Home

Original Pichia Kit Manual - Pichia Pastoris Protein Expression

Contents

1. Continued on next page 67 Proteins Expressed in Pichia continued Table continued 68 Protein Expression Where Expressed Reference Levels How Expressed grams liter Membrane Proteins Human CD38 0 05 Secreted Fryxell et al 1995 soluble portion Mut Mouse Serotonin 0 001 Secreted Weiss et al 1995 Receptor Mutt Proteases and Inhibitors Protease Carboxypeptidase B 0 8 Secreted Despreaux amp Mot Mut Manning 1993 Enterokinase 0 021 Secreted Vozza et al 1996 Mut Ghilanten 0 01 Secreted Brankamp et al Mutt 1995 Kunitz protease 1 0 Secreted Wagner et al 1992 inhibitor D Human Proteinase 0 05 Intracellular Sun et al 1995 Inhibitor 6 Mutz Antibodies Rabbit Single Chain gt 0 1 Secreted Ridder et al 1995 Mut phenotype was not described in the paper Recombination and Integration in Pichia Introduction Gene Insertion at AOX1 or aox1 ARG4 Like Saccharomyces cerevisiae linear DNA can generate stable transformants of Pichia pastoris via homologous recombination between the transforming DNA and regions of homology within the genome Cregg et al 1985 Cregg et al 1989 Such integrants show extreme stability in the absence of selective pressure even when present as multiple copies The most commonly used expression vectors carry the HIS4 gene for selection These vectors are designed
2. Continued on next page Experimental Outline continued Expression and Scale up Experimental Process Generating Recombinant Strain After confirming your Pichia recombinants by PCR you will test expression of both His Mut and His Mut recombinants This procedure involves growing a small culture of each recombinant inducing them with methanol and taking time points If looking for intracellular expression analyze the cell pellet from each time point by SDS polyacrylamide gel electrophoresis SDS PAGE If looking for secreted expression analyze both the cell pellet and supernatant from each time point We recommend that you analyze your SDS PAGE gels by Coomassie staining and if you have an antibody to your protein by western blot We also suggest checking for protein activity by an activity assay if one is available Not all proteins express to the level of grams per liter so it is advisable to check by western blot or activity assay and not just by Coomassie staining of SDS PAGE gels for production of your protein Choose the Pichia recombinant strain that best expresses your protein and optimize induction based on the suggestions on pages 52 53 After you optimize expression scale up your expression protocol to produce more protein The overall experimental process is divided into two major sections Generating Recombinant Strain and Induction Mut and or Mut Each section contains a table outlining the m
3. 20 C Reagent Amount Components Zymolyase 10x 20pL 3mg mL Zymolyase in water 100 000 units g lytic activity 1M DTT 10x1mL 1 M dithiothreitol in water Stab Vials Pichia and E coli stabs Store at 4 C Strain Amount Genotype Phenotype Pichia only GS115 1 stab his4 Mut KM71 1 stab arg4 his4 aox1 ARG4 Mut Are GS115 Albumin 1 stab HIS4 Mut GS115 B Gal 1 stab HIS4 Mut TOP10F Tstab F proAB lacI lacZAM15 Tn10 Tet mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 deoR recA1 araD139 A ara leu 7697 galU galK rpsL Str end A1 nupG Continued on next page Kit Contents and Storage continued Kit Contents continued Media Note Intended Use Vectors Store at 20 C Reagent Description pHIL D2 Vector for intracellular expression in Pichia 10 pg 20 pL at 0 5 pg pL in TE buffer pH 8 0 pPIC3 5 Vector for intracellular expression in Pichia 10 pg 20 pL at 0 5 pg pL in TE buffer pH 8 0 pHIL S1 Vector for secreted expression in Pichia 10 pg 20 pL at 0 5 ug uL in Uses the PHO1 signal sequence TE buffer pH 8 0 pPIC9 Vector for secreted expression in Pichia 10 pg 20 pL at 0 5 ug uL in Uses the a factor signal sequence TE buffer pH 8 0 TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 Primers Store at 20 C 5 AOX1 sequencing primer 2 pg 312 pm
4. Technical Support continued Limited Warranty 90 Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have
5. Cover the flask with 2 layers of sterile gauze or cheesecloth and return them to the incubator to continue to grow Add 100 methanol to a final concentration of 0 5 every 24 hours to maintain induction At each of the times indicated below transfer 1 mL of the expression culture to a 1 5 mL microcentrifuge tube These samples will be used to analyze expression levels and determine the optimal time post induction to harvest Centrifuge at maximum speed in a tabletop microcentrifuge for 2 3 minutes at room temperature Time points hours 0 24 1 day 48 2 days 72 3 days 96 4 days 120 5 days and 144 6 days For secreted expression transfer the supernatant to a separate tube Store the supernatant and the cell pellets at 80 C until ready to assay Freeze quickly in liquid N or a dry ice alcohol bath For intracellular expression decant the supernatant and store just the cell pellets at 80 C until ready to assay Freeze quickly in liquid N or a dry ice alcohol bath Analyze the cell pellets for protein expression by Coomassie stained SDS PAGE and western blot or functional assay see Analyzing Samples by SDS Polyacrylamide Gel Electrophoresis next page Analyzing Samples by SDS Polyacrylamide Gel Electrophoresis Polyacrylamide Invitrogen offers a wide range of pre cast NuPAGE and Tris Glycine Gel polyacrylamide gels and electrophoresis apparatus The patented NuPAGE Gel Electrophoresis System av
6. Harvest the cells and resuspend them to an OD eoo of 10 0 48 10 20 mL with methanol medium Place the cell suspension in a 100 mL or 250 mL baffled flask 4 Incubate the culture at 30 C with shaking and take samples for 48 analysis at 0 24 48 72 96 120 and 144 hours 5 Analyze the medium if protein of interest is targeted for 49 51 secretion and the cell lysates for intracellular and secreted expression for protein via PAGE Coomassie Blue staining western blot activity ELISA or immunoprecipitation Optimize expression of your Hist Mut recombinant 52 53 Scale up your expression for protein purification 54 56 Pichia Strains Introduction Genotype of Pichia Strain Construction of KM71 Important Methods Pichia pastoris is quite similar to Saccharomyces cerevisiae as far as general growth conditions and handling You should be familiar with basic microbiological and sterile techniques before attempting to grow and manipulate any microorganism You should also be familiar with basic molecular biology and protein chemistry Some general references to consult are Guide to Yeast Genetics and Molecular Biology Guthrie amp Fink 1991 Current Protocols in Molecular Biology Ausubel et al 1994 Molecular Cloning A Laboratory Manual Sambrook et al 1989 Protein Methods Bollag et al 1996 and Guide to Protein Purification Deutscher 1990 The Pichia host strains GS115 and KM7
7. Transformation efficiency using the spheroplast method is generally 10 to 10 His transformants ug of DNA There should be no colonies on the No DNA pBR322 plate or the plasmid only no cells plate Plating in top agarose can cause the transformants to be on top or be imbedded in the top agarose making it difficult to pick and patch colonies as described in the next section The following protocol allows you to collect the transformants and re plate them directly onto plates without using top agarose 1 Scrape the agarose containing the His transformants with a sterile spreader into a sterile 50 mL conical centrifuge tube and mix with 20 mL sterile deionized water Vortex the suspension vigorously to separate the cells from the agarose 2 Filter the suspension through 4 folds of sterile cheesecloth Centrifuge the filtrate at 1 500 x g for 5 minutes at room temperature Centrifugation pellets the cells on the bottom of the tube and any remaining agarose on top of the cells 3 Remove the agarose pellet carefully from the top of the cells by gently shaking the tube to disperse only the agarose pellet into the water Decant the supernatant with the agarose pellet 4 Resuspend the cell pellet in 5 mL of sterile deionized water and sonicate for 10 seconds using a microtip and 20 30 power Sonicate to get the cells into solution and not to lyse the cells 5 Dilute cells by 10 and plate 50 uL and 100 pL onto MD plates Incubat
8. YPD Yeast extract Peptone Dextrose medium 1 liter YPD plates 1 liter RDB Regeneration Dextrose Base plates 1 liter RDHB Regeneration Dextrose Histidine Base plates 1 liter Prepare the following solution on the day of transformation and maintain at 45 C 5 SDS solution in water RD Regeneration Dextrose molten agarose 100 mL Continued on next page 31 Growing Pichia for Spheroplasting continued Solutions Spheroplasting and Transformation Reagents Provided 1 M Sorbitol SE 1M sorbitol 25 mM EDTA pH 8 0 DTT 1M DTT in water SCE 1 M sorbitol 1 mM EDTA and 10 mM sodium citrate buffer pH 5 8 CaS 1 M sorbitol 10 mM Tris HCI pH 7 5 10 mM CaCl Zymolyase 3 mg mL in water 40 PEG 40 w v PEG 3350 Reagent grade in water CaT 20 mM Tris pH 7 5 and 20 mM CaCl SOS 1M sorbitol 0 3X YPD 10 mM CaCl2 Prepared fresh for each transformation SED 19 mL of SE and 1 mL of 1 M DTT see page 33 PEG CaT 1 1 mixture of 40 PEG and Cal see page 35 Procedure 1 Streak GS115 or KM71 onto a YPD plate such that isolated single colonies will grow Incubate the plate at 28 30 C for 2 days 2 Inoculate 10 mL of YPD in a 50 mL conical tube or 100 mL shake flask with a single colony of GS115 or KM71 from the YPD plate and grow overnight at 28 30 C with vigorous shaking 250 300 rpm You may store this culture at 4 C for several days 3 Place 200 mL of YPD in each of three 500 mL culture flasks Inoculate
9. from GS115 pHIL D2 Lane 5 shows the expected size of our gene of interest cloned into pHIL D2 650 bp 188 bp 838 bp Analysis of the Pichia recombinants in lanes 2 4 reveal that lanes 2 and 3 contain the insert and that the recombinant in lane 2 may be a Mut because there is no wild type AOX1 Lane 4 although from a His transformant does not contain the gene of interest Expression of Recombinant Pichia Strains Introduction Media Proteases Aeration The purpose of this section is to determine the optimal method and conditions for expressing your gene Below are some factors and guidelines that need to be considered before starting expression in Pichia pastoris As with any expression system optimal expression conditions are dependent on the characteristics of the protein being expressed You need BMGY BMMY buffered complex glycerol or methanol medium BMG BMM buffered minimal glycerol or methanol medium or MGY MM minimal glycerol or minimal methanol medium for expression see Appendix pages 63 65 BMG BMM BMGY and BMMY are usually used for the expression of secreted proteins particularly if pH is important for the activity of your protein Unlike MGY and MM they are all buffered media Because these media are buffered with phosphate buffer you may use a wide range of pH values to optimize production of your protein BMGY BMMY contain yeast extract and peptone which may help stabilize secreted proteins
10. temperature To induce expression decant the supernatant and resuspend cell pellet in 1 5 to 1 10 of the original culture volume of MMH BMMH or BMMY medium approximately 100 200 mL Place the culture in a 1 liter baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return to incubator Continue to grow at 28 30 C with shaking Add 100 methanol to 0 5 every 24 hours until the optimal time of induction is reached Harvest cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature For intracellular expression decant the supernatant and store the cell pellets at 80 C until ready to process For secreted expression save the supernatant chill it to 4 C and concentrate it if desired see next page Proceed directly to purification page 57 or store the supernatant at 80 C until ready to process further To increase the amount of cells for Mut recombinants increase the number of flasks put 200 300 mL in a 3 liter flask or try fermentation Continued on next page 55 Scaling Up Expression continued Concentrating Proteins Cell Lysis Fermentation 56 Proteins secreted into the media are usually gt 50 homogeneous and require some additional purification There are several general methods to concentrate proteins secreted from Pichia These general methods include e Ammonium sulfate precipitation e Dialysis e Centrifuge concentrator for small volume
11. you will need to prepare competent E coli cells for transformation before setting up your ligation reactions See Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Laboratory Manual Sambrook et al 1989 for preparation of electrocompetent or chemically competent E coli or use your laboratory s procedure For a high efficiency and convenient transformation we recommend One Shot TOP10 Chemically Competent E coli or One Shot TOP10 Electrocompetent Cells which are available separately from Invitrogen see page 88 for ordering information Continued on next page Cloning into the Pichia Expression Vectors continued Paox and Multiple Cloning Site of pHIL D2 Special Considerations The figure below shows the detail of the multiple cloning site and surrounding sequences 785 AOX1 mRNA 5 end 837 ACAGGCAATA TATAAACAGA AGGAAGCTGC CCTGTCTTAA ACCTTTTTIT TTATCATCAT TATTAGCTTA 5 AOX7 Primer Site 868 888 CTTTCATAAT TGCGACTGGT TCCAATTGAC AAGCTTTTGA TTTTAACGAC TTTTAACGAC AACTTGAGAA Remaining A of the native AOX7 ATG EcoR GATCAAAAAA CAACTAATTA TTCGAAACGA GGAATTCGCC TTAGACATGA CTGTTCCTCA GITCAAGTTG 3 AOX1 Primer Site 1036 1056 GGCACTTACG AGAAGACCGG TCTTGCTAGA TTCTAATCAA GAGGATGTCA GAATGCCATT TGCCT TGAGAG AOX1 mRNA 3 end 1127 ATGCAGGCTT CATTTTTGAT ACITITITAT TITGTAACCTA TATAGTATAG GATTTTTTTT GTCA e For pHIL D2 the fragment containing the gene
12. 0 01 mL x 0 01 dilution factor x 10 mg mL 0 001 mg protein in the reaction The specific activity 0 400 x 380 15 200 units mg protein 10 x 0 001 mg Pure galactosidase has an activity of 300 000 units mg protein 87 Accessory Products Accessory Products 88 Many of the reagents supplied in Pichia Expression Kit as well as other reagents and kits used in Pichia expression experiments are available separately from Invitrogen Ordering information is provided below For more information refer to www invitrogen com or contact Technical Support see page 89 Product Amount Cat no Pichia Spheroplast Module 10 preparations K1720 01 Box 1 and Box 2 50 transformations Geneticin powder 1g 11811 023 58g 11811 031 25g 11811 098 Geneticin liquid 50mg mL 20 mL 10131 035 100 mL 10131 027 Ampicillin Sodium Salt irradiated 200 mg 11593 027 TA Cloning Kit with pCR 2 1 vector 20 reactions K2000 01 PureLink HiPure Plasmid Miniprep Kit 25 preparations K2100 02 100 preparations K2100 03 Platinum Taq DNA Polymerase 100 reactions 10966 018 250 reactions 10966 026 500 reactions 10966 034 Taq DNA Polymerase Recombinant 100 units 10342 053 500 units 10342 020 Easy DNA Kit 1 kit K1800 01 FastTrack 2 0 mRNA Isolation Kit 1 kit K1593 02 Micro FastTrack 2 0 mRNA Isolation Kit 1 kit K1520 02 pAO815 20 ug V180 20 pPIC3 5K 20 ug V173 20 pPIC9K 20 pg V175
13. 50 2 5 0 75 3 75 1 00 5 0 1 50 7 5 1 75 8 75 2 00 10 0 3 00 15 0 4 00 20 0 Continued on next page 62 Pichia Media Recipes continued MGY and MGYH RD and RDH Liquid Media RDB and RDHB Agar Plates Minimal Glycerol Medium Histidine 1 liter 1 34 YNB 1 glycerol 4 x 105 biotin 0 004 histidine 1 Combine aseptically 800 mL autoclaved water with 100 mL of 10X NR 2 mL of 500X B and 100 mL of 10X GY 2 For growth of his4 strains in this medium a version can be made that contains histidine called MGYH by adding 10 mL of 100X H stock solution 3 Store at 4 C The shelf life of this solution is approximately two months Regeneration Dextrose Medium Histidine 1 liter 1 M sorbitol 2 dextrose 1 34 YNB 4 x 105 biotin 0 005 amino acids 0 004 histidine Dissolve 186 g of sorbitol in 700 mL of water and proceed to Step 2 ray Autoclave 20 minutes on liquid cycle Cool and maintain the liquid medium in a 45 C water bath Pm LN Prepare a prewarmed 45 C mixture of the following stock solutions 100 mL of 10X D 100 mL of 10X YNB 2 mL of 500X B 10 mL of 100X AA 88 mL of sterile water Add to sorbitol solution 5 For growth of his4 strains you must add histidine to the media Add 10 mL of 100X H histidine to the prewarmed mixture in Step 4 Store liquid medium at 4 C Media should last for several months 1 Dissolve 186 g of sorbitol in 700 mL of w
14. Add 10 50 pL of your crude assay to 1 mL of Z buffer and equilibrate at 28 C As a control for spontaneous hydrolysis of ONPG add an aliquot of your lysis buffer to 1 mL of Z buffer 4 To initiate the reaction add 0 2 mL 4 mg mL ONPG to each of the tubes in Step 3 5 Incubate the samples and the control at 28 C until a faint yellow color develops This should occur at least 10 minutes after the start of the assay to ensure accurate data Note that the tube with no lysate may not change color 6 Stop the reaction by adding 0 5 mL of 1 M sodium carbonate to each tube Record the length of incubation for each sample 7 Read the OD against the control containing buffer alone Determine the protein concentration of your lysate in mg mL If the reaction turns yellow too quickly you need to dilute your lysate Try Note successive 10 fold dilutions of the lysate using your lysis buffer until the reaction starts turning yellow after 10 minutes This is to ensure that you are measuring a true initial rate Determining Use the following formula to determine the specific activity of the B Specific Activity galactosidase in units mg total protein OD x 380 minutes at 28 C x mg protein in reaction B galactosidase units mg total protein Sample Here is a sample calculation Extract concentration 10 mg mL Calculation Assay 10 pL of a 1 100 dilution Time 10 minutes OD 0 4 The amount of protein in the reaction
15. CA Hagenson M J Holden K A Parker K A Wood P J Cruze J A Fuke M Hopkins T R and Stroman D W 1989 Expression of Streptokinase in Pichia pastoris Yeast Enzyme Microbiol Technol 11 650 656 Henikoff S and Cohen E H 1984 Sequences Responsible for Transcription Termination on a Gene Segment in Saccharomyces cerevisiae Mol Cell Biol 4 1515 1520 Hinnen A Hicks J B and Fink G R 1978 Transformation of Yeast Cells Proc Natl Acad Sci USA 75 1292 1293 Irniger S Egli C M and Braus G H 1991 Different Classes of Polyadenylation Sites in the Yeast Saccharomyces cerevisiae Mol Cell Bio 11 3060 3069 Johnston M 1987 A Model Fungal Gene Regulatory Mechanism the GAL Genes of Saccharomyces Cerevisiae Microbiol Rev 51 458 476 Koutz P J Davis G R Stillman C Barringer K Cregg J M and Thill G 1989 Structural Comparison of the Pichia pastoris Alcohol Oxidase Genes Yeast 5 167 177 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Laroche Y Storme V Meutter J D Messens J and Lauwereys M 1994 High Level Secretion and Very Efficient Isotopic Labeling of Tick Anticoagulant Peptide TAP Expressed in the Methylotrophic
16. For medium autoclave 800 mL of water for 20 minutes on liquid cycle Cool to about 60 C and then add 100 mL of 10X YNB 2 mL of 500X B 100 mL of 10X D To make MDH add 10 mL of 100X H stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed If preparing plates pour the plates immediately MD stores well for several months at 4 C Minimal Methanol Histidine 1 liter 1 34 YNB 4 x 105 biotin 0 5 methanol 1 2 For medium autoclave 800 mL of water for 20 minutes on liquid cycle Cool autoclaved water to 60 C and add 100 mL of 10X YNB 2 mL of 500X B 100 mL of 10X M To make MMH add 10 mL of 100X H stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed After mixing pour the plates immediately MM and MMH stores well for several months at 4 C Continued on next page Pichia Media Recipes continued BMG and BMM Buffered Minimal Glycerol Buffered Minimal Methanol 1 liter 100 mM potassium phosphate pH 6 0 1 34 YNB 4 x 105 biotin 1 glycerol or 0 5 methanol 1 Autoclave 700 mL water for 20 minutes on liquid cycle 2 Cool to room temperature then add the following and mix well 100 mL 1 M potassium phosphate buffer pH 6 0 100 mL 10X YNB 2 mL 500X B 100 mL 10X GY 3 For BMM add 100 mL 10X M instead of glycerol Store media at 4 C The shelf life of this solution is approximately two months BMGY and
