DNA barcoding Animal Plant DNA Muscle Leaf Unidentified species Unidentified species Mitochondrial i Ribulose 1 5 cytochrome c Polymerase Chain bisphosphate oxidase subunit Reaction PCR carboxylase 1 CO1 gene oxygenase large subunit gene rubisco rbcL from the plastid genome Analyse DNA sequence to identify species 2 USING A MICROPIPETTE This chapter was taken from the University of Queensland website http www di uq edu au sparqmicropipette INTRODUCTION Molecular biologists frequently use very small volumes of liquids in their reserach sometimes as small as 0 1 uL that s one ten thousandth of a millilitre or one ten millionth of a litre For such small volumes a micropipette is used Micropipettes have a lot of different names often based on the companies which manufacture the pipettes For example you
35. anssenteseesea exvseiseesssaninsievaaasastaeesesssuctveteecenesvistaacbesaaavastcaais sieenssaaacenn ves TISSUS EXE a CEI OM isis r a a a ea a aa a AEA E aa venous oh sebeapudasian Soups aa aaa a eae aea ASKEN E Precipitation of Proteins and Polysaccharides Solvent Extraction 1 RNAse A treatment Solvent Extraction 2 Crude DNA pellet precipitatiON ssrin aaraa ea aaa aa A aE EE eds e E AE Ea ran iaren Eaa 70 ethanol WAS Hissesi eeaeee e aa iiaeaa Ea Naa n R ia ana aa ai anaa EK RE iaiia isana Agarose gel electrophoresis of genomic DNA cccsscccccecsessssscecseeececseseeaeseeecsceeseeseeaeseeecesseeaaeseeeeeceeeeesees NanoDrop spectrophotometry of genomic DNA Q cccsscccccecsessessececeeececseseeaececeecsceesesaeeeeecseseseeaeseeeeeeens 15 RECIPES ys ccccsccvectecbicecctesecescooevesscececsccecousssaussesscscesecscewsesscecessddeccusussdccdsssscdeusseccoedsiecesesussecteeresssce 102 AO oS Lo EAE A E ET E E E A EA E E ET E O A EEE 102 5M NaC hetene EE E e A Ea ea EAE E E E S E EEA 102 5M p tassium acetate miini inne c chat deekacacetices adbencee ctl EEEE rE E EE EA EAE O EEEE ESEO 102 RNaSEA 20mg MIL eeren eE a EEEa a E EAE EEEE EEEE EENE 102 20 SDS sodium dodecyl sulphate ccccssscccesencecsesneeeeceeeececseeeeceeqaeeecseeeeeceseeeeeceeqaeeeseeaeeeseseeeeeeseas 103 SDS DIT Extraction Butter eein eesi e eae i Sacetad ocSe nuns e oei e ste sees Ghesttsde cots oneedBavaes eee 103 3M Sodium acetate DH 8 0 oraiiio
36. biosciences d Pi e Syngenta orccaamable BILL MELINDA g ILRI id Q GATES foundation agriculture eastern and central africa 8 SWEDEN Introduction to Molecular Biology and Bioinformatics Training Workshop BecA ILRI Hub Nairobi Kenya May 5 16 2014 Laboratory Manual Written and compiled by Rob Skilton Martina Kyalo Moses Njahira Bramwel Wanjala Francesca Stomeo Solomon Maina Eunice Machuka o oy Be icipe Arican insect Science for Food and Health j py TABLE OF CONTENTS 1 Introduction to the Workshop wises ccccciccceseteetecccccicateseeessendsccctcesseeessondecdencscteeeseeccecdacebsdeuesnecsdccssaeedeses 6 BOCKGIOUN PREE E E E E E A ENE 6 Scope of the IMBB training WOrkSHODP sscssssscsccececescesnesnussecescessseesesneneesausesssseceeseeneesassaesesesessneneeneaaees 6 W OFKSNOP OD CCLIVES c2ccz ccecesers savdeatedacteasteseaceusdudiwcagsdciveutesiessveatersGeceadseessuaiaaaceedactenetedsaddesdutiectanee cenous 6 DNA DQrCOCUIAG esseesesscssccececcesesnnenesassaesecseceseeeeenesaaaesseseeeessseesseaauaessesecessasssausasaaessesecessusesssuassassassecssesseses 7 Workshop Pla Mercerie tees Accs Ress coecdseacecn Get vdecch va ve Dec aae ica ois Gat TAE a dla ave ena Tetons Eea EE E eee 8 2 USING A Micropip tte cosiiccsccclssecesscccsscecedvetsssconssedsessevsseoansscansentencsadssdensvenbeevesescedesteenseveess seen seenseveess 9 PITEROGUCTI ON ee E A E A A EAA A E A E E 9 Pipette tip Sa
37. cal and must be handled in a fume hood Please dispose of all used chloroform in the designated waste bottle in the fume hood 16 Centrifuge the tube at 14 000 rpm for 10 min at 4 C in a refrigerated microfuge Note This produces two phases an upper aqueous phase which contains the DNA and a lower chloroform phase which contains some degraded proteins lipids and many secondary compounds The interface between these two phases contains most of the junk cell debris degraded proteins etc 17 Transfer 450 uL of the upper phase which will be greenish in colour taking care not to pipette up any CIA orinterface material to a new labeled 1 5 mL Eppendorf tube Keep the tubes on ice RNASE A TREATMENT 18 Remove RNAse A 10 mg mL from the freezer and keep on ice 19 Add 3 uL RNAse A to each sample and mix by flicking the tube several times Incubate in a water bath at 37 C for 30 min SOLVENT EXTRACTION 2 20 In a fume hood add an equal volume of chloroform isoamyl alcohol CIA 24 1 to each tube i e if your sample is 450 uL then add 450 uL CIA 21 Cap the tube well Then gently invert the tube gently for 5 min to extract thoroughly f you have many samples then this step can be done with the tubes in a rack Note Do not shake the tubes otherwise the DNA will shear 22 Centrifuge the tube at 14 000 rpm for 10 min at 4 C in a refrigerated microfuge This produces two phases a clear upper aqueous phase which contains th
38. cccsddccade tects cdaveduedh cosdecdesdesucenececedvevcanvadsdctocs dovuvesucetededsestuvetensecs 103 BOSC TBE Butt ete BELG ive taceecs ws Teese ecto acRe De cccesiic sae antennae aeaneutane sects atam renee ectowreeca waate ees 104 TE 1 buffer TGs CAUCIOINS ioina deerne ia aac vedi aaa eis Las aca dha ea DU eek a cae aaa Ga AOAC aaaea ENOAR Ee ANO AASA ddera a Aaaa aah Chloroform TSSADDIEVIAtIONS viet ese fiecescdicdicasessceunsscecsaasscsaduevseccsdedcsecunsceeediehedaleascbeeneedesesssccosvsadensttecensscesseusses tess 110 19 AcknoWledgeMent iscsecced ccs cessscscecececocedessbcscacecscescasessvascccceccscbsossvescccdssccessnsevescced saccesssas adecedstcees 111 PA R To E E E E TTA avails devetuccuns cde ddoasdunduedelciwaredvectndecssstueceswuuausaecbeweds 112 1 INTRODUCTION TO THE WORKSHOP BACKGROUND Biosciences have greatly enhanced our ability to quickly diagnose diseases determine the genetic diversity of pest and pathogen populations understand host pathogen interactions speed the development of new varieties of crops combine genes from a wide array of organisms in transgenic technologies and develop strategies for their management However opportunities linking modern biosciences to agricultural improvement to solve some of Africa s major agricultural problems remain largely untapped A number of NARS in the east and central Africa region have basic equipment for conducting molecular biology techniques and have access
39. dia Files Resources PAGuide Letter chap9 ashx 7 DNA Extraction procedures http labs medmicro wisc edu mcfall ngai papers 2002nish3 pdf 8 Walsh et al 1991 Chelex 100 as a Medium for Simple Extraction of DNA for PCR Based Typing from Forensic Material http www biotechniques com multimedia archive 00190 BTN_A 000114018 O 190 194a pdf 30 5 GENOMIC DNA EXTRACTION FROM PLANT MATERIALS INTRODUCTION Adapted from e CIMMYT 2005 Laboratory Protocols CIMMYT Applied Molecular Genetics Laboratory Third Edition Mexico D F CIMMYT Link e Clarke 2009 Cetyltrimethyl Ammonium Bromide CTAB DNA Miniprep for Plant DNA Isolation Cold Spring Harb Protoc doi 10 1101 pdb prot5177 http cshprotocols cshlp org content 2009 3 pdb prot5177 abstract e Centre for Integrative Legume Research CILR http www cilr ug edu au Userlmages File Plant 20Genomic 20DNA 20Extraction 20by 20CTAB 20 2 _ Fiona pdf PLANT SAMPLE COLLECTION AND STORAGE BEFORE ISOLATION OF GENOMIC DNA GENERAL CONSIDERATIONS Leaves can be harvested from tissue cultured plants the greenhouse or field grown plants It is preferable to use young leaves without necrotic areas or lesions although older leaves that are not senescent may be used If the midrib is thick and tough remove it Cut or fold leaves into 10 15 cm sections and place in a plastic screen mesh bag along with the tag identifying the sample Aluminium foil o
40. e DNA and a clear lower chloroform phase which contains some degraded proteins lipids and many secondary compounds The interface between these two phases contains most of the junk cell debris degraded proteins etc 99 Note If the aqueous layer appears cloudy repeat the step until the solution is clear 23 Transfer 400 uL to a new labeled 1 5 mL Eppendorf tube Note Make sure you do not disturb the interface layer as this is where proteins polyphenols and polysaccharides are concentrated CRUDE DNA PELLET PRECIPITATION 24 Add an equal volume 400 uL of isopropanol and mix by inverting gently 8 10 times 25 Incubate at 20 C for 1 hr Note An overnight incubation at 20 C is preferred 26 Centrifuge at 14 000 rpm for 15 min at 4 C 27 Pipette off as much of the supernatant as possible without disturbing the pellet 28 Dry the pellet by placing the open tube in a water bath at 80 C for 5 min 70 ETHANOL WASH 29 Add 200 uL 70 ethanol and invert the tube several times to wash the pellet 30 Centrifuge tubes at 14 000 rpm for 10 min at 4 C If the pellet is dirty e g a brown colour then repeat the wash step with 70 ethanol 31 Decant supernatant from each sample Be very careful not to pour off the pellet 32 Air dry the DNA pellet for 30 60 min by leaving the open tube on its side on the bench or in a fume hood with the fan running Put the open tube on a piece of clean aluminium foil or Parafilm to pr
41. e sample is first digested with the RE to generate DNA fragments and then the different sized fragments separated by gel electrophoresis In general alleles with correct restriction sites will generate two visible bands of DNA on the gel and those with altered restriction sites will not be cut and will generate only a single band The number and sizes of bands reveals the sample subject s genotype When combined with PCR restriction analysis is called PCR restriction fragment length polymorphism or PCR RFLP In the workshop we will use PCR RFLP to analyze the CO1 and rbcL gene Several REs are available for you to try All are frequent cutters in that they each have a four base recognition sequence The products of digestion will be electrophoresed on a 2 agarose gel and the relative sizes of the restriction fragments will be determined The restriction pattern on the gel will be compared with in silico using Bioinformatics software restriction analysis which you will do during the Bioinformatics part of the workshop in the second week In the Workshop we will use Thermo Scientific FastDigest REs for rapid DNA digestion All FastDigest enzymes are 100 active in a universal FastDigest Green buffer and are able to digest DNA in a few minutes FastDigest Green Buffer includes a density reagent along with blue and yellow tracking dyes that allow for direct loading of the reaction mixtures on a gel The blue dye of the FastDigest Green Buff
42. ea bes cere uaievestsbtaxrab a 21 Internet resources and further INfOLMATLION cseccscccccceccesesseenensscassesecssceseeesessssaeassecseseseseeessasasaseessseess 21 4 Genomic DNA extraction from animal tisSUes cccccccssssssssssceeeccecsssssssceeeccecaaaaassssceeeesesaaaasssseeees 23 IEF ODUCTION chasis isccd eicckdes ceucde vadeudadent conde Misneesardosucadades s lt 0avisoeescedaciieasceseeed sagvaaacaaseneda E e a Ea 23 Collection and storage of tissue SAMPIES cccsscccececsssssseceeeceececseseeaececececseseaeseeeeesceeseesseseeeeeesesneaeeeeeeesens 23 DNA Pu rificatio miss secede iese na een aE e aaa a eaa aa a aa oroi aaae aea E aE 24 Silica based column purification of DNA Using commercial kits ccc ccccccceesssseceeceeececsessaeeeesesceeeseeeaeees 24 DNA extraction from muscle tissue using a spin column Kit cssssscscccceccecesesesesssascececesceseseneseaasassessseess 25 EQUIPMENT and materials urinen eia eaa a a aa aaa i a aeae aa e Eaa 26 WaLa a oTo A E E n T E E a 27 Agarose electrophoresis of genomic DNA W ccecccsescecececeesesnecaeseceeeceeseeaececeesceeseeaeeaeseeecesseseeaeseeeessneeseseaeees 29 NanoDrop spectrophotometry of genomic DNA Q ccsssscscceceessessecececececseseeaeseeeceecsesesaeseeececeesesasaeeeeeeceseeeeea 29 Internet resources and further INfOLMATION csccsscccccccccesesseesensscsesesecsscsenessesssaeasseceseesesesessasasassesseeess 30 5 Genomic DNA extraction from pla
43. ed DNA Wash Buffer to the Zymo Spin IIC Column and centrifuge at 10 000 rpm for 1 min in a microfuge Discard the flow through in the Collection Tube and centrifuge again the Zymo Spin IIC Column at 10 000 rpm for 1 min in a microfuge to completely remove the residual buffer Transfer the Zymo Spin IIC Column to a clean 1 5 mL Eppendorf tube and discard the Collection Tube with flow through Add 50 uL nuclease free water directly to the middle of the column matrix of the Zymo Spin IIC Column and centrifuge at 10 000 rpm for 30 sec in a microfuge to elute the genomic DNA Remove the column and cap the tube The DNA is now suitable for PCR and other downstream applications Store the DNA at 20 C until required 35 Milkweed Leaflet Milkweed Pre Flowering Bud 8 sy t x lt 3 Ss Comparison of DNA yields from various plant and seed samples using the ZR Plant Seed DNA MiniPrep Equivalent amounts of plant materials were processed with equal volumes of eluted DNA analyzed in a 0 8 w v agarose ethidium bromide gel M is a 1 kb DNA size marker Zvmo Research INTERNET RESOURCES AND FURTHER INFORMATION 1 ZR Plant Seed DNA MiniPrep https www zymoresearch com dna genomic dna soil fecal plant dna zr plant seed dna miniprep 2 Dellaporta et al 1983 Plant Molecular Biology Reporter 1 no 4 pp 19 21 http link springer com article 10 1007 2FBFO2712670 LI true page 1 3 CIMMYT 2005 Laboratory Protocols CIMM