17. Very little O linked glycosylation has been observed in Pichia In addition Saccharomyces cerevisiae core oligosaccharides have terminal a1 3 glycan linkages whereas Pichia pastoris does not It is believed that the 01 3 glycan linkages in glycosylated proteins produced from Saccharomyces cerevisiae are primarily responsible for the hyper antigenic nature of these proteins making them particularly unsuitable for therapeutic use Although not yet proven this is predicted to be less of a problem for glycoproteins generated in Pichia pastoris because it may resemble the glycoprotein structure of higher eukaryotes Cregg et al 1993 Experimental Outline Selection of Vector and Cloning Transformation and Integration To utilize the strong highly inducible Paox promoter for expressing your protein four expression vectors are included in this kit pHIL D2 and pPIC3 5 are used for intracellular expression and pHIL S1 and pPIC9 are used for secreted expression see pages 14 17 for more information Before cloning your insert you must e decide whether you want intracellular or secreted expression e analyze your insert for the following restriction sites Sac I Stu I Sal I Not I and Bgl II We recommend these sites for linearizing your construct prior to Pichia transformation If your insert has all of these sites refer to pages 29 30 for alternate sites Two different phenotypic classes of His recombinant strains can
18. be generated Mut and Mut Mut refers to the Methanol utilization slow phenotype caused by the loss of alcohol oxidase activity encoded by the AOX1 gene A strain with a Mut phenotype has a mutant aox1 locus but is wild type for AOX2 This results in a slow growth phenotype on methanol medium Transformation of strain GS115 can yield both classes of transformants His Mut and His Mut while KM71 yields only His Mut because the strain itself is Mut Both Mut and Mut recombinants are useful to have because one phenotype may favor better expression of your protein than the other Because of clonal variation you should test 6 10 recombinants per phenotype There is no way to predict beforehand which construct or isolate will better express your protein We strongly recommend that you analyze Pichia recombinants by PCR to confirm the integration of your construct see page 43 After you have successfully cloned your gene you will linearize your plasmid to stimulate recombination when the plasmid is transformed into Pichia The table below describes the types of recombinants you will get by selective digestion of your plasmid Restriction Integration Event GS115 Phenotype KM71 Phenotype Enzyme Sal I or Stu I Insertion at his4 Hist Mut His Mut Sac I Insertion at 5 His Mutt His Mut AOX1 region Not I or Bgl II Replacement at His Mut His Mut not AOX1 locus Hist Mut recommended see page 7
19. can also be transformed using PEG 1000 page 74 or lithium chloride page 76 These two protocols particularly lithium chloride do not perform as well as spheroplasting or electroporation If you do not have an electroporation device we recommend spheroplasting or using the PEG 1000 method Transformation in Pichia is less efficient than for Saccharomyces For references on general yeast transformation see Cregg et al 1985 Hinnen et al 1978 The cell wall of yeast prevents uptake of DNA To enable yeast to take up DNA it is necessary to partially remove the cell wall Zymolyase is a B glucanase that hydrolyzes the glucose polymers with 1 3 linkages in the cell wall Addition of Zymolyase partially digests the cell wall It is critical not to overdigest the cell wall as doing so will cause the cells to die Zymolyase digestion is monitored by the sensitivity of the cells to SDS Aliquots of cells are added to SDS lysing the spheroplasts This causes a clearing of the solution that is monitored by the absorbance light scattering at 800 nm It has been empirically determined that when 70 spheroplasting has been achieved digestion is optimal Cells are then washed with an isotonic solution to remove the enzyme and incubated with DNA The cells are resuspended in sorbitol to facilitate cell wall regeneration and plated Prepare the following media several days in advance and store at 4 C see Appendix pages 61 64 for details
20. it shares the advantages of molecular and genetic manipulations with Saccharomyces and it has the added advantage of 10 to 100 fold higher heterologous protein expression levels These features make Pichia very useful as a protein expression system Many of the techniques developed for Saccharomyces may be applied to Pichia These include e Transformation by complementation e Gene disruption e Gene replacement In addition the genetic nomenclature used for Saccharomyces has been applied to Pichia For example the HIS4 gene in both Saccharomyces and Pichia encodes histidinol dehydrogenase There is also cross complementation between gene products in both Saccharomyces and Pichia Several wild type genes from Saccharomyces complement comparable mutant genes in Pichia Genes such as HIS4 LEU2 ARG4 TRP1 and URA3 all complement their respective mutant genes in Pichia Pichia pastoris is a methylotrophic yeast capable of metabolizing methanol as its sole carbon source The first step in the metabolism of methanol is the oxidation of methanol to formaldehyde using molecular oxygen by the enzyme alcohol oxidase In addition to formaldehyde this reaction generates hydrogen peroxide To avoid hydrogen peroxide toxicity methanol metabolism takes place within a specialized cell organelle called the peroxisome which sequesters toxic by products away from the rest of the cell Alcohol oxidase has a poor affinity for Oz and Pichia pastori
21. laboratories A partial list is provided below Company Type of Service Contact Glyko Kits for Carbohydrate 1 800 334 5956 Analysis www prozyme com Reagents Contract Services New England BioLabs Reagents 1 800 632 5227 www neb com Appendix E coliMedia Recipes Introduction You select transformants with pAO815 pPIC3K or pPIC9K on LB agar containing 50 to 100 pg mL ampicillin LB Luria 1 Tryptone Bertani Medium 0 5 Yeast Extract 1 NaCl pH 7 0 1 For 1 liter dissolve the following in 950 mL deionized water 10 g tryptone 5 g yeast extract 10 g NaCl 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave the medium for 20 minutes at 15 Ibs sq in Let it cool to 55 C and add desired antibiotics at this point 4 Store the medium at room temperature or at 4 C LB agar plates 1 Make LB Medium as described above and add to it 15 g liter agar before autoclaving Autoclave the medium for 20 minutes at 15 lbs sq in Let the medium cool to 55 C and add the desired antibiotics Pour into 10 cm Petri plates Let the plates harden invert and store at 4 C 59 Pichia Media Recipes Introduction Stock Solutions 60 Expressing recombinant proteins in Pichia pastoris requires the preparation of several different media Recipes for these media are included in this section In addition Yeast Nitrogen Base is available fro
22. of competent cells Include carrier DNA 40 ug of denatured and sonicated salmon sperm DNA with lt 1 ug DNA samples for maximum transformation frequencies Incubate all sample tubes in a 37 C water bath for five minutes Mix the samples once or twice during this incubation period Remove the tubes from the bath and add 1 5 mL of Buffer B to each Mix their contents thoroughly Incubate the tubes in a 30 C water bath for 1 hour Centrifuge the sample tubes at 2 000 x g for 10 minutes at room temperature Decant the supernatant and resuspend the cells in 1 5 mL of Buffer C Centrifuge the samples a second time and resuspend the cell pellet gently in 0 2 mL of Buffer C Spread the entire contents of each tube on an agar plate containing selective growth medium and incubate plates at 30 C for 3 to 4 days Screen for Mut phenotype page 38 or select hyper resistant Geneticin colonies page 41 75 Lithium Chloride Transformation Method Introduction Preparing Solutions Preparing Cells 76 This is a modified version of the procedure described for S cerevisiae Gietz amp Schiestl 1996 This protocol is provided as an alternative to transformation by electroporation Transformation efficiency is between 10 to 10 cfu yg linearized DNA Lithium acetate does not work with Pichia pastoris Use only lithium chloride 1M LiCl in distilled deionized water Filter sterilize Dilute as needed with sterile wat
23. of interest should have a yeast consensus sequence Romanos et al 1992 An example of a yeast consensus sequence is provided below The ATG initiation codon is shown underlined A Y A A T AATGTCT Note that other sequences are also possible Although not as strong as the mammalian Kozak translation initiation sequence the yeast consensus sequence is thought to have a 2 to 3 fold effect on the efficiency of translation initiation e Shorter 5 untranslated leaders reportedly work better in AOX1 expression In pHIL D2 make the untranslated region as short as possible when cloning your gene e If your insert has a Not I site refer to page 29 for alternate restriction sites to linearize your plasmid for Pichia transformation Continued on next page 21 Cloning into the Pichia Expression Vectors continued Paox and Multiple Cloning Site of pPIC3 5 Special Considerations 22 The sequence below shows the detail of the multiple cloning site and surrounding sequences AOX1 mRNA 5 end 824 5 AOX 1 Primer Site 855 875 l 1 TTATCATCAT TATTAGCTTA CTTTCATAAT TGCGACTGGT TCCAATTGAC AAGCTTTTGA TTTTAACGAC BamH SnaB EcoR Avr Il TTTTAACGAC AACTTGAGAA GATCAAAAAA CAACTAATTA TTCGAAGGAT CCTACGTAGA ATTCCCTAGG Not GCGGCCGCGA ATTAATTCGC CTTAGACATG ACTGTTCCTC AGTTCAAGTT GGGCACTTAC GAGAAGACCG 3 AOX 1 Primer Site 1055 1075 IR GTCTTGCTAG ATTCTAATCA AGAGGATGTC AGAATGCCAT TTGCCTGAGA GATGCAGGCT T
24. religates although at a lower frequency AOX1 or aox1 ARG4 Pichia Genome his4 5 AOX1 or aox1 ARG4 TT S Gene of Interest TT Expression Cassette Continued on next page 69 Recombination and Integration in Pichia continued Gene Insertion Events at his4 70 In GS115 Mutt and KM71 Mut gene insertion events at the his4 locus arise from a single crossover event between the his4 locus in the chromosome and the HIS4 gene on the vector This event results in the insertion of one or more copies of the vector at the his4 locus Because the genomic AOX1 or aox1 ARG4 loci are not involved in this recombination event the phenotype of such a His transformant has the same Mut phenotype as the parent strain By linearizing the recombinant vector at a restriction enzyme site located in HIS4 gene Mut or Mut recombinants can be conveniently generated depending on the host strain used The figure below shows the result of an insertion of the plasmid between duplicated copies of the HIS4 his4 genes one still mutant and the other wild type Pichia Genome his4 his4 mutation Geen TT Gene of interest 5 Prox 3 AOX1 ee HIS4 his4s His His Continued on next page Recombination and Integration in Pichia continued Multiple Gene Multiple gene insertion events at a single locus in a cell do occur spontaneously Insertion Events with a low but detectable frequency between 1 and 10 of all selec
25. should be made and used immediately The quality and freshness of DTT is critical for a successful spheroplast preparation The 1 M DTT provided is analytical reagent grade and must be stored at 20 C 1 Wash the cells from Step 5 page 32 by resuspending the pellet in 20 mL of sterile water provided Resuspend the pellet by swirling the tube Transfer to a sterile 50 mL conical tube 2 Pellet the cells by centrifugation at 1 500 x g for 5 minutes at room temperature Decant and discard the supernatant The cell pellet will be used to prepare spheroplasts 3 Wash the cell pellet once by resuspending in 20 mL of fresh SED prepared above and centrifuge at 1 500 e for 5 minutes at room temperature 4 Wash the cells once with 20 mL of 1 M sorbitol and centrifuge as described in Step 2 5 Resuspend the cells by swirling in 20 mL of SCE buffer and divide the suspension into two 50 mL conical tubes 10 mL each 6 Remove one tube of Zymolyase from 20 C and place it on ice Mix well by flicking the tube several times Zymolyase is provided as a slurry and does not go into solution It is important to mix the slurry thoroughly before each use to ensure addition of a consistent amount of Zymolyase Use one tube of cells prepared above to determine the optimal time of digestion with Zymolyase to make spheroplasts After you determine the optimal use the other tube of to make spheroplasts Zymolyase digests the cell wa
26. that are to be analyzed as well as from the untransformed GS115 or KM 71 to control for any background hybridization You can use the DNA in either of the following analyses to detect multicopy integration For a detailed description of this technique as applied to Pichia pastoris see Clare et al 1991a It is very important to digest your DNA with the right restriction enzyme s to generate a blot of digested and gel separated genomic DNA It is also important to understand that your strategy will be different if you use pPIC3 5K versus pAO815 to generate your multiple copies Digesting DNA from Pichia recombinants containing multiple copies produces a band that varies in intensity depending on the number of copies of your gene It is very important to include a control to show the intensity of a single copy gene You can quantify the band intensities using densitometry to estimate relative gene dosage Prepare 10 15 mL of each following of solutions for each dot blot e 50mM EDTA 2 5 B mercaptoethanol pH 9 1 mg mL Zymolyase 100T in water Seikagaku America Inc 1 800 237 4512 e 0 1 N NaOH 1 5 M NaCl e 2XSSC e 3MM paper Continued on next page 81 Detecting Multiple Integration Events continued Quantitative Dot The following protocol is a summary of a rapid DNA dot blot technique to detect Blot Procedure multiple integrants Romanos et al 1991 It is very important to spot equivalent numbers of cells onto f
27. to a separate tube Freeze the supernatant and the cell pellets quickly in liquid N or a dry ice alcohol bath and store them at 80 C until ready to assay For intracellular expression decant the supernatant and store just the cell pellets at 80 C until ready to assay Freeze quickly in liquid N2 or a dry ice alcohol bath Analyze the supernatants and the cell pellets for protein expression by Coomassie stained SDS PAGE and western blot or functional assay see Analysis by SDS Polyacrylamide Gel Electrophoresis page 49 Continued on next page 47 Expression of Recombinant Pichia Strains continued Mut Intracellular or Secreted 48 You can test the effectiveness of your expression conditions by growing GS115 which is Mut and secretes albumin to the medium Remember to include GS115 or KM71 transformed with the parent vector as a control for background intracellular expression 1 Using a single colony inoculate 100 mL of MGY BMG or BMGY medium in a 1 liter baffled flask Grow the culture at 28 30 C in a shaking incubator 250 300 rpm until the culture reaches an ODeo 2 6 approximately 16 18 hours Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend the cell pellet in MM BMM or BMMY medium using 1 5 to 1 10 of the original culture volume approximately 10 20 mL Place the cells in a 100 mL baffled flask
28. to be linearized with a restriction enzyme such that His recombinants are generated by recombination at the AOX1 locus see below or at the his4 locus see next page Note that single crossover events insertions are much more likely to happen than double crossover events replacements Multiple insertion events occur spontaneously at about 1 10 of the single insertion events Gene insertion events at the AOX1 GS115 or aox1 ARG4 KM 71 loci arise from a single crossover event between the loci and any of the three AOX1 regions on the vector the AOX1 promoter the AOX1 transcription termination region TT or sequences even further downstream of AOX1 3 AOX1 This results in the insertion of one or more copies of the vector upstream or downstream of the AOX1 or the aox1 ARG4 genes The phenotype of such a transformant is His Mut GS115 or His Mut KM 71 By linearizing the recombinant vector at a restriction enzyme site located in the 5 or 3 AOX1 regions Mutz or Mut recombinants can be conveniently generated depending on the host strain used The figure below shows the result of an insertion of the plasmid 3 to the intact AOX1 locus Mut and the gain of P4ox your gene of interest and HIS4 expression cassette This event could also happen at the 5 AOX1 regions of the plasmid and genome with the resulting insertion positioned 5 to an intact AOX1 locus This also occurs with non linearized plasmid and plasmid that
29. to help you decide on a strategy We recommend that you transform the three supercoiled Pichia expression vectors into E coli to prepare permanent stock Resuspend each vector in 10 yL sterile water to prepare a 1 pg pL solution Store the stock solution at 20 C Use the stock solution to transform competent E coli and select transformants on LB agar plates containing 50 100 pg mL ampicillin LB Amp The following are some general considerations applicable to all vectors The codon usage in Pichia is believed to be the same as Saccharomyces cerevisiae because many genes have proven to be cross functional Maintain plasmid constructions in a recA mutant E coli strain such as the TOP10F strain provided in the kit The native 5 end of the AOX1 mRNA is noted in each multiple cloning site This information is necessary to calculate the size of the expressed mRNA of the gene of interest Translation termination is determined by either stop codons in the gene of interest or in the 3 AOX1 sequence The stop codons in the 3 AOX1 sequence are noted in each figure on the following pages The premature termination of transcripts due to AT rich regions has been observed in Pichia and other eukaryotic systems Henikoff and Cohen 1984 Irniger et al 1991 Scorer et al 1993 Zaret and Sherman 1984 If you are expressing a gene with high AT content refer to page 53 The predicted protease cleavage sites for the PHO
30. up to 30 minutes for transformation page 35 They cannot be stored for much longer This preparation yields enough spheroplasts for six transformations Transforming Pichia Before Starting Procedure Make sure your RDB plates are at room temperature and that you have molten RD top agarose available Thaw your linearized DNA and keep on ice You should have the following Your construct linearized with Sal I Stu I or Sac I to favor isolation of His Mutt recombinants in GS115 Your construct linearized with Sal I Stu I or Sac I to favor isolation of His Mut recombinants in KM71 Your construct linearized with Not I Bg II or equivalent to favor isolation of His Mut recombinants in GS115 Parent plasmid linearized with same restriction enzyme Controls should include no DNA or linearized pBR322 DNA and plasmid only no cells to check for contamination For each transformation dispense 100 ul of the spheroplast preparation from Step 9 previous page into a sterile 15 mL snap top Falcon 2059 tube or equivalent Add 10 ug of DNA and incubate the tube at room temperature for 10 minutes During the 10 minute incubation make a fresh PEG CaT solution Since each transformation requires 1 0 mL of the PEG CaT solution calculate the amount you need and prepare this volume by adding together equal volumes of 40 PEG and CaT a 1 1 solution Add 1 0 mL of fresh PEG CaT solution to the cells and DNA mix gently
31. you used pPIC3 5K to generate multimers use Bgl II to digest your DNA Clare et al 1991a If you used pPIC3 5K all multimers are NOT necessarily in a head to tail configuration Some multimers may be head to head and others tail to tail We recommend that you think about what products may be produced An expression cassette in the opposite orientation may produce a different band The number of multiple copies will cause one or two bands depending on orientation in the Southern blot to increase in intensity once you have gt 2 copies If you used pAO815 to generate multimers use Bgl II and BamH I to digest the genomic DNA and release the multimer The molecular weight of the band allows you to determine the number of multimers If this multimer is too large you may wish to digest with an enzyme like Sac I This collapses the multimer into single fragments containing your gene These fragments will produce a band that will be quite intense The relative intensity of this band versus a band containing a single copy of your gene allows you to determine the copy number Bgl II digested DNA from GS115 and GS115 transformed with pPIC3 5K or pAO815 produces bands of 2 8 kb the genomic copy of HIS4 and 6 7 kb the vector derived copy of HIS4 respectively when probed with a complementary fragment to HIS4 83 Procedure for Total RNA Isolation from Pichia Introduction Solutions Growing Cells 84 This protocol is designed