44. ee Reaction Buffer has a trace amount of a red dye which serves as a colour aid in gel loading and a tracking dye which migrates at about 10 bp on a 1 TBE agarose gel STORE AT 20 C FastStartTaq DNA Polymerase 5u uL with 10X Mg free PCR Reaction Buffer Roche 12032929001 This modified recombinant Taq DNA Polymerase is inactive at temperatures below 75 C but is activated by a 2 to 4 minute heat activation step at 95 C This is known as hot start PCR In hot start PCR the polymerase is modified to ensure that it remains inactive at lower temperatures and only becomes active at the high temperatures at which primers specifically bind This prevents the amplification of nonspecific products and increases the yield or sensitivity of the desired PCR product STORE AT 20 C 111 DreamTaq DNA Polymerase 5u uL Thermo Scientific EP0701 This enzyme is supplied with a 10X reaction buffer that includes MgCl at a concentration of 20 mM For the purposes of this workshop which you will determine the effect of MgCl concentration on the PCR do not use the DreamTaq 10X buffer Instead use one of the Mg free buffers supplied with the other Taq polymerases supplied in the workshop b 25mM MgCl supplied with Taq DNA polymerases Store at 20 C c dNTP Mix Fermentas RO191 Contains an aqueous solution of dATP dCTP dGTP and dTTP each at a final concentration of 10 mM Store as aliquots at 20 C Nuclease Free Water S
45. eight 0 5 mL Eppendorf tubes 1 to 8 and add 3 uL 2X DNA Gel Loading Buffer to each tube After the PCR has completed add 3 uL of PCR products to the tubes containing 2X DNA Gel Loading Buffer Use a clean pipette tip for each PCR product Run on a 1 8 agarose gel with GelRed Run at 50 100 V in 0 5X TBE buffer until the Bromophenol Blue dye has run 2 3 the length of the gel or the Orange G dye has run 3 4 the length of the gel Document the gel with the gel doc system A predicted rbcL PCR product for Zea mays is 634 bp using primers with M13 tails Sizes of rbcL PCR products from other plant species may vary slightly Store the remaining PCR products at 20 C Example rbcL PCR with titrated MgCl 1 8 agarose gel MgCl concentration mM 69 Example Zea mays rbcL gene sequence and positions of the PCR primers gt gi 18035 emb Z11973 1 Zea mays chloroplast rbcL gene for ribulose bisphosphate carboxylase CTAGEGGETEGASTIGATITIAGC AAAGATGATGAAAACGTAAACTCACAACCATTTATGCGCT GGAGAGACCGTTTCGTCTTTTGTGCCGAAGCAATT TATAAAGCACAAGCCGAAACTGGTGAAAT CAAGGGGCATTACTTGAATGCGACTGCAGGTACATGCGAAGAAATGATTAAGAGAGCTGTATTT GCAAGGGAATTAGGGGTTCCTATTGTAATGCATGACTACTTAACAGGAGGATTCACCGCAAATA CTACTTTGTCTCATTATTGCCGCGACAACGGCCTACTTCTTCACATTCACCGAGCAATGCATGC GTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATG CGGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTAAGT TAGAAGGGGAACGCGAAATAA TTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTTCTCGCGGTATCTT
46. ell after thawing 39 Gel Loading Dye Blue 6X is supplied with the ladder and contains Bromophenol Blue which migrates with DNA of 500 bp in a 1 agarose gel To prepare a ready to use solution of the ladder mix 100 uL Low Molecular Weight DNA Ladder 167 uL Gel Loading Dye Blue 6X and 733 uL TE buffer in a 1 5 mL Eppendorf tube Mix well microfuge briefly and prepare 200 uL aliquots in 0 2 mL Eppendorf tubes For long term storage store at 20 C mix well after thawing Keep an in use aliquot at 4 C Use 10 uL per well lane on a gel iii Perfect DNA 100 bp Ladder Merck Millipore 70539 The Perfect 100 bp DNA Ladder is supplied ready to use at 125 ug ml in 10 mM Tris HCl pH 8 0 1 mM EDTA It contains 13 bands with fragments of the following sizes 100 200 300 400 500 600 700 800 900 1000 1500 2000 and 2500 bp Bands at 500 and 1000 bp are brighter for easy reference on agarose gels Use 5 uL per well lane on a gel Storage short term store at 4 C long term store at 20 C iv GeneRuler 1 kb Plus DNA Ladder Fermentas SM1331 is designed for sizing and quantification of DNA fragments in agarose gels The ladder is composed of fifteen individual DNA fragments in base pairs 20000 10000 7000 5000 4000 3000 2000 1500 1000 700 500 400 300 200 75 It contains three reference bands 5000 1500 and 500 bp for easy orientation The ladder is dissolved in TE buffer The ladder is supp
47. ell by brief vortexing and incubate at room temperature for 2 min Microfuge briefly Add 200 uL PureLink Genomic Lysis Binding Buffer and mix well by vortexing for 5 sec Add 200 uL absolute ethanol to the lysate Mix well by vortexing for 5 sec Microfuge briefly When processing multiple samples you may prepare a master mix of the buffer and ethanol by mixing equal volumes of each relative to the number of samples Remove a PureLink Spin Column in a Collection Tube from the package Add the lysate 640 uL to the PureLink Spin Column Centrifuge the column at 13 000 rpm in a microfuge for 1 min at room temperature Discard the collection tube and place the spin column into a clean PureLink Collection Tube supplied with the kit Add 500 uL Wash Buffer 1 already prepared with ethanol see above to the column Centrifuge column at room temperature at 13 000 rpm for 1 min at room temperature Discard the collection tube and place the spin column into a clean PureLink collection tube supplied with the kit Add 500 uL Wash Buffer 2 already prepared with ethanol see above to the column Centrifuge the column at 13 000 rpm for 1 min at room temperature Discard collection tube Place the spin column in a clean 1 5 mL Eppendorf tube without lid Centrifuge the column at 13 000 rpm for 2 min at room temperature This step is necessary to remove excess ethanol from the column Any remnant ethanol will inhibit downstream DNA manipulations D
48. ene Cyanol FF and glycerol In 1 agarose gels Orange G co migrates with a 50 bp DNA fragment and Xylene Cyanol with 4000 bp DNA fragment Store at 4 C ii 6x Orange Loading Dye Solution Fermentas R0631 contains 10mM Tris HCl pH 7 6 0 15 Orange G 0 03 Xylene Cyanol FF 60 glycerol and 60mM EDTA Store at room temperature or at 4 C for up to 12 months Prepare a 2X DNA Gel Loading buffer by mixing 0 5 mL 6X buffer and 1 mL sterile deionized water Store at 4 C 11 DNA ladders Four DNA ladders are supplied Select any for use in the workshop i Quick Load 100 bp DNA Ladder 50 pg mL NEB NO467S This DNA Ladder is a pre mixed ready to load molecular weight marker containing Bromophenol Blue as a tracking dye which migrates with DNA of 500 bp in a 1 agarose gel It contains 12 bands suitable for use as molecular weight standards for agarose gel electrophoresis Use 10 uL per well lane The ladder includes fragments ranging from 100 1 517 base pairs The 500 and 1 000 bp bands have increased intensity to serve as reference bands Quick Load 100 bp DNA Ladder is stable for at least 6 months at 25 C For long term storage store at 4 C or 20 C If stored at 20 C mix well after thawing ii Low Molecular Weight DNA Ladder 500 ug mL NEB N3233S This ladder includes fragments ranging from 25 766 bp The 200 bp band has increased intensity to serve as a reference point For long term storage store at 20 C mix w
49. er migrates with 3 5 kbp DNA fragments in a 1 agarose gel The yellow dye of the FastDigest Green Buffer migrates with 10 bp DNA fragments in a 1 agarose gel EQUIPMENT AND MATERIALS Nitrile gloves Water bath at 37 C Benchtop cooler Ice bucket and ice Pipettes and tips 0 5 mL Eppendorf tubes Nuclease Free Water Purified PCR products 10X FastDigest Green Buffer Store at 20 C 10 FastDigest restriction enzymes Store at 20 C OONDORWNE 84 11 2 agarose midi gels gel length 10 12 cm This gel size will give good resolution of the digestion products 12 0 5X TBE 13 DNA ladder Restriction Recognition Thermo Scientific enzyme sequence Alul AGACT FD0014 Haelll GG CC FD0154 Hhal GCG C FD1854 Hpall C4CGG FD0514 Msel TATAA FD2174 Sau3Al AGATC FD0784 METHOD e Work as group to prepare digestion Master Mixes e Through consultation with your Tutor select appropriate restriction enzymes to test 1 Remove the 10X FastDigest Green Buffer from the freezer and thaw Mix by briefly vortexing Microfuge briefly Put on ice 2 Remove the restriction enzymes from the freezer and keep in a bench top cooler Microfuge briefly before use 3 Foraenzyme prepare a Digestion Master Mix in a labeled 0 5 mL Eppendorf tube Reagent Volume 1 Master Mix 10 Master Mix reaction reactions 20 reactions Nuclease Free Water 13 5 uL 135 uL 270 uL 10X FastDig
50. eseeesesssassececcsseseseseassassesecssseseseeesusaasassesseeess 11 DNA Sequencing An introduction sssessssssssssesssesossssssessessesssseossssssssescosssssssseecsessseessescesssseessess 81 Internet resources and further INfOLMALION ccssccsccccececceseseecnssssasceseccsssseeecusssassssecesseseeeeeaaasassessesess 82 12 Restriction enzyme digestion of purified PCR products sssssssssssesssssssssssoososessesssscosssssssssseessssses 83 Introducti R cssc iiiaae o e ia e ra EEEo S Ee a eia EaR E Eea aE E EE EEE EE 83 13 NanoDrop spectrophotometry Assessment of nucleic acid concentration and purity 0 90 NanoDrop Basic Use for measuring double stranded DNA csccccccccessesssecececceceesesesesecsceeseaeeeseeeeesesegeea 90 Background information cccccccssscccccececsssseeaeeeeececeesesaeeeeececeeseeeeeseseeeceseeeneaeeeeeeesceesnaaeseeeesseeseeaeseeeeeeessseeaea Contaminant Identification 260 230 RatiOS ceee 200 220 RIOS Saarai mE me we Yee eT Ee Internet resources and further FECACING ccsscceesesssssecececceseseeenessssassececcssseneesusussassesecesseseeeeesusaasassessseess 95 14 Genomic DNA extraction from plants modified Dellaporta method sssssssssssssssssesssssssssssssssessss 97 EQUIPMENT ANG materials vecccccccsscensees coveceseseeasbiesscvecededuce iecencacecduddus Cecbdssisceaddedecasasebecadacdedsreceviasdeneceds adseduanact ANEA oTo Ea E E cds vadevasscenceniaccews
51. est Green Buffer 2 uL 20 uL 40 uL FastDigest restriction 0 5 uL 5 uL 10 uL endonuclease Purified PCR product 4 uL Total 20 pL 160 pL 320 pL Aliquot 16 uL of Digestion Master Mix into 0 5 mL Eppendorf tubes Add 4 uL of purified PCR product Mix by flicking the tubes a few times Microfuge briefly Incubate the tubes in a water bath at 37 C for 30 min 85 Ow Ss 10 11 12 13 Load 10 uL of each directly onto a 2 agarose midi gel gel length 10 12 cm This gel size will give good resolution of the digestion products some of which may be very small and some may have very similar sizes Also load a DNA ladder in the 2 outside wells Run the gel at 50 100 V until the yellow dye has run 3 4 length of the gel Document the gel with the gel doc system Determine the sizes of the bands and interpret the results Store the remaining digest at 20 C 86 Example CO1 DNA sequence showing positions of PCR primers and restriction enzyme sites gt gi 363409135 gb JN543256 1 Birdstrike environmental sample clone BSO9 cytochrome oxidase subunit CO1 gene partial cds mitochondrial VF1d_t1 TCTCAACCAACCACAAAGACATCGGCACCCTATACTTAATCTTTG GGATGACHSEETATAGT TGGTACCGCCCTCM GEBTACTTATTCGTGCAGAACTAGGCEAACCAGGAACCCTCCTAGGCGAC GACCAAATCTACAATGTAATTGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATGC CAATCATAATCGGTGGTTTCGGAAACTGACTAGTACCACTTATAATTGGTGCACCAGACATAGC ATTCCCACGCATAAATAACATAMSMME TC TGACTACTACCCCCATCATTCC
52. event the tube from getting dirty Once dried the pellet should be clear Note Do not over dry the pellet otherwise it may be difficult to re dissolve in the next step 33 Add 50 uL of sterile low salt TE buffer to the pellet Dissolve the pellet by incubating in a waterbath at 55 C with frequent mixing by flicking the tube Or you can leave the tube at room temperature overnight to dissolve and afterwards flick the tube to ensure complete dissolution Note Do not vortex to mix as this will shear the DNA 34 Store DNA at 20 C AGAROSE GEL ELECTROPHORESIS OF GENOMIC DNA 1 Remove 3 uL of the purified genomic DNA and add to a clean 0 5 mL Eppendorf tube Mix with 3 uL 2X DNA Gel Loading Buffer 2 Load on to a 0 8 mini agarose gel with GelRed 100 3 In three wells on the gel load 50 ng 100 ng and 200 ng of Lambda DNA standards These are provided at 10 20 and 40 ng ul in 1X DNA Gel Loading Buffer Load 5 uL of each Also include a DNA Ladder in an outside well Run the gel at 60 80 V for 1 hr Record an image of the gel using a gel documentation system Estimate the concentration of the genomic DNA by comparing with the Lambda Standards on the agarose gel Ok Oe NANODROP SPECTROPHOTOMETRY OF GENOMIC DNA The NanoDrop is a cuvette free spectrophotometer that uses just 1 2 uL to measure nucleic acid concentration and purity See Chapter 13 for detailed instructions on using the NanoDrop Blank the NanoDrop with 1 5 uL of dil
53. f a chemical dissolved in 1 L of solvent usually water MOLAR SOLUTIONS A one molar solution of a chemical is one in which 1 litre of solution contains the number of grams of chemical equal to its molecular weight e Example 1 To make 1 litre of a 1 M NaCl solution dissolve the molecular weight in grams of NaCl in a total volume of 1 litre of water Formula Grams required MW in g x desired molarity in moles x final volume in litres 58 46 MW of NaCl g x 1 moles x 1 litre 58 46 g Dissolve 58 46 g NaCl in water to a final volume of 1 litre e Example 2 To make 100 mL of a 0 3 M NaCl solution Formula Grams required MW in g x desired molarity in moles x final volume in litres 58 46 MW of NaCl g x 0 3 moles x 0 1 litre 1 75 g Dissolve 1 75 g of NaCl in water to a final volume of 100 mL PERCENT SOLUTIONS There are 2 types of percentage solutions weight per volume w v and volume per volume v v Percentage w v weight g in 100 mL of solution Percentage v v volume mL in 100 mL of solution e Example 1 w v To make a 3 solution of NaCl in water weigh 3 g of NaCl and then make up the volume to 100 mL with water e Example 2 v v To make a 10 solution of glycerol in water take 10 mL of glycerol and mix with 90 mL of water 17 CONCENTRATED STOCK SOLUTIONS USING X UNITS Many enzyme buffers and electrophoresis buffers are prepared and stored as concentrated solutions For example a sol