32. 1 and a factor signal sequences are indicated in each figure If you are attempting to secrete a protein using its native secretion signal we recommend that you also try pPIC9 in parallel When using pPIC9 the open reading frame ORF of the mature gene of interest is cloned in frame and downstream of the a factor Continued on next page 19 Cloning into the Pichia Expression Vectors continued General Cloning Strategies Cloning Procedures Bacterial Transformation 20 Strategies generally fall into three different categories 1 Ligation of a compatible restriction fragment a Forced directional insertion involving the use of two different sites in the multiple cloning site for pPIC3 5 pHIL S1 or pPIC9 vectors b Ligation of the fragment with the same restriction end on both ends into a single compatible site e g EcoR I cloning in pHIL D2 2 PCR amplification of the fragment containing the gene of interest in such a way that compatible restriction ends are generated for ligation into the appropriate vector 3 Direct cloning of an amplified fragment containing the gene of interest via the TA Cloning Kit see page 88 for ordering followed by subcloning of a compatible fragment into the appropriate Pichia expression vector Refer to Ausubel et al 1994 pages 3 16 1 to 3 17 3 or Sambrook et al 1989 pages 5 10 to 5 13 for help with cloning Once you have decided on a cloning strategy
33. 1 have a mutation in the histidinol dehydrogenase gene his4 that prevents them from synthesizing histidine All expression plasmids carry the HIS4 gene that complements his4 in the host so transformants are selected for their ability to grow on histidine deficient medium Spontaneous reversion of GS115 and KM71 to His prototrophy is less than 1 out of 10 The parent strain of KM71 has a mutation in the argininosuccinate lyase gene arg4 that prevents the strain from growing in the absence of arginine The wild type ARG4 gene was used to disrupt AOX1 creating KM71 a Mut Are His strain Both GS115 and KM71 will grow on complex medium such as YPD also known as YEPD and on minimal media supplemented with histidine Until transformed neither GS115 nor KM71 will grow on minimal medium alone as they are His Note Mut Methanol utilization slow phenotype has in the past been referred to as Mut The Mut designation has been chosen to accurately describe the phenotype of these mutants The ARG4 gene 2 kb was inserted into the cloned wild type AOX1 gene between the BamH I site codons 15 16 of AOX1 and the Sal I site codons 227 228 of AOX1 ARG4 replaces codons 16 through 227 of AOX1 This construct was transformed into the parent strain of KM71 arg4 his4 and Arg transformants were isolated and analyzed for the Mut phenotype Genetic analysis of Are transformants showed that the wild type AOX1 gene was replaced by the
34. 20 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail jpinfo invitrogen com E mail tech_support invitrogen com eurotech invitrogen com SDS SDSs Safety Data Sheets are available at www invitrogen com sds Certificate of The Certificate of Analysis CofA provides detailed quality control information Analysis for each product The CofA for each product is available on our website at www invitrogen com cofa and is searchable by product lot number which is printed on each box Continued on next page 89
35. A Provow S A Craig W S Velicelebi G Harpold M M and Thill G P 1989 Continuous Production of a Novel Lysozyme via Secretion from the Yeast Pichia pastoris Bio Technology 7 160 164 Ellis S B Brust P F Koutz P J Waters A F Harpold M M and Gingeras T R 1985 Isolation of Alcohol Oxidase and Two other Methanol Regulatable Genes from the Yeast Pichia pastoris Mol Cell Biol 5 1111 1121 Fryxell K B O Donoghue K Graeff R M Lee H C and Branton W D 1995 Functional Expression of Soluble Forms of Human CD38 in Escherichia coli and Pichia pastoris Protein Expression and Purification 6 329 336 Garcia J N Aguiar J A Gill M Alvarez A Morales J Ferrero J Gonzalez B Padron G and Menendez A 1995 High Level Expression of Human IFN a2b in Pichia pastoris Biotecnologia Aplicada 12 152 155 Gietz R D and Schiestl R H 1996 in Methods in Molecular Biology Evans I H ed Humana Press Totowa NJ Guo W Gonzalez Candelas L and Kolattukudy P E 1995 Cloning of a New Pectate Lyase Gene pelC from Fusarium solani f sp pisi Nectria haematococca Mating Type VI and Characterization of the Gene Product Expressed in Pichta pastoris Arch Biochem Biophys 323 352 360 Guthrie C and Fink G R eds 1991 Guide to Yeast Genetics and Molecular Biology Vol 194 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego
36. Buffered Glycerol complex Medium BMMY Buffered Methanol complex Medium 1 liter 1 yeast extract 2 peptone 100 mM potassium phosphate pH 6 0 1 34 YNB 4 x 105 biotin 1 glycerol or 0 5 methanol 1 Dissolve 10 g of yeast extract 20 g peptone in 700 mL water 2 Autoclave 20 minutes on liquid cycle 3 Cool to room temperature then add the following and mix well 100 mL 1 M potassium phosphate buffer pH 6 0 100 mL 10X YNB 2 mL 500X B 100 mL 10X GY 4 For BMMY add 100 mL 10X M instead of glycerol Store the media at 4 C The shelf life of this solution is approximately two months Continued on next page 65 Pichia Media Recipes continued Breaking Buffer Vendors for Baffled Flasks 66 50 mM sodium phosphate pH 7 4 1 mM PMSF phenylmethylsulfony fluoride or other protease inhibitors 1mM EDTA 5 glycerol 1 Prepare a stock solution of your desired protease inhibitors and store it appropriately Follow manufacturer s recommendations 2 For 1 liter dissolve in 900 mL deionized water 6 g sodium phosphate monobasic 372 mg EDTA and 50 mL glycerol 3 Use NaOH to adjust the pH of the solution and bring up the volume to 1 liter Store the breaking buffer at 4 C 4 Right before use add the protease inhibitors Bellco 1 800 257 7043 has a wide variety of baffled flasks from 50 to 2 000 mL Wheaton 1 609 825 1100 only sells side baffle flasks Proteins Expressed in Pichia Table T
37. CATTTTTGA AOX1 mRNA 3 end 1146 4 TACTTTTTTA TTTGTAACCT ATATAGTATA GGATTTTTTT TGTCATTTTG TITCTTC For pPIC3 5 the fragment containing the gene of interest should have a yeast consensus sequence Romanos et al 1992 An example of a yeast consensus sequence is provided below The ATG initiation codon is shown underlined A Y A A T AATGTCT Note that other sequences are also possible Although not as strong as the mammalian Kozak translation initiation sequence the yeast consensus sequence is thought to have a 2 to 3 fold effect on the efficiency of translation initiation Shorter 5 untranslated leaders reportedly work better in AOX1 expression In pPIC3 5 make the untranslated region as short as possible when cloning your gene If you are digesting with BamH I and SnaB I or SnaB I and EcoR I digest with SnaB I first If you digest with BamH I or EcoR I first the SnaB I site will be too close to the end of the DNA and will not digest properly If your insert has a Bg II Sac I Sal I or Stu I site refer to page 29 for alternate restriction sites to linearize your plasmid for Pichia transformation Continued on next page Cloning into the Pichia Expression Vectors continued Pox and Multiple Cloning Site of pHIL S1 Special Considerations The sequence below shows the detail of the multiple cloning site and surrounding sequences 773 AOXI mRNA 5 end 825 ACAGGCAATA TATAAACAGA AGGAAGCTGC CCTG
38. D glucose in 1 000 mL of water 2 Autoclave for 15 minutes or filter sterilize The shelf life of this solution is approximately one year Continued on next page Pichia Media Recipes continued Stock Solutions continued YPD or YEPD 10X M 5 Methanol 1 Mix 5 mL of methanol with 95 mL of water 2 Filter sterilize and store at 4 C The shelf life of this solution is approximately two months 10X GY 10 Glycerol 1 Mix 100 mL of glycerol with 900 mL of water 2 Sterilize either by filtering or autoclaving Store at room temperature The shelf life of this solution is greater than one year 100X AA 0 5 of each Amino Acid 1 Dissolve 500 mg each of L glutamic acid L methionine L lysine L leucine and L isoleucine in 100 mL of water 2 Filter sterilize and store at 4 C The shelf life of this solution is approximately one year 1M potassium phosphate buffer pH 6 0 1 Combine 132 mL of 1M K HPO 868 mL of 1 M KH2PO and confirm that the pH 6 0 0 1 if the pH needs to be adjusted use phosphoric acid or KOR 2 Sterilize by autoclaving and store at room temperature The shelf life of this solution is greater than one year Yeast Extract Peptone Dextrose Medium 1 liter 1 yeast extract 2 peptone 2 dextrose glucose Note If you are using the YP Base Medium or the YP Base Agar medium pouches included with the Multi Copy Pichia Expression Kit follow the directions on the pouch 1
39. Dissolve 10 g yeast extract and 20 g of peptone in 900 mL of water Note Add 20 g of agar if making YPD slants or plates Autoclave for 20 minutes on liquid cycle Add 100 mL of 10X D Store the liquid medium at room temperature Store the YPD slants or plates at 4 C The shelf life is several months Continued on next page 61 Pichia Media Recipes continued YPD Geneticin Yeast Extract Peptone Dextrose Medium plates 1 yeast extract 2 peptone 2 dextrose glucose 2 agar Variable amounts of Geneticin see page 88 for ordering information Use 50 mg mL Geneticin stock solution to make YPD plates containing Geneticin at final concentrations of 0 25 0 5 0 75 1 0 1 5 1 75 2 0 3 0 and 4 0 mg mL For 250 mL 8 to 10 plates of a single Geneticin concentration 1 Combine 2 5 g yeast extract 5 g peptone and 5 g agar in 225 mL deionized water 2 Autoclave for 20 minutes on liquid cycle Add 25 mL of 10X D and mix well 4 Cool YPD to approximately 55 60 C and add appropriate volume of Geneticin stock see chart below Remember to also make several YPD plates without Geneticin 5 Mix well by swirling but take care to minimize bubble formation 6 Pour agar solution into 10 cm Petri plates Let plates harden invert and store bagged at 4 C Plates are stable for at least 6 months Final Geneticin mL Geneticin stock mg mL per 250 mL YPD 0 25 1 25 0
40. H 8 35 e Buffer C 0 15 M NaCl 10 mM Bicine pH 8 35 Filter sterilize the above solutions and store them at 20 C e Fresh reagent grade DMSO that is from an unopened bottle or made fresh and stored at 70 C until use Cell competence decreases very rapidly after the cells thaw even when held on ice It is critical to add DNA to frozen cell samples To perform multiple transformations it is recommended to process them in groups of six at a time 1 Streak Pichia pastoris strain for single colonies on a YPD plate and incubate the plate at 30 C for two days 2 Inoculate a 10 mL YPD culture with a single colony from the plate and grow the culture overnight at 30 C with shaking 3 In the morning use an aliquot of the overnight culture to inoculate a 100 mL YPD culture to a starting ODgo of 0 1 and grow at 30 C to an ODo00 of 0 5 to 0 8 4 Harvest the culture by centrifugation at 3 000 x g at room temperature and wash cells once in 50 mL of Buffer A 5 Resuspend the cells in 4 mL of Buffer A and distribute them in 0 2 mL aliquots to sterile 1 5 mL microcentrifuge tubes Add 11 pL of DMSO to each tube mix and quickly freeze cells in a bath of liquid nitrogen 6 Store the frozen tubes at 70 C Continued on next page PEG 1000 Transformation Method for Pichia continued Transformation 1 Use up to 50 ug of each DNA sample in no more than 20 pL total volume Add the DNA directly to a still frozen tube
41. I site refer to page 29 for alternate restriction sites to linearize your plasmid for Pichia transformation The PHO1 cleavage site has been confirmed for several different fusion proteins by N terminal peptide sequencing In factor pPIC9 or native general more success has been reported with the secretion signals than with pHIL S1 This may be due to the lack of KEX2 like processing signals Laroche et al 1994 Continued on next pa 23 Cloning into the Pichia Expression Vectors continued P Multiple Cloning surrounding sequences Site of pPIC9 773 woen and The sequence below shows the detail of the multiple cloning site and AOX1 mRNA 5 end 824 ACAGCAATAT ATAAACAGAA GGAAGCTGCC CTGTCTTAAA CCTTTTTTTT TATCATCATT ATTAGCTTAC ATCAAAAAAC AACTAAT 5 AOX1 Primer Site 855 875 GTT TTA TTC GCA GCA Val Leu Phe Ala Ala GAA ACG GCA CAA ATT Glu Thr Ala Gln Ile TTC GAT GTT GCT GIT Phe Asp Val Ala Val a Factor Primer Site 1152 1172 TCC TCC GCA TTA Ser Ser Ala Leu CCG GCT GAA GCT Pro Ala Glu Ala TTG CCA TTT TCC Leu Pro Phe Ser T 1 AAT ACT ACT ATT GCC AGC ATT GCT GCT Asn Thr Thr Ile Ala Signal cleavage 1 204 SnaBI EcoR Avr ll Ser Ile Ala Ala GAG GCT GAA GCT TAC GTA GAA TTC CCT Glu Ala Glu Ala Tyr Val Glu Phe Pro a Factor 949 1215 l TAT TCGAAGGATC CAAACG ATG AGA TTT CCT Met Arg Phe Pro GCT GCT CCA GTC AAC Ala Ala Pro Val Asn GTC ATC GGT
42. Johnston 1987 Briefly growth on glucose represses transcription even in the presence of the inducer methanol For this reason growth on glycerol is recommended for optimal induction with methanol Note that growth on glycerol only derepression is not sufficient to generate even minute levels of expression from the AOX1 gene The inducer methanol is necessary for even detectable levels of AOX1 expression Ellis et al 1985 Koutz et al 1989 Tschopp et al 1987a Loss of the AOX1 gene and thus a loss of most of the cell s alcohol oxidase activity results in a strain that is phenotypically Mut Methanol utilization slow This has in the past been referred to as Mut The Mut designation has been chosen to accurately describe the phenotype of these mutants This results in a reduction in the cells ability to metabolize methanol The cells therefore exhibit poor growth on methanol medium Mut Methanol utilization plus refers to the wild type ability of strains to metabolize methanol as the sole carbon source These two phenotypes are used when evaluating Pichia transformants for integration of your gene Experimental Outline page 4 Heterologous expression in Pichia pastoris can be intracellular or secreted Secretion requires the presence of a signal sequence on the expressed protein to target it to the secretory pathway While several different secretion signal sequences have been used successfully including the native s
43. Mut Remember also to isolate two control strains for background protein expression in Pichia One control is the parent plasmid linearized in such a way to generate Hist Mut transformants The other control is the parent plasmid linearized to generate His Mut transformants Transformation of GS115 with Sal I or Stu I linearized constructs favor recombination at the HIS4 locus Most of the transformants should be Mut however with the presence of the AOX1 sequences in the plasmid there is a chance that recombination will occur at the AOX1 locus disrupting the wild type AOX1 gene and creating His Mut transformants Testing on Minimal Dextrose MD and Minimal Methanol MM plates allows you to isolate His Mut transformants see next page There is no need to test recombinants for the Mut phenotype in KM71 all His transformants in KM71 will be Mut because of the disruption of the AOX1 gene a0x1 ARG4 Transforming KM71 with Sal I or Stu I linearized plasmid constructs favor recombination at the HIS4 locus while Sac I linearized plasmid constructs favor recombination at the 5 region of the AOX1 gene Purify His transformants on minimal plates without histidine to ensure pure clonal isolates before testing for expression see page 45 or confirming integration by PCR page 43 Transforming GS115 with Not I linearized pHIL D2 or Bgl II linearized pPIC3 5 pHIL S1 and pPIC9 constructs favors recombination at the AOX1 locu
44. S115 with SMD1168 You can also use this strain in large scale fermentation The most important parameter for efficient expression in Pichia is adequate aeration during methanol induction As a general rule when inducing expression never allow cultures to be more than 10 30 of your total flask volume We strongly recommend that you use baffled flasks See Appendix page 66 for suppliers of baffled flasks Cover the flasks with cheesecloth 2 3 layers or another loose fitting cover Never use tight fitting covers Aeration is not as critical when generating biomass before induction Continued on next page 45 Expression of Recombinant Pichia Strains continued Kinetics of Growth Temperature and Shaking Before Starting Guidelines for Expression 46 Note that while Mutt and Mut strains grow at essentially the same rate in YPD or glycerol media Mut grows faster than Mut when both are grown on methanol because of the presence of the AOX1 gene product Perform expression at 30 C in a shaking incubator It is critical that the temperature does not exceed 30 C If your incubator temperature fluctuates set the temperature at 28 C If using a floor shaking incubator shake at 225 250 rpm If using a table top shaker that sits inside an incubator shake at 250 300 rpm After you have verified recombinants in GS115 or KM71 as well as a control recombinant of GS115 or KM71 Vector no insert proceed with expres
45. TAC TCA Val Ile Gly Tyr Ser AAC AGC ACA AAT AAC Asn Ser Thr Asn Asn AAA GAA GAA GGG GTA Lys Glu Glu Gly Val Not l AGG GCG GCC GCG AAT Arg Ala Ala Ala Asn TCA Ser ACT Thr GAT Asp GGG Gly TOT Ser TAA kkk T 1 TTTCATAATT GCGACTGGTT CCAATTGACA AGCTTTTGAT TITAACGACT TTTAACGACA ACTTGAGAAG ATT TTT ACT GCA Ile Phe Thr Ala ACA ACA GAA GAT Thr Thr Glu Asp TTA GAA GGG GAT Leu Glu Gly Asp TTA TTG TTT ATA Leu Leu Phe Ile Xho l CTC GAG AAA AGA T1 Leu Glu Lys Arg CGCCTTAG ACATGACTGT TCCTCAGTTC AAGTTGGGCA CTTACGAGAA GACCGGTCTT GCIAGATTCT AATCAAGAGG 3 AOX1 Primer Site 1327 1347 1 ATGTCAGAAT GCCATTTGCC TGAGAGATGC AGGCTTCATT TTTGATACTT TTTTATTTGT AACCTATATA AOX1 mRNA 3 end 1418 l GTATAGGATT TTTITTGTCA If cloning into the Xho I site the sequence between the Xho I site and SnaB I site underlined must be recreated in order for efficient cleavage of the fusion protein to occur Special e The fragment containing the gene of interest must be cloned in frame with the Considerations secretion signal open reading frame e Ifthe Xho I site is used for cloning the sequence between the Xho I site and the SnaB I site encoding the KEX2 site Glu Lys Arg X must be recreated for efficient cleavage of the fusion protein to occur It is part of the a factor signal peptide sequence Refer to the discussion on page 18 e An initiating ATG is provided by the s
46. TCTTAA ACCTTTTTTT TTATCATCAT 5 AOX1 primer site 856 876 I 1 TATTAGCTTA CTTTCATAAT TGCGACTGGT TCCAATTGAC AAGCTTTTGA TTTTAACGAC PHO1 942 1007 TTTTAACGAC AACTTGAGAA GATCAAAAAA CAACTAATTA TTCGAAACG ATG TTC TCT Met Phe Ser CCA ATT TTG TCC TTG GAA ATT ATT TTA GCT TTG GCT ACT TTG CAA TCT GTC Pro Ile Leu Ser Leu Glu Ile Ile Leu Ala Leu Ala Thr Leu Gln Ser Val PHOI cleavage site Xho y EcoR I Smal BamHI TTC GCT CGA GAA TTC CEC cdc ATC CTT AGA CAT GAC TGT TCC TCA GTT CAA Phe Ala Arg Glu Phe Pro Gly Ile Leu Arg His Asp Cys Ser Ser Val Gln Stop 1083 GTT GGG CAC TTA CGA GAA GAC CGG TCT TGC TAG ATTCTAATCA AGAGGATGTC Val Gly His Leu Arg Glu Asp Arg Ser Cys 3 AOX1 primer site 1099 1119 AGAATGCCAT TTGCCTGAGA GATGCAGGCT TCATTTTTGA TACTTTTTTA TTTGTAACCT AOX1 mRNA 3 end 1190 ATATAGTATA GGATTTTTTT TGTCA If the Xho I site which is part of the PHO signal cleavage sequence is used for cloning it must be recreated in order for efficient cleavage of the fusion protein to occur The fragment containing the gene of interest must be cloned in frame with the secretion signal open reading frame If the Xho I site is used for cloning it must be recreated for efficient cleavage of the fusion protein to occur It is part of the PHO1 signal peptide sequence An initiating ATG is provided by the signal sequence Translation will initiate at the ATG closest to the 5 end of the mRNA If your insert has a Not
47. Yeast Pichia pastoris Bio Technology 12 1119 1124 Linder S Schliwa M and Kube Granderath E 1996 Direct PCR Screening of Pichia pastoris Clones BioTechniques 20 980 982 Nico Farber K Harder W Ab G and Veenhuis M 1995 Review Methylotrophic Yeasts as Factories for the Production of Foreign Proteins Yeast 11 1331 1344 Continued on next page 94 References continued Paifer E Margolles E Cremata J Montesino R Herrera L and Delgado J M 1994 Efficient Expression and Secretion of Recombinant Alpha Amylase in Pichia pastoris Using Two Different Signal Sequences Yeast 10 1415 1419 Ridder R Schmitz R Legay F and Gram H 1995 Generation of Rabbit Monoclonal Antibody Fragments from a Combinatorial Phage Display Library and Their Production in the Yeast Pichia pastoris Bio Technology 13 255 260 Rodriguez M Rubiera R Penichet M Montesinos R Cremata J Falcon V Sanchez G Bringas R Cordoves C Valdes M Lleonart R Herrera L and delaFuente J 1994 High Level Expression of the B microplus Bm86 Antigen in the Yeast Pichia pastoris Forming Highly Immunogenic Particles for Cattle J Biotechnol 33 135 146 Romanos M 1995 Advances in the Use of Pichia pastoris for High Level Expression Curr Opin Biotech 6 527 533 Romanos M A Clare J J Beesley K M Rayment F B Ballantine S P Makoff A J Dougan G Fairweather N F and Char
48. a final volume of approximately 1 5 mL Note You may freeze the electrocompetent cells in 80 uL aliquots however the transformation efficiencies will decrease significantly 1 Mix 80 pL of the cells from Step 6 above with 5 20 ug of linearized DNA in 5 10 pL TE Buffer and transfer them to an ice cold 0 2 cm electroporation cuvette 2 Incubate the cuvette with the cells on ice for 5 minutes 3 Pulse the cells according to the parameters for yeast Saccharomyces cerevisiae suggested by the manufacturer of the specific electroporation device being used 4 Immediately add 1 mL of ice cold 1 M sorbitol to the cuvette Transfer the cuvette contents to a sterile microcentrifuge tube 5 Spread 200 600 uL of aliquots on MD or RDB plates 6 Incubate the plates at 30 C until colonies appear Screen for Mut Mut phenotypes as indicated on page 38 73 PEG 1000 Transformation Method for Pichia Introduction Required Solutions Important Preparing Competent Cells 74 PEG procedure is usually better than LiCl but not as good as spheroplasting or electroporation for transformation However it is convenient for people who do not have an electroporation device The transformation efficiency is 10 to 10 transformants per pg of DNA e Buffer A 1 0 M Sorbitol Fisher 10 mM Bicine pH 8 35 Sigma 3 v v ethylene glycol Merck e Buffer B 40 w v Polyethylene glycol 1000 Sigma 0 2 M Bicine p
49. ajor steps of the experimental process Each step is discussed in detail further in the manual Refer to the indicated pages to read about particular steps of interest The discussion about recombination and integration in Pichia will help you choose the right vector For more information refer to the review by Higgins Higgins 1995 The goal of this section is to create a Pichia pastoris strain containing your integrated gene of interest Before starting your experiments determine which vector to use Step Procedure Page 1 Select the appropriate expression vector For more information 11 17 refer to Recombination and Integration in Pichia pages 69 72 2 Clone your gene of interest into selected vector 19 24 3 Transform E coli select ampicillin resistant transformants and 25 confirm the presence and orientation of your gene of interest 4 Linearize the constructs with appropriate restriction enzymes to 27 30 generate His Mut and His Mut recombinant strains 5 Transform and select His transformants GS115 recombinants 31 37 His Mut KM71 recombinants His Mut 6 Screen His transformants for Mut and Mut strains 6 10 38 42 recombinants of each phenotype 7 Confirm the integration of your gene of interest in Mut and 43 44 Mut recombinants by PCR Continued on next page Experimental Outline continued Mutt Induction Mut Induction The method
50. ame with the initiation codon of the signal sequence HIS4 selection in Pichia For insertion at AOX1 in GS115 or KM71 linearize with Sac I generates His Mutz in GS115 or His Mut in KM71 For insertion at HIS4 in GS115 or KM71 linearize with Sal I or Stu I generates His Mut in GS115 or His Mut in KM71 For gene replacement at AOX1 in GS115 linearize with Bgl II generates His Mur Refer to page 30 for alternate restriction sites if your insert DNA has a Bg II Sac I Sal I or Stu I site The map below shows the location and size of each feature of pHIL S1 For the details of the multiple cloning site refer to page 23 The complete sequence of pHIL S1 is available at www invitrogen com or from Technical Support page 89 Xho EcoR Sma BamH 3 AOX1 TT pPIC9 Description The details of pHIL S1 are listed below 8 023 bp fusion vector Xho I SnaB I EcoR I Avr II Not I unique sites Secreted expression of your gene using the factor secretion signal For expression your gene must be cloned in frame with the initiation codon of the signal sequence HIS4 selection in Pichia For insertion at AOX1 in GS115 or KM71 linearize with Sac I generates His Mutz in GS115 and His Mut in KM71 For insertion at HIS4 linearize with Sal I or Stu I generates His Mutt in GS115 and His Mut in KM71 For gene replacement at AOX1 in GS115 linearize with Bgl II generates His Mur Refer t
51. and incubate at room temperature for 10 minutes Centrifuge the tube at 750 x g for 10 minutes at room temperature and carefully aspirate the PEG CaT solution Invert the tube and tap it gently to drain the excess PEG CaT solution Resuspend the pellet of transformed cells in 150 uL of SOS medium and incubate it at room temperature for 20 minutes Add 850 pL of 1 M sorbitol Proceed to Plating next page Continued on next page 35 Transforming Pichia continued Plating Evaluating Your Transformation Experiment Optional Method 36 Pichia spheroplasts need to be plated in top agarose or agar to protect them from lysis prior to selection 1 Mix together 100 300 uL of each spheroplast DNA solution from Step 7 previous page with 10 mL of molten RD agarose and pour on RDB plates Allow the top agarose to harden Note There is enough of the spheroplast DNA solution to plate duplicate and triplicate plates 2 Invert plates and incubate at 28 30 C Transformants should appear in 4 6 days 3 For cell viability Mix 100 uL of spheroplasts with 900 uL of 1 M sorbitol Mix 100 uL of this diluted sample with 10 mL of molten RDH and pour ona RDHB plate Allow top agarose to harden 5 Invert the plates and incubate at 28 30 C Appearance of colonies after 4 6 days demonstrates that the spheroplasts can regenerate into dividing cells After 4 6 days His transformants on your sample plates will become apparent
52. and prevent or decrease proteolysis of secreted proteins Inclusion of yeast extract and peptone act as a mixed feed allowing better growth and biomass accumulation There are some proteins specifically susceptible to proteases that have optimal activity at neutral pH If this is the case expression using MGY and MM media may be indicated As Pichia expression progresses in an unbuffered medium such as MM the pH drops to 3 or below inactivating many neutral pH proteases Brierley et al 1994 Pichia is resistant to low pH so the low pH will not affect growth In contrast it has been reported that by including 1 Casamino acids Difco and buffering the medium at pH 6 0 extracellular proteases were inhibited increasing the yield of mouse epidermal growth factor Clare et al 1991b If you know your protein of interest is especially susceptible to neutral pH proteases you may want to do your expressions in an unbuffered medium MM If there is no evidence that your secreted protein of interest is susceptible to proteases at neutral pH we recommend you do your initial expressions in BMMY If the expressed protein is degraded you may then try expression in an unbuffered medium If the above options fail to protect your protein from degradation you may wish to transform your gene into SMD1168 This strain genotype is his4 pep4 and is deficient in proteinase A activity You can use the same procedures for transforming and expressing G
53. ansfer the clear supernatant to a fresh microcentrifuge tube 6 Take 50 uL of supernatant cell lysate and mix with an appropriate volume of denaturing PAGE Gel Loading buffer Sample Buffer 7 Heat the sample as recommended and load 10 20 uL per well Thickness of the gel and number of wells will determine volume loaded You may store the remaining sample at 20 C for western blots if necessary You may store the cell lysates at 80 C for further analysis Continued on next page 49 Analyzing Samples by SDS Polyacrylamide Gel Electrophoresis continued Preparing Samples continued Protein Concentration 50 Preparing of supernatant Secreted Expression only 1 2 Thaw supernatants and place on ice Mix 50 uL of the supernatant with an appropriate volume of denaturing PAGE Gel Loading buffer Heat the sample as recommended then load 10 30 uL onto the gel Remaining sample may be stored at 20 C for western blots if necessary Supernatants may be stored at 80 C for further analysis Analyze Coomassie stained gel and western blot if necessary for your protein If no protein is seen by Coomassie or by western blot then concentrate the supernatant 5 10 fold and analyze samples again by western blot Centricon and Centriprep filters Millipore are very useful for this purpose Lowry BCA Pierce or Bradford protein determinations can be performed to quantify the amounts of protein in the cell
54. aox1 ARG4 construct The advantage of using KM71 is that there is no need to screen for the Mut phenotype on methanol minimal medium All transformants will be Mut Secondly since the AOX1 locus was not completely deleted it is theoretically possible to replace aox1 ARG4 with your construct by gene replacement The phenotype of this strain would be His Mut Are This means the recombinant strain would require arginine in the medium to grow Unfortunately simple inclusion of arginine does not totally alleviate the effects of the arg4 mutation and arg4 strains do not grow well on minimal medium supplemented with arginine Therefore we do not recommend that you generate His transformants in KM71 by replacing the aox1 ARG4 construct Continued on next page Pichia Strains continued Control Expression Strains Growth of Pichia Strains Growth on Methanol GS115 His Mut Albumin This strain is a control for secreted expression and the Mut phenotype when screening Pichia transformants page 38 The gene for serum albumin was cloned with its native secretion signal then integrated into Pichia at the AOX1 locus This strain secretes albumin 67 kDa into the medium at levels gt 1 gram liter GS115 His Mut B galactosidase This strain is a control for intracellular expression and the Mut phenotype when screening Pichia transformants page 38 The gene for B galactosidase lacZ was integrated into Pichia at the his4
55. atch 100 His transformant on MD plates 2 3 plates For controls make one patch from each of the strains GS115 His Mut Albumin and GS115 His Mut Real onto the MD plates Incubate the plates at 28 30 C for 2 days After 2 days replica plate the patches from the MD plates onto fresh MM and MD plates to screen for Mut transformants Incubate the replica plates at 28 30 C for 2 days After 2 days at 28 30 C score the replica plates Look for patches that grow normally on the MD replica plates but show little or no growth on the MM replica plates Including His Mut and His Mut control patches on each plate will provide examples of Mut and Mut phenotypes Some researchers have used a functional assay to directly screen for high expressing Pichia recombinant clones without first screening for Mut or Mutz phenotypes If you elect to screen directly for high expressing recombinants be sure to also check the Mut phenotype to help you optimize expression of your recombinant clone Pichia pastoris is capable of integrating multiple copies of transforming DNA via recombination into the genome at sites of sequence homology see page 72 for figure Although the exact mechanism of multiple integration events is not fully understood such events are reasonably common among selected transformants in this case Hist transformants Successful expression of the gene of interest to useful levels may depend upon the generation of a recom
56. ater and add 20 g of agar Autoclave 20 minutes on liquid cycle 3 Place the autoclaved solution in a 60 C water bath prior to addition of prewarmed mixture of stock solutions This will keep the medium from becoming too thick to mix reagents 4 Prepare the prewarmed 45 C mixture from RD and RDH Liquid Media Step 4 above Add to sorbitol agar solution If you are selecting for His transformants do not add histidine 5 Pour the plates immediately after mixing the solutions in Step 4 Store the plates at 4 C Shelf life is several months Continued on next page 63 Pichia Media Recipes continued RD and RDH Top Agar MD and MDH MM and MMH 64 1 Dissolve 186 g of sorbitol in 700 mL of water and add 10 g of agar or agarose Autoclave 20 minutes on liquid cycle Place the autoclaved solution in a 60 C water bath prior to addition of prewarmed mixture of stock solutions This will keep the medium from becoming too thick to mix reagents Prepare the prewarmed 45 C mixture from RD and RDH Liquid Media Step 4 previous page Add to sorbitol agar solution If you are selecting for Hier transformants do not add histidine Place the solution to 45 C after adding the solutions in Step 4 During transformation use as a molten solution at 45 C Store top agar at 4 C Shelf life is several months Minimal Dextrose Medium Histidine 1 liter 1 34 YNB 4 x 105 biotin 2 dextrose 1 2
57. ation of the Recombinant Enzyme to Explore the Role of Regulatory Cysteinyl Residues by Site directed Mutagenesis J Biol Chem 271 6490 6496 Brankamp R G Sreekrishna K Smith P L Blankenship D T and Cardin A D 1995 Expression of a Synthetic Gene Encoding the Anticoagulant Antimetastatic Protein Ghilanten by the Methylotropic Yeast Pichia pastoris Protein Expression and Purification 6 813 820 Brierley R A Davis G R and Holtz G C 1994 Production of Insulin Like Growth Factor 1 in Methylotrophic Yeast Cells United States Patent 5 324 639 Buckholz R G and Gleeson M A G 1991 Yeast Systems for the Commercial Production of Heterologous Protein Bio Technology 9 1067 1072 Cavener D R and Stuart C R 1991 Eukaryotic Start and Stop Translation Sites Nucleic Acids Res 19 3185 3192 Clare J J Rayment F B Ballantine S P Sreekrishna K and Romanos M A 1991a High level Expression of Tetanus Toxin Fragment c in Pichia pastoris Strains Containing Multiple Tandem Integrations of the Gene Bio Technology 9 455 460 Clare J J Romanos M A Rayment F B Rowedder J E Smith M A Payne M M Sreekrishna K and Henwood C A 1991b Production of Epidermal Growth Factor in Yeast High Level Secretion Using Pichia pastoris Strains Containing Multiple Gene Copies Gene 105 205 212 Cregg J M Barringer K J and Hessler A Y 1985 Pichia pastoris as a Host System for Tra
58. binant strain that contains multiple copies integrated at the AOX1 or HIS4 loci In addition to simply screening expression levels among several His Muts or Hist Mutz recombinants via SDS PAGE analysis it may be desirable to determine the existence of strains that have multiple integrants in the His Mut or Hist Mut recombinant strain Refer to the Appendix page 81 for methods to detect multiple integration events Continued on next page Screening for Mut and Mut Transformants continued g Vectors for Multiple Integration pPIC3 5K and pPIC9K pAO815 Three vectors for isolating or generating Pichia recombinants containing multiple integrations of your desired gene are available separately from Invitrogen see page 88 for ordering information Two of the vectors pPIC3 5K and pPIC9K are used in vivo to identify possible transformants with multiple copies of your gene The other vector pAO815 is used for creating tandem copies of your gene in vitro before transforming into Pichia The vectors pPIC3 5K for intracellular expression and pPIC9K for secreted expression contain the bacterial kanamycin resistance gene cloned between the HIS4 gene and the 3 AOX1 region The kanamycin resistance gene confers resistance to G418 in Pichia Multiple insertions of the kanamycin gene into the Pichia chromosome increase the resistance to G418 Because the kanamycin resistance gene is linked to your gene isolation of hyper res
59. cellulose filter face down on the paper and incubate for 5 minutes at room temperature 6 Remove the nitrocellulose filter from the 3MM paper and replace the 3MM paper with two new sheets Soak them with 10 15 mL of 2X SSC Place the nitrocellulose filter face down on the 3MM paper and incubate it for 5 minutes at room temperature Repeat 7 Bake the nitrocellulose filters at 80 C or UV crosslink the DNA to nylon The filters may be probed with a nonradioactive labeled or random primed P labeled probe complementary to your gene You can identify multi copy integrants by a strong hybridization signal relative to the single copy control You can then quantify dot blots for copy number by densitometry of the film or blot or by using a B scanner if radiolabeled Continued on next page 82 Determining the Copy Number of Multiple Integrants continued General Guidelines Use standard procedures and solutions for Southern blotting as outlined in Molecular Cloning A Laboratory Manual Sambrook et al 1989 pages 9 31 9 58 Isolate genomic DNA and quantify it using fluorometry Be sure to eliminate RNA It is very important to load the same amount of DNA into each lane to accurately determine the copy number Probe your Southern blot with probes to HIS4 and your gene The point mutation in the his4 gene in the host strain will not interfere with hybridization if you make the probe complementary to the wild type gene If
60. creening and expression see Recipes pages 59 66 5 SDS solution 10 mL per transformation Sterile cheesecloth or gauze Breaking Buffer see Recipes page 66 Acid washed glass beads available from Sigma Replica plating equipment optional TM Bead Beater optional available from Biospec vi Introduction Pichia pastoris Expression System Review Articles General Characteristics of Pichia pastoris Similarity to Saccharomyces Pichia pastoris asa Methylotrophic Yeast The information presented here is designed to give you a concise overview of the Pichia pastoris expression system It is by no means exhaustive For further information read the articles cited in the text along with the following review articles Buckholz amp Gleeson 1991 Cregg amp Higgins 1995 Cregg et al 1993 Nico Farber et al 1995 Romanos 1995 Sreekrishna et al 1988 Wegner 1990 A general review of foreign gene expression in yeast is also available Romanos et al 1992 As a eukaryote Pichia pastoris has many of the advantages of higher eukaryotic expression systems such as protein processing protein folding and posttranslational modification while being as easy to manipulate as E coli or Saccharomyces cerevisiae It is faster easier and less expensive to use than other eukaryotic expression systems such as baculovirus or mammalian tissue culture and generally gives higher expression levels As a yeast
61. d in Pichia ee 67 Recombination and Integration in Pichia ee 69 ElSctropOraom Of Pichili sssi cs deeg ees ee A a a iaee Eee eet 73 PEG 1000 Transformation Method for Pichid c cccescscsccsseescsccsesssetesesesssssnsssesesesesceceeeeseseseseseansnensneseseseeeees 74 Lithium Chloride Transformation Methoden 76 Direct PCR Screening of Pichia CIONES EEN 78 Isolating Total DNA fr ni Pichia se ersen eet Ee Eddie 79 Detecting Multiple Integration Events EE 81 Procedure for Total RNA Isolation from Dich 84 B GalactOsidase ASSAy ed een deiere de eege Ee cheb chaps oa EE 86 Accessory Froe erennere Eeer Eeer code geasaddedeanoadeeabdebedsashelandebbaedeot 88 Technical Support ccta EE 89 Purchaser Noun Cation EE 91 EN EE 94 Kit Contents and Storage Kit Contents iv The Pichia Expression Kit is shipped at room temperature and contains the following components Spheroplast Module Box 1 Store at room temperature Reagent Amount Components SOS medium 20 mL 1 M Sorbitol 0 3X YPD 10 mM CaCl Sterile Water 2x125mL Autoclaved deionized water SE 2x125mL 1M Sorbitol 25 mM EDTA pH 8 0 SCE 2x125mL 1M Sorbitol 10 mM Sodium citrate buffer pH 5 8 1mM EDTA 1 M Sorbitol 2x125mL CaS 2x60mL 1M Sorbitol 10 mM Tris HCI pH 7 5 10 mM CaCl 40 PEG 25 mL 40 w v PEG 3350 Reagent grade in water CaT 25 mL 20 mM Tris HCl pH 7 5 20 mM CaCl Spheroplast Module Box 2 Store at
62. e Glu Ala repeats are not necessary for cleavage by KEX2 but the KEX2 cleavage after Glu Lys Arg may be more efficient when followed by Glu Ala repeats A number of amino acids are tolerated at site X instead of Glu in the sequence Glu Lys Arg X These amino acids include the aromatic amino acids small amino acids and histidine Proline however inhibits KEX2 cleavage For more information on KEX2 cleavage see Brake et al 1984 There are some cases where STE13 cleavage of Glu Ala repeats is not efficient and Glu Ala repeats are left on the N terminus of the expressed protein This is generally dependent on the protein of interest The PHO1 signal sequence is atypical of signal sequences even though it is a native Pichia secretion signal If cloning into the Xho I site we recommend regenerating the full signal sequence between the Xho I and EcoR I sites see page 23 However recent evidence suggests that the PHO1 signal sequence might have to be modified to include KEX2 like processing sites for efficient cleavage to occur Laroche et al 1994 Cloning into the Pichia Expression Vectors Introduction A m S QE Now General Considerations After selecting a vector into which to clone your gene of interest see pages 11 17 develop a cloning strategy The AOX1 promoter and the multiple cloning site are presented on the following pages for each vector along with a summary of considerations for each vector