54. filter pipette tips D10 D20 D100 D200 D1000 4 Water bath set at 55 C 5 Eppendorf Snap Cap Microcentrifuge Safe Lock Tubes 0 5 mL and 1 5 mL Fisher Scientific 05 402 18 05 402 25 26 PureLink Genomic DNA Kit Invitrogen K1820 01 Store at room temperature Absolute 100 ethanol Store at room temperature Sterile scalpel blades and clean microscope slides Nitrile gloves 10 Muscle tissue sample stored in 80 ethanol at 4 C OND METHOD e All centrifugations spins are done in a microfuge at room temperature Ensure the centrifuge rotor is balanced before spinning e Make sure there is no precipitate visible in PureLink Genomic Digestion Buffer or PureLink Genomic Lysis Binding Buffer If any precipitate is visible in the buffers warm the buffers at 37 C for 3 5 min and mix well to dissolve the precipitate before use e Add absolute ethanol to PureLink Genomic Wash Buffer 1 and PureLink Genomic Wash Buffer 2 according to instructions on each label Mix well Mark on the labels that ethanol is added Store both wash buffers with ethanol at room temperature e Use filter tips throughout e PureLink Genomic Lysis Binding Buffer and Wash Buffer 1 contain guanidine hydrochloride Guanidine hydrochloride is extremely hazardous in case of ingestion Harmful in case of skin contact irritant of eye contact irritant Redness watering and itching characterize inflammation of the eye Skin
55. form isoamyl alcohol 24 1 Store at room temperature in a Duran glass bottle covered in foil or in an amber Duran bottle 11 lsopropanol Store at 20 C in a 100 mL Duran bottle 12 70 ethanol and 100 absolute ethanol Store both in 100 mL Duran bottles at 20 C 13 Low salt TE buffer Store at room temperature 14 RNAse A Merck Millipore 70856 Supplied at 10 mg ml in 10 mM Tris HCl 1 mM EDTA 50 glycerol pH 7 5 Store at 20 C 15 3 M sodium acetate pH 8 0 Store at room temperature 16 5M potassium acetate pH 8 0 Store at room temperature 97 17 Lambda DNA standards These are provided at 10 20 and 40 ng uL in 1X DNA Gel Loading Buffer Load 5 uL of each Store at 20 C 18 Nuclease Free Water PCR Grade Water Roche 3315932001 Store at room temperature METHOD TISSUE EXTRACTION 1 Collect a young fresh leaf from two different plants of your choice from the ILRI grounds Take a photograph of the plants for your records 2 Wrap the leaf in foil and take to the lab 3 In the lab cut 200 mg of young leaf using clean scissors Using clean forceps transfer the sample to a labeled 1 5 mL Eppendorf tube Keep on ice until you are ready for the next step Rinse scissors and forceps in 10 bleach solution tap water then 70 ethanol each in a beaker and air dry after each sample This will prevent cross contamination between samples 4 When ready remove tubes from ice and add 50 uL SDS DTT Extract
56. he Workshop you must eject the tips into the flasks provided Never touch the tip with your fingers as this poses a contamination risk Also available in the Workshop are pipette tips with aerosol resistant filters which prevent contamination of the pipette barrel with sample and prevents cross contamination between samples which is especially important with PCR PLUNGER POSITIONS For each pipette the plunger can sit at any one of three positions Position 1 is where Position 2 is reached by pushing Position 3 is reached by the pipette is at down on the plunger until pushing down from rest resistance is met position 2 Each of these positions plays an important part in the proper use of the pipette DRAW UP LIQUID Keeping the plunger at the second Steadily release pressure on the position place the tip attached to plunger and allow it to return to the end of the micropipette Position 1 Do this carefully beneath the surface of the liquid particularly with large volumes as to be drawn up Try not to push the liquid may shoot up into the tip right to the bottom especially if and the body of the micropipette If Push down with the thumb until Position 2 is you are removing supernatant bubbles appear in the tip return the reached f co from a centrifuged pellet but liquid to the container by pushing ensure that the tip is far enough down to Position 3 and start again below the surface of the liquid you may need to ch
57. he tip and allow liquid to enter the body of the pipette Do not overwind the volume adjustment as this affects the calibration of the micropipette The way to interpret the readout depends on the micropipette used In a 200 1000 uL micropipette e g a Gilson P1000 the first red digit is thousands of uL it should never go past 1 the middle digit is hundreds while the third is tens Therefore 1000 uL would read as 100 while 350 uL would read as 035 In a 20 200 uL micropipette e g a Gilson P200 the first digit is hundreds of uL it should never go past 2 the second is tens and the third is units Therefore 200 uL would read as 200 while 95 uL would read as 095 In a 2 20 uL micropipette e g a Gilson P20 the first digit is tens of uL it should never go past 2 the second is units and the third red digit is tenths Therefore 20uL would read as 200 while 2 5uL would read a 025 In a 0 2 2 uL micropipette e g a Gilson P2 the first digit is units of uL it should never go past 2 the second red digit is tenths and the third red digit is hundredths Therefore 2uL would read as 200 while 0 5 uL would read as 050 0000 13 INTERNET RESOURCES AND FURTHER INFORMATION 1 Using a Micropipette University of Leicester training video http www youtube com watch v 2UQloYhOowM 2 Using a Micropipette http www di ug edu au sparqmicropipette 3 Pipetman maintenance http oomyceteworld net protocols RaininPipetma
58. i Restriction_enzyme Examples 3 Restriction fragment length polymorphism http en wikipedia org wiki Restriction_fragment_length_polymorphism 4 NEB Restriction endonucleases Technical Guide https www neb com media NebUs Files Brochures RE pdf 5 NEBcutter V2 0 DNA sequence analysis to find restriction enzymes sites http tools neb com NEBcutter2 89 13 NANODROP SPECTROPHOTOMETRY ASSESSMENT OF NUCLEIC ACID CONCENTRATION AND PURITY This information was adapted from e 7T042 TECHNICAL BULLETIN NanoDrop Spectrophotometers Assessment of Nucleic Acid Purity Thermo Fisher Scientific NanoDrop Products Wilmington Delaware USA Technical support info NanoDrop com 302 479 7707 www NanoDrop com http www NanoDrop com Library T042 NanoDrop Spectrophotometers Nucleic Acid Purity Ratios pdf e Using a spectrophotometer to quantitate DNA and RNA http www mc vanderbilt edu root pdfs mclaughlin_lab dna_and_rna_with_a_spectr ophotometer pdf NANODROP BASIC USE FOR MEASURING DOUBLE STRANDED DNA 1 Select DNA 50 for dsDNA on the screen 2 To perform a blanking cycle perform the following a Load a blank sample the buffer solvent or carrier liquid used with your samples onto the lower measurement pedestal and lower the sampling arm into the down position b Click on the Blank F3 button c Open the arm and wipe the blanking buffer from both pedestals using a soft paper tiss
59. ications guide dna e Nishiguchi et al 2001 DNA isolation procedures In Techniques in Molecular Systematics and Evolution 2001 edited by Rob DeSalle Gonzalo Giribet Ward Wheeler http www google co ke search tbo p amp tbm bks amp q isbn 376436257X COLLECTION AND STORAGE OF TISSUE SAMPLES The quality of the starting material affects the quality and yield of the isolated DNA Optimal results are obtained with fresh material or with material that has been immediately frozen e g frozen in liquid nitrogen or dry ice and stored at 80 C or liquid nitrogen Repeated freezing and thawing of stored samples should be avoided as this leads to reduced fragment size and precipitation of the DNA and in diagnostic samples to reduced yields of pathogen DNA e g viral DNA In general genomic DNA yields will decrease if samples are stored at either 4 C fridge temperature or 20 C general freezer temperature without previous treatment Animal tissues can also be stored in 70 90 ethanol at 4 C often for many months without loss of DNA quality Blood can be stored for many years at room temperature as dry blood spots on FTA cards When obtaining tissue samples regardless of the study or molecule of interest the goal should be to acquire the freshest or best preserved samples Degraded nucleic acids can prevent successful molecular research For example PCR of DNA from old or badly preserved tissues can be unsuccessful because
60. il a uniform fine pulp is produced Leave pestle in tube after grinding Transfer the macerated plant tissue to a ZR Bashing Bead Lysis Tube and add 650 uL Lysis Solution to the tube Use additional 100 uL Lysis Solution to rinse the 1 5 mL Eppendorf tube and microtube micro pestle used in step 1 and collect the rinse into the ZR Bashing Bead Lysis Tube Cap tube tightly to prevent leakage Secure the ZR Bashing Bead Lysis Tubes in the Eppendorf ThermoMixer and process at maximum speed 2000 rpm for 10 min Centrifuge the ZR Bashing Bead Lysis Tube in a microfuge at 13 000 rpm for 5 min Snap off the base of the Zymo Spin IV Spin Filter orange top prior to use and insert into a new Collection Tube Transfer up to 400 uL supernatant from step 4 to the prepared Zymo Spin IV Spin Filter Collection Tube and centrifuge at 7 000 rpm for 1 min in a microfuge Add 1 200 uL of Plant Seed DNA Binding Buffer to the filtrate in the Collection Tube from Step 4 and mix thoroughly by pipetting up and down with a 1 mL pipette tip Transfer 800 uL of the mixture from Step 6 to a Zymo Spin IIC Column in a Collection Tube and centrifuge at 10 000 rpm in a microfuge The Zymo Spin IIC Column has a maximum capacity of 800 uL Discard the flow through from the Collection Tube and repeat Step 7 Add 200 uL DNA Pre Wash Buffer to the Zymo Spin IIC Column in a new Collection Tube and centrifuge at 10 000 rpm for 1 min in an Eppendorf microfuge Add 500 uL Plant Se
61. iling in a microwave until the solution becomes clear Put tissues under the flask when you microwave which will make an accidental boil over spill easier to clean Heat the agarose buffer for 10 sec then remove from the microwave and swirl briefly to mix Repeat until the solution starts to boil Continue to boil with very short intervals to prevent boiling over until the solution becomes clear Eye protection and heat resistant gloves must be worn when removing hot items from the microwave Do not hold hot glassware with tissues Beware of boiling over and spilling hot liquid 5 Dispense the molten gel into two 125 mL aliquots in 200 mL Duran bottles Use immediately see below or store at room temperature until required but be sure to loosen the cap before microwaving again otherwise the bottle may explode CASTING THE AGAROSE GEL 1 Set up the casting tray and combs according to the manufacturers instructions In the Workshop we will use the Mupid ex gel kit see the Kit Instructions folder on the Workshop website for more information 2 Place the casting stand on a level surface 42 Place gel tray s into the casting stand Two gels can be cast simultaneously with normal size trays Put the 13 toothed comb into the casting stand 3 Melt a 125 mL agarose aliquot in a microwave oven as described above 4 Cool in a water bath at 55 60 C for 30 min gently swirling every 10 min so it cools evenly IMPORTANT Failure
62. ine the size and integrity of your product For plants the size of a rbcL PCR product generated using primers with M13 tails is approx 634 bp For animals the size of a CO1 PCR product is approx 709 bp NANODROP SPECTROPHOTOMETRY If the yield and integrity of the purified PCR product looks acceptable from the gel i e a good strong single band of the expected size without any evidence of degradation then proceed to NanoDrop Spectrophotometry The NanoDrop is a cuvette free spectrophotometer that uses just 1 2 uL to measure nucleic acid concentration and purity See Chapter 13 for detailed instructions on using the NanoDrop oe wh Blank the NanoDrop with 1 5 uL of diluent used for your genomic DNA sample Nuclease Free Water Perform a spectral measurement with 1 5 uL of your samples A pure sample of DNA has a 260 280 ratio of 1 8 1 8 1 9 is acceptable An ideal concentration is at least 25 ng uUL Store the purified PCR product at 20 C DNA SEQUENCING For sequencing your purified PCR product should be at least 25 ng uL with a 260 280 ratio of 1 8 1 9 Submit an aliquot 10 uL in a labeled 0 5 mL Eppendorf tube to the SegoliP Unit for direct DNA sequencing Aliquots of the PCR primers 5 uM have already been given to the SegoliP Unit for sequencing The PCR product will be directly sequenced using forwards and reverse sequencing primers a The PCR primers will be used for sequencing of the CO1 PCR products b
63. inflammation is characterized by itching scaling reddening or occasionally blistering Contact of Guanidine hydrochloride with acids or bleach liberates toxic gases DO NOT ADD acids or bleach to any liquid wastes containing this product Wear gloves e g nitrile gloves and eye protection when handling these products 1 You will each receive a small piece of muscle tissue of unknown origin in 75 ethanol in a 1 5 mL Eppendorf tube Each muscle sample is about 25 mg These samples are stored at 4 C 2 Remove as much of the ethanol as possible using a 200 uL pipette tip Dispose of the ethanol 3 Using a sterile scalpel blade chop the muscle sample as finely as possible on a clean glass microscope slide Transfer the chopped tissue to a clean 1 5 mL Eppendorf tube 4 Add 180 uL PureLink Genomic Digestion Buffer and 20 uL Proteinase K supplied with the kit to the tube Ensure the tissue is completely immersed in the buffer mix 5 Incubate at 55 C with occasional vortexing until lysis is complete 1 4 hours although the lysis incubation can be left overnight if this is convenient 6 To remove any particulate materials centrifuge the lysate at 13 000 rpm in a microfuge for 3 min at room temperature 27 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Transfer supernatant to a new 1 5 mL Eppendorf tube Add 20 uL RNase A supplied in the kit to the lysate mix w