63. e the plates overnight at 30 C Proceed to Screening for Mut and Mut Transformants page 38 Transforming Pichia continued Chemically Competent Pichia Cells Screening by Functional Assay TM The Pichia FEasyComp Kit see page 88 provides enough reagents to produce 6 preparations of competent cells each preparation yields enough competent cells for 20 transformations You may use these cells immediately or store them frozen for future use Each 50 uL aliquot of competent Pichia cells with 3 ug linearized plasmid DNA yields approximately 50 colonies on selective medium Contact Technical Support for more information page 89 Some researchers have used a functional assay to directly test for high expressing Pichia recombinant clones without first screening for Mut or Mutz phenotypes After testing for high expression be sure to also check the Mut phenotype This will help you optimize expression of your recombinant clone 37 Screening for Mut and Mut Transformants Introduction Screening for His Mut in GS115 His Mut in KM71 Screening for His Mut in GS115 38 After colonies appear on plates of Hist GS115 transformants score for the Mur and Mut phenotypes The kit contains two strains that will provide examples of Mutt and Mut phenotypes GS115 Albumin is Mut and GS115 B Gal is Mutz Hist KM71 recombinants do not need to be screened for their Mut phenotype as they all will be
64. e there is not enough of some of these reagents in the kit to perform this experiment Minimal Medium MD MGYH Sterile water SCED 1 M sorbitol 10 mM sodium citrate pH 7 5 10 mM EDTA 10 mM DTT Zymolyase 3 mg mL stock solution in water Seikagaku America Inc 1 800 237 4512 1 SDS in water 5 M potassium acetate pH 8 9 TE buffer pH 7 4 10 mM Tris HCl pH 7 4 1 mM EDTA pH 8 0 7 5 M ammonium acetate pH 7 5 Phenol chloroform 1 1 v v L Grow at 30 C the recombinant strain and the parent strain to an ODs of 5 10 in 10 mL of minimal media such as MD or MGY recombinant or MDH or MGYH GS115 or KM71 2 Collect the cells by centrifugation at 1 500 x g for 5 10 minutes at room temperature 3 Wash the cells with 10 mL sterile water by centrifugation as in Step 2 L Resuspend the cells in 2 mL of SCED buffer pH 7 5 Make this solution fresh 2 Add 0 1 0 3 mg of Zymolyase mix well before adding to the cells Incubate at 37 C for 50 minutes to achieve lt 80 spheroplasting monitor the percent spheroplasting using the procedure on pages 33 34 3 Add 2 mL of 1 SDS mix gently and set on ice 0 to 4 C for 5 minutes Add 1 5 mL of 5 M potassium acetate pH 8 9 and mix gently Centrifuge at 10 000 x g for 5 10 minutes at 4 C and save the supernatant Continued on next page 79 Isolating Total DNA from Pichia continued DNA Precipitation 80 Transfer the supernatant from Step 5 the
65. ecretion signal present on some heterologous proteins success has been variable The secretion signal sequence from the Saccharomyces cerevisiae factor prepro peptide has been used with the most success Cregg et al 1993 Scorer et al 1993 The major advantage of expressing heterologous proteins as secreted proteins is that Pichia pastoris secretes very low levels of native proteins Since there is very low amount of protein in the minimal Pichia growth medium this means that the secreted heterologous protein comprises the vast majority of the total protein in the medium and serves as the first step in purification of the protein Barr et al 1992 However that if there are recognized glycosylation sites Asn X Ser Thr in your protein s primary sequence glycosylation may occur at these sites Continued on next page Pichia pastoris Expression System continued Posttranslational Modifications In comparison to Saccharomyces cerevisiae Pichia may have an advantage in the glycosylation of secreted proteins because it may not hyperglycosylate Both Saccharomyces cerevisiae and Pichia pastoris have a majority of N linked glycosylation of the high mannose type however the length of the oligosaccharide chains added posttranslationally to proteins in Pichia average 8 14 mannose residues per side chain is much shorter than those in Saccharomyces cerevisiae 50 150 mannose residues Grinna and Tschopp 1989 Tschopp et al 1987b
66. ect method for PCR screening is available in the Appendix page 78 Invitrogen s Easy DNA Kit provides a fast and easy method to isolate genomic DNA from Pichia pastoris See page 88 for ordering information 1 Set up PCR reactions as follows 10X PCR Buffer 5 uL Genomic DNA 1 ug 5 pL 100 mM dNTPs 25 mM each 1 pL 5 AOX1 Primer 0 1 ug pL 5 pL 3 AOX1 Primer 0 1 pg pL 5 pL Sterile water to 50 pL Taq Polymerase 5 U uL 0 25 pL Resuspend the primers in 20 uL sterile water to prepare a 0 1 pg pL solution You may decrease the amount of primer For 20 pmoles primer use 2 uL of each resuspended primer For amplification controls use 100 ng of recombinant plasmid positive control and 100 ng of the appropriate plasmid without insert negative control 2 Load thermocycler and run the following program Step Temperature Time Cycle Hot Start 94 C 2 minutes 1X Denaturation 94 C 1 minute Annealing 55 C 1 minute 25 35X Extension 72 C 1 minute Final Extension 72C 7 minutes 1X 3 Analyze 10 uL on a 1X TAE 0 8 agarose gel Continued on next page 43 PCR Analysis of Pichia Integrants continued Interpreting PCR Important Example of PCR Analysis Discussion 44 If screening Mutt integrants you should see two bands one corresponding to the size of your gene of interest the other to the AOX1 gene approximately 2 2 kb If screening Mut integrant
67. ell suspension and vortex it for 20 seconds Add an equal volume 450 500 uL of buffer saturated phenol to the tube and vortex it for 20 seconds Incubate the cell suspension at 65 C for 4 minutes Incubate the cell suspension in a dry ice ethanol bath until crystals show 1 minute Centrifuge the tube at maximum speed for 2 minutes at 4 C Transfer the aqueous phase to a new centrifuge tube add an equal volume of phenol chloroform and vortex it for 20 seconds Centrifuge the tube at maximum speed for 2 minutes at 4 C Remove the upper phase to a new tube and add 40 uL of 3 M sodium acetate pH 5 3 and 2 5 volumes of 100 ethanol 20 C Centrifuge the tube at maximum speed for 15 minutes at 4 C Remove the supernatant Wash the pellet with 80 ethanol and air dry it briefly Resuspend total RNA in 20 pL of DEPC treated water and store it at 80 C The average yield is 60 300 ug of total RNA See Ausubel et al 1994 for a protocol for mRNA isolation and Northern analysis The FastTrack 2 0 mRNA Kit is designed to isolate mRNA from 0 2 to 1 mg total RNA and the Micro FastTrack 2 0 Kit is designed to isolate mRNA from 100 pg total RNA see page 88 for ordering information You will need 1 5 pg mRNA per time point 85 B Galactosidase Assay Introduction Required Solutions Z Buffer ONPG Solution 1M Sodium Carbonate 86 The GS115 B Gal strain is provided as a Hist Mut intracellular e
68. er 50 polyethylene glycol PEG 3350 in distilled deionized water Filter sterilize Store in a tightly capped bottle 2 mg mL denatured fragmented salmon sperm DNA in TE 10 mM Tris HCl pH 8 0 1 0 mM EDTA Store at 20 C 1 Grow a 50 mL culture of Pichia pastoris in YPD at 30 C with shaking to an ODeso of 0 8 to 1 0 approximately 10 cells mL 2 Harvest the cells and wash with 25 mL of sterile water and centrifuge at 1 500 x g for 10 minutes at room temperature 3 Decant the water and resuspend the cells in 1 mL of 100 mM LiCl Transfer the cell suspension to a 1 5 mL microcentrifuge tube 5 Pellet the cells at maximum speed for 15 seconds and remove the LiCl with a pipet Resuspend the cells in 400 uL of 100 mM LiCl 7 Dispense 50 pL of the cell suspension into a 1 5 mL microcentrifuge tube for each transformation and use immediately Do not store on ice or freeze at 20 C Continued on next page Lithium Chloride Transformation Method continued Transformation 1 Boil a 1 mL sample of single stranded DNA for five minutes then quickly chill in ice water Keep on ice Note It is neither necessary nor desirable to boil the carrier DNA prior to each use Store a small aliquot at 20 C and boil every 3 4 times the DNA is thawed Centrifuge the LiCl cell solution from Step 7 previous page Remove the LiCl with a pipet For each transformation sample add the following reagents in the order given
69. firm your construct by sequencing proceed to Preparing Transforming DNA page 27 We strongly recommend that you sequence your construct before transforming into Pichia to confirm the following e The correct reading frame for secretion e An ATG in the proper context for eukaryotic translation initiation Use the primers listed on the next page to sequence your constructs Resuspend each primer in 20 uL sterile water to prepare a stock solution of 0 1 ug L For the location of the priming sites see pages 21 24 For sequencing protocols refer to Unit 7 in Current Protocols in Molecular Biology Ausubel et al 1994 or Chapter 13 in Molecular Cloning A Laboratory Manual Sambrook et al 1989 Continued on next page 25 Transformation into E coli continued 5 AOX1 Sequencing Primer 3 AOX1 Sequencing Primer a Factor Sequencing Primer 26 is 5 GACTGGTTCCAATTGACAAGC 3 hybridizes 5 of the MCS in the AOX1 promoter region allows the determination of the 5 AOX1 gene of interest junction confirms that the ORFs are preserved where necessary is 5 GCAAATGGCATTCTGACATCC 3 hybridizes just 3 of the MCS in the 3 AOX1 TT region allows the determination of the 3 AOX1 gene of interest junction is 5 TACTATTGCCAGCATTGCTGC 3 hybridizes within the factor leader region in pPIC9 allows the determination of the 5 end of the gene of interest confirms that the ORFs are preserved where
70. he most productive eukaryotic expression systems available Likewise there are several examples of proteins that have been successfully expressed in Pichia pastoris that were completely unsuccessful in baculovirus or Saccharomyces cerevisiae suggesting that the Pichia pastoris system is an important alternative to have available If you obtain no or low protein expression in your initial expression experiment use the following guidelines to optimize expression e Doa time course study of expression Check to see if there is a time point that yields a larger percentage of full length protein e If secreting your protein check to see if your protein is susceptible to neutral pH proteases by expressing in unbuffered medium MM In addition try 1 Casamino acids with buffered medium to inhibit extracellular proteases e Try using SMD1168 proteinase A deficient for expression see Proteases page 45 e Check cell pellet to see if overall expression is low or if the protein did not secrete If it did not secrete try a different signal sequence e g a native or a factor signal sequence e Concentrate your supernatant by ammonium sulfate precipitation or ultrafiltration see page 56 e For Mutt induce expression with a higher density culture e Check both Mut and Mut recombinants for increased expression Some proteins express better in one type of genetic background than another e If secreting your protein try intracell
71. he number of transformants and frequency of targeting will be reduced if digestion is not complete Extract the digest with phenol chloroform isoamyl alcohol 25 24 1 and ethanol precipitate the digested DNA Resuspend DNA pellet in 10 20 pL of TE buffer It is not necessary to purify the fragment containing your gene away from the rest of the plasmid Store at 20 C until ready to transform Continued on next page Preparing Transforming DNA continued Alternate Restriction Sites If your insert DNA contains Sac I Sal I and Stu I sites you need to linearize your construct with another enzyme Use the following table to select another enzyme A single digestion which linearizes the vector in either of the AOX1 recombination sequences allows integration but at lower efficiencies Remember to digest the parent vector with the same enzyme when preparing your DNA samples for transformation pPHIL D2 Restriction 5 AOX1 3 AOX1 Vector HIS4 gene Enzyme 14 940bp 4 577 5 333bp backbone 1 688 4 222 bp 5 333 bp Sac I 221 S A Pmel 424 SS D z Bpu 1102 I 599 S S S NsiI 689 S Xcm I 711 E 7 Not I 8 5 337 Dra I 424 5 169 5 311 5 896 6 588 E Sal I z 2 887 Stu I T 2 972 BspE I 3 554 pPIC3 5 Restriction 5 AOX1 3 AOX1 Vector HIS4 gene Enzyme 1 937 bp 4 616 5 393 bp backbone 1 715 4 249 b
72. he table below provides a partial list of references documenting successful expression of heterologous proteins in Pichia pastoris Note that both Mut and Mut phenotypes were used successfully as well as secreted and intracellular expression Protein Expression Where Expressed Reference Levels How Expressed grams liter Enzymes Invertase 2 3 Secreted Tschopp et al Mutz 1987b Bovine Lysozyme c2 0 55 Secreted Digan et al 1989 Mut Streptokinase 0 08 Intracellular Hagenson et al active 1989 Alpha amylase 2 5 Secreted Paifer et al 1994 Mut Pectate Lyase 0 004 Secreted Guo et al 1995 Mut Spinach Phospho 0 1 Intracellular Brandes et al 1996 ribulokinase Mut Antigens Hepatitis B surface 0 4 Intracellular Cregg et al 1987 antigen Mut Pertussis Antigen 3 0 Intracellular Romanos et al 1991 P69 Mut Tetanus Toxin 12 0 Intracellular Clare et al 1991a Fragment C Mut Mut HIV 1 gp120 1 25 Intracellular Scorer et al 1993 Mut Tick Anticoagulant 1 7 Secreted Laroche et al 1994 protein Mut Bm86 Tick Gut 15 Secreted Rodriguez et al Glycoprotein 1994 Regulatory Proteins Tumor Necrosis 10 0 Intracellular Sreekrishna et al Factor TNF Mut 1989 Mouse Epidermal 0 45 Secreted Clare et al 1991b Growth Factor Mut EGF Human Interferon 0 4 Intracellular Garcia et al 1995 IFN a2b Muts
73. ich when expressed in Pichia gave premature termination of the mRNA When this sequence was changed longer transcripts were found Scorer et al 1993 If your protein is hyperglycosylated e Try intracellular expression to bypass the secretion pathway and to avoid protein modification e Try deglycosylating the protein with Peptide N Glycosidase F or other enzymes see page 57 e Engineer your gene to remove N linked glycosylation sites 53 Scaling Up Expression Guidelines for Expression Mut Intracellular or Secreted 54 Once expression is optimized scale up your expression protocol to produce more protein by increasing the culture volume using larger baffled flasks below or by fermentation Use the guidelines below to scale up your expression protocol To purify your protein see the references listed on page 57 1 Using a single colony inoculate 25 mL of MGYH BMGH or BMGY ina 250 mL baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until culture reaches an ODs 2 6 approximately 16 18 hours 2 Use this 25 mL culture to inoculate 1 liter of MGYH BMGH or BMGY ina 3 or 4 liter baffled flask and grow at 28 30 C with vigorous shaking 250 300 rpm until the culture reaches log phase growth CDe 2 6 3 Harvest the cells using sterile centrifuge bottles by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resu
74. ignal sequence Translation will initiate at the ATG closest to the 5 end of the mRNA e If your insert has a Bgl II site refer to page 30 for alternate restriction sites to linearize your plasmid for Pichia transformation 24 Transformation into E coli Introduction Analyzing Transformants Sequencing Recombinant Clones At this point you have ligation reactions that you will transform by chemical means or electroporation into competent E coli cells TOP10F or equivalent For procedures to prepare competent cells refer to Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Laboratory Manual Sambrook et al 1989 1 After transformation plate the transformation mix onto LB plates with 50 100 pg mL ampicillin see Appendix page 59 and select ampicillin resistant colonies 2 Pick 10 ampicillin resistant transformants and inoculate into LB medium with 50 100 pg mL ampicillin Grow overnight at 37 C with shaking 3 Isolate plasmid DNA by miniprep for restriction analysis and sequencing see below To sequence the Pichia expression vectors use the primers provided 4 Make a glycerol stock of your desired clone for safekeeping by combining 0 85 mL of an overnight bacterial culture with 0 15 mL of sterile glycerol Mix by vortexing and transfer to a labeled storage tube Freeze the tube in liquid nitrogen or a dry ice ethanol bath and store at 70 C 5 After you con
75. ilters to quantify the copy number Alternatively you may isolate genomic DNA and spot it directly onto nitrocellulose or nylon fix it and analyze it 1 Grow Mut or Mut transformants in individual wells of a 96 well microtiter plate in 200 uL of YPD broth at 30 C until all wells have approximately the same density This may necessitate several passages Alternatively you may grow individual transformants in culture tubes and normalize the absorbance at 600 nm by adding medium 2 Filter 50 uL of each sample onto a nitrocellulose or nylon filter placed into a dot slot blot apparatus using multi channel pipettor Air dry filters 3 To lyse the cells on the filter treat the filter with four solutions as follows place two sheets of 3 MM paper in a tray and soak with 10 15 mL of 50 mM EDTA 2 5 B mercaptoethanol pH 9 Make sure that the paper is uniformly soaked and that there are no puddles Place the nitrocellulose filter face down on the treated 3MM paper Incubate the filter for 15 minutes at room temperature 4 Remove the nitrocellulose filter from the 3MM paper and replace the 3MM paper with two new sheets Soak them with 10 15 mL of 1 mg mL Zymolyase 100T as described in Step 3 Place the nitrocellulose filter face down on the 3MM paper and incubate it for 4 hours at 37 C 5 Remove the nitrocellulose filter from the paper and replace the paper with two new sheets Soak with 10 15 mL of 0 1 N NaOH 1 5 M NaCl Place the nitro
76. insertion events at the his4 or AOX1 loci leaving an intact AOX1 locus Use the plates containing His transformants and screen for the Mut and Mut phenotypes as described below 1 Using a sterile toothpick pick one His colony and streak or patch it in a regular pattern on an MM plate and an MD plate Note Make sure to patch the MM plate first Use a new toothpick for each transformant and continue picking transformants until you have patched 100 transformants 2 3 plates To differentiate Mutt from Mutz make one patch for each of the controls GS115 His Mut Albumin and GS115 His Mut B gal onto the MD and MM plates Incubate the plates at 30 C for 2 days After 2 days or longer at 30 C score the plates Mut transformants grow well on both MD and MM plates Mut transformants grow well only on MD plates and show little or no growth on the MM plates We recommend that you purify your His transformants to ensure pure clonal isolates You may do this before or after testing for the Mut phenotype Continued on next page 39 Screening for Mut and Mut Transformants continued g Replica Plating Procedure Screening by Functional Assay Multiple Integration Events 40 The following procedure gives a lower rate of misclassifications but it increases the overall Mut Mut screening procedure by 2 days For the procedure you need replica plating equipment 1 Using sterile toothpicks p
77. invitrogen Pichia Expression Kit For Expression of Recombinant Proteins in Pichia pastoris Catalog no K1710 01 Revision date 07 September 2010 Manual part no 25 0043 MAN0000012 Table of Contents Kit Contents and Stora g mesi tii ie Meine lee EE iv Required Equipment and Supplies EEN EEEEE vi tte EE 1 Pichia pastoris EXpression System EE 1 Experimental Outliers coed Saba aeni E aa E elie don E abt iid draped ai SESE 4 let begleede eege 7 Pichia EE 7 ESCO Strain Sesentuh a a doe te Eu EE dee Eed 10 Selecting a Pichia EXpressiOn Vector seis eer deiere deeded a ata EE deer EE ee e 11 PLT DE 14 PRIGS Othe te ege Eet 15 PUM EE 16 PCD shits geriet eieiei 17 Signal Sequence Processing soppene eneee ei gee ep ree EES 18 Cloning into the Pichia Expression Vector ENEE 19 Transformation into E eolt EEN 25 Preparing Transforming DNAs ee See ed 27 Growing Pichia for Spheroplasting EEN 31 Preparing Dap resete o eeoa a AAEE E e RA Ras 33 Transforming Pichidis ipu esaa seta Ses Hae he SL e a eel E iaee oie es ea aed e a oaee aaah lade Ba 35 Screening for Mutt and UE E 38 PCR Analysis of Pichia Inte grant een 43 Expression of Recombinant Pichia Gtratms EEN 45 Analyzing Samples by SDS Polyacrylamide Gel Hlectropbhoresais EE 49 Optimizing Pichia Protein Expression EE 52 Scaling UP EE 54 Protein Purification and Glycosylation EE 57 REEL 59 E coli Media Recipes eer Eege tiles Suen eet enee Bee eebe 59 E ENEE 60 Proteins Expresse
78. ion Spheroplasting 100 ODso at time t ODso at time 0 x 100 For example At time t 0 the ODso 0 256 At time t 15 the ODs 0 032 Calculation spheroplasting 100 0 032 0 256 x 100 100 0 125 x 100 100 12 5 87 5 Determine the time of incubation that results in approximately 70 spheroplasting This time of incubation is variable due to differences in lots of Zymolyase In Invitrogen labs it takes approximately 15 40 minutes of Zymolyase treatment to achieve optimal spheroplasting Note It is important to establish the minimum time required for the desired amount of spheroplasting Prolonged incubation with Zymolyase is deleterious to spheroplasts and will result in lower transformation efficiency Add 7 5 uL Zymolyase to the remaining tube of cells as described in Step 1 above Incubate the tube at 30 C for the time that was established in Step 5 to obtain the optimal level 70 of spheroplasting Harvest the spheroplasts by centrifugation at 750 x g for 10 minutes at room temperature Decant and discard the supernatant Wash the spheroplasts once with 10 mL of 1 M sorbitol gently disperse the pellet by tapping the tube do not vortex Collect the spheroplasts by centrifugation at 750 x g for 10 minutes at room temperature Wash the spheroplasts once with 10 mL of CaS and centrifuge as in Step 7 Gently resuspend the spheroplasts in 0 6 mL of CaS The spheroplasts must be used immediately
79. istant G418 transformants may also indicate that your gene is present in multiple copies The vector pAO815 for intracellular expression allows you to generate multiple copies of your gene in vitro by creating an expression cassette e g P4oxr your gene of interest HIS4 and cloning multiple copies in tandem in the vector The vector is then transformed into Pichia and transformants are selected and tested for increased expression of the desired protein 41 Screening for Mut and Mut Transformants continued Scoring Templates eee n BE HD afas DIE EJED EE DIE DIE E WE Ely aa bp le D I D I 43 fo I foe o o Vo o O o n 19 E E 42 PCR Analysis of Pichia Integrants Introduction Isolating Genomic DNA from Pichia Analysis by PCR Use the following protocol to analyze Pichia integrants to determine if the gene of interest has integrated into the Pichia genome Isolate genomic DNA from 6 to 10 Mut or Mut Pichia clones and the strain transformed with the parent plasmid using the protocol on page 79 After isolating your DNA use the procedure below to identify integrants Amplify the gene of interest using the a factor primer for pPIC9 only or the 5 AOX1 primer paired with the 3 AOX1 primer included in the kit This protocol can confirm the integration of the gene of interest but does not provide information on the site of integration Note A more dir
80. les I G 1991 Recombinant Bordetella pertussis Pertactin p69 from the Yeast Pichia pastoris High Level Production and Immunological Properties Vaccine 9 901 906 Romanos M A Scorer C A and Clare J J 1992 Foreign Gene Expression in Yeast A Review Yeast 8 423 488 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press Plainview New York Scorer C A Buckholz R G Clare J J and Romanos M A 1993 The Intracellular Production and Secretion of HIV 1 Envelope Protein in the Methylotrophic Yeast Pichia pastoris Gene 136 111 119 Scorer C A Clare J J McCombie W R Romanos M A and Sreekrishna K 1994 Rapid Selection Using G418 of High Copy Number Transformants of Pichia pastoris for High level Foreign Gene Expression Bio Technology 12 181 184 Sreekrishna K Nelles L Potenz R Cruse J Mazzaferro P Fish W Fuke M Holden K Phelps D Wood P and Parker K 1989 High Level Expression Purification and Characterization of Recombinant Human Tumor Necrosis Factor Synthesized in the Methylotrophic Yeast Pichia pastoris Biochemistry 28 4117 4125 Sreekrishna K Potenz R H B Cruze J A McCombie W R Parker K A Nelles L Mazzaferro P K Holden K A Harrison R G Wood P J Phelps D A Hubbard C E and Fuke M 1988 High Level Expression of Heterologous Proteins in Me
81. ll and makes the cells extremely fragile Handle the sample gently The moment after adding Zymolyase the cell wall begins to get digested e Prepare at least 20 mL of a 5 SDS solution not provided for use below e Set your UV Vis spectrophotometer to 800 nm and blank with 800 uL 5 SDS and 200 uL SCE e Set up 17 sterile microcentrifuge tubes and label them 0 2 4 5 6 7 8 9 10 15 20 25 30 35 40 45 and 50 Add 800 uL of 5 SDS to each tube Continued on next page 33 Preparing Spheroplasts continued Adding Zymolyase continued 34 From one tube of cells Step 5 page 33 withdraw 200 uL cells and add to the tube marked 0 This is your zero time point Set the tube aside on ice Add 7 5 uL of Zymolyase to the same tube of cells mix it gently by inversion and incubate the cells at 30 C Do not shake the sample This sample will be used to establish the incubation time for optimal spheroplasting as described below Keep the second tube of cells at room temperature for use in Step 6 below Keep the remainder of the Zymolyase on ice Monitor the formation of the spheroplasts as follows At time 2 minutes withdraw 200 uL of cells from the suspension in Step 2 and add to the tube marked 2 Repeat at time t 4 5 6 7 8 9 10 15 20 25 30 35 40 45 and 50 minutes after adding Zymolyase Read the ODso for all samples Determine the percent of spheroplasting for each time point using the equat
82. llularly Include GS115 or KM71 transformed with the parent vector as a control for background intracellular expression 1 Using a single colony inoculate 25 mL of MGY BMG or BMGY medium in a 250 mL baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until the culture reaches an ODeow 2 6 log phase growth approximately 16 18 hours Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature Decant the supernatant and resuspend the cell pellet to an OD600 of 1 0 in MM BMM or BMMY medium approximately 100 200 mL to induce expression Place the culture in a 1 liter baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return it to the incubator to continue growth Add 100 methanol to a final concentration of 0 5 methanol every 24 hours to maintain induction Be sure to check the volume of the culture and add methanol accordingly Evaporation may reduce the culture volume At each of the times indicated below transfer 1 mL of the expression culture to a 1 5 mL microcentrifuge tube These samples will be used to analyze expression levels and to determine the optimal time post induction to harvest Centrifuge the samples at maximum speed in a tabletop microcentrifuge at room temperature for 2 3 minutes Time points hours 0 6 12 24 1 day 36 48 2 days 60 72 3 days 84 and 96 4 days For secreted expression transfer the supernatant
83. locus This strain expresses B galactosidase 117 kDa at levels that can be detected on Coomassie stained SDS PAGE see pages 49 51 or assayed using ONPG see page 86 87 The growth temperature of Pichia pastoris is 28 30 C for liquid cultures plates and slants Growth above 32 C during induction can be detrimental to protein expression and can even lead to cell death Other important facts e Doubling time of log phase Mut or Mut Pichia in YPD is 2 hours e Mut and Mut strains do not differ in growth rates unless grown on methanol e Doubling time of log phase Mut Pichia in methanol medium MM is 4 6 hours e Doubling time of log phase Mut Pichia in MM is 18 hours One OD6o00 5 x 10 cells mL Note that growth characteristics may vary depending on the recombinant strain When plates or medium containing methanol are used as growth medium it is advisable to add methanol every day to compensate for loss due to evaporation or consumption e For plates add 100 uL of 100 methanol to the lid of the inverted plate e For liquid medium add 100 methanol to a final concentration of 0 5 Some researchers have had success adding methanol to 1 every day for Mut strains and up to 3 for Mut without any negative effect to their liquid culture Continued on next page Pichia Strains continued ly N WENO er Y Ne SU Storing Pichia Strains Note Make frozen stocks for long term storage of all
84. lular protein of the same size masks it Western blot analysis enzymatic activities or a defined purification profile if available may help to identify the expressed protein among the native Pichia cellular proteins Inspection of your Coomassie stained SDS PAGE should reveal the induction over time of your protein co migrating with your standard If there is no recombinant protein visible then perform a western blot or a functional assay if you have one If you detect low expression of your recombinant protein see Optimizing Pichia Protein Expression page 52 Test your expression conditions with the one of the two control strains included in the kit GS115 B Gal or Albumin If there is no indication of expression at all perform a northern analysis to see if and how much full length mRNA is induced See page 84 for an RNA isolation protocol 51 Optimizing Pichia Protein Expression Introduction Proteolysis or Degradation Low Secreted Expression Levels Low Expression Levels 52 Based on available data there is approximately a 75 chance of expressing your protein of interest in Pichia pastoris at reasonable levels The biggest hurdle seems to be generating initial success i e expression of your protein at any level While there are relatively few examples of expression of 210 grams liter there are many examples of expression in the 21 gram liter range making the Pichia pastoris expression system one of t
85. lycosylation site Check your protein sequence for possible N glycosylation sites Asn X Ser Thr before cloning a cytosolic protein into a secretion vector If your protein is normally secreted glycosylated or directed to an intracellular organelle you may wish to try secreting your protein We recommend that you try both the native secretion signal and the a factor signal sequence in pPIC9 to secrete your protein There has been better success reported with the a factor signal sequence than with the PHO1 signal sequence in pHIL S1 This may be due to the lack of KEX2 like processing signals in the PHO signal sequence Laroche et al 1994 13 pHIL D2 Description The details of pHIL D2 are listed below 8 209 bp nonfusion vector One unique EcoR I site For intracellular expression of your gene Requires an initiating ATG codon in a Kozak consensus sequence for proper translation initiation of your gene Cavener and Stuart 1991 Kozak 1987 Kozak 1990 HIS4 selection in Pichia For insertion at AOX1 in GS115 or KM71 linearize with Sac I generates Hier Mut in GS115 and His Mut in KM71 For insertion at HIS4 linearize with Sal I or Stu I generates His Mut in GS115 and His Mutz in KM71 For a gene replacement at AOX1 in GS115 linearize with Not I generates His Mut Refer to page 29 for alternate restriction sites if your insert DNA has a Not I Sac I Sal I or Stu I site Map of pHIL D2 The ma
86. lysates and medium supernatants In general Pichia cell lysates contain 5 10 pg L protein Pichia medium supernatants will vary in protein concentration primarily due to the amount of your secreted protein Pichia secretes very few native proteins If the protein concentration of the medium is gt 50 pg mL 10 pL of medium will give a faint band on a Coomassie stained SDS PAGE gel Continued on next page Analyzing Samples by SDS Polyacrylamide Gel Electrophoresis continued Controls N gio 7 O Nous Analyzing Protein Expression Include the following samples as controls on your SDS PAGE e Molecular weight standards appropriate for your desired protein e A sample of your protein as a standard if available e A sample of GS115 or KM71 with the parent plasmid transformed into it This control shows the background of native Pichia proteins that are present intracellularly Inclusion of this sample will help you differentiate your protein from background if you express it intracellularly e Analyze the GS115 B Gal and Albumin controls also as they should indicate any problems with the media or expression conditions In addition to Coomassie stained SDS PAGE we strongly recommend performing a western blot or another more sensitive assay to detect your protein Visualization of the expressed protein depends on several factors including its expression level its solubility its molecular weight and whether an abundant cel
87. m Invitrogen see below for ordering information Item Amount Cat no Yeast Nitrogen Base 67 g pouch Q300 07 with ammonium sulfate Each pouch contains reagents Shout amino agds to prepare 500 mL of a 10X YNB solution 500 g Q300 09 10X YNB 13 4 Yeast Nitrogen Base with Ammonium Sulfate without amino acids 1 Dissolve 134 g of yeast nitrogen base YNB with ammonium sulfate and without amino acids in 1 000 mL of water Heat the solution to dissolve YNB completely in water 2 Alternatively use 34 g of YNB without ammonium sulfate and amino acids and 100 g of ammonium sulfate 3 Filter sterilize and store at 4 C The shelf life of this solution is approximately one year If you are using the YNB pouch included in the kit follow the directions on the pouch Note Pichia cells exhibit optimal growth with higher YNB concentrations therefore the amount of YNB used in this kit is twice as concentrated as YNB formulations for Saccharomyces 500X B 0 02 Biotin 1 Dissolve 20 mg biotin in 100 mL of water and filter sterilize 2 Store at 4 C The shelf life of this solution is approximately one year 100X H 0 4 Histidine 1 Dissolve 400 mg of L histidine in 100 mL of water Heat the solution if necessary to no greater than 50 C in order to dissolve 2 Filter sterilize and store at 4 C The shelf life of this solution is approximately one year 10X D 20 Dextrose 1 Dissolve 200 g of
88. necessary Preparing Transforming DNA Introduction Preparing Plasmid DNA You should have a Pichia multi copy expression vector with your gene of interest cloned in the correct orientation for expression The table below describes what you will be doing in the next few sections Step Action Pages 1 Prepare your DNA for transformation 28 2 Grow GS115 or KM71 to prepare spheroplasts 32 3 Prepare spheroplasts for transformation 33 4 Transform GS 115 or KM71 with your DNA 35 5 Select His transformants and characterize for Mutt Mut 38 phenotype 6 Test 10 His Mut and 10 His Mut by PCR for integration 43 of your gene We recommend isolating both His Mut and Hist Mut Pichia transformants as it is difficult to predict beforehand what construct will best express your protein see pages 69 and 70 By linearizing your construct DNA in the 5 AOX1 region or in the HIS4 gene and using GS115 Mutt and KM71 Mut you can easily isolate Mut and Mut recombinants Plan on using 10 pg digested DNA for each transformation Plasmid DNA for Pichia transformation should be at least pure enough for restriction digestion however the cleaner the DNA the more efficient the transformation We recommend the PureLink HiPure Plasmid Miniprep Kit see page 88 to prepare plasmid DNA for routine Pichia transformations Refer to www invitrogen com or contact Technical Support for more inf
89. no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 74 Pichia Pastoris Expression Sys tem The Pichia Expression System is based on the yeast Pichia pastoris Pichia pastoris was developed into an expression system by scientists at Salk Institute Biotechnology Industry Associates SIBIA and Phillips Petroleum for high level expression of recombinant proteins All patents for Pichia pastoris and licenses for its use as an expression system are owned by Research Corporation Technologies RCT Inc Tucson Arizona Life Technologies has an exclusive license to sell Pichia expression kits and vectors to scientists for research purposes only under the terms described below Use of Pichia pastoris by commercial entities for any commercial purpose requires the user to obtain a commercial license as detailed below Before using any Pichia expression product please read the following license agreement If you do not agree to be bound by its terms contact Life Technologies within 10 days for authorization to return the unused Pichia expression products and to receive a full refund If you do agree to the terms of this license agreement plea
90. nsformations Mol Cell Biol 5 3376 3385 Cregg J M and Higgins D R 1995 Production of Foreign Proteins in the Yeast Pichia pastoris Canadian J Botany Supp 73 5981 5987 Cregg J M Madden K R Barringer K J Thill G and Stillman C A 1989 Functional Characterization of the Two Alcohol Oxidase Genes from the Yeast Pichia pastoris Mol Cell Biol 9 1316 1323 Cregg J M Tschopp J F Stillman C Siegel R Akong M Craig W S Buckholz R G Madden K R Kellaris P A Davis G R Smiley B L Cruze J Torregrossa R Velicelebi G and Thill G P 1987 High Level Expression and Efficient Assembly of Hepatitis B Surface Antigen in the Methylotrophic Yeast Pichia pastoris Bio Technology 5 479 485 Cregg J M Vedvick T S and Raschke W C 1993 Recent Advances in the Expression of Foreign Genes in Pichia pastoris Bio Technology 11 905 910 Despreaux C W and Manning R F 1993 The dacA Gene of Bacillus stearothermophilus Coding for D Alanine carboxypeptidase Cloning Structure and Expression in Escherichia coli and Pichia pastoris Gene 131 35 41 Continued on next page 93 References continued Deutscher M P ed 1990 Guide to Protein Purification Vol 182 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego CA Digan M E Lair S V Brierley R A Siegel R S Williams M E Ellis S B Kellaris P
91. o page 30 for alternate restriction sites if your insert DNA has a Bg II Sac I Sal I or Stu I site Map of pPIC9K The figure below shows the map of pPIC9 Details of the multiple cloning site are provided on page 24 The sequence of pPIC9 is available at www invitrogen com or from Technical Support page 89 Comments for pPIC9 8023 nucleotides 5 AOX7 promoter fragment bases 1 948 5 AOX7 primer site bases 855 875 a Factor secretion signal s bases 949 1215 a Factor primer site bases 1152 1172 Multiple Cloning Site bases 1192 1241 A AOX7 primer site bases 1327 1347 3 AOX7 transcription termination TT bases 1253 1586 HIS4 ORF bases 4514 1980 3 AOX1 fragment bases 4870 5626 pBR322 origin bases 6708 6034 Ampicillin resistance gene bases 7713 6853 17 Signal Sequence Processing Signal Sequence Processing Optimizing Signal Cleavage 18 Note When cloning into the Xho I site of pPIC9 the secretion signal sequence between the Xho I site and SnaB I may need to be regenerated The processing of the o factor mating signal sequence in pPIC9 occurs in two steps 1 The preliminary cleavage of the signal sequence by the KEX2 gene product with the final KEX2 cleavage occurring between arginine and glutamine in the sequence Glu Lys Arg Glu Ala Glu Ala where is the site of cleavage 2 The STE13 gene product further cleaves the Glu Ala repeats In Saccharomyces cerevisiae th
92. oduction of a Recombinant Bovine Enterokinase Catalytic Subunit in the Methylotrophic Yeast Pichia pastoris Bio Technology 14 77 81 Wagner S L Siegel R S Vedvick T S Raschke W C and VanNostrand W E 1992 High level Expression Purification and Characterization of the Kunitz type Protease Inhibitor Domain of Protease Nixin 2 amyloid b Protein Precursor Biochem Biophys Res Commun 186 1138 1145 Wegner G H 1990 Emerging Applications of the Methylotrophic Yeasts FEMS Microbiology Reviews 87 279 284 Weiss H M Haase W Michel H and Reilander H 1995 Expression of Functional Mouse 5 HT 5a Serotonin Receptor in the Methylotrophic Yeast Pichia pastoris Pharmacological Characterization and Localization FEBS 377 451 456 Zaret K S and Sherman F 1984 Mutationally Altered 3 Ends of Yeast CYC1 mRNA Affect Transcript Stability and Translational Efficiency J Mol Biol 177 107 136 2009 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 96 invitrogen Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
93. of induction depends on whether the recombinant is Mut or Mut The differences primarily occur in the culture volumes and the time of induction see below Refer to the following pages for more detailed instructions Step Procedure Page 1 Guidelines for expression of recombinant proteins in Pichia 45 46 2 Grow Hist Mut recombinants in 25 mL of buffered glycerol 47 medium to a final ODeo 2 6 3 Harvest the cells and resuspend them to an ODew of 1 0 47 100 200 mL with methanol medium Place the cell suspension in a 1 liter baffled flask 4 Incubate the culture at 30 C with shaking and take samples for 47 analysis at 0 6 12 24 36 48 60 72 84 and 96 hours 5 Analyze the medium if protein of interest is targeted for 49 51 secretion and the cell lysates for intracellular and secreted expression for protein via PAGE Coomassie Blue staining western blot activity ELISA or immunoprecipitation Optimize expression of your Hist Mut recombinant 52 53 7 Scale up your expression for protein purification 54 56 This is very similar to Mut induction except that Mut grow very slowly on methanol To compensate cells are concentrated to increase cell mass before induction Step Procedure Page 1 Guidelines for expression of recombinant proteins in Pichia 45 46 2 Grow His Mut recombinants in 100 200 mL of buffered 48 glycerol medium to a final OD6o 2 6 3