64. ing http en wikipedia org wiki DNA_sequencing Introduction to sequencing http en wikipedia org wiki Sequencing Sanger_sequencing 5 BigDye Terminator v3 1 Cycle Sequencing Kit https www lifetechnologies com order catalog product 4337455 82 12 RESTRICTION ENZYME DIGESTION OF PURIFIED PCR PRODUCTS INTRODUCTION Adapted from e http en wikipedia org wiki Restriction_enzyme Examples e http en wikipedia org wiki Restriction_digest e http www vivo colostate edu hbooks genetics biotech enzymes renzymes html A restriction enzyme or restriction endonuclease RE is an enzyme that cuts DNA at specific recognition nucleotide sequences known as restriction sites Such enzymes found in bacteria and archaea are thought to have evolved to provide a defense mechanism against invading viruses Inside a bacterial host the REs selectively cleave foreign DNA in a process called restriction Host DNA is methylated by a modification enzyme a methylase to protect it from the RE activity Together these two processes form the restriction modification system To cut the DNA a RE makes two incisions once through each sugar phosphate backbone i e each strand of the DNA double helix Restriction sites are typically four six eight ten or twelve nucleotides long Because there are only so many ways to arrange the four nucleotides that compose DNA Adenine Thymine Guanine and Cytosine into a four to twelve nuc
65. ion Buffer pre warmed to 65 C to each sample tube 5 Grind the tissue using an Eppendorf microtube micro pestle until a uniform fine pulp is produced Leave pestle in tube after grinding 6 Add 550 uL SDS DTT Extraction Buffer pre warmed to 65 C while rinsing off the micro pestle Remove the pestle and then cap the tube 7 Put the tube into a shaking water bath at 65 C for 30 60 min Flick regularly to mix 8 Centrifuge the tube at 14 000 rpm in a microfuge for 5 min at room temperature to pellet plant debris 9 Transfer upper greenish phase to a clean 1 5 mL Eppendorf tube Note Be sure NOT to pipette up any of the pellet or floating debris PRECIPITATION OF PROTEINS AND POLYSACCHARIDES 10 Add 250 uL of ice cold 5M potassium acetate Mix by gently inverting 5 6 times 11 Incubate on ice for 5 min 12 Centrifuge in a microfuge at 14 000 rpm for 10 min at 4 C in a refrigerated microfuge 13 Transfer 450 uL of supernatant to a new 1 5 mL Eppendorf tube 98 SOLVENT EXTRACTION 1 14 In a fume hood add an equal volume i e 450 uL of chloroform isoamy alcohol CIA 24 1 to each tube 15 Cap the tube well Then gently invert the tube gently for 3 5 min to extract thoroughly Note Do not shake the tubes otherwise the DNA will shear During the extraction the solution will turn cloudy yellow green If you have many samples then this step can be done with the tubes in a rack Caution Chloroform is a hazardous chemi
66. iscard collection tube Place the spin column in a clean 1 5 mL Eppendorf tube without a lid Add 25 uL of PureLink Genomic Elution Buffer to the column Incubate at room temperature for 2 min Centrifuge the column at 13 000 rpm for 1 min at room temperature Leave the column in the tube Add another 25 uL of PureLink Genomic Elution Buffer to the column Incubate at room temperature for 2 min Centrifuge the column at 13 000 for 1 min at room temperature The eluate in the tube contains purified genomic DNA Transfer the DNA to a clean labeled 0 5 mL Eppendorf tube Store the purified DNA at 20 C 28 AGAROSE ELECTROPHORESIS OF GENOMIC DNA See Chapter 6 for more information on agarose gel electrophoresis 1 Transfer 3 uL of the purified genomic DNA to a clean 0 5 mL Eppendorf tube and mix with 3 uL 2X DNA Gel Loading Buffer 2 Load sample onto a 0 8 agarose gel made with GelRed 3 In three wells on the gel load 50 ng 100 ng and 200 ng of Lambda DNA standards These are provided at 10 20 and 40 ng uL in 1X DNA Gel Loading Buffer Load 5 uL of each 4 Also include a DNA Ladder in an outside well 5 Run the gel at 50 80 V until the Bromophenol Blue dye has reached 2 3 the length of the gel or the Orange G dye has reached 3 4 the length of the gel 6 Record an image of the gel using a gel documentation system 7 Estimate the concentration of the genomic DNA by comparing with the Lambda Standards on the agarose gel
67. kits ranging in price from 250 to 300 for 50 preps In the Workshop you will extract DNA from Plant tissues using the ZR Plant Seed DNA MiniPrep kit 32 GENOMIC DNA EXTRACTION FROM PLANT MATERIALS USING THE ZR PLANT SEED DNA MINIPREP KIT INTRODUCTION The ZR Plant Seed DNA MiniPrep is designed for the simple rapid isolation of inhibitor free PCR quality DNA from a variety of plant sample sources including leaves stems buds flowers fruit seeds etc The procedure is easy and can be completed in as little as 15 minutes plant samples 150 mg each are added directly to a ZR Bashing Bead Lysis Tube and rapidly and efficiently lysed by bead beating without the use of organic denaturants or proteinases The eluted DNA is ideal for downstream molecular based applications including PCR arrays etc The DNA is high quality inhibitor free and is eluted with DNA Elution Buffer that is suitable for PCR amplification A260 A280 gt 1 8 Yields are typically 20 80 ng DNA mg plant material A schematic of the ZR Plant Seed DNA MiniPrep procedure is shown below w Vortex Plant Seed Sample With ZR BashingBead Lysis Tube P Spin Sample Filter Lysate homogenization Ga With Zymo Spin IV Spin Bind Wash Elute DNA With Zymo Spin IIC Spin E he o Spin li Pure genomic DNA 33 EQUIPMENT AND MATERIALS REQUIRED ZR Plant Seed DNA MiniPrep kit 50 preps Catalog No D6020 Nitrile gl
68. lace the lid on the gel box and where necessary connect the electrodes to the gel tank and connect the power supply Make sure the positive red and negative black electrodes are correctly connected to the power supply DNA is negatively charged so will migrate towards the positive red electrode Turn on the power supply Set the voltage usually between 50 and 100 V Set the time usually between 30 and 60 min Start the run Ensure the current is running through the buffer by looking for bubbles forming on each electrode Also ensure that the current is running in the correct direction by observing the movement of the dye in the sample buffer it will take a minute or before you can see a movement The dye should move towards the positive red electrode The dye will run in the same direction as the DNA Run the gel until the Bromophenol Blue dye has reached 2 3 the length of the gel or the Orange G dye has run 3 4 the length of the gel Turn off the power on the power pack and at the socket and where necessary disconnect the wires from the power supply and the tank Remove the lid of the gel tank 10 Carefully remove the gel and the gel tray and transfer to a plastic box 11 Rinse the gel in deionized water or tap water 47 VIEWING AND PHOTOGRAPHING THE GEL WITH THE UV TRANSILLUMINATOR GEL DOC SYSTEM Caution Radiation Hazard UV transilluminators are powerful sources of UV radiation that will cause serious damage to un
69. laced in a thermal cycler an instrument that subjects the reaction to a series of different temperatures for set amounts of time This series of temperatures and times is referred to as one cycle of amplification Each PCR cycle theoretically doubles the amount of targeted sequence in the reaction Ten cycles theoretically multiply the target by a factor of about one thousand 20 cycles by a factor of more than a million in a matter of 1 2 hours Thirty to 35 cycles are most commonly used in PCR Each cycle of PCR includes steps for template denaturation primer annealing and primer extension new DNA strand synthesis The initial step denatures the target DNA by heating it to 94 95 C for 15 120 seconds In the denaturation process the two strands of DNA separate from each other producing the necessary single stranded DNA template for replication by the thermostable DNA polymerase In the next step of a cycle the temperature is reduced to approximately 45 65 C for 15 60 seconds At this temperature the oligonucleotide primers can bind anneal with their specific complementary sequences on the denatured target DNA and act as primers for the DNA polymerase to synthesize a new DNA strand The synthesis of new DNA begins as the reaction temperature is raised to the optimum for the DNA polymerase which is about 72 C for most thermostable DNA polymerases including Taq DNA polymerase The extension step is usually 30 120 seconds The next cycle begins
70. lease Free 18 16 14 12 10 8 6 4 2 4 6 8 10 12 14 16 Final Mg conc in the PCR mM 0 5 1 1 5 2 2 5 3 3 5 4 Cap the tubes Mix by flicking and then microfuge briefly Then leave in a rack at room temperature 58 4 Prepare a PCR Master Mix to a labeled 0 5 mL Eppendorf tube on ice add the following This is sufficient for 10 reactions of 25 uL Note some groups of trainees will use 10X buffer and others will use 5X buffer Adjust volumes of buffer and water according to this table Reagent Volume Final concentration Nuclease Free Water 92 5 uL 67 5 uL 10X 5X Taq Buffer 25 uL 50 pL 1X 10 mM dNTP Mix SuL 200 uM Primer VF1d_t1 2 uM 25 uL 0 20 uM Primer VR1d_t1 2 uM 25 uL 0 20 uM Taq DNA Polymerase 5u uL 2 5 uL 1 25u 20uL Genomic DNA 10 ng uL 257 1 ng uL Total 200 pL FastStart TAQ DNA Polymerase is supplied with 10X Mg free buffer Crimson TAQ DNA Polymerase is supplied with 5X Mg free buffer Use either buffer with DreamTaq 5 Cap the tube and mix by flicking the tube Microfuge briefly Return the tube to ice 6 Return the PCR reagent stock solutions to the 20 C freezer 7 Label eight 0 2 mL PCR tubes 1 to 8 8 Add 20 uL Master Mix to each tube Cap the tubes and leave on ice 9 Transfer 5 uL of MgCl from M1 to PCR tube 1 Transfer 5 uL of MgCl from M2 to PCR tube 2 Transfer 5 uL of MgCl from M3 to PCR tube 3 and so on 10 Cap the PCR t
71. lective incorporation of chain terminating dideoxynucleotides by DNA polymerase during in vitro DNA replication Developed by Frederick Sanger and colleagues in 1977 it was the most widely used sequencing method for approximately 25 years More recently Sanger sequencing has been succeeded by Next Gen sequencing methods especially for large scale automated genome analysis However the Sanger method remains in wide use primarily for smaller scale sequencing projects The classical chain termination method requires a single stranded DNA template a DNA primer a DNA polymerase thermostable DNA polymerases are most commonly used normal deoxynucleosidetriphosphates dNTPs and modified di deoxynucleosidetriphosphates ddNTPs the latter of which terminate DNA strand elongation These chain terminating nucleotides lack a 3 OH group required for the formation of a phosphodiester bond between two nucleotides causing DNA polymerase to cease extension of DNA when a modified ddNTP is incorporated The ddNTPs are each labeled with a separate dye that fluoresces at a different wavelength for detection in automated sequencing machines DNA sequencers This form of Sanger sequencing is known as dye terminator sequencing DNA sequencers such as ABI DNA Analyzers can sequence 16 to 384 DNA samples in a single batch run in up to 24 runs a day DNA sequencers carry out capillary electrophoresis for size separation of the DNA fragments produced d
72. leotide sequence recognition sequences tend to occur by chance in any long sequence Over 3000 REs have been studied in detail and more than 600 of these are available commercially and are routinely used for DNA modification and manipulation in laboratories Because of the huge variety of REs available potential restriction sites appear in almost any gene or locus of interest on any chromosome The length of restriction recognition sites varies e g the enzymes EcoRI Sacl and Sstl each recognize a 6 base pair bp sequence of DNA whereas Notl recognizes a sequence 8 bp in length and the recognition site for Sau3Al is only 4 bp in length Length of the recognition sequence dictates how frequently the RE will cut in a random sequence of DNA REs with a 6 bp recognition site will cut on average every 4 or 4096 bp a 4 bp recognition site will occur on average every 256 bp REs have many uses in molecular biology For example they are used to assist insertion of genes into plasmid vectors during gene cloning REs can also be used to distinguish gene alleles 83 or differences between homologous genes between species by specifically recognizing single base changes in DNA known as single nucleotide polymorphisms SNPs This is only possible if a SNP alters the restriction site present in the allele or homologous gene In this method the restriction enzyme can be used to genotype a DNA sample without the need for expensive gene sequencing Th
73. lied with 6X DNA Loading Dye 10 mM Tris HCl pH 7 6 0 03 Bromophenol Blue 0 03 Xylene Cyanol FF 60 glycerol and 60 mM EDTA Before use dilute the ladder to a 1X solution as follows 25 uL Ladder 25 uL 6X DNA Loading Dye 150 uL sterile deionized water Use 5 uL per well lane on a gel Storage short term store at 4 C long term store at 20 C Base Pairs Mass ng 1517 45 lp 5 1 200 35 500 27 15 a 1 000 95 350 20 900 27 300 33 800 24 250 27 700 21 200 110 600 8 150 33 500 517 97 400 38 100 43 5 8 300 29 50 63 200 25 100 48 ee 0 5 paflane 8 cm length gel F 1X TAE 7 V cm 45 min Quick Load 100 bp Low Molecular Weight Perfect DNA 100 bp GaneRaier T kb Plas DNA Ladder DNA Ladder Ladder DNA Ladder 40 12 13 14 15 16 17 18 Lambda DNA Standards 10 20 and 40 ng L in 1X DNA Gel Loading Buffer Store at 20 C Use 5 uL well on a gel 10X TBE buffer BecA ILRI Hub Central Core Deionized water BecA ILRI Hub Central Core Microwave oven Water bath at 55 60 C Electrophoresis gel tank power supply gel casting tray combs Mupid ex gel kit Eurogentec MU 0040 Gel documentation system Also known as a Gel Doc System It is widely used in molecular biology laboratories for the imaging and documentation of nucleic acids on agarose gels stained with a fluorophore such as GelRed or ethidium bromide Typically a gel doc system is composed of an ultraviolet UV light