94. oids the protein modifications associated with LaemmLi type SDS PAGE ensuring optimal separation for protein analysis In addition Invitrogen carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use refer to www invitrogen com or contact Technical Support page 89 If you are pouring your own gels note that any standard SDS polyacrylamide gel apparatus and protocol will work for example a 12 polyacrylamide gel with a 5 stacking gel is recommended for proteins ranging in size from 40 100 kDa For other recommendations see standard texts such as Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Laboratory Manual Sambrook et al 1989 Guide to Protein Purification Deutscher 1990 or Protein Methods Bollag et al 1996 Preparing You will need to prepare Breaking Buffer see page 66 and have acid washed Samples 0 5 mm glass beads on hand Preparing of cell pellets Intracellular and Secreted Expression 1 Thaw cell pellets quickly and place on ice 2 For each 1 mL sample add 100 uL Breaking Buffer to the cell pellet and resuspend 1 Add an equal volume of acid washed glass beads size 0 5 mm Estimate equal volume by displacement 4 Vortex 30 seconds then incubate on ice for 30 seconds Repeat for a total of 8 cycles 5 Centrifuge at maximum speed for 10 minutes at 4 C Tr
95. oles lyophilized 5 GACTGGTTCCAATTGACAAGC 3 3 AOX1 sequencing primer 2 ug 314 pmoles lyophilized 5 GCAAATGGCATTCTGACATCC 3 a Factor sequencing primer 2 pg 315 pmoles lyophilized 5 TACTATTGCCAGCATTGCTGC 3 The following prepackaged media is included for your convenience Instructions for use are provided on the package Store at room temperature Media Amount Yield YP Base Medium 2 pouches 2 liters of YP medium YP Base Agar Medium 2 pouches 2 liters of YP medium Yeast Nitrogen Base 1 pouch 500 mL of 10X YNB The Pichia Spheroplast Module for transforming Pichia by spheroplasting is available separately from Invitrogen see page 88 for ordering information For research use only Not intended for any animal or human therapeutic or diagnostic use Required Equipment and Supplies Required Equip ment and Supplies not provided 30 C rotary shaking incubator Water baths capable of 37 C 45 C and 100 C Centrifuge suitable for 50 mL conical tubes floor or table top Baffled culture flasks with metal covers 50 mL 250 mL 500 mL 1000 mL and 3 L 50 mL sterile conical tubes 6 mL and 15 mL sterile snap top tubes Falcon 2059 or similar UV Spectrophotometer Mini agarose gel apparatus and buffers Agarose and low melt agarose Polyacrylamide gel electrophoresis apparatus and buffers Media for transformation growth s
96. ome techniques are listed below and are discussed thoroughly in Guide to Protein Purification Deutscher 1990 Be sure to perform all steps from cell lysis to purified protein at 4 C Ion Exchange Chromatography Gel Filtration Affinity Chromatography Chromatofocusing Isoelectric Focusing Immunoprecipitation Solubilization Membrane Proteins Lectin Affinity Chromatography Prepare Breaking Buffer BB as described in Appendix page 66 1 Wash cells once in BB by resuspending them and centrifuging 5 10 minutes at 3 000 x g at 4 C Resuspend the cells to an Ou of 50 100 in BB 3 Add an equal volume of acid washed glass beads 0 5 mm Estimate volume by displacement 4 Vortex the mixture 30 seconds then incubate on ice for 30 seconds Repeat 7 more times Alternating vortexing with cooling keeps the cell extracts cold and reduces denaturation of your protein 5 Centrifuge the sample at 4 C for 5 10 minutes at 12 000 x g 6 Transfer the clear supernatant to a fresh container and analyze for your protein The total protein concentration should be around 5 10 mg mL 7 Save the pellet and extract with 6 M urea or 1 Triton X 100 to check for insoluble protein Biospec Bartlesville OK makes a Bead Beater that can handle 5 200 mL volumes of cell suspension When expressing and purifying a glycosylated protein in a heterologous expression system it is desirable to quickly determine whether the protein is glyco
97. on products in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Pichia Expression products in your control and so notify Life Techno logies in writing You may contact Research Corporation Technologies at the following address Bennett Cohen Ph D Research Corporation Technologies 101 North Wilmot Road Suite 600 Tucson Arizona 85711 3335 Tel 520 748 4443 Fax 520 748 0025 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Barr K A Hopkins S A and Sreekrishna K 1992 Protocol for Efficient Secretion of HSA Developed from Pichia pastoris Pharm Eng 12 48 51 Bollag D M M DR and Edelstein S J 1996 Protein Methods Second Ed Wiley Liss New York Brake A J Merryweather J P Coit D G Heberlein U A Masiarz G R Mullenbach G T Urdea M S Valenzuela P and Barr P J 1984 a Factor Directed Synthesis and Secretion of Mature Foreign Proteins in Saccharomyces cerevisiae Proc Natl Acad Sci USA 81 4642 4646 Brandes H K Hartman F C Lu T Y S and Larimer F W 1996 Efficient Expression of the Gene for Spinach Phosphoribulokinase in Pichia pastoris and Utiliz
98. ormation on a large selection of plasmid purification columns You may prepare plasmid DNA using alkaline lysis phenol chloroform extraction and ethanol precipitation Continued on next page 27 Preparing Transforming DNA continued Linearizing Plasmid DNA Procedure 28 We recommend that you linearize your vector in such a manner to generate both Mut and Mut recombinants It is possible that one phenotype will express your protein of interest better than the other will To isolate Hist Mutt transformants of GS115 linearize all constructs with Sal I Stu I or Sac I To isolate His Mut transformants of KM71 linearize plasmid constructs with Sal I Stu I or Sac I Note If your insert DNA has all three sites please see the next page To isolate His Mut transformants of GS115 linearize plasmid constructs with Not I pHIL D2 or Bgl II pPIC3 5 pHIL S1 and pPIC9 Note If you wish to generate recombinants that are Mut use KM71 because it is much easier and more efficient to generate Mut recombinant strains using single crossover events than double crossover events e g insertions at AOX or his4 as opposed to gene replacement at AOX1 Digest both your construct and the parent vector You will transform GS115 and or KM71 with the parent vector as a background control for expression Analyze a small portion of your digest by agarose gel electrophoresis to confirm complete digestion of your fragment T
99. p 5 393 bp Sac I 209 Se Pmel 414 8 Bpu 1102 I 589 S z NsiI 678 E E S Xcem 1 699 S T Bgl Il 2 5363 E S Dra I 414 5 201 5 343 6 534 6 553 7 245 SalI 2 919 Stu I Z 3 004 BspEI E z 3 586 Continued on next page Preparing Transforming DNA continued Alternate Restriction Sites continued 30 pHIL S1 Restrictio 5 AOX1 3 AOX1 Vector HIS4 gene n Enzyme 1 940 bp 4 639 5 395 bp Packbone 1 750 4 284 bp 5 395 bp Sac I 209 F T Pmel 412 SS g E Bou 11021 587 NsiI 677 E Xcm I 699 z Bgl Il 2 5 394 Dra D 412 5 232 5 374 7 021 7 713 Sal I 2 950 pPIC9 Restriction 5 AOX1 3 AOX1 Vector HIS4 gene Enzyme 1 948 bp 4 881 5 638bp backbone 1 980 4 514 bp 5 638 bp Sac I 209 S S Pme l 414 Bpu 1102 I 589 S 5 NsiI 678 E XcmI 699 i Bel Il 2 5 622 Dra I 414 5 460 5 602 6 793 6 812 7 504 Sal I K E 3 178 Stu I 3 263 BspEI 3 845 Restriction sites are used to generate gene replacements at AOX1 in GS115 only Growing Pichia for Spheroplasting Introduction Spheroplasting Preparing Media In general spheroplasting and electroporation page 73 provide the highest efficiency of transformation for most researchers 10 to 10 transformants per ug DNA Pichia
100. p below shows the location and size of each feature of pHIL D2 For the details of the multiple cloning site refer to page 21 The complete sequence of PHIL D2 is available at www invitrogen com or from Technical Support page 89 Comments for pHIL D2 8209 nucleotides D AOX1 promoter fragment bases 14 941 D AOX7 primer site bases 868 888 EcoR Site bases 956 961 3 AOX7 primer site bases 1036 1056 3 AOX1 transcription termination TT fragment bases 963 1295 HIS4 ORF bases 4223 1689 3 AOX1 fragment bases 4578 5334 Ampicillin resistance gene bases 5686 6546 f1 origin of replication bases 7043 6588 pBR322 origin bases 7138 7757 DC Q O UI 2 AOX1 TT 14 pPIC3 5 Description The details of pHIL D2 are listed below e 7 751 bp nonfusion vector es BamHI SnaB I EcoR I Avr II Not I unique sites e Intracellular expression of your gene e Requires an initiating ATG codon in a Kozak consensus sequence for proper translation initiation of your gene Cavener and Stuart 1991 Kozak 1987 Kozak 1990 e HIS4 selection in Pichia e For insertion at AOX1 in GS115 or KM71 linearize with Sac I generates His Mut in GS115 and Hist Mut in KM71 e For insertion at HIS4 linearize with Sal I or Stu I generates His Mutt in GS115 and Hist Mupp in KM71 e Fora gene replacement at AOX1 in GS115 linearize with Bg II generates His Mut Refer to page 29 for alternate restriction sites if your inse
101. previous page and add 2 volumes of ethanol to the supernatant Incubate at room temperature for 15 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C Resuspend the pellet gently in 0 7 mL of TE buffer pH 7 4 and transfer to a microcentrifuge tube Gently extract with an equal volume of phenol chloroform 1 1 v v followed by an equal volume of chloroform isoamy alcohol 24 1 Split the aqueous layer into two microcentrifuge tubes Add 1 2 volume of 7 5 M ammonium acetate pH 7 5 and 2 volumes of ethanol to each tube Place on dry ice for 10 minutes or at 20 C for 60 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C and wash the pellets once with 1 mL of 70 ethanol Briefly air dry the pellets and resuspend each one in 50 uL of TE buffer pH 7 5 Determine the concentration of the DNA sample You can store the samples at 20 C separately or combined until ready for use Detecting Multiple Integration Events Introduction Southern Blot Analysis Materials Needed for Quantitative Dot Blot It has been demonstrated in a number of papers Brierley et al 1994 Clare et al 1991a Romanos et al 1991 Scorer et al 1993 Scorer et al 1994 that multiple integration events may increase the levels of protein expressed If the expression of your protein is low you may wish to isolate multicopy integrants Using the protocol detailed on the previous page isolate genomic DNA from the His recombinants
102. rt DNA has a Not I Sac I Sal I or Stu I site Map of pPIC3 5 The map below shows the location and size of each feature of pPIC3 5 For the details of the multiple cloning site refer to page 22 The complete sequence of pPIC3 5 is available at www invitrogen com or from Technical Support page 89 Comments for pPIC3 5 7751 nucleotides 5 AOX1 promoter fragment bases 1 937 5 AOX7 primer site bases 855 875 Multiple Cloning Site bases 938 968 3 AOX7 primer site bases 1055 1075 3 AOX7 transcription termination TT fragment bases 981 1314 HIS4 ORF bases 4242 1708 3 AOX1 fragment bases 4598 5354 pBR322 origin bases 6436 5764 Ampicillin resistance gene bases 7442 6582 15 pHIL S1 Description Map of pHIL S1 Comments for pHIL S1 8260 nucleotides D AOX7 promoter fragment bases 1 941 D AOX7 primer site bases 856 876 PHO1 secretion signal S bases 942 1007 Multiple Cloning Site Region bases 1006 1026 3 AOX1 primer site bases 1099 1119 3 AOX7 transcription termination TT fragment bases 1025 1190 HIS4 ORF bases 4286 1753 3 AOX1 fragment bases 4641 5397 pBR322 origin bases 6556 5937 f1 origin of replication bases 6651 7106 Ampicillin resistance gene bases 7922 7062 16 The details of pHIL S1 are listed below 8 260 bp fusion vector Xho I EcoRI Sma I BamH I unique sites Secreted expression using the PHO1 secretion signal For expression your gene must be cloned in fr
103. s Displacement of the alcohol oxidase AOX1 structural gene occurs at a frequency of 5 35 of the Hier transformants Patching or replica plating on Minimal Dextrose MD versus Minimal Methanol MM plates can readily distinguish Mut and Mut transformants Because Mut transformants do not produce alcohol oxidase the product of the AOX1 gene they cannot efficiently metabolize methanol as a carbon source therefore they grow poorly on minimal methanol MM medium This slow growth on methanol can be used to distinguish His transformants in which the AOX1 gene has been disrupted His Mut from His transformants with an intact AOX1 gene His Mut Continued on next page Screening for Mut and Mut Transformants continued Materials Needed Note His Mut or His Mut in GS115 Important You can prepare the following media see page 64 and materials several days in advance and store at 4 C Minimal Dextrose MD agar plates 1 liter Minimal Methanol MM agar plates 1 liter Sterile toothpicks and Scoring Templates see page 42 Streak out the strains GS115 Albumin His Mut and GS115 B Gal His Mut on an MD or MGY plate as controls for Mut and Mut growth on MD and MM plates In contrast to His Mut transformants generated using a construct linearized with Not I or Bgl II most of the Hie transformants generated by the Sac I Sal I jor Stu I digested construct should be Mut arising from gene
104. s e g Centricon or Centriprep devices available from Millipore e Pressurized cell concentrators for large volumes e g Amicon ultrafiltration devices available from Millipore e Lyophilization A general guide to protein techniques is Protein Methods Bollag et al 1996 A general procedure for cell lysis using glass beads is provided on the next page There is also a cell lysis protocol in Current Protocols in Molecular Biology page 13 13 4 Ausubel et al 1994 and in Guide to Protein Purification Deutscher 1990 We also recommend lysis by French Press follow the manufacturer s suggestions for yeast Basic guidelines are available for fermentation of Pichia from Invitrogen We recommend that only those with fermentation experience or those who have access to people with experience attempt fermentation Contact Technical Support for more information page 89 Protein Purification and Glycosylation Introduction Some Protein Purification Techniques Procedure for Cell Lysis Analysis of Glycoproteins At this point you have an optimized protocol for expressing your protein and a method to scale up production of your protein for large scale purification You may already have a method to purify your protein Since every protein is different it is difficult to recommend specific techniques for purification For an overview of methods for purification see Deutscher 1990 or Ausubel et al 1994 S
105. s compensates by generating large amounts of the enzyme The promoter regulating the production of alcohol oxidase is the one used to drive heterologous protein expression in Pichia Continued on next page Pichia pastoris Expression System continued Two Alcohol Oxidase Proteins Expression Phenotype of aox mutants Intracellular and Secretory Protein Expression Two genes in Pichia pastoris code for alcohol oxidase AOX1 and AOX2 The AOX1 gene product accounts for the majority of alcohol oxidase activity in the cell Expression of the AOX1 gene is tightly regulated and induced by methanol to very high levels typically gt 30 of the total soluble protein in cells grown on methanol The AOX1 gene has been isolated and a plasmid borne version of the AOX1 promoter is used to drive expression of the gene of interest encoding the desired heterologous protein Ellis et al 1985 Koutz et al 1989 Tschopp et al 1987a While AOX2 is about 97 homologous to AOX1 growth on methanol is much slower than with AOX1 This slow growth on methanol allows isolation of Mut strains aox1 Cregg et al 1989 Koutz et al 1989 Expression of the AOX1 gene is controlled at the level of transcription In methanol grown cells approximately 5 of the polyA RNA is from the AOX1 gene The regulation of the AOX1 gene is a two step process a repression derepression mechanism plus an induction mechanism e g GAL1 gene in Saccharomyces
106. s desired protein for N terminal protein secretion secretion signal MCS Multiple Cloning Site Allows insertion of your gene into the expression vector TT Native transcription Permits efficient transcription termination and termination and polyadenylation polyadenylation signal from of the mRNA AOX1 gene 260 bp HIS4 Pichia wild type gene coding Provides a selectable marker to for histidinol dehydrogenase isolate Pichia recombinant strains 2 4 kb and used to complement Pichia his4 strains 3 AOX1 Sequences from the AOX1 gene Targets plasmid integration at the that are further 3 to the TT AOX1 gene sequences 650 bp Amp Ampicillin resistance gene Allows selection replication and pBR322 E coli origin of replication maintenance in E coli origin fl origin Bacteriophage f1 origin of Permits generation of single replication 458 bp stranded DNA for mutagenesis Not I Unique restriction sites Permits linearization of vector for Bel II efficient integration into the Pichia genome Sac I Sal I Stu I Continued on next page Selecting a Pichia Expression Vector continued Selecting a Vector If your protein is cytosolic and non glycosylated you may elect to express the protein intracellularly However there is evidence of a non glycosylated protein being secreted without extensive modification Despreaux and Manning 1993 Note that the protein in question was a secreted bacterial protein with one N g
107. s in GS115 you should see only the band that corresponds to the gene of interest In KM71 because of the ARG4 insert in AOX1 the PCR product is 3 6 kb Parent plasmids produce the following sized PCR products Add these fragments to the size of your insert to interpret your PCR results Vector PCR Product pHIL D2 188 bp pPIC3 5 214 bp pHIL S1 262 bp pPIC9 using the 5 AOX1 primer 492 bp pPIC9 using the a Factor primer 195 bp If you use the a factor primer as a PCR primer you will not see a band with GS115 or KM71 This is because there is no a factor signal associated with the chromosomal AOX1 gene Sometimes there will be ghost bands appearing in your PCR These do not seem to be significant as they have not been shown to be a problem The figure below shows the results of a typical PCR analysis using the procedure on the previous page Genomic DNA was isolated from Pichia recombinants and from appropriate controls Ten microliter samples from each PCR were run on a 0 8 agarose gel Lanes 1 and 8 contain markers for a 1 kb ladder Lanes 2 4 are Pichia recombinants Lane 5 is pHIL D2 with the gene of interest Lane 6 is GS115 pHIL D2 no insert and Lane 7 is pHIL D2 alone 838 bp 188 650 188 bp Lane 7 shows the 188 bp PCR product made from pHIL D2 by priming with the 5 and 3 AOX1 primers see page 26 Lane 6 shows the 188 bp product and the wild type AOX1 gene 2 2 kb
108. se complete the User Regis tration Card and return it to Life Technologies before using the product Life Technologies Corporation Life Technologies grants you a non exclusive license to use the enclosed Pichia expression vectors Expression Vector for academic research or for evaluation purposes only The Expression Vectors are being transferred to you in furtherance of and reliance on such license You may not use the Expression Vectors for any commercial purpose without a license for such purpose from Research Corporation Technologies Inc Tucson Arizona Commercial purposes include any use of Expression Products or Expression Vectors in a Commercial Product any use of Expression Products or Expression Vectors in the manufacture of a Commercial Product any sale of Expression Products any use of Expression Products or the Expression Kit to facilitate or advance research or development directed to a Commercial Product and any use of Expression Products or the Expression Kit to facilitate or advance any research or development program the results of which will be directly applied to the development or manufacture of a Commercial Product Expression Products means products expressed with the Expression Kit or with the use of any Pichia expression vectors including the Expression Vector or host strains Commercial Product means any product intended for sale or commercial use Commercial entities may conduct their evalua
109. sion When performing your expression it is important to run the proper controls so that you will be able to interpret your expression results You should use the following expression controls GS115 Hist Mut albumin Mupp Secretion control GS115 His t Mut B Gal Mutt Intracellular control GS115 or KM71 Vector no insert Background control Recombination can occur in many different ways that can affect expression We recommend that you screen 6 10 verified recombinant clones for expression levels Start with colonies from the freshest plates available Colony viability drops over time so if you have any doubts it is better to streak out your strain You may also start the cultures with a small sample from a frozen glycerol stock that was generated from a single colony The following information is designed to get you started with expression You may have to change the conditions to optimize expression for your particular protein Use bottom or side baffled flasks whenever possible see page 66 If you are analyzing a number of recombinants you can try 50 mL conical tubes Make sure that the medium is well aerated by increasing the rate of shaking or placing the tubes at an angle in the shaker Continued on next page Expression of Recombinant Pichia Strains continued Mut Intracellular or Secreted Test the effectiveness of your expression conditions by growing GS115 B Gal which is Mut and expresses galactosidase intrace
110. spend cell pellet to an Oe 1 0 2 6 liters in MMH BMMH or BMMY medium to start induction 4 Aliquot the culture between several 3 or 4 liter baffled flask Cover the flasks with 2 layers of sterile gauze or cheesecloth and return to incubator Continue to grow at 28 30 C with shaking 5 Add 100 methanol to 0 5 every 24 hours until the optimal time of induction is reached as determined from the time course study 6 Harvest cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature 7 For intracellular expression decant the supernatant and store the cell pellets at 80 C until ready to process For secreted expression save the supernatant chill it to 4 C and concentrate it if desired see page 56 Proceed directly to purification page 57 or store the supernatant at 80 C until ready to process further Continued on next page Scaling Up Expression continued Mut Intracellular or Secreted Note 1 Using a single colony inoculate 10 mL of MGYH BMGH or BMGY ina 100 mL baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until the culture reaches an ODeo 2 6 approximately 16 18 hours Use this 10 mL culture to inoculate 1 liter of MGYH BMGH or BMGY ina 3 or 4 liter baffled flask and grow at 28 30 C with vigorous shaking 250 300 rpm until the culture reaches log phase growth ODeo 2 6 Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room
111. suitable for use ee We recommend that you make a frozen stock of TOP10F to keep on hand N Ce SS Ai S 1 Culture TOP10F in 5 mL LB with 10 pg mL tetracycline Grow overnight E 2 Mix thoroughly 0 85 mL of culture with 0 15 mL sterile glycerol 3 Transfer to a freezer vial and freeze in liquid nitrogen or a dry ice ethanol bath 4 Store at 80 C 10 Selecting a Pichia Expression Vector Generic Structure Note All the vectors included in this kit share several general features shown in black while some of the vectors also have signal sequences Sig and or an f1 bacteriophage origin For details of each individual plasmid refer to pages 14 17 Sig Mcs Transcription Termination TT Not or Sac Bgl Il Not or Bgl Il There is no yeast origin of replication in any of the Pichia expression vectors included in this kit His transformants can only be isolated if recombination occurs between the plasmid and the Pichia genome Continued on next page 11 Selecting a Pichia Expression Vector continued Features 12 The table below describes the general and optional features of the Pichia expression vectors Feature Description Benefit 5 AOX1 An 1000 bp fragment Allows methanol inducible high containing the AOX1 promoter level expression in Pichia Targets plasmid integration to the AOX1 locus Sig DNA sequence coding foran Target
112. sylated properly For carbohydrate analysis of proteins to characterize glycosylated proteins see Ausubel et al 1994 Unit 17 Further information about glycosylation in eukaryotes is available in a review Varki amp Freeze 1994 57 Protein Purification and Glycosylation continued Enzymes for Analyzing Glycoproteins Commercial Carbohydrate Analysis 58 These are just a few of the enzymes available for carbohydrate analysis Abbreviations are as follows Asn Asparagine Gal Galactose GlcNAc N acetylglucosamine GalNAc N acetylgalactosamine and NeuAc N acetylneuraminic acid Enzyme Type of Specificity enzyme Endoglycosidase D Endo Cleaves various high mannose glycans Endoglycosidase F Endo Cleaves various high mannose glycans Endoglycosidase H Endo Cleaves various high mannose glycans B galactosidase Exo Removes terminal galactosides from Gal B1 3 GlcNAc Gal B1 4 GlcNAc or Gal B1 3 GalNAc Peptide N Glycosidase F Endo Glycoproteins between Asn and GlcNAc removes oligosaccharides Sialidases Exo NeuAc a2 6 Gal Neuraminidases NeuAc a2 6 GlcNAc Vibrio cholerae or NeuAc a2 3 Gal Clostridium perfringens Arthobacter ureafaciens Newcastle disease virus There are a number of commercial vendors who will contract to analyze proteins for glycosylation A number of companies also supply kits and reagents for researchers to do carbohydrate analysis in their own
113. ted His transformants Multi copy events can occur as gene insertions either at the AOX1 a0x1 ARG4 or his4 loci This results in a Mut phenotype in GS115 and a Mut phenotype in KM71 Quantitative dot blot analysis Southern blot analysis and differential hybridization can detect multiple gene insertion events See page 81 for a protocol to screen for multiple inserts 5 AOX1 or aox1 ARG4 TT 3 5 Paox g Cene of Interest TT Kan HIS4 Expression Cassette 1 J 2nd Insertion Event Expression 5 AOX1 or aox1 ARG4 TT 3 p 5 Paox g Gene of Interest TT Kan HIS4 Cassette 1 Expression Cassette 2 3rd Insertion Event etc Continued on next page 71 Recombination and Integration in Pichia continued Gene Replacement at AOX7 in GS115 72 Ina his4 strain such as GS115 a gene replacement omega insertion event arises from a double crossover event between the AOX1 promoter and 3 AOX1 regions of the vector and genome This results in the complete removal of the AOX 1 coding region Oe gene replacement The resulting phenotype is His Mut His transformants can be readily and easily screened for their Mut phenotype with Mut serving as a phenotypic indicator of integration via gene replacement at the AOX1 locus The net result of this type of gene replacement is a loss of the AOX1 locus Mut and the gain of an expression cassette containing Doan your gene of interest and HIS4 The figure below shows a gene replacement e
114. the flasks with 5 10 and 20 uL of cells from the culture made in Step 2 and incubate them overnight with vigorous shaking 250 300 rpm at 28 30 C 4 The next morning bring the transformation solutions SE SCE Sterile Water SOS PEG CaS CaT 1 M sorbitol provided in the kit the RDB plates for plating transformants and the RDHB plates for viability control to room temperature 5 Check the ODev of each of the three culture flasks Harvest the cells from the culture that has an ODs between 0 2 and 0 3 Centrifuge the cells at room temperature for 5 10 minutes at 1 500 x g Decant the supernatant and discard the other cultures Proceed to Preparing Spheroplasts page 33 Note If the cultures are all over 0 3 choose one of the cultures and dilute 1 4 with fresh medium and incubate at 28 30 C until the ODeo is between 0 2 and 0 3 2 4 hours Harvest the cells and proceed as in Step 5 above 32 Preparing Spheroplasts Before Starting Note Washing the Cells Adding Zymolyase You should have a cell pellet from Step 5 page 32 e Prepare 100 mL of molten RD agarose and keep at 45 C see Appendix page 64 e Thaw one tube of 1 M DTT provided in the kit e Prepare fresh SED for one batch of spheroplasts as follows Using sterile technique transfer 19 mL of SE provided to an appropriate sterile container e g 50 mL conical tube Add 1 mL of 1 M DTT and mix well For best results this solution of SED
115. three Pichia strains included in this kit see below To store cells for weeks to months use YPD medium or YPD agar slants see page 61 1 Streak for single colonies of the desired strain on YPD 2 Transfer one colony to a YPD stab and grow for 2 days at 30 C 3 You can store the cells on YPD for several weeks at 4 C To store cells for months to years store frozen at 80 C 1 Culture a single colony of the desired strain overnight in YPD 2 Harvest the cells and suspend in YPD containing 15 glycerol at a final ODeoo of 50 100 approximately 2 5 x 10 5 0 x 10 cells mL 3 Freeze the cells in liquid nitrogen or a dry ice ethanol bath and store at 80 C After extended storage at 4 C or 80 C we recommend checking the His transformants for correct genotype and viability by streaking on MM MD or MGY plates before using again E coli Strains Genotype of The E coli strain TOP10F is provided in case no suitable E coli strain is E coli Strain available Other strains which may be suitable are TOP10 DH5aF JM109 or any other strain which is recombination deficient recA and deficient in endonuclease A endA F proAB lacl lacZAM15 Tn10 Tet mcrA A mrr hsdRMS mcrBC b80lacZAM15 AlacXx74 recA1 X araD139 A ara leu 7697 galU galk rpsL Str endA1 nupG Note If you do not plan to perform single stranded DNA rescue E coli strains that do not carry the E episome are also
116. thylotrophic Yeast Pichia pastoris J Basic Microbiol 28 265 278 Sun J Coughlin P Salem H H and Bird P 1995 Production and Characterization of Recombinant Human Proteinase Inhibitor 6 Expressed in Pichia pastoris Biochim Biophys ACTA 1252 28 34 Thill G P Davis G R Stillman C Holtz G Brierley R Engel M Buckholz R Kinney J Provow S Vedvick T and Siegel R S 1990 in International Symposium on the Genetics of Microorganisms Vol 2 pp 477 490 Tschopp J F Brust P F Cregg J M Stillman C and Gingeras T R 1987a Expression of the lacZ Gene from Two Methanol Regulated Promoters in Pichia pastoris Nucleic Acids Res 15 3859 3876 Tschopp J F Sverlow G Kosson R Craig W and Grinna L 1987b High Level Secretion of Glycosylated Invertase in the Methylotrophic Yeast Pichia pastoris Bio Technology 5 1305 1308 Continued on next page 95 References continued Varki A and Freeze H H 1994 The Major Glycosylation Pathways of Mammalian Membranes A Summary Subcell Biochem 22 71 100 Vedvick T Buckholz R G Engel M Urcan M Kinney J Provow S Siegel R S and Thill G P 1991 High level Secretion of Biologically Active Aprotonin from the Yeast Pichia pastoris J Ind Microbiol 7 197 201 Vozza L A Wittwer L Higgins D R Purcell T J Bergseid M Collins Racie L A LaVallie E R and Hoeffler J P 1996 Pr
117. tion for one year at which time this license automatically terminates Commercial entities will be contacted by Research Corporation Technologies during the evaluation period regarding their desire for a commercial license Access to the Expression Kit and Vector must be limited solely to those officers employees and students of your institution who need access to perform the above described research or evaluation You must inform each such officer employee and student of the provisions of this license agreement and require them to agree in writing to be bound by the provisions of this license agreement You may not distribute any Expression Vector or host strain contained herein or in the Expression Kit to others even those within your own institution You may only transfer modified altered or original material from the Expression Kit or Vector to a third party following written notification of and written approval from Life Technologies so that the recipient can be licensed You may not assign sub license rent lease or otherwise transfer this license agreement or any of the rights or obligation there under except as expressly permitted by Life Technolo gies and RCT Continued on next page 91 Purchaser Notification continued Limited Use Label License No 74 Pichia Pastoris Expression System 92 This license agreement is effective until terminated You may terminate it at any time by destroying all Pichia Expressi
118. to isolate 60 300 ug total RNA Schmitt et al 1990 from Pichia which is suitable for mRNA isolation using Invitrogen s FastTrack 2 0 or Micro FastTrack 2 0 mRNA Isolation Kit If you wish to use another protocol scale up the reaction to yield about 2 mg of total RNA per time point The mRNA is for Northern blot analysis of Pichia recombinants to determine if the gene of interest is being induced and transcribed RNA isolation should be done from induced cultures using an uninduced culture as a negative control Use DEPC treated water and equipment free of RNase MGYH or BMGY medium DEPC treated water 3 M sodium acetate pH 5 3 Buffered phenol 10 SDS in DEPC treated water Phenol chloroform 1 1 Chloroform isoamyl alcohol 24 1 65 C water bath AE buffer 50 mM sodium acetate pH 5 3 1 mM EDTA 1 Grow up two cultures 100 200 mL in MGY or BMGY but induce only one of them Use the same protocol for induction that you used in the Expression section 2 Take 10 mL time points at 1 2 3 4 and 6 days 3 Harvest the cells from each time point by centrifugation at 1500 x g for 10 minutes at room temperature 4 Resuspend the cell pellet in 400 uL of AE buffer and transfer it to a microcentrifuge tube Continued on next page Procedure for Total RNA Isolation from Pichia continued Lysing Cells MRNA Isolation and Northern Analysis 1 Add 40 uL of 10 SDS to the microcentrifuge tube containing the c
119. to the cells PEG shields the cells from the detrimental effects of the high concentration of LiCl 240 pL 50 PEG 36 pL 1 M LiCl 25 pLl 2 mg mL single stranded DNA Plasmid DNA 5 10 ug in 50 pL sterile water Vortex each tube vigorously until the cell pellet is completely mixed 1 minute Incubate the tube at 30 C for 30 minutes without shaking Heat shock in a water bath at 42 C for 20 25 minutes Centrifuge the tubes at 6 000 to 8 000 rpm and remove the transformation solution with a pipet Gently resuspend the pellet in 1 mL of sterile water Plate 25 to 100 pL on RDB or MD plates Incubate the plates for 2 4 days at 30 C Screen for Mut phenotype page 38 or select hyper resistant Geneticin colonies page 41 77 Direct PCR Screening of Pichia Clones Introduction Materials Needed Procedure 78 A simple protocol has been reported in the literature to directly test Pichia clones for insertion of your gene by PCR Linder et al 1996 Briefly the cells are lysed by a combined enzyme freezing and heating treatment You may use the genomic DNA directly as a PCR template A culture or single colony of a Pichia transformant 1 5 mL microcentrifuge tube 5 U pL solution of Lyticase Sigma 30 C water bath or heat block Liquid nitrogen Reagents for PCR Place 10 uL of a Pichia pastoris culture into a 1 5 mL microcentrifuge tube For relatively dense cultures dilute 1 uL of the culture into 9 pL
120. ular expression The protein may not be processed correctly and fail to secrete Be sure you check your cell pellets for evidence of expression If you are having problems with intracellular expression try secreting your protein It probably will glycosylate which may be desirable or not If glycosylation is undesirable oligosaccharides can be removed with Peptide N Glycosidase F New England Biolabs page 58 e Scale up to fermentation page 56 Pichia is a yeast and is particularly well suited to fermentation Continued on next page Optimizing Pichia Protein Expression continued No Expression Hyper glycosylation Be sure to try some of the easier things solutions on the previous page because very low expression may be perceived as no expression If none of those improve protein expression perform a northern blot analysis to check for transcription of your gene There is a protocol in the Appendix for RNA isolation from Pichia see page 84 Analyze for the presence of your insert by PCR see page 43 You can reasonably analyze 12 20 transformants by PCR Remember to include the vector only and original one copy construct controls in order to analyze your PCR experiment If you see premature transcriptional termination check the AT content of your gene In Saccharomyces there are a few consensus sequences that promote premature termination One of these TTTTTATA resembles a sequence in HIV 1 gp120 ATTATTTTAT AAA wh
121. vent at the AOX1 locus Gene replacement double crossover event is less likely to happen than insertions single crossover events In general we recommend linearizing your plasmid DNA to create Pichia recombinants by single crossover events By using GS115 or KM71 the Mut phenotype of the recombinant will be the same as the parent strain Linearized plasmid 57 AOX1 TT 3 Pichia genome his4 7 R Plasmid integrated 5 Paox1 Gene of Interest TT HIS4 3 AOX1 into genome Electroporation of Pichia Introduction Preparing Cells Transformation This method does not require the generation and maintenance of spheroplasts making it a very convenient method for generating Pichia transformants Efficiencies run about the same as spheroplasting Scorer et al 1994 1 Grow 5 mL of Pichia pastoris in YPD page 61 in a 50 mL conical at 30 C overnight 2 Inoculate 500 mL of fresh medium in a 2 liter flask with 0 1 0 5 mL of the overnight culture Grow the culture overnight again to an ODeo 1 3 1 5 3 Centrifuge the cells at 1 500 x g for 5 minutes at 4 C Resuspend the pellet with 500 mL of ice cold sterile water 4 Centrifuge the cells as in Step 3 and resuspend the pellet with 250 mL of ice cold sterile water 5 Centrifuge the cells as in Step 3 and resuspend the pellet in 20 mL of ice cold 1 M sorbitol 6 Centrifuge the cells as in Step 3 and resuspend the pellet in 1 mL of ice cold 1 M sorbitol for
122. water Alternatively pick a single colony and resuspend in 10 uL of water Add 5 pL of a5 U pL solution of lyticase and incubate at 30 C for 10 minutes Freeze the sample at 80 C for 10 minutes or immerse in liquid nitrogen for 1 minute Set up a 50 uL PCR for a hot start 10X Reaction Buffer 5 pL 25 mM MgCl2 5 uL 25 mM dNTPs 1 uL 5 AOX1 primer 10 pmol pL Lut 3 AOX1 primer 10 pmol pL Lut Sterile water 27 pL Cell lysate 5 pL Total Volume 45 pL Place the solution in the thermocycler and incubate at 95 C for 5 minutes Add 5 pL of a 0 16 U pL solution of Taq polymerase 0 8 units Cycle 30 times using the following parameters Step Temperature Time Denaturation 95 C 1 minute Annealing 54 C 1 minute Extension 122 1 minute Include a final extension of 7 minutes at 72 C Analyze a 10 pL aliquot by agarose gel electrophoresis Isolating Total DNA from Pichia Introduction Solutions Preparing Cells Spheroplasting and Lysis The protocol below allows you to isolate DNA from the desired Hist recombinant and the untransformed GS115 or KM71 which is suitable for Southern blot analysis dot slot blot analysis or genomic PCR See Current Protocols in Molecular Biology pages 13 11 1 to 13 11 4 Ausubel et al 1994 Guide to Yeast Genetics and Molecular Biology pages 322 323 Strathern and Higgins 1991 or Holm et al 1986 Prepare the following solutions becaus
123. xpression control Growth of the strain during Mut expression provides a positive control for expression conditions The cell free B galactosidase assay described below can also be found in Miller 1972 page 403 and can be used to evaluate expression of B galactosidase e A fresh crude cell lysate of GS115 B Gal see page 57 e Z buffer e ONPG solution e 1Msodium carbonate solution Recipes for the solutions are below 60 mM NazHPO 7H20 40 mM NaH PO H O 10 mM KCl 1 mM MgsSQu 7H O 50 mM mercaptoethanol pH 7 0 1 Dissolve the following in 950 mL deionized water NazHPO 7H20 16 1 NaH2PO H 0 5 9 KCl 0 75 g MgsO 7H O 0 246 g B mercaptoethanol 2 7 mL 2 Adjust pH to 7 0 with either NaOH or HCl and bring the volume up to 1 liter with water 3 Do not autoclave Store at 4 C 4 mg mL in 100 mM phosphate buffer pH 7 0 1 Dissolve the following in 90 mL deionized water Naj HPOQ 7H O0 1 61 g NaH2POu H2O 0 55 g 2 Adjust pH to 7 0 with either NaOH or HCl 3 Add 400 mg ONPG Stir to dissolve and bring the volume up to 100 mL with water 4 Store at 4 C away from light Dissolve 12 4 g sodium carbonate in 100 mL of deionized water Store at room temperature Continued on next page B Galactosidase Assay continued Procedure 1 Determine protein concentration of your lysate by Lowry Bradford or BCA assay Equilibrate Z buffer ONPG solution and sodium carbonate solution to 28 C

Download Pdf Manuals

Related Search

Related Contents

Case Logic ULM-116  Télécharger le manuel  Sh 30 - Grundig Business Systems GmbH  Kicker ZX400.1 User's Manual  

Copyright © All rights reserved. Failed to retrieve file