74. lum 4 Gel pdf e http www instrument com cn show Literature C98928 pdf Gel electrophoresis is a widely used technique in molecular biology used routinely for the analysis and preparation of DNA Electrophoresis is the separation of charged molecules in an electric field Agarose is a polysaccharide purified from seaweed An agarose gel is created by suspending dry agarose ina buffer solution boiling until the solution becomes clear and then pouring it into a casting tray and allowing it to cool The result is a flexible gelatine like slab DNA samples are loaded onto the gel in wells created by a sample comb during gel casting For electrophoresis the gel is submersed in a chamber containing a buffer solution and a positive and negative electrode The DNA to be analyzed is forced through the pores of the gel by the electrical current DNA will move towards the positive electrode and away from the negative electrode Several factors influence how fast the DNA moves including i the strength of the electrical field ii the concentration of agarose in the gel and iii most importantly the size of the DNA molecules Smaller DNA molecules move through the agarose faster than larger molecules thereby giving separation of the DNA molecules in the sample by virtue of DNA size DNA in the gel is visualized with a DNA stain which can either be added to the gel before casting or can be used to stain the DNA on the gel after electrophoresi
75. lymerase chain reaction polyvinylpyrrolidone molecular weight 40 000 ribonuclease sodium dodecyl sulphate Thermus aquaticus DNA polymerase tris borate EDTA buffer tris hydroxymethyl aminomethane 110 19 ACKNOWLEDGEMENTS The BecA ILRI Hub gratefully acknowledges the support of Australian Aid through a partnership between Australia s Commonwealth Scientific and Industrial Research Organisation CSIRO and the BecA ILRI Hub and the support of Syngenta Foundation for Sustainable Agriculture SFSA the Bill amp Melinda Gates Foundation BMGF and the Swedish Ministry for Foreign Affairs through Sida the Swedish International Development Cooperation Agency 2 AIDS Syngenta fovrunamabie BILL MELINDA agriculture GATES foundation SWEDEN AD TRANSFORMING AFRICA biosciences L R eastern and central africa We also gratefully acknowledge the following companies who provided high quality reagents for the workshop e Inqaba Biotec www ingababiotec co za e F amp S Scientific www fnscientific com e Merck Millipore www merckmillipore com e Roche www roche applied science com e Kentros Biosciences Unlimited jeremiah matogo kentrosunlimited com B icipe a ae ESN N lt foche i kentrostiogigces T z Science for Food and Heath ingaba biotec 111 20 NOTES 112
76. me institutes e Provide practical skills and concepts in basic molecular biology and bioinformatics e Experience the discovery process as a team e Provide skills to establish basic molecular biology and bioinformatics at NARs institutes e Give researchers basic concepts of molecular biology and bioinformatics for understanding various contemporary areas of research and their applications and for communicating with other researchers in these fields e Help establish links between researchers and with BecA DNA BARCODING The Workshop will be based on DNA barcoding to illustrate the power of basic molecular biology and bioinformatics techniques DNA barcoding is a new diagnostic tool for rapid species recognition identification and discovery As of February 2013 the Barcode of Life Datasystems database included almost 2 000 000 barcode sequences from over 160 000 species of animals plants and fungi www boldsystems org DNA barcoding is based on a simple concept it is a taxonomic method that uses a specific short genetic marker in an organism s DNA to identify the species In 2003 Paul D N Hebert from the University of Guelph Canada proposed the creation of a public library of DNA barcodes that would be linked to named specimens and species This library would provide a new master key for identifying species one whose power will rise with increased taxon coverage and with faster cheaper sequencing How Barcoding works Org
77. might hear them called Gilsons as this company makes a large range of these pipettes used in laboratories In the Workshop you will use a range of Gilson Pipetman micropipettes Regardless of the manufacturer micropipettes operate on the same principle the thumb depresses a plunger and as it is released liquid is drawn into a disposable plastic tip When the plunger is pressed again the liquid is dispensed e ie Tip Eject Button Volume Adjustment Volume Readout Tip Eject Shaft Tip Attachment PIPETTE TIPS Disposable tips are an important part of the micropipette and allow the same device to be used for different samples so long as you change your tip between samples without washing They come in a number of different sizes and colours depending on the micropipette they are used with and the volume to be dispensed The most commonly used tips are D10 for use with P2 and P10 pipettes D20 for use with P20 pipette D100 for use with P100 pipette D200 for use with P200 pipette D1000 for use with P1000 pipette They are loaded into tip boxes for ease of use Often the boxes of tips are sterilized to prevent contamination For this reason tip boxes should be kept closed if they are not in use Tips are loaded onto the end of the micropipette by pushing the end of the device into the tip and giving two sharp taps Once used tips are ejected into a waste beaker or flask using the tip eject button In t
78. n for an additional 1 min at maximum speed to completely remove any residual wash buffer Note This step is essential as the presence of residual ethanol in the DNA sample may inhibit subsequent reactions 7 Transfer the GeneJET purification column to a clean 1 5 mL Eppendorf tube without a lid 8 Add 30 ul of Nuclease Free Water to the centre of the GeneJET purification column membrane and microfuge for 1 min at 13 000 rpm at room temperature 9 Discard the GeneJET purification column Transfer the purified PCR product to a clean labeled 0 5 mL Eppendorf tube 74 AGAROSE GEL ANALYSIS See Chapter 6 for more information on agarose gel electrophoresis NO Gee iN Remove 3 uL of purified PCR product and mix with 3 uL 2X DNA Gel Loading Buffer in a 0 5 mL Eppendorf tube Load onto a 1 8 agarose gel prepared with 0 5X TBE and GelRed Also load a DNA ladder into one of the outside wells Run at 100 V for 30 40 min Record the gel image Determine the size and integrity of your product For plants the size of a rbcL PCR product generated using primers with M13 tails is approx 634 bp For animals the size of a CO1 PCR product is approx 709 bp NANODROP SPECTROPHOTOMETRY If the yield and integrity of the purified PCR product looks acceptable from the gel i e a good strong single band of the expected size without any evidence of degradation then proceed to NanoDrop Spectrophotometry The NanoDrop is a cuvette free s
79. nGuide pdf 4 Gilson Pipetman spare parts http www pipetman com ReplacementParts aspx 14 3 LAB MATH Biosciences researchers need a good working knowledge of basic mathematical methods and formulae In this chapter we have compiled the most common mathematical concepts and methods for use in the biosciences lab Topics include scientific notation molarity and making solutions and dilutions POWER PREFIXES It is essential that you learn the meaning of power prefixes The most common ones used in the biology lab are kilo milli micro nano and pico In the laboratory you will encounter these when dealing with volumes e g milliliters ml or mL microliters wl or ul or uL molarity e g micomolar or uM weights e g kilograms kg nanograms ng molecular weights e g kiloDaltons or kDa You will also encounter kilo to describe 1000 nucleotide bases or base pairs e g kb kilo bases kbp kilo base pairs In bioinformatics you will encounter the prefix mega which is used to describe a million bases megabases or Mb kilo hecto deka da 108 deci nn a centi c Jio milli mids micro nano ees tr ae pico A oe not used in the biosciences laboratory 15 CONVERSION FACTORS Conversion Factors grams 1x10 g 1 kg kilogram 1000 g 1x10 g 1 mg milligram 0 001 g 1x10 g 1 ug microgram 0 000001 g 1x10 g 1 ng nanogram 0 000000001 g 1x10 g 1 pg picogr
80. ndorf tubes 5 3M Sodium Acetate pH 5 2 Store at room temperature 6 Absolute ethanol Store at room temperature 7 70 ethanol Store at room temperature METHOD Combine the PCR products for purification in a 0 5 mL Eppendorf tube Add 1 10 volume of 3 M sodium acetate pH 5 2 and 2 5 volumes of absolute ethanol to the PCR product For example if your PCR product volume is 100 uL then add 10 uL sodium acetate and 250 uL absolute ethanol f you are purifying a large number of samples then you can prepare a mastermix of the two solutions according to the number of samples for purification Mix thoroughly by inverting the tube several times Incubate the tube at 20 C for 1 hr Centrifuge at 14 000 rpm for 20 min at 4 C Carefully discard the supernatant and add 300 uL of 70 ethanol to the pellet Mix thoroughly by inverting the tube several times Centrifuge at 14000 rpm for 15 min at 4 C Carefully discard the supernatant and air dry the pellet wo aonoauw pw 10 Dissolve the pellet with 20 uL of Nuclease Free Water AGAROSE GEL ANALYSIS See Chapter 6 for more information on agarose gel electrophoresis 1 Remove 3 uL of purified PCR product and mix with 3 uL 2X DNA Gel Loading Buffer in a 0 5 mL Eppendorf tube 2 Load onto a 1 8 agarose gel prepared with 0 5X TBE and GelRed 77 Or Gr BGs Also load a DNA ladder into one of the outside wells Run at 100 V for 30 40 min Record the gel image Determ
81. nt materials cccccccccsssssssscceeccccccnssssceeecececcnecssssseeeceeeseeeesess 31 lMtrodUCtiON eiee aoee eE E EE E EE E EE E E E E REE 31 Plant sample collection and storage before isolation of genomic DNA General considerations 31 2 DNA purification METHODS from plant materials cccccccccccssssssececececsesseeecececesceesesaeeeeececeeseaseeseeeseseseseea 31 Standard chemical method USING CTAB ccceceessssscecececsessesneaeeeecceceesesaeseeecsceseneseeaeseeeescseaaeseeeceseessegeea 32 Plant Genomic DNA PURIFICATION using A Kit cccccccccceccessesssceseeeceesesneaeceecececeesesaseeseescesseesaaeeeeeesees 32 Genomic DNA extraction from plant materials using the ZR Plant Seed DNA MiniPrep Kit 000 33 VIMEO CU CEI OT sss ce zs ua Son cae Seeds eevee dulhc cad chomnceotscdagedeucna se ubeds on bugecedas gee A Ea aR AEAEE REENE CERERA E ERIR 33 Equipment and materials required te ace ei e EEE aA NECA AE A A AEAEE detente 34 Methods ESES T T E deee eee 34 SAMPLE GCOLLECHON Taraan eaea Ee E E Ea REE a SA EAE AAE EAEE NERS 34 DNA EXTRACTION eeaeee a a ite a a a a aaa E n Eaa aaa A Mae ees 34 Internet resources and further INfOFMALION ccscccsccccccecceseseesnssscasseseccssssnsesesscaesesecsscesesesessasasasseeseeess 36 6 Agarose gel electrophoresis ic ssscccececesccscassacecececessecasaacsececee sosscasastsecsces socdassncesececsssaccassacesecesscsacaasas 38 RTOU U CUON ooo vcs aa A
82. nucleic acid concentration and or negatively influence downstream analysis Shown below Fig 1 are example spectra for 4 common extraction reagents which if not properly cleaned up will affect sample purity 92 O 10mm Absorbance 9 4 5 F 5 3 4 E E Z FIGURE 1 Spectra of reagents used in the isolation of nucleic acids A TriZol B Phenol C Guanidine HCL D Guanidinium Isocyanate CONTAMINANT IDENTIFICATION Examination of sample spectra may be useful in identifying that a problem with sample purity exists It is recommended that the following be reviewed after each sample measurement e 260 230 ratio a low ratio may be the result of a contaminant absorbing at 230 nm or less e 260 280 ratio a low ratio may be the result of a contaminant absorbing at 280 nm or less e Wavelength of the trough in sample spectrum this should be at 230 nm Absorbance by a contaminant at a low wavelength will typically shift the wavelength of the trough Refer to Figure 2 e Wavelength of the peak in sample spectrum this should be at 260 nm Absorbance by a contaminant may shift the peak absorbance wavelength Refer to Figure 2 260 230 RATIOS Some contaminants have characteristic profiles e g phenol however many contaminants present similar characteristics absorbance at 230 nm or less Abnormal 260 230 values may indicate a problem with the sample or with the extraction procedure
83. of contaminating proteins lipids carbohydrates RNA and any cell debris Traditionally this was accomplished by organic extraction using a combination of high salt low pH and an organic mixture of phenol and chloroform The combination readily dissolves hydrophobic contaminants such as lipids and lipoproteins collects cell debris and strips away most DNA associated proteins After extraction with phenol chloroform the DNA is then precipitated with alcohol ethanol or isopropanol and then washed with 70 ethanol to remove salts NH AEE DNAn CF DNA aquecus precipitation solution ethanol Adidification Extraction h acetic acid phenol Ey S salt chloroform Coll debris General scheme of organic DNA isolation pna Safety concerns in the laboratory make the use of phenol undesirable Methods of DNA isolation that do not require phenol extraction have been developed and are used in many laboratories An example is given below SILICA BASED COLUMN PURIFICATION OF DNA USING COMMERCIAL KITS These days many labs use commercial silica column kits for the isolation of nucleic acids The spin columns contain a silica resin that selectively binds DNA Briefly a cell lysate in high concentrations of chaotropic salts is applied to a silica column and the DNA in solution adsorbs to the solid phase After the immobilized DNA is washed with optimized wash buffer to remove 24 cellular proteins and metab
84. olites the purified DNA is eluted in a specific volume of low salt buffer No alcohol precipitation is required This method is safer than methods where organic extraction is used Silica spin column purification of DNA 1 1 1 1 1 Prepare Apply Apply Apply Elute lysate lysate to wash wash DNA using column buffer 1 buffer 2 with low Digestion and spin to to salt Buffer column column buffer and spin and spin Silica based column kits are available for purification of genomic DNA from animal plant and microbial sources Kits are also available for the purification of RNA plasmids and PCR products DNA EXTRACTION FROM MUSCLE TISSUE USING A SPIN COLUMN KIT In the workshop you will purify genomic DNA from animal muscle tissues using an Invitrogen PureLink Genomic DNA Kit The DNA obtained will be very pure with high molecular weight suitable for PCR DNA will then be used to PCR amplify the CO1 gene the target DNA Barcoding gene for animals PureLink Genomic DNA Kit Overview Prepare lysate using Digestion Buffer and Proteinase K Add Lysis Binding Buffer and ethanol to the lysate Wash the column with Wash Buffer 2 Apply sample toa PureLink Spin Column Elute DNA with Elution Buffer acj 9 Wash the column with Wash Buffer 1 i y ao a 25 EQUIPMENT AND MATERIALS 1 Microfuge Eppendorf tube centrifuge microcentrifuge 2 Vortexer 3 Gilson Pipetman pipettes and aerosol resistant
85. or the Orange G has migrated 3 4 the length of the gel 17 Document the gel with the gel doc system The specific CO1 PCR product is 709 bp 18 Store PCR products at 20 C Example Agarose gel of CO1 PCR products 1 8 gel run in 0 5X TBE buffer at 100 V for 35 min Moi tee2o 3 45 6782 9 10 12 12 13 T14 15 16 I7 18 19 20 M o E E E EPE EERE EEEE EE EEF 1 Kamba Zebu 2 Goat 3 Pig 4 Impala 5 Eland 6 Wildebeest 7 Buffalo 8 Dik dik 9 Ovine 10 Burchell s zebra 11 Grevy s zebra 12 Grant s gazelle 13 Thompson s gazelle 14 Sheep 15 Beef 16 Crocodile 17 Goat 18 Goat 19 20 Negative controls M 1Kb Plus DNA Ladder The size of the CO1 PCR product is 709 bp 57 CO1 PCR USING INDIVIDUAL PCR REAGENTS TITRATING MGCL e PCR is very sensitive and prone to cross contamination e Work as cleanly as possible e Use filtered pipette tips throughout e Always wear disposable gloves e g nitrile gloves Change gloves frequently METHOD 1 On ice thaw the following reagents primers VF1d_t1 and VR1d_t1 2 uM each 10X or 5X Taq Buffer 25 mM MgCl 10 mM dNTP Once thawed flick the tubes to mix contents then microfuge briefly 2 Remove the DNA polymerase from the freezer and microfuge briefly to settle the contents and then keep on ice 3 Label eight 0 5 mL Eppendorf tubes M1 MB8 Put in a rack at room temperature Add the following to the tubes Reagent Nuc
86. ough generally not necessary 2 uL water aliquots can be used to clean the measurement surfaces after measuring particularly high concentration samples to ensure no residual sample is retained on either pedestal After measuring a large number of samples however it is recommended that the areas around the upper and lower pedestals be cleaned thoroughly This will prevent the wiping after each measurement from carrying previous samples onto the measurement pedestals and affecting low level measurements A final cleaning of all surfaces with de ionized water is also recommended after the user s last measurement lower measurement pedestal measurement pedestal BACKGROUND INFORMATION Nucleic acids and proteins have absorbance maxima at 260 and 280 nm respectively Historically the ratio of absorbances at these wavelengths has been used as a measure of purity in both nucleic acid and protein extractions A ratio of 1 8 is generally accepted as pure for DNA a ratio of 2 0 is generally accepted as pure for RNA Similarly absorbance at 230 nm is accepted as being the result of other contamination therefore the ratio of A260 A230 is frequently also calculated The 260 230 values for pure nucleic acid are often higher than the respective 260 280 values Expected 260 230 values are commonly in the range of 2 0 2 2 Residual chemical contamination from nucleic acids extraction procedures may result an overestimation of the
87. oves Microfuge Eppendorf tube centrifuge microcentrifuge Mixer Eppendorf ThermoMixer C Gilson Pipetman pipettes and aerosol resistant filter pipette tips 1 5 mL Eppendorf tubes Nuclease Free Water 1M Dithiothreitol DTT ready made and stored at 4 C Aluminium foil OO ao Ww Sw O Pe 10 Clean scissors and forceps 11 Microtube micro pestle 12 Scalpel blades METHOD SAMPLE COLLECTION 1 Collect a young fresh leaf from two different plants of your choice from the ILRI grounds Take a photograph of the plants for your records 2 Wrap the leaf in foil and take to the lab 3 In the lab cut the young leaf with clean scissors and weigh out 150 mg on a small piece of clean foil on the balance Cut the tissue finely with a scalpel blade on a clean foil paper and transfer into a clean 1 5 mL Eppendorf tube using clean forceps Keep on ice until you are ready for the next step Rinse scissors and forceps in 10 bleach solution tap water then 70 ethanol each in a beaker and air dry after each sample This will prevent cross contamination between samples DNA EXTRACTION For optimal performance add 1M Dithiothreitol DTT on the material day to the Plant Seed DNA Binding Buffer to a final dilution of 10 mM i e 500 uL per 50 ml or 1 mL per 100 mL Note The Plant Seed DNA Binding Buffer with DTT can be stored at 4 C for up to 1 week 34 10 11 12 13 14 Grind the tissue using a microtube micro pestle unt
88. pectrophotometer that uses just 1 2 uL to measure nucleic acid concentration and purity See Chapter 13 for detailed instructions on using the NanoDrop UT Boo Blank the NanoDrop with 1 5 uL of diluent used for your genomic DNA sample Nuclease Free Water Perform a spectral measurement with 1 5 uL of your samples A pure sample of DNA has a 260 280 ratio of 1 8 1 8 1 9 is acceptable An ideal concentration is at least 25 ng uL Store the purified PCR product at 20 C DNA SEQUENCING 1 3 For sequencing your purified PCR product should be at least 25 ng uL with a 260 280 ratio of 1 8 1 9 Submit an aliquot 10 uL in a labeled 0 5 mL Eppendorf tube to the SegoliP Unit for direct DNA sequencing Aliquots of the PCR primers 5 uM have already been given to the SegoliP Unit for sequencing The PCR product will be directly sequenced using forwards and reverse sequencing primers 75 a The PCR primers will be used for sequencing of the CO1 PCR products b M13 primers will be used for sequencing the rbcL PCR products 13 Store the remaining purified PCR product at 20 C Example 1 8 agarose gel showing GeneJET purified rbcL PCR products 634 bp rbcL PCR product M GeneRuler 1 kb Plus DNA ladder 1 4 purified rbcL PCR products 76 PCR PRODUCT PURIFICATION BY ETHANOL PRECIPITATION EQUIPMENT AND MATERIALS 1 Nitrile gloves 2 Microfuge and refrigerated microfuge 3 Pipettes and tips 4 0 5 mL Eppe
89. ples Reagent volume final conc 1M Tris HCl pH 8 0 5 ml 100 mM 0 5M EDTA pH 8 0 5 ml 50 mM 5M NaCl 5 ml 500 mM 20 SDS 2 5 ml 1 In a 100 mL Duran bottle mix together the reagents above make up to 47 5 mL with sterile de ionized water and adjust to pH 8 0 using concentrated HCI This can be stored at room temperature for up to 1 month On the day of use add 1 g PVP 40 000 MW and 500 uL of 1M Dithiothreitol DTT in fume hood Mix using a sterile magnetic bar Then make up to 50 mL with sterile de ionized water Obtained from Sigma Store at 4 C 3 M SODIUM ACETATE PH 8 0 Dissolve 204 12 g of sodium acetate 3H20 in 400 mL of sterile deionized water Adjust the pH to 8 with glacial acetic acid Adjust the volume to 500 mL with sterile deionized water Dispense into 100 mL aliquots in 100 mL Duran bottles and sterilize by autoclaving 103 10X TBE BUFFER PH 8 Prepare 1 litre of a 10X stock solution In 800 mL of sterile deionized water dissolve 108 g of Tris base 55 g of boric acid and 9 3 g EDTA Stir with a magnetic stirrer to dissolve Make up the volume to 1 litre with sterile deionized water and mix Transfer to a sterile 1 litre Duran bottle Store at room temperature The pH of the concentrated stock buffer should be approx 8 3 Dilute the concentrated stock buffer to 0 5X with deionized water before use TE 1 BUFFER Low salt Tris EDTA buffer 10 mM Tris HCl pH 8 0 0 1 mM EDTA To make 10
90. protected eyes and skin Wear a UV facemask and gloves for protection when using an open transilluminator Y aw Pw Place the gel on the UV transilluminator and turn on the UV light Observe the DNA bands on the screen and record the gel image with the digital video camera Turn off the UV light Save the file Dispose the gel in the appropriate bin Clean the UV transilluminator with damp tissues CLEANING THE GEL EQUIPMENT Dispose the tank buffer in the sink Rinse the tank with deionized water Clean the casting tray gel tray and combs with deionized water Be sure the trays and combs are clean of residual agarose gel INTERNET RESOURCES AND FURTHER INFORMATION 1 Making an Agarose Gel University of Leicester http www youtube com watch v wXiiTW3pflM 2 Running an Agarose Gel University of Leicester http www youtube com watch v U2 5ukpKg Q amp feature relmfu 3 Agarose Gel Electrophoresis http www youtube com watch v 9f2VSyVhsGI 4 How to Make and Run an Agarose Gel DNA Electrophoresis http www youtube com watch v 2UQloYhOowM 5 Aska biologist agarose gel electrophoresis http askabiologist asu edu agarose gel electroporesis 6 Agarose gel electrophoresis basic method http www methodbook net dna agarogel html 7 DNA ladders Wikipedia http en wikipedia org wiki DNA_ladder 8 Overview of DNA stains http www interchim fr ft B BQ041U pdf 48 10 11
91. r paper bags may be substituted if holes are punched to allow good air flow Place bags in an ice chest or other container with ice to keep samples cool but do not allow them to freeze Make sure samples do not get wet Leaf samples can be dried using silica gel and dried leaf samples may be stored in sealed plastic bags at room temperature for a few days or preferably at 20 C where the leaf materials will be stable for several years Fresh leaf samples may be frozen and stored at 80 C for up to one year Fresh leaf samples yield the highest quality DNA and in the Workshop you will use fresh young leaves from plants collected on the ILRI campus DNA PURIFICATION METHODS FROM PLANT MATERIALS Plant materials are among the most difficult for high quality DNA extractions DNA extraction from plant tissue can vary depending on the material used The key is to properly prepare the 31 tissues for DNA extraction Essentially any mechanical means of breaking down the cell wall and membranes to allow access to nuclear material without its degradation is required STANDARD CHEMICAL METHOD USING CTAB For this usually an initial grinding stage with liquid nitrogen in a mortar and pestle is employed to break down cell wall material and allow access to DNA while harmful cellular enzymes and chemicals remain inactivated Once the tissue has been sufficiently ground it can then be resuspended in a suitable buffer containing reagents such as cet
92. ratios are within expected limits yet there is a problem with the sample 94 SHIFTS IN SPECTRAL PROFILE T nwted peak tA peak aip peaks hA Shifted troughs N Normal trough FIGURE 2 Spectra of purified DNA without contamination A and of the same DNA sample contaminated with guanidine B and phenol C e Change in sample acidity Small changes in the pH of the solution will cause the 260 280 to vary 1 Acidic solutions will under represent the 260 280 ratio by 0 2 0 3 while a basic solution will over represent the ratio by 0 2 0 3 e Wavelength Accuracy of the Spectrophotometers Although the absorbance of a nucleic acid at 260 nm is generally on a plateau the absorbance curve at 280 nm is quite steeply sloped A slight shift in wavelength accuracy will have a large effect on 260 280 ratios The micro volume capability of NanoDrop spectrophotometers allow the researcher to quickly and easily run quality control checks of nucleic acid and protein samples In addition the instrument s short measurement cycle and general ease of use greatly increases the rate at which samples can be processed making it possible to implement multiple quality control checks throughout a procedure or process INTERNET RESOURCES AND FURTHER READING 1 William W Wilfinger Karol Mackey and Piotr Chomczynski 1997 Effect of pH and lonic Strength on the Spectrophotometric Assessment of Nucleic Acid Purity BioTechniques
93. s Ethidium bromide because of its low price and good sensitivity has been widely used for many decades as a dye for nucleic acid gel staining However ethidium bromide is a toxic and highly mutagenic material The safety hazard and costs associated with decontamination and waste disposal can make the dye expensive to use Alternative safer gel stains such as GelRed have become commercially available in recent years Like ethidium bromide GelRed binds to DNA and illuminates when exposed to ultraviolet light causing the DNA bands to fluoresce GelRed will be used in the Workshop 38 EQUIPMENT AND MATERIALS 1 Nitrile gloves 2 Safety goggles 3 Heat resistant insulated gloves or Insulated Grippers 4 P10 P20 P100 P200 P1000 Gilson Pipetman pipettes and appropriate pipette tips D20 D20 D100 D200 D1000 5 0 5 mL Eppendorf tubes 6 Glassware 500 mL flasks 1 L amp 100 mL measuring cylinders 1 litre Duran bottle and 200 mL Duran bottles 7 Agarose Molecular Biology Grade Merck Millipore 121853 Store at room temperature 8 GelRed DNA stain 10 000X in water Biotium 41003 Store at room temperature or at 4 C for long term storage 9 Water bath set at 55 C 10 DNA Gel Loading Buffers Two 6X buffers are supplied Select either for use in the workshop i 6X DNA Gel Loading Buffer Merck Millipore 69180 3 6X Loading Buffer is for gel electrophoresis of DNA fragments or PCR products and contains Orange G Xyl
94. se fresh buffer for each gel run LOADING THE DNA SAMPLES ONTO THE GEL 1 Toa0 5 mL labeled Eppendorf tube mix the required uL of your DNA sample with an equal volume of 2X DNA Gel Loading Buffer Gently mix by gently pipetting up and down 3 4X or by flicking the tube 2 Carefully pipette each sample into separate wells in the gel Make sure to record the order of the samples on the gel Do not damage the wells with the pipette tip Use a fresh tip for each sample or wash the tip after each sample by pipetting multiple times in a beaker of sterile deionized water or in the buffer in the gel tank Leave outside wells for the DNA size Ladder 1 well or Lambda DNA Standards 3 wells 46 3 4 Load the DNA size ladder or Lambda DNA Standards a When analyzing PCR products pipette appropriate amount of DNA Ladder into one of the outside wells b When analyzing genomic DNA pipette 5 uL of each of the Lambda DNA Standards 10 20 40 ng uL in 1x DNA Gel Loading Buffer into three outside wells The Lambda DNA Standards diluted to the appropriate concentration are supplied Do not move the tank after the samples have been loaded otherwise the samples may be washed out of the wells RUNNING THE GEL ELECTROPHORESIS Caution Electrical hazard Never use electrical equipment with wet gloves on Keep water and buffer away from all electrical connections Do not use an electrical connection if it is wet Oo Pw MN 9 P
95. sna e r E A E E E E E EE EEEa a 9 Plunger POSITIONS ti ccesivetsestented enn e o s a a Draw UD WiQUiG riaa ei E E a obs a e a a a a Eei DISPENSE NIQUIG EEE EE O E E EEEE E E E A A E E EE E Changing the volume Internet resources and further INfOFMALION cssccsccccccecceseseessesscasceseccecseneesessesasesseceseeseseeenesaasaseessseess 14 Bi Lab Mathis ssssscccccsssdssscseneccsssssedsccunveccectsssesscsuedeccecsssssccceseecewasssssceecsevecunsassscadsseoeceanssssssscceasennessssasees POWEW IP ROTIKES cesses ccs cctccathactestes gua ceeauceh ol E E aa e a IGONVENSIO NRA CLONS aseara E E E ccavareeseastaes R a Eaa a T E CONGO geha o EEE S E E A E E N T T E E T E The M words Mole Molar Molarity cccccccccccccscsssssesecccseseeseseesececsceeseeeeeeececceseeseeaeeeesesceeseaaseeseeeseseeegeea Molar SOLUTIONS stissa an A a a O Ee a E ER Ea Eaa Saa E Percent solutions Concentrated stock solutions using X units Preparation of working solutions from concentrated stock solutions cc cccccccecceesssssceceeeceessseeeeeceseneeeeees 18 SIME Olea hnectceaavensectcesnccanteatecsareciancaceanctasteisctacceatotessattesaneaccesursaventeasaaceseytectacotetuaancseeaaceateastesuedasuaaes 20 tab Math Cheat Sh et sciccscisscciesescccsisccsveazeienessdescacetastancavsavansstsasesdasstncssestetvensecohestinenvens sadapess catia sdleedasdesienessee 20 O linescalc latorS 235 i5 ves debs sei iecten saves ached beastie Ses aks R R sedoesenu
96. snsscasseseccssssesesessscaesesecssceseseeessaasassesssess 71 10 Purification of PCR product i iicscsccccsees sec dickescceecsete ea decdekecenctet onv decsebecdost EEES REENER OTSEN EEEE EERS 73 lainaa lo LINO 101 LAE EE A A EEE E E 73 GeneJET PCR Product P rificatio Msas eiorinn EE AA ESE OAE E TEREE 73 Equipment and Mate raS a aa a a E aaa e EA Aa LLERA RE E A E N iis 73 GOMOUET a caitstine E si cvucvnt vans E adaesus cuvesouapeas cad evenness vine cets vanwinande coins cen cnuaneaseseasmarectecsas Agarose SEI AI AIVSIS ieee Seecetsatsntcttheete lt Secsezactveetasuenaduceatsashsovenccdecadeuu tan easteasdeseaseieatacccedeeeeracebatt NanoDrop Spectrophotometry DNA SC GQUEIICING ausenaner ovaaee A Ea a S oe acing sbtsuvatesaes a E acsagarauunonsas sks PCR Product Purification by ETHANOL PrecipitQtionn ccccccscssessssnsccceccecssneenesnssassesecsssesesstessaaasassessseess Equipment and materials MCT oTo EP csentccsasgncetsssuncnedsucccds tes ceuedsvacens soneeesangndeceaguicers snenedadsundansaseheceusaccestvscncerassodseesldnset sarevedeedvectbess Agarose g lanalysiS sis ccces cesacvexscececcesvenvexscceeeeed crane deveceseccesaneatannccaeeisauscanve EE eaaa E AE a aE Eae aN EAER NanODrop SpectrophOtOMe try sisisi ea a Ea a aE a a aa na R EEr aat DNA SEGUENCINE rosrenrorsoeii teanen seis dened danie ea ra EAA E EEE duevesbissdudicnsvebasnetensvendsendteuhsorsecndechevcestecss Internet resources and further INfOFMATLION csccssscccccecces
97. ss 52 EQUIP MeNTHANG Ma OS e a a a a E aaa O eare eE aeia 53 CO1 PCR using Bioneer Accupower PCR PreMix Kit tuD s ccccccccccccesesseessncsscececescssesseestsaasaesecsseeseseeenes 55 Method EATE E AT T E E AT 55 CO1 PCR using individual PCR reagents titrating MOCl sccscscccccccesesssssssasccseccscssesssessaasaesecssceseseeeaes 58 WAGA aoo EEPE E sdeucdtteus stack cote cpeauneee Se cbadlcagubyahenbertedine side shaganden tad gaceeblauagben E 58 9 PCR of the ribulose 1 5 bisphosphate carboxylase oxygenase large subunit rbcL for DNA barcoding OP PLANTS sesssaveesecedesecsdevdvessedicevisceadvacesdtics cseusesvacebsteccucedasasessec cesscedusdeteseddeccecoaseadaedicdcnescoadeadeesscttccseusaes 62 Introduction DNA BOrcOding s ssssscssssccccsecesessnensscsssssecescesesensseaaesaeseseeseseeeeeesasaasesseessceseeesssaaaaseeesseess 62 EquipMe nt and Materials seesmine iniia e a a E aa aa sshabaddeseeeaseesbadeeVbecocsssudbactersseedtesuvends 62 rbcL PCR using Bioneer Accupower PCR PreMix Kit tubes ccccsecsesssccscececcecssessnesnscascesecesesseseeesessaaaes 64 Methods cicsccs ouster neta Mieinasetecanns ftecboteeevehentedi haehedectlleabeleatesduseceteasbachapbatechvegdeheda NAAT E A KENNE AEE a 64 rbcL PCR using individual PCR reagents titrating MOC ccccceceeeeesesssccsceseccscssesssesnsaaecesecssceseseeestsaaaaess 67 AEA OTa PAA E E E AT A EAE EAE 67 Internet resources and further INfOLMALION ccssccsccccccecceseseeen
98. tation 3 Lecture David R Caprette Ph D Solutions and Dilutions http www bioedonline org presentations index cfm presentation35 21 10 11 12 How to Make Simple Solutions and Dilutions http abacus bates edu ganderso biology resources dilutions html BioMath Calculators http www promega com biomath default htm Introduction to lab math http ocw mit edu NR rdonlyres Biological Engineering 20 109Spring 2006 4EF419A7 E30F 409E 9B12 E6C68E43D3D9 0 intro_to_labmath pdf Laboratory Math for Biologists http www rickhershberger com bioactivesite lab math labmath ppt 292 Notes on Basic Laboratory Mathematics Laboratory Solutions amp Some Practice Problems http www tracy k12 ca us thsadvbio pdfs biotechmath pdf Chemistry Tutorial Concentration Molarity http www youtube com watch v JwV3F708Zrl Maths for Science Open University online course http openlearn open ac uk mod oucontent view php id 398516 amp direct 1 Using numbers and handling data Open University online course http openlearn open ac uk mod oucontent view php id 398704 Mole and Avgadro s Number Khan Academy lecture http www khanacademy org science chemistry v the mole and avogadro s number 22 4 GENOMIC DNA EXTRACTION FROM ANIMAL TISSUES INTRODUCTION Adapted from e Qiagen DNA Protocols amp Applications http www qiagen com knowledge and support spotlight protocols and appl
99. th a final volume of 25 uL Note some groups will use 10X buffer and others will use 5X buffer Adjust volumes of buffer and water according to this table Reagent Volume Final concentration Nuclease Free Water 92 5 uL 67 5 uL 10X 5X Taq Buffer 25 uL 50 pL 1X 10 mM dNTP Mix 5 ul 200 uM Primer rbcLa FM13 2 uM 25 uL 0 25 uM Primer rbcLa RevM13 2 uM 25 uL 0 25 uM Taq DNA Polymerase 5u uL 2 5 uL 1 25u 20uL Genomic DNA 20 ng uL 25 2 ng uL Total 200 pL 11 FastStart TAQ DNA Polymerase is supplied with 10X buffer Crimson TAQ DNA Polymerase is supplied with 5X buffer Use either buffer with DreamTaq Cap the Master Mix tube and mix by flicking the tube Microfuge briefly Return the tube to ice Return your PCR stock solutions to the 20 C freezer Label eight 0 2 mL PCR tubes 1 to 8 Add 20 uL Master Mix to each tube Cap the tubes and leave on ice Transfer 5 uL of MgCl from tube M1 to PCR tube 1 Transfer 5 uL of MgCl from tube M2 to PCR tube 2 Transfer 5 uL of MgCl from tube M3 to PCR tube 3 and so on Cap the PCR tubes and mix each by flicking Microfuge briefly 12 13 14 15 16 17 18 19 Perform PCR of samples in an ABI GeneAmp 9700 Thermocycler with heated lid or equivalent PCR machine using the following amplification program At the end of the amplification programme put the PCR tubes on ice Label
100. tore at room temperature ABI GeneAmp 9700 PCR thermocycler or similar with 96 well block 2X DNA Gel Loading Buffer 1 8 agarose gel with GelRed 63 RBCL PCR USING BIONEER ACCUPOWER PCR PREMIX KIT TUBES e PCR is very sensitive and prone to cross contamination e Work as cleanly as possible e Use filtered pipette tips throughout e Always wear disposable gloves e g nitrile gloves Change gloves frequently METHOD Remove the primer stocks Nuclease Free Water from the 20 C freezer Thaw the primer stocks on ice Flick the tube a few times to mix Microfuge briefly Return the tubes to ice 3 Prepare a water primer mix To a 0 5 mL Eppendorf tube on ice add the following Reagent Volume Final conc in PCR Nuclease Free Water 280 uL Primer rbcLa fM13 2 uM 40 uL 0 20 uM Primer rbcLa revM13 2 uM 40 uL 0 20 uM Total 360 uL This is sufficient for 20 reactions Cap the tube mix by flicking the tube a few times then microfuge briefly Keep on ice Take two strips of 8 Bioneer Premix tubes from the freezer Label the strips of tubes using a fine black marker pen with numbers 1 to 16 Add 18 uL water primer mix to each of the 16 tubes Cap tubes and put in a rack at NoW Ss room temperature 8 To tubes 1 2 9 10 add 2 uL Nuclease Free Water Cap tubes and return to ice These are your negative controls 9 To each of tubes 3 4 5 6 7 add 2 pL 40 ng purified gDNA from plant
101. transilluminator a hood to shield external light sources and a camera for image capturing In the workshop we will use a Syngene Ingenius 3 UV light gel doc system see image below or a custom made gel doc system 41 METHOD PREPARING AGAROSE GELS 0 8 1 8 2 1 Measure out 50 mL 10X TBE buffer in a 100 mL cylinder Transfer to a 1 litre cylinder Add 100 mL deionized water to the 100 mL cylinder and transfer the water to the 1 litre cylinder this is to remove residual TBE in the 100 mL cylinder Add deionized water to the 1 litre cylinder to 1 litre this will give a 0 5X TBE solution Transfer the 0 5X TBE to a 1 litre Duran bottle Mix by inverting the bottle a few times Label the bottle with contents your name and date 2 Make three different concentrations of agarose gels e To make 250 mL of 0 8 agarose gel Weigh out 2 0 g of agarose powder e To make 250 mL of 1 8 gel Weigh out 4 5 g of agarose powder e To make 250 mL of 2 gel Weigh out 5 g of agarose powder 0 8 gel will be used to analyze genomic DNA gDNA 1 8 gel will be used to analyze PCR products 2 gel will be used to analyze PCR product restriction digests 3 Transfer the required amount of agarose to a 500 mL flask Add 250 mL 0 5X TBE Buffer to the flask and swirl to get an even suspension of agarose Put a loose fitting Duran cap or similar on the top of the flask to prevent excessive evaporation during boiling 4 Dissolve the agarose by bo
102. tures below 75 C but is activated by a 2 to 4 minute heat activation step at 95 C This is known as hot start PCR In hot start PCR the polymerase is modified to ensure that it remains inactive at lower temperatures and only becomes active at the high temperatures at which primers specifically bind This prevents the 53 amplification of nonspecific products and increases the yield or sensitivity of the desired PCR product Store at 20 C DreamTaq DNA Polymerase 5u uL Thermo Scientific EPO701 This enzyme is supplied with a 10X reaction buffer that includes MgCl at a concentration of 20 mM For the purposes of this workshop which you will determine the effect of MgCl concentration on the PCR do not use the DreamTaq 10X buffer Instead use one of the Mg free buffers supplied with the other Taq polymerases supplied in the workshop Store at 20 C 12 25 mM MgCl supplied with Taq DNA polymerases Store at 20 C 13 dNTP Mix Fermentas R0191 Contains an aqueous solution of dATP dCTP dGTP and dTTP each at a final concentration of 10 mM Store in aliquots at 20 C 14 CO1 PCR primers 2 uM each in Nuclease Free Water Store at 20 C a VF1d_t1 TCTCAACCAACCACAARGAYATYGG b VR1d_t1 TAGACTTCTGGGTGGCCRAARAAYCA Degenerate bases R A G Y C T These primers have a broad target group including mammals reptiles and fishes Primers were obtained from Bioneer 15 Nuclease Free Water Store at room temperature
103. ubes and mix each by gently flicking Microfuge briefly 11 Perform PCR of samples in an ABI GeneAmp 9700 Thermocycler with heated lid or equivalent PCR machine with the following amplification program 12 At the end of the amplification program put the PCR tubes on ice 13 Label 5 x 0 5 mL Eppendorf tubes 1 to 5 and add 3 uL 2X DNA Gel Loading Buffer to each tube 14 After the PCR has completed add 3 uL of PCR products to tubes containing 2X DNA Gel Loading Buffer Use a clean pipette tip for each PCR product 15 Electrophorese on a 1 8 agarose gel prepared with GelRed Include a DNA ladder in an outside lane 16 Run the gel at 50 100 V in 0 5X TBE buffer until the Bromophenol Blue has migrated 2 3 the length of the gel or the Orange G has migrated 3 4 the length of the gel 17 Document the gel with the gel doc system A specific CO1 PCR product is 709 bp 18 Store the remaining PCR products at 20 C Example CO1 PCR products from PCR with a range of MgCl concentrations 0 5 4 0 mM MegCl Gel 1 8 agarose DNA ladder 1Kb Plus 60 EXAMPLE CO1 DNA SEQUENCE SHOWING POSITIONS OF PCR PRIMERS AND THE CO1 BARCODE REGION gt HIMANTOPUS MEXICANUS BLACK NECKED STILT VOUCHER JGS1761 CYTOCHROME OXIDASE SUBUNIT I COI GENE COMPLETE CDS MITOCHONDRIAL GENBANK DQ385166 1 GTGACTTTCATCAACCGATGATTAT CATCTTAATCCTACCCGGCTTCGGAATCATCTCC CACGTAGTAACATACTACGCGGGCAAAAAAGAACCCT TCGGCTA
104. uding PEG precipitation filtration organic extraction alcohol precipitation Exonuclease Shrimp Alkaline Phosphatase Exo SAP treatment and suing commercial DNA purification kits In the Workshop we will use two methods a commercial kit GeneJET method and an ethanol precipitation method GENEJET PCR PRODUCT PURIFICATION The GeneJET PCR Purification Kit is designed for rapid and efficient purification of DNA from PCR and other enzymatic reaction mixtures The kit utilizes silica based membrane technology in the form of a convenient spin column eliminating the need for toxic phenol chloroform extractions The GeneJET PCR Purification Kit effectively removes primers dNTPs enzymes and salts from PCR and other reaction mixtures The kit can be used for purification of DNA fragments from 25 bp to 20 kbp The recovery rates are 90 100 in a 100 bp 10 kb DNA fragment size range Each GeneJET purification column has a total binding capacity of up to 25 ug of DNA and the entire procedure takes just 5 min The purified DNA can be used in common downstream applications such as sequencing restriction digestion ligation and cloning EQUIPMENT AND MATERIALS Nitrile gloves Absolute ethanol Store at room temperature Nuclease Free Water 1 2 3 4 Microfuge 5 1 5mLand0 5 mL Eppendorf tubes 6 GeneJET PCR Purification Kit Fermentas KO701 Store at room temperature 7 Pipettes and filter pipette tips 73 METHOD GE
105. ue 3 Analyze an aliquot of water as though it were a sample This is done using the Measure button F1 The result should be a spectrum with a relatively flat baseline Wipe the blank from both measurement pedestal surfaces and repeat the process until the spectrum is flat 4 Then measure your samples a Absorbances of the samples are represented as if measured with a conventional 10 mm path b A 260 280 nm ratio of 1 8 is generally accepted as pure for DNA c The sample concentration will be calculated in ng uL based on absorbance at 260 nm and the selected analysis constant 1 O D at 260 nm for double stranded DNA 50 ng uL of dsDNA 90 d The reading at 280 nm gives the amount of protein in the sample Pure preparations of DNA and RNA have OD 260 0D280 values of 1 8 to 2 0 respectively If there is contamination with protein or phenol this ratio will be significantly less than the values given above and accurate quantitation of the amount of nucleic acid will not be possible 5 When the measurement is complete open the sampling arm and wipe the sample from both the upper and lower pedestals using a soft laboratory wipe Simple wiping prevents sample carryover in successive measurements 6 Cleaning the Pedestals Wiping the sample from both the upper and lower pedestals as shown below upon completion of each sample measurement is usually sufficient to prevent sample carryover and avoid residue build up Alth
106. uent used for your genomic DNA sample Perform a spectral measurement with 1 5 uL of your sample 3 Once you have determined the concentration of your sample dilute an aliquot of the DNA with Nuclease Free Water in a labeled 0 5 mL Eppendorf tube to give 50 uL of 10 ng DNA uL 4 Store both the undiluted and diluted genomic DNA at 20 C Example 0 8 agarose gel of high quality genomic DNA extracted from various plants using the modified Dellaporta method M 1 2 3 4 5 M GeneRuler 1kb Plus DNA Ladder 1 Lambda DNA standard 200 ng 2 Bougainvillea 3 Hibiscus 4 Loquat 5 Cowpea 101 15 RECIPES CHLOROFORM ISOAMYL ALCOHOL 25 1 To a 100 mL Duran bottle add 96 mL chloroform and 4 mL isoamyl alcohol Mix by gently swirling the bottle Cover the bottle with foil and label Store at room temperature in a flammables store 0 5 M EDTA PH 8 0 To prepare 1 litre of EDTA at 0 5 M pH 8 0 add 186 1 g of disodium EDTA 2H20 to 800 mL of sterile deionized water Stir vigorously on a magnetic stirrer Adjust the pH to 8 0 with NaOH approx 20 g of NaOH pellets Adjust the volume to 1 litre with water Dispense into 200 mL aliquots in Duran bottles and sterilize by autoclaving The disodium salt of EDTA will not go into solution until the pH of the solution is adjusted to approx 8 0 by the addition of NaOH 70 ETHANOL Mix 70 mL ethanol and 30 mL sterile deionized water Store in a 100 mL Duran bottle at room temperature
107. ume of stock solution the material to be diluted 4 unit volumes of the solvent the diluent This is known as a 1 4 dilution and has a dilution factor of 5 The dilution factor is frequently expressed using exponents 1 5 would be 5 1 1 100 would be 10 and so on Dilutions can be written in different ways For example one part in ten dilution can be written in any of these ways 1 10 1in10 1 part in 10 1 9 10 Dilution factor of 10 LAB MATH CHEAT SHEET Lab math cheat sheet Amole of a chemicalhas a mass equal to the molecular weight orformula weight in grams Aone molar solution contains 1 mole of a chemical in a total volume of 1 litre When making molar solutions use the formula Grams required MW in g x desired molarity in moles x volume in litres Percentage w v weight g in 100 ml of solution Percentage v v volume ml in 100 ml of solution A20X solution is 20 times more concentrated and would require a 1 20 dilution i e a 1 19 dilution to attain the typical working concentration One partin ten dilution can be written 1 10 1in 10 1 9 10 andthe dilution factoris 10 When making working solutions from concentrated stock solutions use the formula Ci x Vi Cf x Vf with normalised units 20 ONLINE CALCULATORS There are plenty of online resources to help you with your calculations Sigma Aldrich have a number of easy to use calculators Links to three calculators for solution dilution
108. uring the sequencing reaction followed by detection and recording of dye fluorescence and data output as fluorescent peak trace chromatograms also known as a sequence trace file Sequencing reactions by thermocycling cleanup and re suspension in a buffer solution before loading onto the DNA sequencer are performed separately The SegoliP Unit uses the BigDye Terminator v3 1 Cycle Sequencing Kit for sequencing reactions https www lifetechnologies com order catalog product 4337455 81 The 48 capillary 3730 DNA Analyzer is one of the DNA sequencers used by the SegoliP Unit It is the Gold Standard in low to medium throughput genetic analysis The 3730 DNA Analyzer is used for DNA fragment analysis applications such as microsatellites AFLP and traditional Sanger DNA sequencing IAT TAACT GACGACCTCCAATCTCTAGTCGGCATGGTT TATGGT TAGGACTACGACGGTA This is a sequence trace file this example was generated by one of the participants at the 2011 IMBB Training Workshop The four bases are detected using the different fluorescent labels These are detected by the DNA sequencer and represented as peaks of different colours that can then be interpreted to determine the base sequence INTERNET RESOURCES AND FURTHER INFORMATION Sanger sequencing http en wikipedia org wiki Sanger_sequencing DNA Sequencing by Capillary Electrophoresis http tools invitrogen com content sfs manuals cms_041003 pdf 3 DNA sequenc
109. uscle tissue sample 1 Cap tubes and return to ice 7 To each of tubes 11 12 13 14 15 add 2 uL 20 ng purified gDNA from muscle tissue sample 2 Cap tubes and return to ice 8 To each of tubes 8 16 add 2 uL 20 ng ve control gDNA Cap tubes and return to ice These are your positive controls 9 Place your tubes in the rack provided below along with all PCR tubes from your group 55 tM FE of 43 Ay Ay i 10 Place a lid on the rack Vortex to dissolve the dried PreMix blue pellet by holding the rack with the tubes on the vortexer for a few seconds below 11 Spin the rack tubes in a plate centrifuge at 2500 rpm for 2 min at room temp Ensure the centrifuge is balanced before use below 56 12 Perform PCR of samples in an ABI GeneAmp 9700 Thermocycler with heated lid option or equivalent PCR machine with the following amplification program 13 At the end of the amplification program put the PCR tubes on ice 14 Label 16 x 0 5 mL Eppendorf tubes with numbers 1 to 16 and add 3 uL 2X DNA Gel Loading Buffer to each tube 15 Add 3 uL of PCR products to tubes containing 2X DNA Gel Loading Buffer Use a clean pipette tip for each PCR product 16 Electrophorese on a 1 8 agarose gel prepared with GelRed Include a DNA ladder in an outside lane of each row of wells Run the gel at 50 100 V in 0 5X TBE buffer until the Bromophenol Blue has migrated 2 3 the length of the gel
110. use Allow the gel to solidify It will turn from clear to translucent as it solidifies and will take about 30 40 min Remove the comb s with both hands by gently pulling upwards 44 10 Note for some gel kits the comb can be removed after the gel has been placed into the electrophoresis gel tank and overlaid with buffer Hold the gel tray on the both sides at the notches of the casting stand Pull the tray upwards Gel preparation is now complete Gels can be stored in the gel tray at 4 C for up to a week Wrap in cling film and store in a moist box a lunch box with tissues soaked in water or 0 5X TBE to prevent the gels from drying out Alternatively store the gel in the gel tray and casting stand saturate with a small quantity of 0 5X TBE buffer and cover the whole gel and tray with cling film to protect it from drying out and contamination and store at 4 C Place the gel and gel tray on the gel bed of the Gel Tank Unit without removing it from the tray Be careful the gel does not slide from the tray 45 Be sure the sample wells are nearest to the negative black electrode DNA is negatively charged and will migrate towards the positive red electrode 11 Add 0 5X TBE to the tank so the gel is covered by 2 mm of buffer The buffer volume required for the chamber will be indicated in the manufacturers instructions For the Mupid exU gel kit the volume required is approximately 300 mL Always u
111. ution 20 times more concentrated would be denoted as 20X and would require a 1 20 dilution to attain the working concentration e Example 1 Using 50X electrophoresis buffer To prepare 1 litre of 1X electrophoresis buffer from a 50X stock take 20 mL of stock i e 1 50 of the final volume and mix with 980 mL of water e Example 2 Restriction enzyme digest using a 10X buffer To set up a 25 uL restriction enzyme digestion add 2 5 uL of a 10X buffer i e 1 10 of the final volume plus the other reaction components and then water to a final volume of 25 uL PREPARATION OF WORKING SOLUTIONS FROM CONCENTRATED STOCK SOLUTIONS Many buffers in molecular biology require the same components but often in varying concentrations To avoid having to make every buffer from scratch it can be useful to prepare several concentrated stock solutions and dilute as needed The following formula is useful for calculating amounts of stock solution needed Ci x Vi Cf x Vf Where Ci initial concentration or concentration of stock solution Vi initial volume or amount of stock solution needed Cf final concentration or concentration of desired solution Vf final volume or volume of desired solution You must first normalize the units i e choose the same units for volumes and for concentrations e g convert all volumes to mL and all molarities to mM 18 Example 1 How do you prepare 100 mL of TE buffer containing 10 mM Tris and 1 m
112. viated label for the genome of the species Therefore the barcode of life is a key in addition to the binomial species name to knowledge about a species Compiling a public library of sequences linked to named specimens plus faster and cheaper PCR and DNA sequencing is making this new barcode key increasingly practical and useful A portion of the cytochrome c oxidase subunit 1 mitochondrial gene CO1 is the standard barcode region for higher animals The barcode region is 658 nucleotide base pairs bp from the 5 end of the CO1 gene a very short sequence compared to the 3 billion base pairs in the human genome for example In the Workshop we will use DNA barcoding to illustrate the power of PCR DNA sequencing and bioinformatics to identify animal species We will use PCR of the CO1 gene using primers with a broad target group including mammals reptiles and fish For PCR you will have the opportunity to a use the Bioneer Accupower PCR Premix Kit tubes and b to make PCR mixes from individual components 52 EQUIPMENT AND MATERIALS Nitrile gloves Vortexer Plate centrifuge Microfuge Ice bucket and ice Pipettes and filtered pipette tips 0 5 mL and 1 5 mL Eppendorf tubes 0 2 mL PCR tubes Tube racks LO 00 OO NS m jo Bioneer Accupower PCR PreMix 20 uL kit Bioneer K 2016 The Bioneer Accupower PCR PreMix kit contains 0 2 mL tubes each containing lyophilised components of a PCR master mix enzyme buffer
113. yltrimethyl ammonium bromide CTAB or SDS sodium Dodecy Sulphate The presence of polysaccharides in a plant DNA preparation can inhibit techniques such as polymerase chain reaction PCR CTAB is a surfactant useful for isolation of DNA from tissues containing high amounts of polysaccharides Under the high salt conditions used in this protocol the CTAB binds the polysaccharides removing them from the solution SDS is a strong anionic detergent useful for isolation of DNA from tissues containing high amounts of polysaccharides The solubilized DNA is then extracted with chloroform to remove lipids and proteins Finally DNA must then be precipitated from the aqueous phase and washed to remove contaminating salts Although we will not use the CTAB or SDS method in the Workshop a detailed SDS protocol is available in Chapter 14 PLANT GENOMIC DNA PURIFICATION USING A KIT The advantages of using DNA isolation kits over crude CTAB method described above is they are fast simple do not contain harmful chemicals such as phenol or chloroform and involves minimal handling The technology makes use of spin columns which contain a silica gel based membrane that binds the DNA The DNA while bound to the membrane can be washed and cleaned from contaminants and then eluted from the column membrane using water The DNA obtained is usually more pure and clean than DNA isolated from the crude CTAB method One disadvantage of the kits is the cost with

Laboratory Manual - ILRI Research Computing

Contents

Download Pdf Manuals

Related Search

Related Contents